• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    A DNA transfer vector comprises a deoxynucleotide sequence coding for bovine growth hormone or bovine pre-growth hormone.
    公开号:SU1471949A3
    申请号:SU813345603
    申请日:1981-10-23
    公开日:1989-04-07
    发明作者:Л.Миллер Уолтер；А.Мартиал Джозеф；Д.Бакстер Джон
    申请人:Дзе Раджентс Оф Дзе Юниверсити Оф Колифорния (Фирма)；
    IPC主号:
    专利说明:

    31
    Polyadenylated RNA is transcribed to single-stranded DNA using reverse transcriptase. RNA is removed by alkaline hydrolysis. Single stranded DNA is extracted with phenol, subjected to chromatographic separation by passing over G-50 Sephadex and precipitated with ethanol. Single-stranded DNA is used as the basis for synthesizing the second strand of cDNA using reverse transcriptase. The single-stranded heparin loop at the 3-terminal portion of the first molecular chain of the cDNA is removed by treatment with nuclease 5d. The double-stranded DNA is purified by extraction with phenol, subjected to chromatographic separation by passing over G5.0 Sephadex and precipitated in ethanol. Double-stranded cDNA is provided with a terminal unit, dCMP using dCTP and terminal transferase.
    Plasmid pBR 322 was digested with the Pst I endonuclease and end-linked to dGMP, with the exception that dGTP was used instead of dCTP. 50 ng of the Pst I cleaved plasmid pBR.322 with the dG-terminal part and 20 ng of double-stranded cDNA with the dG-terminal part of the annealing in 50 μl of the reaction mixture.
    Transformation of E. coli X, 1776 with plasmid was carried out as described below. E. coli X 1776 strain becomes permeable dp DNA. As a result of holding in a thermostat of 75 µM CaC, 5 MKMMgCl, 10 µM Tris, pH 7.5 for 20 min at 4 s, the plasmid and bacteria are incubated for 60 min at and then for 2 min at. Transformed colonies are selected for tetracycline resistance. The presence of multiplied DNA is determined by hybridizing colonies of cDNA with a 32P-labeled probe and encoding 1M bulls growth hormone. The DNA plasmid was isolated from the selected colonies, digested with Pst I, subjected to electrophoresis on 1% agarose, treated with ethidium bromide, photographed, and finally transferred to nitrocellulose filters. The presence of growth hormone sequences is determined by hybridization with the full cDIC chain of rat hormone labeled with nick-translation. Get one clone that has been hybridized with a nick-translated DMA and is labeled pBP 348. Introduced
    Q 5 0
    5 o
    five
    0
    five
    0
    five
    the sequence included 8831 base pairs.
    Example 2. PbP 348 plasmid was digested with Pst 1, phosphate at 5-terminal units of DNA fragments was removed by treatment with alkaline phosphatase and replaced with P-labeled phosphate using polynucleotide kinase. Then, plasmid pBP 348 was cleaved with Pst I, Pvu II or Sau-C, labeled, and polynucleotide kinase, and then cleaved with other enzymes to form DNA fragments labeled in a single terminal portion. These fragments are obtained by elution from a polyacrylamide gel and establish the sequence.
    The amino acid positions are numbered starting from the amino acid with the amine end of the growth hormone bulls towards the carboxyl end and towards the first AU.G codon, which is supposed to be the translation start point. This sequence encodes the synthesis. growth hormone, which includes posttreatment treatment. Translating growth hormone mRNA leads to a growth hormone precursor comprising a signal peptide.
    Example 3 (A) Carry out the procedure in the same manner as described in Example 1 using the pBR 315 plasmid instead of the pBR 322 plasmid. All conditions, including the selection of recombinant clones, are described previously.
    The sequence introduced is removed and analyzed as in Example 2, resulting in a DNA containing approximately 831. p.
    (B) Carry out the procedure in the same manner as described in Example 1, using the plasmid pBR 316 instead of the plasmid pBR 322-. All conditions are identical to those described in example 1-.
    Example 4. In this example, the cDNA encoding the progenitor of the growth hormone bulls is prepared according to example 1.
    (A) Hind III linkers, having the sequence 5 -CCAAGCTTGG-3, are linked to the cDNA prepared in Example 1 by binding the cut ends using T4 DNA ligase. After bonding, the product is digested with Hind III or Hsu I. Plasmid pBR 322 is digested
    Hind III or Hsu I and treated with alkaline phosphatase. After precipitation from ethanol, the phosphatase-treated digested pBR 322 is linked to cDNA containing the Hind III linker. E. coli X 1776 is transformed with recombinant plasmid and selected for tetracycline sensitivity. A colony is obtained comprising the inserted sequence, which hybridizes with nick-translated DNA. The inserted sequence is removed by cleavage with Hind III or Hsu I and analyzed as described in Example 2. The introduced molecule contained approximately 830 base pairs, (c) Carry out the procedure as in Example 4, which used several vectors instead of pBR 322, but instead pBR 322 plasmids use plasmids pSC lOlj pMB9, pBR 315 and pBR 316. All conditions, including the selection of recombinant clones, are similar to those described. Identical results are obtained for all plasmids, i.e. in each case, a recombinant plasmid containing cDNA encoding bovine growth hormone is obtained.
    (C) Carry out the procedure in the same manner as described in Example 4 (A), but use several other restriction endonuclease and restriction endonuclease sites. In this example, Sal I and Wat H I linkers are used instead of Hind III linkers. Linker sequences are 5 -GGTCCACC-3 and 3 -CCGGATCCGG-s. When using Sal I linkers, cDNA and pBR 322 are cleaved with the Sal I endonuclease, and when using Wat H I linkers, the restriction endonuclease is Wat HI. All conditions, including the selection of recombinant clones, are described in Example 4 (A-).
    (D) Carry out the procedure analogously to Example 4 (C), in which the plasmids pSC 101, pMB9, pBR 313, pBR 315 and pBR 316 are used instead of the plasmid pBR 322; All conditions are the same as in Example 4 (C) and identical results are obtained.
    (E) Carry out the procedure analogously to example 4 (A) using an Eco RI linker having the sequence 5 -CCGAATT6G-3, instead of the linker-Hind III and using the Endo nucleus Eco RI instead of Hind III
    (Hsu I). Transformation of the colony is not selected for tetracycline sensitivity.
    (F) Carry out the procedure analogously to Example 4 (E), but using the plasmids pSC 101, pMB 9, pBR 313 and pBR 315 instead of pBR 322. Use the same conditions as described in
    10 of example 4 (E), and identical results are obtained for each plasmid.
    (G) Carry out the procedure analogously to Example 4 (A) using the Pst I linker, having the sequence 5 -GCTGCAGC-3, and using the Pst I endonuclease instead of the Hind III site and instead of Hind III (Hsu I), respectively. Identical conditions are used with the difference
    Q. That selection of recombinant clones is carried out as described in Example 1. A recombinant clone is obtained.
    (H) Carry out the procedure as in Example 4 (G), but use
    5 plasmids pBR 315 and instead of plasma plasmids pBR 322. Use the same conditions as described in example 4 (G) and get identical results. Q) Carry out the procedures as follows.
    0 in the same manner as described in examples 1 3 (A), 3 (B) and 4 (A) - (I), using E. coli RRJ or E. coli HB 101 instead of E. cali X 1776. All conditions and results are identical to those described.
    j Example In this example, cDNAs are obtained that encode i the precursor of the growth hormone of bulls, as described in winner 1. The Eco RI linkers are linked to cDNA and
    Q is chopped with Eco RJ.
    (A) Charon 16A is used as a vector. Cohesively bonded end parts are treated by pressing for 60 minutes at 42 ° C in 0.1 M
    g Tris-HC1, pH 8.0 and 10 mM MgClj. The vector is cleaved at the site; ECO RI with the Eco-RJ endonuclease and then treated with alkaline phosphatase. After precipitation from ethanol into the phosphatase treated vector CEE, the RI site is introduced with cDNA at a molar ratio of 2 moles of vector to I mole.
    0
    +
    This mixture is crosslinked with phage T ligase. The resulting mixture is transformed into a suspension of E. coli X 1776 cells prepared for transformation as described in Example 1. Recombinant phages are recovered and applied to .Lac bacteria in cups containing 5-chloro-4-bromo-3 -indolip- () -B-glucozid (X6), for the production of colorless negative colonies, recombinant phages are selected (80 µg / ml) containing
    cDNA in E. coRJ site of vector 16A. The isolated recombinant is isolated and treated with an excess of Eco RJ endonucleases and the treatment product is analyzed as described in Example 2. Long-chain DNA containing approximately 830 base pairs is extracted. The resulting phages are packaged in vitro.
    (B) Charon ZA phage DNA or 4A is used as a vector instead of Charon 16A DNA. All conditions were identical to those described for Charon 16A DNA. Selection of recombinant phages is carried out by applying phage to Lac bacteria in plates containing Hb and isolating colorless negative colonies, followed by either hybridization with an appropriate sample or treatment with endonuclease. This inserted sequence is removed as previously described, resulting in a long chain DNA of approximately 830 base pairs.
    (C) DNA of phage gt WE8 LV is used as a vector instead of Charon 16A. All conditions are identical to those described for Charon 16A. The selection of recombinant phages is carried out according to the method of hybridization.
    The introduced fragment is removed as previously described, resulting in a DNA of approximately 830 base pairs (chain length).
    (D) Carry out the procedure in the same manner as described in the examples.
    5 (A) - (C), in which E. coli RPJ, E. coli IV 101, E. coli DP 50 or E. coli DPS if F were used instead of E. coli, X 1776, All conditions are identical and get identical results.
    Example 6. For the implementation of this example, cDNA is obtained encoding a growth harmonic precursor as described in example 1. Hind III linkers and cDNA are injected using Hind III or Hsu I as described in Example 4 (A).
    Pusmid pC 194, isolated from S. aureus, is used as a vector, pC 194 is cleaved in the Hind Hi zone with Hind III or Hsu I and then subjected to treatment with alkaline phosphatase.
    The obtained cDNA is combined with cleaved pC-194, B is transformed, subtil is RuB, and the cell suspension is applied directly to L plates containing 3 µg of chlorofenicol. The selected recombinant is isolated and treated with Hind III, and the cleavage product is analyzed as described in Example 2. The DNA is extracted with a chain length of approximately 830 base pairs.
    Example 7, (A) Plasmid pBR 348 is treated with the Hae II endonuclease to form a fragment comprising 1600 bp. However, the Nae II zone is within the introduced cDNA, encoded by a growth hormone precursor, and the second zone is within the fragment of the plasmid pBR322. As a result of cleavage receive
     , ... 3 - W -GCGGAA5
    Bovine GH (growth hormone) starts with either 4-1 ala or s - + 2 phe of the residual unit in the terminal position NHj ,. Removing the don ala. carried out by incubation in a DNA thermostat along with dATP and a fragment of Klenow DNA Polymerase I. As a result of this reaction, a receive.
    5 TTC.,., 3
    W - AAG5.
    DNA is extracted with phenol and precipitated. Excess dATP and digested bases are removed by chromatography on a G50 Sephadex. The remaining 5 link is removed by nuclease S .. As a result of this cleavage,
    5- ТТС,. ,, 3
    s - AAG- .... 5
    (B) Carry out the procedure in the same manner as described in Example 7 (A), in which the deoxynucleotide sequence encoding the bovine growth hormone precursor is removed by processing recombinant DNA obtained in Examples 3, 4, 5, and 6 with the Hae II endonuclease .
    The vectors and endonucleases used are shown in the table.
    After treatment with a restriction enzyme, the sequence of the precursor growth hormone bovine is isolated by gel electrophoresis and over 914
    However, it is processed as described in Example 7 (A), and identical results are obtained.
    (C) Carry out the procedures in the same manner as described in examples 7 (A) and 7 (B), using polymerase or 3-5 exonuclease instead of Kpenova DNA polymerase I fragment.
    All other conditions are identical and in each case identical sequences of the growth hormone fragment of bulls are obtained.
    PRI me R 8. (A) a fragment of the growth hormone bulls,
    5 - With TTC .... 3
    h - GCCGAAG z
    is obtained by processing Nae II, as described in Example 7 (A) or 7 (B). Blunting is carried out as follows. DNA is incubated with dATP, dCTP, dCTP, dTTP and Kpenova DNA polymerase I fragment. This reaction results in 5 - GG
    W - GCGGAAG ...,
    DNA is extracted with phenol and precipitated. This sequence is then incubated in a thermostat with a Klenow fragment of DNA polymerase I in the presence of dCTP. This sequence is followed by S | nuclease, resulting in a sequence
    5 - GCC TTSz
    3 - CGG AAG5
    (c) Carry out the procedure in the same manner as described in Example 8 (A), using T4 DNA polymerase or 3-5, i.e. in the presence of dCTP.
    Example 9. A deoxynucleotide sequence encoding a bulls growth hormone is inserted into transfer vectors as described for the bulls growth hormone precursor.
    (A) Carry out the procedures in the same manner as described in Examples 3 (A), 3 (B), 4 (A) - (J), 5 (A) -, () and 6, using DNA prepared similar to examples 7 (A), 7 (B) or 7 (C). All other conditions are identical. The DNAs were digested with the appropriate endonucleases, as shown in the table, and analyzed as described in Example 2. In each case, 9 O
    DNA is obtained with a sequence starting with Phe at position 2.
    (B) Carry out the procedures in the same manner as described in Examples I, 3 (A), 3 (B), 4 (A) - (SG), 5CA) - (D) and 6, using DNA prepared according to Example 8 (A) or 8 (B). All other conditions are identical.
    The DNA is cleaved with the corresponding endo. nuclease (as shown in the table) and analyzed as described in Example 2. In each case, a DNA was obtained having a sequence starting with the Ala codon.
    Example 10. (A) Expression of the precursor growth hormone bovine as a fusion protein is demonstrated by radioimmunoassay and
    mini-pet experiment. In the experiment with radioimmunoassay E. coli X 1776, containing pBR 348, or E. coli, containing pBR 322, as a control, is grown in nutrient
    the broth and extract by centrifugation. The cells are resuspended and lysirutot, and radiolabelled sheep growth hormone and sheep (or bulls) antibody are introduced into the growth hormone.
    The immune complex is precipitated and the radioactivity is measured. The experiment showed that the protein of the fusion retains a certain 1но activity of bulls growth hormone. An example of a more detailed illustration of protein production of the fusion is the microcellular experiment. This experiment shows that pBR 348 forms a fusion protein consisting of 183 amino acids
    | Lactamase, 217 amino acids of bovine growth growth hormone and several binding amino acids, usually encoded, in the non-translated 5 zone. The total molecular weight of about 45,000 corresponds to the predicted molecular weight of the fusion protein.
    (B) Dp direct expression of bovine growth hormone precursor introduced ™ is first separated from pBR 348 by partial cleavage of endonuclease Pst I and purified by preparative gel electrophoresis. 15 μg of purified sample entered
    H is then modified by suspending the DNA in water, into which the salt solution is injected so that the final composition contains: 70 mM Tris, H 8.8; 70 mM MgCl2; U b ditio1
    treitol and 13.75 molecular units of DNA polymerase in a total volume of 250 µl. The reaction mixture was incubated at 37 ° C for several minutes, then dATP was introduced to a concentration of 50 M} J. After additional incubation in the thermostat for 30 min, the enzyme is inactivated by heat treatment at 65 ° C for 5 min. This process is repeated two more times, once using dCTP and dATP, and then again using dTTP. The treated DNA is extracted by ethanol precipitation. Treat with S, nuclease. This process provides for obtaining a DNA molecule terminating at the start codon at position 26. Such molecules translate when inserted into an expression vector, having an input zone corresponding to about 3-11 nucleotides from the sequence of the ribssome linkage.
    The direct expression vector was constructed by modifying the ptrp plasmid EZO by removing 23-29 nucleotides using polymerase and S nucleases, as previously described.
    The modified cDNA and the modified expression vector are provided with a linker having a sequence of 5 -CCGGATCCGG-3 on one strand, and a sequence homologous to it, on the other strand by linking with ligase. These linkers provide the availability of Wat E + sites. The E. coli HB 101, RR5 or X 1776 host bacteria are transformed with recombinant DNA that carries a fragment encoding a growth hormone precursor, and the transformations are selected for ampicillin resistance. A single transformant designated as ptrRESO / bGH is selected for additional analysis.
    Bacterial cells transformed with plasmcal ptr rezo / bGH are grown in standard minimal medium (M9) containing LeU PrO, vitamin B1 and ampicillin at 37 ° C. In the early logarithmic phase, trp operon is induced by introducing y-indolyl acrylic acid (30 μg / ml of medium). Control cultures remained non-induced. After 3 hours of growth, 1.5 ml of the cells are subjected to radioactive labeling by entering 20 1K S-L-Met and incubated in the terrae of the bridge47
    ev l. oh inatn a- and - y-
    rp t, i.
    s 5 g and - l-. from1949J2
    those for 10 min. The cells are recovered by centrifugation, washed and resuspended in 250 µl of a buffer solution containing 10% glycol, 5% p-mercapto ethanol, and 2.3% SDS in 0.0525 M Tris, pH 6.8. The suspension is boiled for 5 minutes, then injected into a 10% SDS gel with polyacrylam 10 and fractionated by electrophoresis. Bands corresponding to the protein zones are visually observed by autoradiography. The results showed the presence of a new protein
    15 bands of approximately 2AOOO daltons, which is absent in uninduced or non-transformed cultures.
    The precursor of growth hormone is cleared by the usual methods,
    including, for example, gel filtration, ion exchange chromatography, adsorption chromatography and methods based on the difference in solvents. Growth Hormone Precursor Turn into growth hormone.
    (C) Linkers with the sequence S -CCGGATCCGGATG-3 on one chain and its sequence homologous
    30 At the other. The chain is connected with a DNA fragment encoding growth hormone, obtained similarly to Examples 7 (A) - (C) and 8 (A) - (B). This modified DNA is then introduced into the ptr vector.
    -g pE 30 as described in Example 10 (B). The host bacterium is transformed and cultured, and the resulting growth hormone bulls are purified as described in Example 10 (B).
    权利要求:
    Claims (2)
    [1]
    1. A method for constructing recombinant plasmid DNA encoding bovine growth hormone, comprising
    45 that polyadenylated bovine pituitary mRNA was purified, poly A mRNA was purified by adsorption chromatography using oligo-ε-cellulose, treated with reverse transcriptag Q and obtained by cDNA, duplicating the obtained single-DNA, using reverse transcriptase, the samples were prepared by reverse transcriptase. The cDNA is sequentially processed with the Hae II endonuclase, the Klenogow fragment, DNA polymerase, and then with the nucleus S (and a cDNA is obtained that encodes a bovine growth hormone from 26 to 191 amino acids with the following nucleotide sequence;
    S-ATGATGCCTCCAGGCCCCCGGACCTCCCTGCTCCT GCTTTCGCCCTGCTCTGCCTGCCGTGGAGTCAGGTG GTGGGCGTTCCC AGGCATGTGGTTGTCCGGGGGG TTTGCGAACGCGGTGTCCGGGTCTGCCGGGTG
    CAGCTGGGTGCTGAGACCTTGAAAGAGTTTGAG CGTAGCTACATCGGGGAGGGAGAGAGATACTGC; ATCCAGAACACCGAGGTTGCCTTCTGCTTCT € C IGAAACCATGCCGGCGGCCACGGGAGAGAATGAG
    GGCCAGCAGAAATGAGACTTGGAGCTGCTTCGC
    ATCTCACTGCTCCTGATCCAGTCGTGGCTTGGG
    GCCCTGCAGTTTCTCAGGAGAGTCTTCACC
    AACAGCTTGGTGTTTGGGAGGTCGGAGCGT
    GTCTATGAGAAGCTGAAGGACCTGGAGGAA
    GGCATGTTGGCCGTGATGGGGGAGCTGGAA
    GATGG CAGC GGGCGGGG TGGG CAGATGCTC
    AAGCAGACCTATGAGAAATTTGACACAAAC
    ATGCGCAGTGACGAGGCGGTGCTCAAG
    AACTACGGTqTGGTGTGGTGCTTCCGG
    AAGGACCTGGATAAGACGGAGACGTAC
    CTGAGGGTGATGAAGTGGCGCGGGTTC
    GGGGAGGGCAGGTGTGGCTTGTAG-З,
    five
    °
    five
    0
    by treatment with endonuclease S, and obtaining cDNA, encoded with a bull growth hormone with the following nucleotide sequence
    5 -GGGTTGGGAGCGATGTGGTTGTGCGGCCTGTTT GGGAAGGGTGTGCTGGGGGCTCAGCACCTGCAG GAGGTGGGTGCTGACAGGTTGAAAGAGTTl GAG CGTACGTAGATGCCGGAGGGACAGAGATAGTCC ATGGAGAAGAGCCAGGTTGCCTTGTGCTTGTGC .. GAAAGCATCCCGGCCGCCACGGGCAAGAATGAG GCCCAGGAGAAATCAGACTTGGAGCTGCTTGGG ATGTCACTGCTGCTGATCGAGTCGTGGCTTGGGCCCGTG CAGTTTCTCAGCAGAGTCTTGACCAACAGGTTG GTGTT GGAGCTGGGACCGTGTCTATGAGAAG, GTGAAGGACCTGGAGGAAGGGATCTTGGCCCTG ATGCGGGAGGTGGAAGATGGGACCCCCCGCGTC GGGGAGATCGTCAAGCAGACGTATGAGAAATTT GAGACAAACATGCGCAGTGACGAGGGCGTG CTCAAGAACTACGGTCTGCTGTCCTGGTTCCGGAAG GAGGTGGATAAGAGGGAGACGTAGGTGAGGGTGATG AAGTGGGGGCGGTTGGGGGAGGGGAGGTGTGGCTTGTAG
    and clone it into the PS t I or EcoRI site of the pBR 322 vector.
    [2]
    2. Gnoco6 no. 1, characterized in that the double-stranded cDNA is cleaved with a Hae II endonuclease and the obtained fragments are incubated in the presence of c1ATP, dGTP, bCTF and dTTP sequentially processed with a fragment of Klenow, phage T. DNA polymerase T.
    I1-T
    or 3 -5 in the presence of eTTP -c
    Enzyme restriction
    Carry Vector (Example)
    0
    Pst I Hind III Sal I Bam HI ECO RI
    FOR, ZB, 4G, 4H
    4A, 4B, 6
    4G, 4D
    4G, 4D
    4E, 4F 5A, 5B, 5G
    类似技术:
    公开号 | 公开日 | 专利标题
    SU1471949A3|1989-04-07|Method of constructing recombinant plasmide dna coding bull growth hormone
    CA1340522C|1999-05-04|Fusion proteins containing neighbouring histidines for improved purification
    Bedouelle et al.1980|Mutations which alter the function of the signal sequence of the maltose binding protein of Escherichia coli
    SU1764515A3|1992-09-23|Method of leukocyte interferon preparation
    US5643758A|1997-07-01|Production and purification of a protein fused to a binding protein
    EP0131868B1|1987-05-06| human urogastrone, corresponding gene, corresponding recombinant plasmid, transformed cell and process for production thereof
    Tam et al.1989|The F plasmid ccd autorepressor is a complex of CcdA and CcdB proteins
    Filutowicz et al.1985|Autorepressor properties of the π-initiation protein encoded by plasmid R6K
    Franklin et al.1979|The N protein of bacteriophage lambda, defined by its DNA sequence, is highly basic
    JPH0648987B2|1994-06-29|Method for producing peptide by expression of partially synthetic gene
    EP0316018A2|1989-05-17|Modification of DNA sequences
    Baty et al.1987|Extracellular release of colicin A is non‐specific.
    JP2000060577A|2000-02-29|Mature human interleukin-1 protein
    US5087564A|1992-02-11|Release of recombinant peptides from polypeptides using V8 endopeptidase
    EP0095350A2|1983-11-30|A method of producing human gamma-interferon-like polipeptide
    AU595805B2|1990-04-12|Releasing desired peptides from fusion polypeptides using endopeptidases
    Zhang et al.1988|Escherichia coli RNase D: sequencing of the rnd structural gene and purification of the overexpressed protein
    US4675297A|1987-06-23|Genes encoding bovine prolactin
    EP0046669B1|1984-10-24|Somatostatin or somatostatin precursors
    IE53607B1|1988-12-21|Expression vectors
    US6194200B1|2001-02-27|Expression systems for preparation of polypeptides in prokaryotic cells
    EP0153961B1|1992-08-19|Recombinant materials and methods for producing human connective tissue-activating peptide-iii and analogs thereof
    US6692941B1|2004-02-17|Bovine growth hormone
    EP0113372A1|1984-07-18|Vector
    EP0314184B1|1995-12-13|Expression plasmids
    同族专利:
    公开号 | 公开日
    YU206281A|1984-08-31|
    PH22847A|1989-01-19|
    GR74350B|1984-06-26|
    PH21216A|1987-08-21|
    ES504968A0|1984-05-16|
    DD204711A5|1983-12-07|
    EP0047600A2|1982-03-17|
    CA1225948A|1987-08-25|
    IL63628A|1991-06-10|
    ES8305828A1|1983-04-16|
    DK372881A|1982-02-27|
    EP0047600B1|1992-02-26|
    HU195535B|1988-05-30|
    KR830007822A|1983-11-07|
    YU44962B|1991-06-30|
    CZ280596B6|1996-03-13|
    ES8405072A1|1984-05-16|
    IE52755B1|1988-02-17|
    DE3177273D1|1992-04-02|
    IL63628D0|1981-11-30|
    DD212403A5|1984-08-15|
    JP2534221B2|1996-09-11|
    PT73569B|1982-11-09|
    PL232797A1|1983-07-18|
    CZ636081A3|1995-02-15|
    JPS57171999A|1982-10-22|
    EP0047600A3|1982-10-20|
    AT72833T|1992-03-15|
    PT73569A|1981-09-01|
    IE811822L|1982-02-26|
    ES514526A0|1983-04-16|
    DD211581A5|1984-07-18|
    DD212267A5|1984-08-08|
    FI812614L|1982-02-27|
    AU7449681A|1982-03-04|
    ZA815696B|1982-08-25|
    JP2763024B2|1998-06-11|
    RO105533B1|1995-10-01|
    AU544453B2|1985-05-30|
    NZ198050A|1984-12-14|
    JPH09135691A|1997-05-27|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    GB2007676B|1977-11-08|1982-09-08|Genentech Inc|Method and means for microbial polypeptide expression|
    GR71912B|1978-08-11|1983-08-16|Univ California|
    ZA802992B|1979-06-01|1981-10-28|Univ California|Human pre-growth hormone|
    IL59690A|1980-03-24|1983-11-30|Yeda Res & Dev|Production of bovine growth hormone by microorganisms and modified microorganisms adapted to produce it|US4443539A|1980-02-05|1984-04-17|The Upjohn Company|Process for preparing bovine growth hormone|
    JPS58996A|1981-06-01|1983-01-06|Torasuteiizu Mishigan Suteeto|Method of cloning ox growth hormone gene in germ|
    AT83799T|1981-09-18|1993-01-15|Genentech Inc|METHODS AND PRODUCTS FOR THE LIGHT MICROBIOLOGICAL EXPRESSION OF DNA SEQUENCES.|
    US5489529A|1984-07-19|1996-02-06|De Boer; Herman A.|DNA for expression of bovine growth hormone|
    US5254463A|1981-09-18|1993-10-19|Genentech, Inc.|Method for expression of bovine growth hormone|
    NZ201918A|1981-09-18|1987-04-30|Genentech Inc|N-terminal methionyl analogues of bovine growth hormone|
    DE3380262D1|1982-05-25|1989-08-31|Lilly Co Eli|Cloning vectors for expression of exogenous protein|
    CA1224432A|1982-08-17|1987-07-21|Gary N. Buell|Dna sequences, recombinant dna molecules andprocesses for producing bovine growth hormone-likepolypeptides in high yield|
    JPS59501852A|1982-09-16|1984-11-08|
    CA1341012C|1982-09-27|2000-06-06|Biogen, Inc.|Dna sequences, recombinant dna molecules and processes for producing swine growth hormone-like polypeptides|
    ZA837173B|1982-11-08|1984-05-30|Univ Case Western Reserve|Genomic bovine growth hormone|
    AU2092983A|1982-11-08|1984-05-17|Genentech Inc.|Porcine growth hormone produced by recombinant dna technology|
    EP0111814A3|1982-12-16|1985-08-14|Mgi Pharma, Inc.|The cloning and expression of nucleotide sequences encoding bovine growth hormone|
    DE3247922A1|1982-12-24|1984-06-28|Boehringer Ingelheim International GmbH, 6507 Ingelheim|DNA SEQUENCES, THEIR PRODUCTION, PLASMIDES CONTAINING THESE SEQUENCES AND THE USE THEREOF FOR THE SYNTHESIS OF EUKARYOTIC GENE PRODUCTS IN PROKARYOTS|
    AU2704084A|1983-04-19|1984-10-25|Genex Corp.|Cloned ovine growth hormone genes|
    US4859600A|1983-04-25|1989-08-22|Genentech, Inc.|Recombinant procaryotic cell containing correctly processed human growth hormone|
    US4755465A|1983-04-25|1988-07-05|Genentech, Inc.|Secretion of correctly processed human growth hormone in E. coli and Pseudomonas|
    US5198361A|1983-07-15|1993-03-30|Bio-Technology General Corp.|Plasmids for production of met-asp-gln bovine growth hormone, hosts containing the plasmids, products manufactured thereby and related methods|
    BG49718A3|1983-07-15|1992-01-15|Bio Technology General Corp|Method for preparing of polypeptid with superoxiddismutasne activitty|
    US4521409A|1983-10-03|1985-06-04|Cornell Research Foundation, Inc.|Use of growth hormone to enhance ruminant mammary development|
    US4935370A|1983-12-23|1990-06-19|Pfizer Inc.|Expression plasmids for improved production of heterologous protein in bacteria|
    EP0147178B1|1983-12-23|1991-08-14|Pfizer Inc.|Expression plasmids for improved productionof heterologous protein in bacteria|
    US5037806A|1985-02-22|1991-08-06|Monsanto Company|Biologically active method using somatotropins|
    US4861868A|1985-02-22|1989-08-29|Monsanto Company|Production of proteins in procaryotes|
    DE3685424D1|1985-06-26|1992-06-25|Upjohn Co|SOLUBILIZATION AND OXIDATION OF SOMATOTROPIN FROM TRANSFORMED MICROORGANISMS.|
    US4786501A|1985-07-15|1988-11-22|International Minerals & Chemical Corp.|Cylindrical implants for the controlled release of growth hormones|
    US5631227A|1985-09-18|1997-05-20|The Upjohn Company|Somatotropin analogs|
    EP0236452B1|1985-09-18|1990-10-31|The Upjohn Company|Enhanced bioactivity of mammalian somatotropin through selective deamidation|
    EP0263206B1|1986-10-08|1990-12-12|The Upjohn Company|Enhanced bioactivity of mammalian somatotropin through selective deamidation|
    US5013653A|1987-03-20|1991-05-07|Creative Biomolecules, Inc.|Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage|
    US5215896A|1987-03-20|1993-06-01|Creative Biomolecules, Inc.|Leader sequences for the production of recombinant proteins|
    US5268284A|1988-03-11|1993-12-07|The Upjohn Company|Ribosome binding site|
    JP2787729B2|1990-08-02|1998-08-20|株式会社ニッポンジーン|Recombinant mink growth hormone gene, recombinant mink pre growth hormone gene, mink growth hormone or mink pre growth hormone transforming plasmid, and mink growth hormone or mink pre growth hormone transformed Escherichia coli|
    WO2002051238A2|2000-12-26|2002-07-04|Monsanto Technology Llc|Recombinant dna vectors for expression of somatotropins|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    US18134880A| true| 1980-08-26|1980-08-26|
    [返回顶部]