• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to a process for the preparation of equine interferon gamma (EqIFN- gamma ), DNA sequences which encode this polypeptide, suitable vectors and host organisms which contain these DNA sequences, and EqIFN- gamma itself. The invention also relates to DNA part-sequences which encode polypeptides which differ structurally from the natural EqIFN- gamma polypeptide. The use of the proteins is also described.
    公开号:SU1701114A3
    申请号:SU874203834
    申请日:1987-12-09
    公开日:1991-12-23
    发明作者:Хауптманн Рудольф；Химмлер Адольф；Светлы Петер
    申请人:Берингер Ингельгейм Интернациональ Гмбх (Фирма)；
    IPC主号:
    专利说明:

    The invention relates to a method for producing interferon, in particular, to a method for producing equine interferon of type y.
    The method of obtaining y-interferon in a horse is that high-molecular-weight DNA is extracted from the liver of the horse, which is treated with the endanuclease SauKa, the obtained fragments of a length of 10-20 kb. are separated, dephosphorylated, cloned into an lambda vector, and the interferon gene is isolated from the resulting genomic DNA library, the gene is replicated into expression vectors, the recombinant DNAs are transformed into an E. coli strain, followed by isolation and purification of the target product.
    Example. Stage 1. Isolation of horse DNA.
    Frozen horse livers are ground in liquid nitrogen to a fine powder and incubated in 0.5 M for 5 hours at 55 ° C.
    ethylenediaminetetraacetic acid (EDTA), 10 mM Tris-HCl, pH 8.0, 0.5% sodium dodecyl sulfate (SDS), and 0.1 mg / ml proteinase K (20 ml / g of tissue). The resulting viscous solution is freed from protein by a single extraction with phenol and three times extraction with a mixture of phenol with chloroform and isoamyl alcohol (25: 24: 1 by volume), dialyzed in a solution of 50 mmol Tris-HCl, pH 8.0, 10 mmol EDTA, 10 mmol of sodium chloride and DNA are precipitated with two volumes of ethanol. After complete vacuum drying, the DNA is dissolved in TE buffer (10 mmol Tris-HCl, pH 8.0, 1 mM EDTA) at 4 ° C, centrifuged in a solution of cesium chloride 1.273 g / ml at 40,000 rpm for 62 hours at 20 ° C, fractions containing DNA are dialyzed in TE buffer, DNA is precipitated with two volumes of ethanol, washed with 70% ethanol, dried and redissolved in TE buffer at 4 ° C
    VI
    ABOUT
    s
    The resulting preparation DICK is free from RNA and has a length of more than 50 kb. (determined by electrophoresis on a 0.45% agarose gel).
    Stage 2, Partial digestion with endonuclease and fractionation by horse size.
    50 μg of horse DNA along with 1.6 units. SauGES is incubated at 37 ° C in 450 μl of the reaction medium (10 mmol Tris-HCl, pH 7.5, 10 mmol magnesium chloride, 1 mmol dithiothreitol). After 15, 25 and 40 minutes, 150 ml aliquots are taken out and mixed with 15 mmol EDTA and heated for 10 minutes at 70 ° C to stop the reaction. After adding 0.3 mol of sodium acetate, pH 6.0, the DNA is precipitated with 2.5 volumes of ethanol. After re-dissolution in TE-buffer, DNA is separated in size in TBE buffer (10-8 g / l Tris, 5.5 g / l boric acid, 0.93 g / l EDTA disodium salt) by electrophoresis at 1 V / cm on a 0.45% agarose gel overnight. The DNA was digested with restriction enzymes EcoR1 and Hind 111 and DNA fragments of length kbp were isolated. by electroelution at 300 V for 3 hours (buffer 5, 0.1 x TBE), cleaned on an Elutip D column and then precipitated with ethanol.
    DNA is dephosphorylated. For This DNA together with 5 units. intestinal bovine phosphatase is incubated for 30 min at 37 ° C in 140 µl of the reaction medium (50 mmol Tris-HC, pH 9.5, 10 mmol magnesium chloride, 0.1 mmol zinc acetate, 1 mmol spermidine), 5 units . enzyme and incubated for 30 min. After addition of EDTA to a final concentration of 25 mmol, DNA is extracted once with a mixture of phenol and chloroform and isoamyl alcohol (25: 24: 1 by volume), twice with a mixture of chloroform and isoamyl alcohol (24: 1 by volume) and three times with simple diethyl alcohol, precipitated with ethanol, dried and dissolved in 0.1 xTE buffer.
    Stage 3. Getting a library of horse genomic DNA,
    Dephosphorylated 10-23 kb in length. Horse DNA fragments are cloned into a lambda vector, for example, lambda EMBL3 or EMBL 3A with protruding G-A-T-C-termini by removing the internal Barn H1 fragment of phage DNA.
    The vector is grown in an E. coli strain with a suppressor factor SupF., For example E. coli NM 526, 538 or 539, in LB broth with 5 mmol of magnesium sulfate, precipitated with polyethylene glycol and purified by double centrifugation at 45000 rpm and 20 ° C for 40 h using cesium chloride as a density gradient (0.71 g / ml solution). After dialysis in TE-buffer, phage DNA is freed from protein by twofold extraction with a mixture of phenol with chloroform and iso-emyl alcohol (25: 24: 1 by volume) and double extraction with a mixture of chloroform with isoamyl alcohol (24: 1 by volume), then concentrated by precipitation with ethanol.
    0 To obtain terminal fragments of 2EMBL for 50 µg of phage DNA, completely digested with Barn H1 for 2 hours at 37 ° C in 45 µl of reaction medium (10 mmol Tris-HCl, pH 7.5, 10 mmol chloride
    5 mg, 1 mmol dithiothreitol), then the reaction is stopped by adding 15 mmol EDTA for 10 minutes at 70 ° C. DNA is precipitated with ethanol.
    To avoid re-ligation
    0, the middle fragment is cut with EcoR1 and the oligonucleotide to be separated is removed by precipitation with isopropanol.
    The obtained DNA is completely digested with EcoR1 for 2 hours at
    5 37 ° C in 450 µl of 10 mmol Tris-HCl, pH 7.5, 100 mmol of sodium chloride, 10 mmol of magnesium chloride and the reaction is stopped by adding 15 mmol of EDTA and heating for 10 minutes at 70 ° C. After
    To add sodium acetate to a final concentration of 0.3 M, three large DNA fragments are precipitated with 0.6 volumes of isopropanol for 15 minutes at 0 ° C, washed 2 times with 0.45 M sodium acetate (0.6%).
    5 volumes of isopropanol) and once with 0.3 M sodium acetate (2.5 volumes of ethanol) and dissolved in 15 µl of 0.1 x TE buffer. In addition, Bam H1 / EcoR1 linkers are precipitated in solution.
    0 Fragments of EMBL FOR (8 µg) are combined
    with about 5 μg of horse DNA 10-23 kb in length, and 10 units. T4-DNA-li ae and incubated overnight at 14 ° C and one day at 4 ° C in 50 µl of ligation medium (66
    5 mmol of trms-HC, pH 7.2, 0.1 M sodium chloride, 10 mM magnesium chloride, 1 mM EDTA, 5 mM dithiothreitol, 0.5 mM adenosine triphosphate - ATP). The cited DNA mixture is packaged into mature lambda phage particles.
    The components of this system, i.e. an ultrasonic extract (UE), a lysate obtained by freezing and thawing (LZR), buffers M1 and A are prepared in a well known manner. A 10 μl aliquot of the ligated DNA mixture is incubated at room temperature for 2 minutes with 25 μl of UE, which, like LZR, is thawed in ice for 30 minutes, mixed with 100 μl of LZR and further incubated for 60 minutes at room temperature temperature The resulting mixture was diluted with 150 µl lmbd of diluent (100 mM Tris-HCl, pH 7.5, 10 mM magnesium sulfate, 1 mM EDTA) and stored at 4 ° C.
    Step 4. Cloning and sequence analysis of a gene for equine interferon type gamma.
    Isolation of the full gene clone for equine interferon of the gamma type,
    A bacterial culture growing overnight in an LB nutrient solution (10 g / L sodium chloride, pH 7.4) containing 0.2% maltose was adjusted to an optical density of 2.0 (at 600 nm). 0.5 ml of this suspension infect 50,000 units. The lambda-phages of the DNA library and by means of a layer of soft agar are distributed on LB-arap plates containing 10 mM magnesium sulphate. The plates have a diameter of 13.5 cm. A total of 1.5 x 106 recombinant lambda phages are screened. After incubation overnight at 37 ° C, the phages of each plate are used to prepare double replicons on nitrocellulose. After denaturation of phage DNA (1 min of 0.5N sodium hydroxide, 1.5 M sodium chloride), neutralization (2 times for 3 min in 0.5 M Tris-HC, pH 7.5, 1.5 M chloride sodium) and washing (1 min in 2xSSC buffers, 1xSSC, 0.15 M sodium chloride, 15 mM sodium citrate) the filters are dried in air, the DNA is fixed at 80 ° C for 2 hours. The filters are washed at 65 ° C during the night in a solution of 1.5 M sodium chloride, 10 mM Tris-HCl, pH 8.0, 0.1% SDS, is subjected to preliminary hybridization at 65 ° C for 4-6 h (solution for hybridization: 0.9 M sodium chloride , 50 mM sodium hydrogen phosphate, pH 7 , 4, 5 mM EDTA, 0.1% Ficoll, 0.1% polyvinylprolrolidone, 0.1% cattle serum albumin, 0.1% SDS, 20 mg / ml DNA of salmon sperm, subjected to ultrasonic treatment and denaturation).
    Hybridization is carried out in fresh solution using 10b cp per filter with radioactively labeled human interferon gamma at 65 ° C for 20 h. The filters are washed at 65 ° C in 3xSSC buffer, 0.1% SDS, dried and subjected to autoradiography. After cleaning the spots three times, five lmbe clones are identified that show positive hybridization signals.
    Of these recombinant phage secreted, DNA is purified by known techniques. After digestion with various restriction enzymes and subsequent Southern analysis, phage DNAs are characterized by hybridization with a sample of human gamma interferoch. Selection - 5 yu single hybridsmith GrantH-fragment of 4.6 t pi. clone lsmbda Eq-y2, which is cloned into the site of the Bam HI cut with the known plasmid pUC9.
    0 After transformation of E. coli JM101 from the obtained colonies, plasmid DNA is obtained by the method of preparing mini-preparations, which is characterized by digestion with restriction enzymes. Plzmid with the desired Bam H 1 insert is designated as RAN111. After being introduced into the known M 1 vectors, 3m P8 or M13mp9, the BamHI insert of the RAN111 plasmid is subjected to sequence analysis using the dm-deoxy method. Comparison of sequences with the human interferon-type gamma gene shows greater homology with the noncoding 5- and 3-regions. By these
    5 results conclude that the complete equine gamma interferon gene has been isolated.
    Sequence analysis. equine interferon-type gamma gene isolated from clots lambda Eq-v2
    0Bam HI - insert length 4.6. n RAN111 plasmids are subjected to complete sequence analysis. The total sequence of the Bam H1 fragment is determined by combining the partial sequences of the M13 subclones, which are obtained by directionally cloning the restriction fragments (EcoR1. Hind 111, Pst1, Pst1 - Bgi11, Hind 111 - Bam H1) into correspondingly cut vectors
    0 M13mp8 or M13mp9 Further partial sequences are obtained by cloning a fragment of Bam H1-Bgl 11 with a length of 2.0 t.p. or a fragment of Pst1 with a length of 2.0 kb. in the vector M13mp8. Both fragments
    5 DNA is divided into smaller pieces by ultrasound treatment, the ends of DNA are made blunt by incubating DNA polymerase 1 from E. coli (Klenow fragment) in the presence of all four deoxynucleotid triphosphates, each of which is used in an amount of 0.1 mM ( reaction buffer: 50 mM Tris-HCl, pH 7.5, 10 mM magnesium chloride, 1 mM dithiothreitol, 0.5 mg / ml bovine serum albumin
    5 cattle, 1 h, 25 ° C). After fractionation in an agarose gel, DNA fragments are approximately 0.4–1.0 kb in length. the Sma1 section of the vector M13mp8 is isolated and ligated. The resulting sequences are combined using a computer program to obtain a total sequence of 4,664 base pairs.
    After analysis using an open reading computer and comparing with interferon-type gamma genes of other origin, the coding region of the horse's gamma-interferon gene is determined. The coding region consists of three introns, the first encoding a hydrophobic signal peptide 20 amino acids long and 18 amino acids of a mature horse equine interferon gamma polypeptide (bases 366-479). The second ekvone encodes amino acids 19-41 (bases 1639-1707), the third exon - amino acids 42-102 (bases 1803-1985), and the fourth exon - the carboxy-terminus with amino acids 103-146 (bases 3307-3441). At positions 4010 and 4020, there are two signal sequences (AATAAA) for polyadenylation of mRNA. At positions 86-88 of the polypeptide for mature equine gamma interferon, there is the only possible site of N-glycosylation (AsN-Ser-Ser), which coincides with the second place of N-glycosylation (Asn-Gly-Ser) of bovine interferon of the gamma type. In an unexpected way, the polypeptide for mature equine gamma-interferon contains only one cysteine residue in position 3, and, similarly to natural, human and mouse gamma maginterinterferons, the first three amino-amino acids (in this case, Tyr-Tyr-Cys) all over the surface of the protein - tically split off in the body.
    Step 5. Preparation of a synthetic gene for mature equine interferon type gamma.
    A synthetic gene for a mature equine gamma interferon is designed in two variants using 16 different oligonucleotides. The first variant encodes a mature interferon with 146 amino acids plus starting methionine, and the second variant - on the terminal amino group, a polypeptide shortened by 3 amino acids (Tug-Tug-Sug) plus a c-art methionine, as in the body.
    Equine gamma interferon gene synthesis is carried out in two stages. In the first stage, the first part of the gene is constructed using eight EG-1 EG-8 oligonucleotides to the Sail incision site, and in the second stage, the second half of the gene is constructed using six EG-9 oligonucleotides placed from the incision site Sail to the site of the cut Bam H1. To construct a three amino acid-shortened variant on the terminal amino group of a horse gamma interferon variant, E6-15 and EG-1 b oligonucleotides are used instead of EG1 and EG-2 oligonucleotides. Complementary oligonucleotides in pairs are subjected to phosphorylation at the 5th end. 100 pmol of both oligonucleotides (for example, EG-3 and EG-4, EG-5 and EG-6, etc.) are incubated with P O units. T4-polynucleotide kinase at 37 ° C for 10 min in 9 μl of reaction buffer (70 mM Tris-HCl, pH 7.6. 10 mM magnesium chloride, 5 mM ditiotriitol), 2 μCh () ATP. Then 1 µl of 10 mM ATP solution is added and
    5 incubated at 37 ° C for 50 minutes The reaction is stopped by heating to 95 ° C for 10 minutes. In order to prevent the subsequent binding of the ends of the DNA, EG-1, EG-15, EG-9 and EG-14 oligonucleotides do not
    0 phosphorylate. After inactivation of the polynucleotide kinase, they are mixed with the corresponding complementary oligonucleotide, heated to 95 ° C for 5 min, and cooled to room temperature.
    5 temperature. Mixes of oligonucleotides EG-1 + EG-2 (or EG-15 and EG-16), EG-3 + EG-4, EG-5 + EG-6 and EG-7 + EG-8 are combined, mixed with 1 µl 5 M sodium chloride is heated to 70 ° C for 5 minutes and
    0 cooled to room temperature. 5 µl of 10 mM ATP, 2 µl of dithiothreitol, 1.5 µl of 10 x ligation buffer (0.66 M Tris-HCl, pH 7.2, 1 M sodium chloride, 100 mM magnesium chloride, 10
    5 mM EDTUK, 50 mM dithiothreitol) and 80 units. T4 DNA ligases and incubated at 4 ° C for 48 hours. The ligation reaction was monitored by separation of a small portion of the reaction medium by electrophoresis in a 5% polyacrylamide gel and subsequent autoradiographs. Similarly, six oligonucleotides of EG-9 to EG-14 bind to one another. The reaction is stopped by extraction with phenol and chloroform, the DNA is isolated by precipitation with ethanol.
    Step 6: Introduction of the synthetic gene into the plasmid pRH-100
    10 µg of the pRH-SC llaemide are digested
    0 restrictase Sad in 100 μl of reaction buffer and thereby inactivate by heating for 10 minutes to 70 ° C. The DNA is treated with Klenow fragment at 25 ° C for 30 minutes in the presence of all four deoxy nucleotides, each of which is taken in an amount of 10 μM. The reaction is stopped by extraction with a mixture of phenol and chloroform, the DNA is concentrated by precipitation with ethanol. As a result of this treatment, a blunt end of DNA is formed behind the tryptophan promoter, which ends with a translational start codon ATS. The linearized plasmid DNA was digested with the restriction enzyme WatH1 and the vector portion was recovered by agarose gel electrophoresis.
    50 ng of the thus prepared plasmid vector pRH-SE were mixed with 20 pmol of ligated EG-1 oligonucleotides to EG-8 and EG-9 to EG-14 and in 10 kml of ligation buffer (66 mM Tris-HCl, pH 7.2, 100 mM sodium chloride, 10 mM magnesium chloride, 1 mM EDTA, 5 mM dithiothreitol, 1 mM ATP) are incubated with 1 unit. T4-DNA ligases at 14 ° C for 24 hours. Calcium-treated E. coli 1M-101 cells are transformed with this ligase mixture and incubated at 37 ° C overnight. Plasmid DNA was isolated from the resulting transformers, the structure of which was determined by restriction analysis and sequence analysis of the Hind 111-Bam H1 insert. The plasmid of the desired structure for the expression of mature equine interferon of the gamma type is designated pEqG-YYC1. Similarly, the oligonucleotides EG-15, EG-16, EG-3 to EG-8 and EG-9 to EG-14 are cloned into the pRH-SE vector so as to obtain a three-amino acid-shortened equine gamma-type interferon. The plasmid of the desired structure is designated pEqG-QAA1.
    Stage 7. Expression of interferon activity by E.col HB101 strain containing plasmid pEq-YYC1 or pEqG-QAA1.
    100 ml of the bacterial culture is incubated at 37 ° C and shaken vigorously in the following, not containing tryptophan in the medium (data per liter of medium): 10 g of ammonium phosphate, 3.5 g of potassium hydrogenphosphate, pH 7.3 with hydroxide sodium, 0.5 g sodium chloride, 21 g Cas-amino acids (acid hydrolyzed), 11 g glucose, 1 mM magnesium sulfate, 0.1 mM calcium chloride, 1 mM thiamine-HCl, 20 mg L-cysteine, 20 mg 3 - / 3- indole of acrylic acid. In addition, the medium may contain another 50-100 mg of ampicillin. After incubation, the medium is centrifuged at 4000 rpm for 5 minutes, the pellet is suspended in e-cooled buffer (50 mM Tris-HCl, pH 8.0, 30 mM sodium chloride), taken in an amount of 1/10. The cells were sonicated twice at 30 s (at 20 kHz, 100 W). The remains of the destroyed cells were removed by squeezing for 10 minutes at 10,000 rpm at 4 ° C and, after sterilizing filtration, the supernatant was tested for interferential
    activity by determining the cytopathic effect of vesicular stomatitis virus (VVS) or encephalomyocarditis virus (HEM).
    Test system: NBL-b cells (ATCC CCL 57, equine zidermida cells) / Air Force.
    A 549 (ATCC CCL 185, human lung tumor cell line) / VEM. The titer ng cells And 549 normalized to international units using the standard human interferon. The strain E. coli CSR603 is transformed with plasmids, the bacteria are selected on agar plates containing ampicillin. To prepare maxi-cells and label proteins, cells are grown at 37 ° C to an optical density of 0.5 at 600 nm in 15 ml of medium (see step 7) without indole-acrylic acid and 10 ml of this culture in a rocking Petri dish, irradiated for 5 with a lamp mounted at a distance of 50 cm from the cup (15 W), then incubated at 37 ° C for 1 h. The cultures are mixed with 100 µg / ml D-cycloserine, incubated at 37 ° C for 14 h, the bacteria are separated by centrifugation. The cells are washed twice with 5 ml of Hershey saline solution, suspended in 5 ml of Hershey medium with 20 µg / ml of indo-acrylic acid and incubated at 37 ° C for 2 hours. To each culture, 5 µCi / ml of 35S-methionine (1000 Ci / mmol) is added and shaken at 37 ° C for 1 hour. Cells are separated, lysed in electrophoresis buffer containing SDS and 2-mercaptoethanol, and proteins are separated in a 15% polyacrylamide gel.
    The composition of the HECH solution (per liter):
    NaCI5-4 g
    KCI3.0 g
    , 1 g
    CaCl2 2H2015mg
    MgCb 6H200.2 g
     bNaO0,2 mg
    KH2P0487 mg
    Tris-NA 12.1 g
    pH7.4.
    The composition of the medium Hershey (100 ml Hershey saline):
    2 ml of 20% glucose
    0.5 ml2% threonine
    1.0 ml1% leucine
    1.0 ml2% prolins
    1.0ml2% arginine
    0.1 MI0.1% Thiamine
    The autoradiography of the dried gel was carried out for 2 days at -80 ° C on an x-ray film using an amplifying film. As standard
    (L
    a molecular weight, a mixture of C-methyl proteins is used. As a control, plasmid pER103 was used, which contains only the promoter without the interferon gene, and plasmid pER21 / 1, which contains two copies of the human inerferon gene of the Alfszago type.
    Stage 8, Proof of the presence of homologous sequences in the genome with the EdIF gene.
    30 µg of high molecular weight horse NK (see stage 1) is completely digested with 60 units. the corresponding restriction enzyme in 200 µl of the reaction volume and each time 10 µg of this cut DNA are separated in a 0.8% agarose gel. After transferring to a nitrocellulose filter, denaturing and fixing the DNA, each filter is hybridized for 17 hours at 65 ° C, bhbufer SSC, 5 x Denhardt solution, 0.1% SDS, 20 μg / ml denatured DNA from salmon sperm in the presence of about 6x106% ppm .
    As a sample for EdIF-y, a fragment from plasmid pEaG-YYd is used, which contains the sequence / encoding the entire mature interferon. The filters are then washed 4 times for 45 minutes at 65 ° C. with 0.3x SSC / 45 mM sodium chloride, 4.5 mM sodium citrate, 0.1% SDS. Autoradiography was performed on an x-ray film using an amplifying film at -80 ° C 8 for 7 days.
    Step 9. Expression of equine interferon type) in E. coli HB101 / pEG-QAA2 and HB101 / pEgG-QAA3.
    To achieve improved expression, improved expression vecgory and an improved ribosomal binding site are used.
    Improved expression vectors are based on the trp promoter from Serratia marcescens (Sma), which in region -35, by replacing the base (pRH281), is equated to the consensus region -35, or on the hybrid trp promoter, which has E.Coil, the first A / T rich region ( Eco) or the second A / T rich region plus the Sma promoter (pRH282). Enterotoxin II from E. coli is emitted as a ribosomal binding site.
    pRH281 / 5.
    The following oligonucleotides are synthesized in a known manner: Trp-1: 51 -AATTGACGCTG-31; Trp-3: 51ATCGCTAAAACATTGTGCAAAAAGAGGGTT-GACATTGCCTTCGCGAACCAGTTAACTAGT ACAC-31;
    Trp-5: 51-AGTTCACGGCTCGAGACGGTAAGGAGGTTT
    AATATGAGCTCGAATTCAT-31; Trp-2: 51 -TTAGCGATCAGCGTC-31; Trp-4: 51-CGTGAACTTGTGTACTAGTTAACTGGTTCG CGAAGGCAATGTCAACCCTCTTTTTGCAAT
    GTT-31;
    Trp-6: 51-CGATGAATTCGAGCTCATATTAAACCTCCT TACCGTCTCGAGC-31,
    100 pmol of Trg-2 Trg-5 oligonucleotides are separately phosphorylated in 10 µl of the reaction solution. Trr-1 and -2, Trr-3 and -4 and Trr-5 and -6 are hybridized by boiling and slow cooling. Solutions of oligonucleotide pairs are combined and
    by adding T4-DKA ligase. 3 μg of pAE153 are cut with EcoR1 and C1A1. After purification of the large fragment, approximately 20 pmol of oligonucleotides are added to it and ligated. Then DNA
    transformed into E. coli HB101 and plasmids from the resulting colonies were isolated. The Pst-Hind111 fragment containing the promoter is subjected to sequence analysis. After confirming the desired sequence, a plasmid is selected and is designated pRH281 / 5.
    The sequence of the promoter part is as follows: -35 5LGAATTGACGCTGATCGCTAAAACATTGT
    GCAAAAAGAGGGTTGACATTGC
    3 -CTTAACTGCGACTAGCGATTTTGTAACA CGTTTTTCTCCCAACTGTAACG
    Xho1
    / -10 Transkriptionsstart
    CTTCGCGAACCAGTTAACTAGTACACAAGT- -TCACGGCTCGAGACGGAGAAG GAAGCGCTTGGTCAATTGATCATGTGTTCA -AGTGCCGAG CTCTGCCATTC RBS Sst1 EcoRi Cla i
    GAGGTTTAATATGAGCTCGAATTCATCGAT-31
    CTCCAAATTATAC.TCGAGCTTAAGTAGCTA-51
    The advantages of the new expression vector are the optimal region - 35 in the trp-Sma promoter; the only place Xho1 in front of the ribosomal binding site (MLS), which allows for the replacement
    Mrs to another; the expression plasmid contains the translational start of ATG at a distance of 5 nucleotides from the MPC; G of this ATG is the first base of the Sst 1 recognition sequence (GAGCTC). By cutting with Sst 1 and then obtaining a direct end, an expression vector is obtained with a translational start of ATS, with which a foreign gene can be ligated, starting from the first base of the reading frame; the MPC-ATG link contains neither G nor C; by selecting the sequence of oligonucleotides at the 5-terminus, the original EcoRI cut is destroyed, so that at the 3-nd end of the promoter a multi-cloning site can be obtained consisting of Sst1, EcoR1, Cla1 and Hind 111 (already in рАТ153).
    PRH282 / 5.
    Similarly, construct the expression vector pRH-282/5. The oligonucleotides Trg-1 and Trr-2 are replaced by the oligonucleotides Trg-7 and Trr-8: Trp-7; 51VATTGCCCGTTTGGATAATGTTTTTTGCG CCGACATCATCATGCT-3; Tgr-8:
    TTAGCGATCAGCATGATGATGTCTCGGCGC AAAAAACATTATCCAGAACGGGC-31.
    The sequence of the promoter part in pRH282 / 5 is as follows:
    51GAATTGCCCGTTCTGGATAATGTTTTTTGC-GCCGACATCATCATGCTGAT
    CTTAACGGGCAAGACCTATTACAAAAAACG - CGGCTGTAGTAGTACGACTA -35CGCTAAAACATTGTGCAAAAAGAGGGTTGA CATTCCCTTCGGAACCAGT GCGATTTTGTAACACGTTTTTTATAGACTGTGGG
    -10lTranskriptionsstart RBS TAACTAGTACACAAGTTCACGGCTCGACGG TAAGGAGGTTTAATATGA ATTGATCATGTGTTCAAGTGCCGAGCTCTGCCATTCCTCCAAATTATACT Sst EcoRI
    1 μg of pUC18 is cut with Bam H1 and 5aI, Iz10mkgEDSS) AA1 by cutting with Bam H1 and Sail, the second half of the horse interferon type 20 ng vector is ligated and 100 ng of insert is ligated and the DNA is transformed into E.colt JM101. A single colony plasmid is analyzed by digestion with restriction enzymes and is designated pCM1.
    pCN3.
    The first half of the synthetic gene, together with the ribosomal binding site, is constructed from oligonucleotides:
    5 5 EqG-1: 5L
    -AGCTTCCCTCGAGAGGTTGAGGTGATTTAT GCAGGCTGCTTTCTTTAAAGAAATCGAAAA CCTGAAAGAATACTTCAACGCTCGTAACCC 5 AGACGTTGGT-31:
    EqG-2: 5L
    -GACGGTGGTCCGCTGTTCCTGGACATCCT GAAAAACTGGAAAGAAGACTCTGACAAAAA GATCATCCAGTCTCAG-31;
    0 EqG-3: 51-ATCGTTTCTTTCTACTTCAAACTGTTCGAAA ACCTGAAGAAAGACAACCAGGTTATCCAGA AATCGATGGACACTATCAAAGAAGATCTGT TCGTTAAATTCTTCAACTCGTCGACTCCG-31
    five ;
    EqG-4:
    -AATTCGGAGTCGACGAGTTGAAGAATTTAA CGAACAGATCTTCTTTGATAGTGTCCATCG ATTTCTGGATAACCTGGTTGTCTTTCAGGTT
    0 TTCGAACAGTTTGAAGTAGAAAGAAAACGA TCTGAGACTG-31; EqG-5: 51-GATGATCTTTTTGTCAGAGTCTTCTTTCCAG TTTTTCAGGATGTCCAGGAACAGCGGACCA
    5 CCGTCACCAACGTC- 31:
    EqG-6:
    -TGGGTTACGAGCGTTGAAAGTATTCTTTCA GGTTTTCCATTTCTTTAAAG AAAG CAG CCT GCCATAAATCACCTCAACCTCTCGAGGA-31.
    0 50 pmol of oligonucleotides phosphorylate, namely EqG-2 together with EqG-5 in 7 μl, EqG-З and EqG-8 separately in 8 μl. The reaction is stopped by heating to 100 ° C. 50 pmol of EqG-4 (1
    5 μl), and to EqG-8 - 50 pmol EqG-1 (1 μl). The solutions are again heated to 100 ° C and slowly cooled. Oligonucleotide pairs are combined and ligated with T4-DNA ligase in 30 µl, 2 µg pUC18
    0 is digested with EcoRI and Hindi 11, the vector portion is gel purified and dissolved in 50 µl of water. 40 ng of the vector and about 2 pmol of ligated oligonucleotides are ligated in a medium of 10 km
    5 transform E. coli JM101 cells; Insert EcoR1-Hind111; some of the plasmids obtained are re-cloned into M13tp9 and sequence is established. Plasmid is selected with the required sequence and is designated pGN3. pGN20.
    About 3 µg of pGN1 and pGN3 split Hindi 11 and Sail. The pGNS H vector is purified in the gel (the second half of the Eq5 gene IF-y from pGN1). 0.2 μg of pGN3 are ligated with about 0.05 μg of the pGN3 insert and the DNA is transformed into E. coli JM101. The plasmid of the obtained clone is selected after checking the restriction pattern and is designated as pGN20.
    pEqG-QAA2 or pEqG-QAA3,
    An Xho1-EcoR1 fragment containing the gene of synthetic horse interferon gamma-interferon, together with the ribosomal binding site of generators of E. coli III, is isolated from about 10 µg of pGN20. pYH281 / 5 or pRH282 / 5 cleaves restrictagamine Xhol and EcoRI. 20 ng of the vector are ligated with 20 ng of the fragment, the obtained DNA is transformed into E. coli HB10 cells, from which plazmids are then isolated and checked by restriction analysis. A plasmid is chosen, which is designated as pEqG-QAA2 (vector pRH281 / 5) or (vector: pRH282 / 5).
    Experience in testing the activity of interferon-gon type.
    An overnight culture of E. coli HB101 / pEqG-QAA2 or HB101 / pEqG-QAA3 was diluted 1: 100 with LB buffer (100 g / l tryptone, 5 g / l yeast extract, 5 g / l chloride sodium (50 mg / l ampicillin) and then incubated at 37 ° C. After an optical density of 0.3 (600 nm) was reached, 50 mg / l of dol-acrylic acid was added and the culture was incubated for a further 2 hours at 37 ° C. Bacteria1 are separated by centrifugation and destroyed by ultrasonic sterile filtration., The supernatant is tested on NBL-6 cells (ATCCL57) for gamma-interferon activity, and the virus is used as a virus stomatitis virus. The lysates of both transformed bacterial cultures (E. col HB101 / pEqG QAA2 or HBIOI / pEqG-QAA3) show about 0.1-1 ppm units / ml of interferon activity. As a control, lysate E. coli HB101 / pRH281 was identically prepared. This control lysate exhibits less than 100 units / ml.
    权利要求:
    Claims (1)
    [1]
    Invention Formula
    A method for producing interferon horses, which is sealed in that v, horse liver at pH 8.0 is extracted with DNA using phenol, elgaate is used, DNA is precipitated with ethanol, centrifuged in buffer pH 8.0, diluted and precipitated with ethanol of DNA larger than 50 tons The DNA obtained is cleaved with the SauA endonuclease at pH 7.5, Fractionated by electrophoresis, fragments 10-23 kb in length are isolated, they are dephosphorylated and cloned in the EMBL 3 vector (-ZA) , by screening cloned DNA fragments, a fragment homologous to the gamma-interferon gene is selected. human, selected fragment size 4.6 TPN digested with the Bam HI restrmtase, inserted into the pUC9 vector, recombinant DNA obtained is transformed into Escherlchia coll JM101 bacteria, the plasmid RAN111 containing Bam H1 is synthesized
    a fragment consisting of 14 oligonucleotides EG 1 - EG 14, which is inserted into the plasmid pHNUO at the Sac restriction site by blunting the protruding ends of the DNA with a Klenow fragment in the presence of four deoxynucleotide trifosfates and additional hydrolysis of Wat H1, followed by recombinant DNA transform E. coli bacteria JM101, transformation products containing
    5 plasmid pEqG-YYC1 or pEqG-QAA1, cultured, analyzed for interferon activity of the isolated and purified ion exchange chromatography and gel chromatography of the protein, synthesize oligonucleotides
    0 Trr 1-6 or Trr 7-8 with the following nucleotide sequences: Trr-1: 5 -AATTGACGCTG-3: Trp-3: 51-ATCGCAAAACATTGTGCAAAAAGAGGGTT
    5 GACATTGCCTTCGCGAACCAGTTAACTAGT АСАКА-31;
    Trp-5: 51-AGTTCACGGCTCGAGACGGTAAGGAGGTTT AATATGAGCTCGAATTCAT-31;
    0 Tgr-2: 5 -TTAGCGATCAGCGTC-3: Trp-4: 51-CGTGAACTTGTGTACTAGTTAACTGGTTCG CGAAGGCAATGTCAACCCTCTTTTTTGACA ATGTT-31;
    5 Trp-6: 51-CGATGAATTCGAGCTCATATTAAACCTCCT TACCGTCTCGAGC-31; Trp-7: 51-AATTGCCCGTTCTGGATAATGTTTTTTGCGC
    0 CGACATCATCATGCT-3; Trr-8: 5-TTAG CGATCAG CATGATGATGTCGG CG CAA AAAACATTATCCAGAACGGGC-3 then get fragments encoding
    5 promoter and ribosomal binding site, ligate them with a large fragment of the plasmid pAT153 cut with EcoRI and CE, transform the obtained DNA strain E.coii HB101 and plasmid pRH281 / 5 or pRH282 / 5 parallel to the vector PUC18 treated with Bam H1 and Sail endonuclease, are ligated with the second half of the synthetic fragment obtained by digesting the plasmid
    5 EqG-QAA1 with endonucleases Bam H1 and SaM and dephosphorylation, the resulting DNA was transformed with E. coli JM101 bacteria and the pGN1 plasmid or the pUC18 vector treated with EcoRI and Hind 111 endonucleases were ligated with EqG-1 - EqG-6-6 or EqG-6 oligonucleotides, EqG-6 or EindG1-6, or Eind-6. , E. coli JM101 is transformed by the pioneer of DC, plasmid pGN3 is isolated, plasmids pGN1 and pGN3 are treated with Hind 111 and Sail, gel purified, then ligated, the resulting DNA is transformed into E. coli JM101 and then plasmid pGN20 is transformed Xho1-EcoR1 DNA fragment containing the synthetic interferon gene from the month ohm
    ribosomal binding of E.coll Enterotoxln And, which are ligated with plasmids pRH 281/5 and pRH 282/5, treated with Xho1 and EcoR1, endonucleases, the obtained DNA is transformed into a strain of the bacterium E.coli HB101, transformation products containing the plasmid pEqG-QAA2 or pEq1 or pEqG-QAA2 or pEpI p1HP101 pE. -QAA3, cultivated with the subsequent isolation of interferon and its purification by ion-exchange chromatography and gel chromatography.
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1701114A3|1991-12-23|Method of equine @-interferone preparation
    Polack et al.1984|A complete set of overlapping cosmid clones of M-ABA virus derived from nasopharyngeal carcinoma and its similarity to other Epstein-Barr virus isolates
    SU1764515A3|1992-09-23|Method of leukocyte interferon preparation
    DK174927B1|2004-03-01|DNA encoding human factor VIII: C, vector comprising this DNA, transformed host comprising this DNA, and method for producing human factor VIII: C
    EP0174367B1|1992-06-10|Hosts and methods for producing recombinant products in high yields
    JPH0716419B2|1995-03-01|Rennin, pre-prorennin, or prorennin genes obtained from recombinant DNA material, and live cells containing these genes
    SU1762761A3|1992-09-15|Method for preparation of polypeptide showing properties of tumor necrosis factor
    PL149079B1|1990-01-31|Method of obtaining polypeptides of ifn-beta type
    NZ211666A|1990-01-29|Pharmaceutical compositions comprising tumour necrosis factor and its production via recombinant techniques
    JP2721139B2|1998-03-04|Animal interferon
    JP2525023B2|1996-08-14|Purification of recombinant interleukin-1
    SU1646489A3|1991-04-30|Method for preparation of bovine hormone growth
    EP0155189A2|1985-09-18|Expression of cell wall degrading proteins and host cells harboring dna encoding such protein
    EP0146026A2|1985-06-26|DNA encoding rabbit TNF, vector having said DNA inserted thereinto, host transformed with said vector, rabbit TNF polypeptide, and process for production thereof
    NZ228424A|1992-06-25|Protease-deficient gram-positive bacteria and their use as host organisms for the production of recombinant products
    JPH09500011A|1997-01-07|P. Cloning and expression of chondroitinase I and II genes from Bulgaris
    EP0227110B1|1991-12-11|Human immunoglobulin g fc region protein and production thereof
    JP2792813B2|1998-09-03|Novel leukocyte interferon
    EP0231883A1|1987-08-12|Hybrid plasminogen activator-like polypeptide
    EP0509768A2|1992-10-21|DNA clone of guayule rubber particle protein
    CA2154543A1|1996-04-29|Human 26s proteasome subunit components
    JPH06311884A|1994-11-08|Plasmid and escherichia coli transformed with the same
    JP2591713B2|1997-03-19|DNA sequences, recombinant DNA molecules and methods for the production of the enzyme mutarotase from Acinetobacter calcoaceticus
    JP3897343B2|2007-03-22|Protein that induces production of interferon-γ in immunocompetent cells
    JP2641273B2|1997-08-13|Mutant human lysozyme
    同族专利:
    公开号 | 公开日
    PH30889A|1997-12-23|
    US5602010A|1997-02-11|
    FI875427A0|1987-12-10|
    NO180239C|1997-03-12|
    DE3786649D1|1993-08-26|
    FI99116B|1997-06-30|
    ES2058094T3|1994-11-01|
    IL84780A|1992-11-15|
    NO180239B|1996-12-02|
    EP0271824A2|1988-06-22|
    JPH07250690A|1995-10-03|
    DK645887A|1988-06-11|
    NO875136D0|1987-12-09|
    PT86332A|1988-01-01|
    EP0271824A3|1989-05-24|
    ZA879245B|1989-08-30|
    NZ222856A|1991-11-26|
    DE3642096A1|1988-06-16|
    NO875136L|1988-06-13|
    DK170054B1|1995-05-08|
    IE873342L|1988-06-10|
    KR880007568A|1988-08-27|
    HUT46066A|1988-09-28|
    AT91722T|1993-08-15|
    JPH07258294A|1995-10-09|
    PT86332B|1990-11-07|
    IL84780D0|1988-05-31|
    FI875427A|1988-06-11|
    AU8223387A|1988-06-30|
    EP0271824B1|1993-07-21|
    DK645887D0|1987-12-09|
    CA1339776C|1998-03-24|
    JPS63233794A|1988-09-29|
    IE60404B1|1994-07-13|
    HU213566B|1997-08-28|
    FI99116C|1997-10-10|
    AU616873B2|1991-11-14|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    DE88622C|
    ZA811368B|1980-03-24|1982-04-28|Genentech Inc|Bacterial polypedtide expression employing tryptophan promoter-operator|
    EP0088540A3|1982-02-22|1984-10-17|Biogen, Inc.|Dna sequences, recombinant dna molecules and processes for producing human immune interferon-like polypeptides|
    IE54592B1|1982-03-08|1989-12-06|Genentech Inc|Anumal interferons, processes involved in their production, compositions containing them, dna sequences coding therefor and espression vehicles containing such sequences and cells transformed thereby|
    DE3247922A1|1982-12-24|1984-06-28|Boehringer Ingelheim International GmbH, 6507 Ingelheim|DNA SEQUENCES, THEIR PRODUCTION, PLASMIDES CONTAINING THESE SEQUENCES AND THE USE THEREOF FOR THE SYNTHESIS OF EUKARYOTIC GENE PRODUCTS IN PROKARYOTS|
    JPH0515435B2|1983-11-30|1993-03-01|Takeda Chemical Industries Ltd|
    US4666865A|1984-01-13|1987-05-19|Centocor, Inc.|Immunoassay for biologically active human interferon-gamma employing unique monoclonal antibodies|
    DE3414831A1|1984-04-19|1985-10-31|Hoechst Ag, 6230 Frankfurt|PRODUCTION OF POLYPEPTIDES WITH HUMAN GAMMA INTERFERON ACTIVITY|
    FI90990C|1984-12-18|1994-04-25|Boehringer Ingelheim Int|Recombinant DNA molecule, transformed host organism, and method for producing interferon|
    US4689224A|1985-10-07|1987-08-25|Neogen Corporation|Method for administering vaccines containing equine leukokines and compositions therefor|
    DE3607835A1|1986-03-10|1987-09-24|Boehringer Ingelheim Int|HYBRID INTERFERONS, THEIR USE AS MEDICINAL PRODUCTS AND AS INTERMEDIATE PRODUCTS FOR THE PRODUCTION OF ANTIBODIES AND THE USE THEREOF AND METHOD FOR THEIR PRODUCTION|
    CA1340698C|1986-07-25|1999-08-10|Kabushiki Kaisha Hayashibara Seibutsu Kaguku Kenkyujo|Preparation and uses of interferon-gamma|
    US4908432A|1987-01-09|1990-03-13|New York University|Novel polypeptide having gamma-interferon activity|NO811118L|1980-04-03|1981-10-05|Biogen Nv|DNA SEQUENCES, RECOMBINANT DNA MOLECULES, AND PROCEDURE FOR PREPARING POLYPEPTIDES|
    US5272263A|1989-04-28|1993-12-21|Biogen, Inc.|DNA sequences encoding vascular cell adhesion molecules |
    US6307025B1|1989-04-28|2001-10-23|Biogen, Inc.|VCAM fusion proteins and DNA coding therefor|
    US7049102B1|1989-09-22|2006-05-23|Board Of Trustees Of Leland Stanford University|Multi-gene expression profile|
    GB9414752D0|1994-07-21|1994-09-07|Q One Biotech Ltd|Feline gamma-interferon|
    GB2291645A|1994-07-21|1996-01-31|Q One Biotech Ltd|Equine gamma-interferon|
    IL155730D0|2000-11-03|2003-11-23|Biomedicines Inc|Method for short-term and long-term drug dosimetry|
    US20030143197A1|2001-11-09|2003-07-31|Moran S. Mark|Method for treating diseases with omega interferon|
    US7731947B2|2003-11-17|2010-06-08|Intarcia Therapeutics, Inc.|Composition and dosage form comprising an interferon particle formulation and suspending vehicle|
    WO2006083761A2|2005-02-03|2006-08-10|Alza Corporation|Solvent/polymer solutions as suspension vehicles|
    US11246913B2|2005-02-03|2022-02-15|Intarcia Therapeutics, Inc.|Suspension formulation comprising an insulinotropic peptide|
    JP5143131B2|2006-05-30|2013-02-13|インターシアセラピューティクス，インコーポレイティド|Two-piece internal channel flow modulator for osmotic delivery system|
    CN102274557B|2006-08-09|2014-12-03|精达制药公司|Osmotic delivery systems and piston assemblies|
    DK2157967T3|2007-04-23|2013-04-08|Intarcia Therapeutics Inc|Suspension formulations of insulinotropic peptides and applications thereof|
    WO2009102467A2|2008-02-13|2009-08-20|Intarcia Therapeutics, Inc.|Devices, formulations, and methods for delivery of multiple beneficial agents|
    EP3323423B1|2009-09-28|2020-06-17|Intarcia Therapeutics, Inc|Rapid establishment and/or termination of substantial steady-state drug delivery|
    US20120208755A1|2011-02-16|2012-08-16|Intarcia Therapeutics, Inc.|Compositions, Devices and Methods of Use Thereof for the Treatment of Cancers|
    US9889085B1|2014-09-30|2018-02-13|Intarcia Therapeutics, Inc.|Therapeutic methods for the treatment of diabetes and related conditions for patients with high baseline HbA1c|
    WO2016196851A2|2015-06-03|2016-12-08|Intarcia Therapeutics, Inc.|Implant placement and removal systems|
    WO2017200943A1|2016-05-16|2017-11-23|Intarcia Therapeutics, Inc.|Glucagon-receptor selective polypeptides and methods of use thereof|
    USD860451S1|2016-06-02|2019-09-17|Intarcia Therapeutics, Inc.|Implant removal tool|
    USD840030S1|2016-06-02|2019-02-05|Intarcia Therapeutics, Inc.|Implant placement guide|
    EP3565580A1|2017-01-03|2019-11-13|Intarcia Therapeutics, Inc|Methods comprising continuous administration of a glp-1 receptor agonist and co-adminstration of a drug|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    DE19863642096|DE3642096A1|1986-12-10|1986-12-10|HORSEINTERFERON|
    [返回顶部]