• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention, entitled method for the determination of prognosis in subjects diagnosed with pulmonary arterial hypertension, is related to a method of analysis of the prognosis in subjects diagnosed with pulmonary arterial hypertension, as well as a method to select a personalized therapy for the subjects affected by this. disease, carriers of mutations in the main genes involved in the pathology. After the genetic characterization of the patients, through in vitro functional studies of the genetic variants identified, it will be possible to know the clinical progression of the patients according to their genotype, knowing that these pathogenic changes produce a worse prognosis. Finally, the present invention relates to a method for selecting a subject diagnosed with pulmonary arterial hypertension for a personalized therapy based on the combination of the data obtained after the diagnosis and its gene pool. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2683921A1
    申请号:ES201700285
    申请日:2017-03-28
    公开日:2018-09-28
    发明作者:Guillermo POUSADA FERNANDEZ；Adolfo BALOIRA VILLAR；Diana VALVERDE PEREZ
    申请人:Universidade de Vigo；
    IPC主号:
    专利说明:

     5 DESCRIPTION METHOD FOR THE DETERMINATION OF THE FORECAST IN DIAGNOSED SUBJECTS WITH PULMONARY ARTERIAL HYPERTENSION SECTOR OF THE TECHNIQUE The present invention relates to a method that allows the prediction of the prognosis in subjects diagnosed with Hypertension with a pulmonary method, to select and also to select a personalized therapy for the subjects affected by this disease, carriers of mutations in the BMPR2, ACVRL 1 and ENG genes, involved in the pathology.  15 BACKGROUND OF THE INVENTION Pulmonary Arterial Hypertension is a rare disease and is defined as an abnormally high pressure in the pulmonary arteries with normal postcapillary pressure.  This increase in pressure is due to the narrowing or plugging suffered in the small arteries and pulmonary capillaries creating an increase in resistance to blood flow that flows through them.  The progressive increase in pulmonary vascular resistance (RVP) that is created can lead to failure of the right heart ventricle and even premature death.  25 The normal mean pulmonary artery pressure is approximately 14 mmHg at rest.  However, in patients with PAH, the mean arterial blood pressure in the pulmonary artery is equal to greater than 25 mmHg at rest.  It is known that an increase in resistance causes an increase in the tension of the right ventricle, having to do more work in each beat to be able to move the blood to the lungs.  This causes over time a right heart failure when ventricular hypertrophy leads to dilatation and retrograde increase in systemic venous pressure.  Although there are more and more therapeutic options against Pulmonary Arterial Hypertension, the prognosis remains poor.  35 2Only 6% of patients with Pulmonary Arterial Hypertension report family history according to data from the National Institute of Health.  This is possibly due to the fact that familial pulmonary arterial hypertension is inherited as an autosomal dominant disease with incomplete penetrance.  Therefore, a family history 5 of Pulmonary Arterial Hypertension may go unnoticed in cases of idiopathic Pulmonary Arterial Hypertension as a result of this incomplete penetrance or due to the appearance of de novo mutations.  There are several types of pulmonary hypertension that are classified into 5 groups: PAH 10 which in turn can be idiopathic, hereditary (associated with the type 11 receptor of bone morphogenetic proteins (bone morphogenetic protein receptor type 11 gene, BMPR2) with autosomal transmission dominant with incomplete penetrance and to a lesser extent to Activin Kinase Type I (activin-like kinase-type 1, ALK-1), Endogline or unknown genes), or associated (exposure to drugs or other 15 diseases); in relation to diseases of the left heart; associated with lung diseases or chronic hypoxia; chronic thromboembolic pulmonary hypertension; multifactorial pulmonary hypertension.  Hereditary PAH and idiopathic PAH have a similar clinical course, although the former has a more early age of onset and somewhat more severe hemodynamic deterioration, although both have a similar survival.  To date, about five hundred mutations have been described that affect the genes involved in Pulmonary Arterial Hypertension, using different molecular methodologies.  In approximately 70% of patients with family involvement, some mutation has been detected in the BMPR2 gene, however, in patients without a family history of the pathology, the percentage of detection varies between different jobs from 10% to 40% .  For ACVRL 1 and ENG genes the percentage of mutations found is lower.  30 Of all the changes detected in these genes, most of them are located in the coding region.  These nucleotide changes can affect the amino acid sequence (missense), produce a stop codon (nonsense) or be silent.  These changes can produce variations in the structure or expression of the protein.  Also, another part of the changes are located in the promoter region of these genes.  These changes do not affect the amino acid sequence directly 3but yes to the structure or expression of the protein since they could modify binding sites to gene transcription factors, preventing their binding.  To date, with respect to Pulmonary Arterial Hypertension there have been no 5 functional studies for the mutations found in the coding region of genes and perhaps these changes have a significant implication in the pathogenesis.  These analyzes allow for a genotype / phenotype correlation, opening a wide range of possibilities.  These changes produce a more severe phenotype in patients.  10 15 The evolution of these patients is very variable and depends on the factors of the disease, the environment and the genetic load of the individual.  In this way, knowing these data, a personalized treatment can be administered to each patient.  Although the influence of certain markers on the evolution of patients with Pulmonary Arterial Hypertension is known, there is no analysis algorithm that allows a specific weight to be given to each genetic marker in determining disease progression.  In addition, since the genetic load 20 has an important implication in the pathology, there is no mechanism to evaluate the clinical and genetic conditions of a patient with respect to the administered treatment.  EXPLANATION OF THE INVENTION The authors of the present invention have developed a method for determining the prognosis of a patient with Pulmonary Arterial Hypertension.  This method is based on the combination of particular genetic profiles associated with the development of PAH.  30 These genetic profiles are determined from the results obtained from the mutational analysis of certain genes associated with the development of the disease and whose main objective is its use in the evaluation of the prognosis of patients with PAH and to select a personalized therapy for the subjects. affected by this disease.  35 4one.  First method of the invention: In a first aspect, the present invention relates to an in vitro method for determining the prognosis in subjects diagnosed with Pulmonary Arterial Hypertension 5 which comprises the determination of the pathogenic mutations of the BMPR2, ACVRLt and ENG genes, where an increase in these mutations is indicative of a severe prognosis of Pulmonary Arterial Hypertension.  Therefore, in one aspect, the invention relates to an in vitro method for predicting whether a subject diagnosed with Pulmonary Arterial Hypertension will have a milder or more severe phenotype, and therefore a better or worse prognosis, which comprises : 15 20 i) ii) determine the genetic profile of patients diagnosed with Pulmonary Arterial Hypertension, sequencing the BMPR2, ACVRL 1 and ENG genes associated with the disease, and obtain the corresponding genetic profile of a biological sample of a subject with hypertension pulmonary arterial; In vitro analysis of the genetic profile by luciferase and hybrid minigenes assays, in order to identify pathogenic mutations of the genetic variants identified in the BMPR2, ACVRL 1 and ENG genes determined in step (i).  The term "subject", as used in the present description, refers to human beings, female or male, and of any race or age.  Throughout the present description, the terms "subject" and "patient" are used interchangeably.  The term "milder phenotype" or "more severe phenotype", as used in the present invention, as well as the term "severe prognosis", refers to the evolution of the disease.  Patients with a "more severe phenotype or a severe prognosis" 30 will develop the symptoms of the disease before patients with a "milder phenotype".  Likewise, a patient of Pulmonary Arterial Hypertension is considered a patient with a severe prognosis of Pulmonary Arterial Hypertension when he has an early diagnostic age, higher values for systolic pulmonary arterial pressure, for mean pulmonary arterial pressure and for vascular resistance. pulmonary, has lower values for the cardiac index, does not decrease 5At least one functional class, after diagnosis, with the administration of the treatment and does not respond correctly to the treatment administered.  The term "disease", as used in the present invention, refers to the condition of a subject having been diagnosed with Pulmonary Arterial Hypertension.  one. one.  Determination of the genetic profile: Step (i) of the first method of the invention consists in determining the genetic profile 10 of the main genes related to the disease of a subject diagnosed with Pulmonary Arterial Hypertension and obtaining the corresponding genetic profile.  The term "gene variant", as used herein, includes mutations, polymorphisms and allelic variants.  A gene variant is found among individuals within populations and among populations within species.  In a particular embodiment, the gene variants used in the present invention are human gene variants associated with the evolution of Pulmonary Arterial Hypertension present in one or more genes in a sample of a subject diagnosed with Pulmonary Arterial Hypertension.  The human gene variants associated with the evolution of patients with Pulmonary Arterial Hypertension that have been related to the faster progression of the disease are found in the BMPR2, ACVRL 1 and ENG genes.  25 The TGF-13 family (transforming growth factor beta) belongs to a superfamily of growth factors that includes three isoforms for TGF-13 (TGF-131, TGF-132, TGF-133) and other varied factors, such as morphogenic protein Bone (BMP), activins, inhibins and the antimullerian hormone.  They are involved in cellular processes such as hematopoiesis, cell proliferation, angiogenesis, differentiation, migration and cell apoptosis, so it is essential during embryogenesis and development.  The main genes related to the pathology belong to the TGF-13 family, 35 whose functions are detailed below: 6BMPR2 (Bone morphogenetíc receptor protein type 11 gene): When there is a modification in the BMPR2 gene, the patient is predisposed to vasoconstriction and vascular remodeling.  A mutation in the BMPR2 gene is considered the first event to trigger Pulmonary Arterial Hypertension; however, mutations in this gene are not entirely penetrating and therefore require a second event, originating from the activation of genetic modifiers and / or environmental mediation, so that vascular remodeling can occur, with the consequent development of the typical pathological lesions 10 in the pathology.  ACVRL 1 (Actívín-like kinase-type 1): It belongs to the TGF-j3 superfamily group and shows a highly restricted expression pattern to endothelial cells and highly vascularized tissues, such as placenta and lung.  It is a homodimeric transmembrane protein of the cell surface and, at first, was called TSR-I.  ENG (Endoglin): Presents a high level of expression in the proliferation of vascular endothelial cells where angiogenesis is active, during embryogenesis, in inflammatory processes, in vascular lesions and in tumor vessels.  It has been identified as an accessory receptor for TGF-j3 type 111 (Tj3R-III) that only binds ligands when associated with Tj3R-11.  It has been observed that endoglin is necessary for TGF-j3 / ALK1 signaling.  In addition, in the absence of endoglin, the endothelial cells do not grow and ALK1 signaling is suppressed while the ALK5 pathway is stimulated.  In contrast, endogline overexpression downregulates TGF-j3 / ALK5 signaling by inhibiting the transcriptional activity of Smad3.  Endoglin could thus serve as a regulator of EC growth mediated by TGF-j3 by stimulating the signaling of TGF-j3 / ALK1 and indirectly inhibiting TGF-30 j3 / ALK5, promoting the activation phase of angiogenesis.  In order to determine the genetic profile of the subjects, in the main genes related to Pulmonary Arterial Hypertension, by means of the method of the invention, in a first stage the nucleic acid is extracted from a biological sample of the subject to be analyzed. .  7The extraction of nucleic acid (DNA) from a biological sample from a subject can be carried out by conventional methods using commercial products useful for extracting said DNA.  Virtually any biological sample containing DNA can be used to practice the invention; by way of illustration, not limitation, said biological sample may be a biopsy sample, tissues, cells or fluids, for example blood, saliva, plasma, serum, secretions, milk, etc.  In a particular embodiment, said biological sample is blood.  It is a preferred embodiment, said biological sample is a peripheral blood sample.  Once the DNA is obtained, those regions of said DNA containing the gene variants to be identified are amplified.  As previously mentioned, the thermal "gene variant", as used in this description, includes polymorphisms (e. g. , 15 SNPs), mutations and allelic variants.  To amplify the regions of DNA that contain the gene variations to be identified, specific oligonucleotide primers are used that amplify the genome fragments that may contain said gene variants.  Such specific oligonucleotide primers are described in detail below.  Thus, the DNA regions that contain the gene variants to be identified (target DNA regions) are subjected to an amplification reaction to obtain the amplification products that contain the gene variants to be identified.  Although any technique or method that allows the amplification of all 25 DNA sequences containing the gene variants to be identified can be performed, in a particular embodiment, said sequences are amplified by a polymerase chain amplification reaction (PCR).  For the determination by PCR of the gene variants of the method of the invention, the use of a pair of specific priming oligonucleotides or primers capable of amplifying said target DNA regions containing the gene variants to be identified as explained above is required.  Virtually any pair of oligonucleotide primers that allow specific amplification of said target DNA regions can be used, preferably 35 pairs of oligonucleotide primers that allow said amplification at number 8Possible amplification reactions.  Thus, using the pairs of specific oligonucleotide primers and the appropriate conditions, all the target DNA regions necessary for the determination of the genetic profile for said gene variants to be analyzed can be amplified with the minimum possible number of 5 reactions.  It is a particular embodiment, said oligonucleotide primers are selected from the oligonucleotide primers identified in Table 1.  Gene Registered Primer Sequence (5'73 ') n Exon BMPR2_1AF CCAGTCAAGGAAGAGGTTTGT (Sec ID No 1) BMPR2 1A BMPR2_1AR AGCAGGATGGTCCATGGTAG (Sec ID No 2) Exon BMPR2_1BF ATGAAAGCTCTGCAGCTAGCBRGG2GG (BGG) PGRBGG (BMG) exon 2 BMPR2_2F TGAAGTCATTCGGATAAGACAAAG (Seq ID No 5) BMPR2_2R TTATTACCCAGGCTGGTCTCA (Seq ID No 6) BMPR2 exon 3 BMPR2_3F CCCCATGAAATGTCTTTGGTA (Seq ID No 7) BMPR2_3R TGCAAATCTTTGGAGAAAGGA (Seq ID No 8) BMPR2 exon 4 BMPR2_ 4F CATTTCCTTTGATGCAAAAACA (Seq ID No 9) BMPR2_4R AATAATCCAGTGGCATGGAAA (Seq ID No 10) BMPR2 Exon 5 BMPR2_5F GTCTCCCAGAATTTGGCTTTC (Seq ID No 11) BMPR2_5R TGCCTAGAATAGGCCTTGACA (Seq ID No 12) BMPR2 Exon 6 BMPR2_6F GGTAGGAGCTTCATCAGCCATA (Seq ID No 13) BMPR2_6R TACAGGCATAAGCCACCACA (Seq ID No 14) BMPR2 Exon 7 BMPR2_7F CATGGAATCCTAGCCTATTTGC (Sec ID No 15) BMPR2_7R AGCCCAGGAGTTTTACTCAGC (Sec ID No 16) BMPR2 Exon 8 BMPR2_8F ATCTGAAGTGGCAGCATGTTT (Sec ID No 17) BMPR2_8R CACCTGGCCAGTAGATGTTTT (Sec ID No 18) BMPR2 Exon 9 BMPR2_9F TTCAGGAAGGGCATTTTATAGG (Seq ID No 19) BMPR2_9R TGCATCCTGCTGCTAATAATGT (Seq ID No 20) Exon BMPR2_10F GCCTGAAGGGGATGAAAAA (Seq ID No 21) BMPR2 10 BMPR2_10R GTTTGATTTGTGGCATTAGGC (Seq ID No 22) Exon BMPR2_11F TTTGAGCATGTTCCGTAATCC (Seq ID No 23) BMPR2 11 BMPR2_11R TTCTTTGTTGGGTCTCAGTTTC (Sec ID No 24) Exon BMPR2_12AF TCAGAGGTGTTAAATTTGGAGAGA (Sec ID No 25) BMPR2 12A BMPR2_12AR GGTCTAGCTTGTTGGTTTCCA (Sec ID No 26) Exon BMPR2_12BF ACCACAAATGTTGCACAGTCA 12GPGRG 12GPGRG (Sec IDB12G)Ex6n BMPR2_12CF GCAGCAAGCACAAATCAAACT (Seq ID No 29) BMPR2 12C BMPR2_12CR GAATTAGGCCTCTGTGCTCTTC (Seq ID No 30) Ex6n BMPR2_12DF CACAGTGTTAACTCCCATGCT (Seq ID No 31) BMPR2 12D BMPR2_12DR AGGTGTGAGCCACTGTGC (Seq ID No 32) Ex6n BMPR2_13F TCCTGAGACA TTGGTTTGACC (Seq ID No 33) BMPR2 13 BMPR2_13R TCTATTTAAAGCAAGTCTTTGTTGC (Seq ID No 34) ACVRL1 Ex6n 1 ACVRL1_1F CCCGGGAGGCTGCCGCGCCAGC (Seq ID No 35) ACVRL1_1R GTGGCGGGCGGCCTGACCCCCG (Seq ID No 36) ACVRL1 Ex6n 2 ACVRL 1_2F CTCTGTGATTTCCTCTGGGCA (Seq ID No 37) ACVRL1_2R TACATTCTCCCCAGCTTCTCAA (Seq ID No 38) ACVRL1 Ex6n 3 ACVRL1_3F AGCTGGGACCACAGTGGCTGA (Seq ID No 39) ACVRL 1_3R GGAGGGCAGGGGCCAAGAAGAT (Seq ID No 40) ACVRL1 Ex6n 4 ACVRL1_4F AGCTGACCTAGTGGAAGCTGA (Seq ID No 41) ACVRL 1_ 4R CTGATTCTGCAGTTCCTATCTG (Seq ID No 42) ACVRL1 Ex6n 5 ACVRL1_5F AGGAGCTTGCAGTGACCCAGCA (Seq ID No 43) ACVRL1_5R ATGAGAGCCCTTGGTCCTCATCCA (Sec ID No 44) ACVRL1 Ex6n 6 ACVRL 1_6F AGGCAGCGCAGCATCAAGAT (Sec ID No 45) ACVRL1_6R AAACTTGAGCCCTGAGTGCAG (Sec ID No 46) ACVRL1 Ex6n 7 ACVRL 1_7F TGACGACTCCAGCCTCCCTTAG (Seq ID No 47) ACVRL 1_7R CAAGCTCCGCCCACCTGTGAA (Seq ID No 48) ACVRL1 Ex6n 8 ACVRL1_8F AGGTTTGGGAGAGGGGCAGGAGT (Seq ID No 49) ACVRL 1_8R GGCTCCACAGGCTGA TTCCCCTT (Seq ID No 50) ACVRL1 Ex6n 9 ACVRL1_9F TCCTCTGGGTGGTATTGGGCCTC (Seq ID No 51) ACVRL 1_9R CAGAAATCCCAGCCATGAGCCAC (Sec ID No 52) Ex6n ACVRL 1_10F TCTCCTCTGCACCTCTCTCCCAA (Sec ID No 53) ACVRL1 10 ACVRL1_10R CTGCAGGCAGAAAGGAATCAGGTGC (Sec ID No 54) ENG IDG ENG Ex6n 2 ENG_2F CACCTTATTCTCACCTGGCCTCTT (Seq ID No 57) ENG_2R CTGCCTTGGAGCTTCCTCTGAG (Seq ID No 58) ENG Ex6n 3 ENG_3F GGGTGGCACAACCTATACAAAT (Seq ID No 59) ENG_3R CAGAGATGGACAGTAGGGACCT (Seq ID No 60) ENG Ex6n 4 ENG_4F CTACATGGGATAGAGAGGGCAC (Seq ID No 61) ENG_4R TTCCTCCTGAGCAGTATCATGAG (Sec ID No 62) ENG Ex6n 5 ENG_5F TGAGGGAAGGGACTGAGGTG (Sec ID No 63) ENG_5R GTGGGGACTAGTGTCAGGGGC (Sec ID No 64) ENG Exon 6 ENG_6F GGCCTGTCCTTG ID No. 65) 10ENG_6R GTTTTGTGTCCCGGGAGCTG (Sec ID No 66) ENG Exon 7 ENG_7F CCCCCTGTTCTGCCTCTCTC (Sec ID No 67) ENG_7R CTGATCCAAGGGAGGGGAAG (Sec ID No 68) ENG Exon 8 ENG_8F ACACATATCACGGGGGG (NGG) No. 9 CTCCTGATGGTGCCCCTCTCTT (Seq ID No 71) ENG_9R TTGTCTTGTGTTCTGAGCCCCTG (Seq ID No 72) Exon ENG_10F CTGCAGGGGCTCAGAACACA (Seq ID No 73) ENG 10 ENG_10R GGCCAGGTGGGTTAGCACG (Seq ID No 74) Exon ENG_11F ATTGACCAAGTCTCCCTCCC (Seq ID No 75) ENG 11 ENG_11R GAAAGGCGGAGAGGAAGTTC (Seq ID No 76) Exon ENG_12F GGTGGGGTGAAGAGCAGCTG (Sec ID No 77) ENG 12 ENG_12R GACCTGGAAGCTCCCACTTGAA (Sec ID No 78) Exon ENG_13F GAGTAAACCTGGAAGCCGC (Sec ID No 79) ENG 13 ENG_13R GCCACTAGACGGGGGGGGGGGGGGGGGGGGGGGG ENG 14A ENG_14AR CTCAGAGGCTTCACTGGGCTCC (Sec ID No 82) Exon ENG_148F AGGACCCTGACCTCCGCC (Sec ID No 83) ENG 148 ENG_148R CTCTCCTGCTGGGCGAGC (Sec ID No 84) Table 1: Specific primers for amp lification of the exons of the BMPR2, ACVRL 1 and ENG genes for the search for gene variants.  In a preferred embodiment, exon 1A of the BMPR2 gene will be amplified by the pair of sequence oligonucleotide primers Sec ID No 1 and Sec ID No 2, exon 18 will be amplified by the pair of oligonucleotide primers sequence Seq ID No 3 and Sec ID No 4, exon 2 will be amplified by the pair of sequence oligonucleotide primers Sec ID No 5 and Sec ID No 6 and so on with the other exons 10 of all genes used in this invention.  In a particular embodiment, for the determination of the gene variants of each of the exons of the BMPR2, ACVRL 1 and ENG genes, the PCR products can be obtained using different specific oligonucleotide primers.  Subsequently, the PCR products can be resolved on a 2% agarose gel and visualized with ultraviolet light, so that they can be purified using a method 11commercial.  Once the PCR product has been purified, the sequencing reaction is carried out using a commercial kit containing a mixture of the 4 dNTPs at 5 90%, a mixture of dideoxyribonucleotides (ddATP, ddTTP, ddCTP and ddGTP), labeled each with a different fluorophore, and the enzyme DNA polymerase.  Once the sequencing of each exon is finished, the product 10 of the sequencing reaction will be purified.  This purification will be necessary to eliminate unincorporated labeled dNTPs and to obtain the highest quality in the sequences.  In a preferred embodiment, the sequence purification reaction will be carried out with the help of ethanol and salts.  After the product of the sequencing reaction is purified, the purified sequences will be migrated in a capillary sequencer on single strands, so it is necessary to denature the samples by subjecting them to 99 ° C for five minutes.  To increase the denaturation of the samples, they are resuspended in 25 IJL of maximum purity formamide.  Once denatured they remain cold.  20 During their electrophoretic migration from the cathode to the anode, the fragments separated in the capillary according to their size, will pass through the capillary reading area, where the fluorochromes are going to be excited by a beam of UV light and therefore, They will emit fluorescence at a certain wavelength.  This emitted fluorescence will be captured and analyzed by a computer program.  The system software contains information on the fluorochromes being used and provides the appropriate filters to collect light intensities.  The reading and analysis of the sequences will be carried out with computer programs, in the present invention the computer program ClustaIW2 30 (http: // www. ch. embnet org / software / ClustaIW. html) that compares multiple alignments of different sequences and indicates the differences found between them.  In this way, we can identify the gene variants present in these fragments.  Once the genetic profile of a subject diagnosed with Pulmonary Arterial Hypertension has been determined, the pathogenic nature of the gene variants will be determined. 12identified by in vitro studies.  one. 2.  Determination of the pathogenic character of the gene variants: Step (ii) of the first method of the invention consists in determining the pathogenic character of the gene variants identified in the BMPR2, ACVRL 1 and ENG genes.  In this way, pathogenic mutations can be differentiated from gene variants by in vitro molecular characterization, which will in turn comprise Luciferase assays and Hybrid Minigenes.  10 15 The term "pathogenic mutation", as used herein, only includes malignant mutations related to the onset of diseases.  A pathogenic mutation is found among individuals within populations and among populations within species.  First, an analysis of the identified gene variants is carried out to classify them as missense mutations (change of sense mutations), nonsense (missense mutations), synonymous or mutations of the 5'UTR region and, subsequently, proceed to In vitro analysis to verify how the 20 mutations located in the 5'UTR region produce alterations in transcriptional activity and to confirm that mutations affect the mechanism of splicing.  In a particular embodiment, for the study of the effect of gene variants 25 located in the 5'UTR region of the BMPR2, ACVRL1 and ENG gene at the corresponding protein expression levels, an in vitro study based on a system of reporter genes that measure luciferase activity.  For the study of the effect on the RNA processing mechanism that the gene variants identified in the exonic region of said 30 genes could have, they will be analyzed by the construction of Hybrid Minigenes.  one. 2. one.  Luciferase assays of the gene variants identified in the 5'UTR region of the genes under study: 35 After the identification of variations in the 5'UTR region of the genes under study, PCR amplification of said region will be carried out.  In one embodiment 13preferred, it will be based on the genomic DNA of the patients and the specific oligonucleotide primers must contain the MAAA tail, followed by the restriction target to be used, these targets will allow subsequent cloning of the fragment into the vector in the desired direction, and the sequence of 20 base pairs of the insert.  The restriction targets Nhel and Xhol will be used.  Once the 5'UTR region of the genes is amplified, it will be cloned into the pGL3-Basic vector, since it lacks promoter and enhancer sequences of eukaryotic genes, allowing maximum flexibility in the cloning of regulatory sequences.  The uncloned pGL3-Promoter vector will be used as a positive control, the uncloned pGL3-Basic vector as a negative control and the pRL-CMV vector as an internal control.  Once the insert of the 5 'UTR region is amplified, the insert and the vector will be digested to produce the cohesive ends necessary for ligation with the vector.  15 The digestion reaction will take place in a thermal cycler and according to the restriction enzymes used.  After the digestions are finished, these are checked on a 2% agarose gel with ethidium bromide at a concentration of 10. ¡G / mL, loading the entire volume of the digestion.  A band for the digested insert and two bands for the digested vector must be observed in the gel: a band of 4798 base pairs corresponding to the digested linear vector and a band of 20 base pairs corresponding to the fragment located between the points of cut of both enzymes.  After digestion, the total DNA of the samples should be quantified, using a spectrophotometer to proceed to vector-insert ligation, using the enzyme T4 DNA Ligase, and its subsequent transformation using competent cells E.  coli JM109 and liquid commercial LB culture medium with 50¡. G / mL Ampicillin.  Confirmation of the transformation of the desired insert, using oligonucleotides 30 specific primers RVprimer3 (TGGAAGACGCCMAAACATAAAG; Sec ID No. 85) and GLprimer2 (GGGACAGCCTATTTTGCTAG; Sec ID No. 86), the fragment will be sequenced, using a commercial kit, to verify that sequence is correct and know if, in each case, the wild sequence or that carrier of the mutation to be studied has been cloned.  To do this, a small-scale plasmid DNA extraction will be carried out to verify the existence of 14plasmid of interest, using a commercial kit.  With this wild and mutated plasmid DNA, COS-1 cells will be transfected to perform the luciferase assay using a commercial kit and following the manufacturer's instructions.  5 After 24 hours of transfection, the cells will be lysed and the supernatant collected to measure the activity of the Photinus luciferase and the activity of the Renilla luciferase, which is used to normalize the values obtained and correct differences due to the efficiency of the transfection.  Because both types of luciferase have a different evolutionary origin, it is possible to measure their activities 10 simultaneously and discriminate their activity.  For this, the Dual Luciferase Assay kit (Promega) commercial kit will be used.  The final values will be measured by a luminometer and the actual value of the luciferase will be obtained by dividing the value obtained from the Photinus luciferase reaction by the value of the Renilla luciferase reaction.  The test must be carried out in triplicate, in two different tests.  This test will allow to verify that variations produce an alteration of the transcriptional activity of the genes under study.  In a particular embodiment, variants that produce variations greater than 10% will be classified as pathogenic.  25 1. 2. 2.  Hybrid minigenes of the gene variants identified in the exonic region of the genes under study: Following the identification of the missense, nonsense and synonym gene variants, in vitro analysis of these variants was carried out to analyze which of them affect the mechanism of the splicing through hybrid minigenes.  30 The study of the effect that mutations that presumably affect the RNA processing mechanism may have will be carried out through the construction of hybrid minigenes.  These consist of the insertion of the fragment to be studied (which comprises both the exon of interest and its flanking intronic regions) between two exons previously cloned into a mammalian cell expression vector.  35 Once the hybrid minigenes are obtained, they will be transfected into 15 cellseukaryotes and the effect caused by the mutations studied in this process will be evaluated.  As for luciferase assays of the gene variants identified in the 5'UTR region of the genes under study, genomic AON of the patients will be used and the specific oligonucleotide primers will be designed in the same way.  To carry out the analysis of the mutations, the vector p will be used. SPL3 Expression vector that can be used for constitutive or transient expression in mammalian cells.  In the polylinker region of vector p. SPL3, between the Xhol and Nhel restriction sites, the insert of interest will be cloned.  This region is located between exons S06 and SA2 of the vector.  The insert and vector will be digested, construction ligation, transformation, plasmid AON extraction and test sequencing, using the specific oligonucleotide primers CATGCTCCTTGGGATGTTGAT (direct; Sec ID No 87) and ACTGTGCGTTACAATTTCTGG (reverse; Sec ID No 88).  Once the wild and mutated constructs are obtained, they will be transfected into COS-7 cells using a commercial kit.  After 48 hours after cell transfection, RNA will be extracted from the transfected cells using a commercial kit.  Once the RNA extraction is finished, the complementary AON chains will be synthesized from RNA, using a concentration of 1000 ng of RNA, to obtain the same complementary AON concentration of all mutants and 25 of the wild constructs.  After obtaining the AONc a PCR will be carried out, with the specific priming oligonucleotides TCTGAGTCACCTGGACAACC (direct; Sec ID No 89) and ATCTCAGTGGTATTTGTGAGC (reverse; Sec ID No 90), and the Phusion High-Fidelity ONA Polymerase will be used.  The PCR product will be analyzed on a 1.5% agarose gel and ethidium bromide, as described above.  Each of the bands obtained must be purified separately with a commercial AON purification kit.  Finally, the purified PCR product will be sequenced and analyzed.  35 In a particular embodiment, those variants that affect the splicing mechanism 16They will be classified as splicing mutations and pathogenic mutations.  one. 2. 3.  Analysis of the phenotype of the patients: 5 After the genetic characterization of the patients and the molecular characterization of the gene variants identified by in vitro analysis, it will be known that patients have a severe prognosis and which will present a smoother phenotype, depending on being carriers of pathogenic mutations.  10 Those patients carrying one or more pathogenic mutations in the same gene or in different genes analyzed and included in this invention will be classified as patients with a worse prognosis, where an increase in these mutations is indicative of a severe prognosis. of Pulmonary Arterial Hypertension.  15 As has been shown, it is known that patients with pathogenic mutations had an earlier age of disease onset, altered mean pulmonary and arterial blood pressure values, a higher value of pulmonary vascular resistance and a lower value for cardiac index 20 than patients without pathogenic mutations in the genes analyzed.  2.  Second method of the invention: The first method of the invention described above is useful for knowing the prognosis of a subject diagnosed with Pulmonary Arterial Hypertension.  According to the prognosis of the disease, the doctor could design a personalized therapy for said subject.  Therefore, in a second aspect, the present invention relates to a method 30 for selecting a subject diagnosed with Pulmonary Arterial Hypertension for personalized therapy, hereinafter second method of the invention, which comprises determining whether said subject has a severe prognosis. according to the method according to the first method of the invention, wherein said subject is selected for said therapy if it is classified as a patient at risk of developing Pulmonary Arterial Hypertension 35 with a severe prognosis.  173.  Third method of the invention: Likewise, in a third aspect, the present invention relates to a method for selecting a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension in need of treatment, hereinafter third method of the invention, comprising determining whether said subject has a serious prognosis according to the method according to the first method of the invention, where a personalized therapy for said subject is related if it is selected for said therapy if it is classified as a patient at risk to develop Pulmonary Arterial Hypertension More serious.  The term "therapy" or "personalized therapy" or "treatment" or "personalized treatment", as used herein, refers to a therapeutic treatment where the objective is to prevent the progression of the disease or reduce the rate of progression  Beneficial or desirable clinical results include, without limitation, a mean arterial blood pressure in the inferior pulmonary artery of 25 mmHg at rest and no abnormalities in systolic pulmonary arterial pressure, pulmonary vascular resistance or cardiac index.  20 In a particular embodiment, the therapy is a vasodilator therapy.  The therapy is decided according to the recommendations of the different European international guides such as: ERH (European Society of Hypertension), ERS (European Respiratory Society) or ESC (European Society of Cardiology).  Vasodilator therapy includes, without limitation, all drugs marketed to date, such as silderafil, bosentan, ambrisentan, etc.  Patients with pathogenic mutations in the main pathology-associated genes, included in this invention, do not respond correctly to treatment since they are treated with phosphodiesterase-5 pathway inhibitors, an example without limitation is Silderafil, and mutations. pathogenic affects the TGF-I3 path.  For this same reason, patients with 30 pathogenic mutations should be treated with a combination of medications that affect different routes, including treatments that act on the endothelin route, calcium channels and the TGF-I3 route.  35 185 4.  Kits of the invention: The present invention also contemplates the preparation of kits for the implementation of the methods according to the present invention.  Therefore, in a fourth aspect, the present invention relates to a kit, hereinafter kit of the invention, comprising the reagents necessary for genotyping the genes included in this invention associated with Pulmonary Arterial Hypertension and the reagents necessary to analyze Functionally identified gene variants 10, by luciferase assays and hybrid minigenes, to classify them according to their pathogenicity.  Suitable kits include various reagents for use in accordance with the present invention in suitable containers and packaging materials, including tubes, vials, and cellophane and blow molding packages.  Materials suitable for inclusion in an exemplary kit according to the present invention comprise one or more of the following: Specific priming oligonucleotides for amplifying and sequencing the genes included in this invention (described in relation to the first method of the invention) ; reagents capable of amplifying a specific genomic DNA sequence; necessary reagents for physically separated products derived from the various alleles (for example agarose and a buffer to be used in electrophoresis); reagents necessary to be able to sequence the exons of the genes to be analyzed; reagents necessary to be able to clone the fragments of interest in the vectors included in the present invention (including the pGL3-Basic, pGL3-Promoter, pRL-CMV and pSLP3 vectors, and including the specific oligonucleotide primers to be able to analyze and verify the cloning) ; Reagents needed to perform RNA synthesis to complementary DNA.  30 5.  Uses of the invention: In a fifth aspect, the present invention relates to a use of a kit of the invention, hereinafter first use of the kit of the invention, to predict without a subject diagnosed with Pulmonary Arterial Hypertension is classified as a patient. with 19severe prognosis  In a sixth aspect, the present invention relates to a use of a kit of the invention, hereinafter second kit of the invention, to select a subject 5 diagnosed with Pulmonary Arterial Hypertension for a personalized therapy comprising determining whether said subject is classified as a patient with a severe prognosis.  Also, in a seventh aspect, the present invention relates to a use of a kit of the invention, hereinafter third use of the kit of the invention, to select a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension in need of treatment , which includes determining whether said subject is classified as a patient with a good prognosis or with a worse prognosis.  15 PREFERRED EMBODIMENT OF THE INVENTION This section will show an example of material and methods and the results of the analysis of the complete BMPR2 gene.  This analysis is the same for the ACVRL 1 and 20 ENG genes.  one.  Patients: A total of 60 patients with 25 Pulmonary Arterial Hypertension in group 1 of Nize 2013 (Nice, France) were included in this study.  Patients were diagnosed by experienced pulmonologists based on their medical history, as well as depending on the result of various hemodynamic tests.  The diagnosis of PAH was based on a right catheterization with a mean pulmonary arterial pressure (PAPm) ~ 25 mm Hg and an interlocking pressure of less than 15 mm Hg without specific treatment.  In all cases the usual management protocol was followed according to the recommendations of the European Respiratory Society / European Society of Cardiology (ERS / ESC).  35 Clinical data were collected as Functional Class (CF), 6-minute walk test 20(TM6M), Pulmonary Function and laboratory studies.  The hemodynamic studies collected are the Mean Pulmonary Arterial Pressure (PAPm), Systolic Pulmonary Arterial Pressure (PAPs), Interlocking Pressure (PE), Cardiac Index (IC), Pulmonary Vascular Resistance (RVP) and vasoreactivity test.  The patients were stable at the time of catheterization.  2.  Extraction of AON: The biological sample used to carry out the genetic studies was genomic DNA extracted from 9 mL of peripheral blood, from each of the patients studied, collected on EDTA anticoagulant (ethylenediaminetetraacetic acid).  This extraction was carried out using the FlexiGene DNA Kit (Qiagen, Hilden, Germany), following the manufacturer's instructions.  15 3.  Mutational analysis of the BMPR2 gene: To determine the mutational spectrum of the BMPR2 gene, by polymerase chain reaction, the oligonucleotide primers described by Deng et al.  (Am J Hum Genet 2000; 67: 737-44).  For this, the following amplification protocol was followed, the final volume being 25 ~ L: 25 5 minutes at 95 oC.  35 cycles of: 30 seconds at 95 oC, 30 seconds at X oC and 30 seconds at 72 oC.  7 minutes at 72 oC The temperature of X depends on the pair of specific oligonucleotide primers used.  In this case, the temperature described by Deng et al.  for the BMPR2 gene.  30 To verify the correct amplification of the PCR product, this was resolved in 2% agarose gels with ethidium bromide at a concentration of 1 O ~ g / mL.  Each amplified DNA sample was mixed with 5 L of a loading solution containing bromophenol blue, prior to being loaded on the gel.  The electrophoresis was performed on the Sub-Cell® GT equipment (Bio-Rad, Hercules, CA, USA), in a buffer of T AE electrode.  After electrophoresis, the DNA was visualized using a 21transilluminator (GelDoc EQ, Bio-Rad, Hercules, CA, USA) And a digital image of the gel was obtained using the QuantityOne 4 program. 6. one.  After verifying the correct amplification of the PCR product, it was purified using the Nucleic Acid and Protein Purification, NucleoSpin Extract 11 commercial kit (Macherey-Nagel, Düren, Alemánia), following the manufacturer's instructions.  Once the PCR product was purified, the sequencing reaction was carried out using the commercial kit BigDye® Terminator v3. 1 Cycle Sequencing 10 Kit (Applied Biosystems, Carlsbad, CA, USA), following the manufacturer's instructions.  The so-called sequencing reaction takes place in the thermal cycler according to the following protocol: 15 3 minutes at 94 oC.  35 cycles of: 10 seconds at 96 oC, 6 seconds at 50 oC and 4 minutes at 60 oC.  The sequencing reaction product was purified to eliminate unincorporated labeled ddNTPs and to obtain the highest quality in the sequences.  For this, 55 ~ L of cold ethanol, 19 ~ L of 2 mM MgCl2 and 10 ~ L of sterile 20 H20 were added to each sample.  This mixture was mixed, incubated at -20 ° C for 20 minutes, centrifuged at 14. 000 rpms for 15 minutes, the supernatant was removed and 84 ~ 70% ethanol was added.  It was centrifuged again at 14. 000 rpms for 15 minutes, the supernatant was removed and the samples were stored.  Sequence reading was performed on the ABI PRISM 3130 Genetic Analyzer 25 hair sequencer (Applied Biosystems, Carlsbad, CA, USA).  Four.  Sequence analysis: The sequences of the subjects were aligned with the reference sequence 30 [ENST00000374580] of the Ensembl for the BMPR2 gene.  35 Following the mutational analysis of the genes, gene variants have been identified in 92% of the patients identified.  Among these variants, missense, nonsense, synonym and variant variants have been identified in the 5'UTR region of the genes.  225.  Luciferase assays: The Dual-Luciferase Reporter Assay System (Promega, USA) double reporter system was chosen to establish the activity of the 5'UTR region of the genes under study. The 5'UTR region of the BMPR2 gene was amplified using the Specific oligonucleotide primers GGAAGCACCGAAGCGAAAC (direct) and CCCTGGGCCAGCCAAGAAT (reverse) and high fidelity Phusion polymerase (Finnzymes, Espoo, Finland), The resulting fragments were digested with restriction enzymes Nhel / Xhol and cloned into the vector pGL3-Basic Nhel / Xhol restriction sites 10, using the enzyme T 4 DNA Ligase (Invitrogen Corporation, Carlsbad, CA) to generate a construction with the 5'UTR region of wild and mutated type.  For the ligation of the previously digested vector and inserts, a concentration of 50 ng of digested vector was used and to know the optimal concentrations of the insert the following formula was followed, using two dilutions (1/3 and 115), being: ng (nanograms), Kb (kilobases), ~ L (microliters).  20 ng vector x K b insert 3 ng insert.  - = :: -: ------: -: -: -: - x - = = ~ L mserto Kb digested vector 1 [insert 1 ng vector x K b insert 5 ng insert.  --- = - :: -: ------: -: ---: - x - = = ~ L mserto Kb digested vector 1 [insert 1 After ligation of the vector-insert, we proceeded to transformation of the cloned construct (vector + insert) using competent cells E.  coli JM109 and a half of 25 commercial liquid LB culture with 50 iJg / mL Ampicillin.  To transform, 5 µL of the construct was added to 50 µL of competent cells, gently stirred and incubated on ice for 10 minutes.  After this time, a thermal shock was applied at 42 ° C for 40-50 seconds, so that the cells opened their pores and the construction could enter them.  Next, the cells were incubated on ice for 4 minutes so that the cells closed their pores and the construction could not leave.  500 iJL of Super Optimize Outbreak medium with catabolite repression (SOC Medium) were added to each vial with competent cells and plated with Petri dishes with LB medium and 50 iJg / mL Ampicillin and incubated for 24 hours in the dark .  2. 3After 24 hours of incubation, it was checked whether the bacterial colonies had grown and were grown in a 3 mL preculture of liquid LB medium at 37 ° C, under constant agitation, for 18 hours.  After growing the colonies overnight in the liquid culture, they were amplified directly by PCR to verify the size of the insert and that the cloning of the same in the vector occurred correctly.  The specific oligonucleotide primers used were RVprimer3 (TGGAAGACGCCAAAAACATAAAG; Sec ID No. 85) and GLprimer2 (GGGACAGCCTATTTTGCTAG; Sec ID No. 86) (Promega, Madison, Wisconsin, 10 EE. UU. ), following the standard conditions of PCR amplification.  The result of the PCR was checked on a 2% agarose gel with ethidium bromide at a concentration of 1 O ~ g / mL.  The specific oligonucleotide primers used hybridize with the vector, so that, if the insert has not been cloned, a band of 153 base pairs will be observed in the gel and if it has been correctly cloned a band between 500 and 1000 will be observed. base pairs, depending on the size of the amplified insert.  The uncloned pGL3-Basic vector was used as a negative control and the uncloned pGL3-Promoter vector as a positive control.  COS-1 cells were used for the luciferase assay.  The cell line was cultured in 20 DMEM medium (Gibco, Grand Island, USA. UU. ), supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA. UU. ), 11% L-glutamine (Lonza, Basel, Switzerland) and 11% penicillin / streptomycin (Lonza, Basel, Switzerland), in a humidified atmosphere at 37 ° C with 5% C02.  Cells were cultured in 6-well plates and COS-1 cells were transfected, with a confluence of 80-90%, using 2 ~ g of the pGL3-Basic construct (with the 5'UTR region of the BMPR2 gene, of wild and mutant type) and positive and negative controls per well.  COS-1 cells were also transfected with 20 ng of pRL-CMV vector (Renilla control plasmid).  Transfection was performed using Fugene HO (Promega, Madison, Wisconsin, USA. UU. ), in a 2: 5 ratio of ~ g of plasmid AON and Fugene HO ~ I, respectively, and 30 following the manufacturer's instructions.  Cells were collected at 36 hours after transfection.  Luciferase assays were performed with the Dual-Luciferase Reporter Assay System (Promega, USA) on an EnVision 2104 luminometer (PerkinElmer, Waltham, 35 Massachusetts, USA. UU. ).  Cells were lysed with 500 ~ I lysis buffer (buffer 24PLB) at room temperature for 30 minutes.  For the luciferase assay, 20 µL aliquots of lysate were added in a 96-well plate to measure the firefly luciferase (100 µL) and the renilla luciferase (100 µL).  Luciferase values were divided by renilla values to normalize fluctuations in the 5 cells and obtain efficiency.  The test was performed in triplicate, in two different trials.  This trial allowed to verify that variations produce an alteration of the transcriptional activity of the genes under study.  Statistically significant differences in transcriptional activity were observed in 4 of the 5 gene variants when compared to wild construction, by luciferase assays.  Three of the gene variants (c. 1-347C> T, c. 1-301 G> A and c. 1-92C> A) showed a decreased transcriptional activity that ranges between 70-77% (p <O, 0001) compared to wild type levels. Surprisingly, the gene variant c.1-279C> A produced the greatest decrease in transcriptional activity: 93% (p <O, 0001). The c.1-186A> G gene variant led to a decrease of approximately 2% without statistical significance (p = 0.495). Following this analysis, gene variants c.1-347C> T, c.1-301G> A have been classified. c.1-279C> A and c.1-92C> A as pathogenic mutations, and 20 are present in 7 of the 60 patients analyzed. 6. Hybrid minigenes: To construct the hybrid minigenes, fragments were generated that contained exon 25 in which the gene variant to be analyzed and 200 base pairs of flanking intronic regions were located, in order to ensure that they contain consensus sequences involved in splicing. The fragments were amplified by PCR using genomic AON from the patients, using high fidelity Phusion polymerase (Finnzymes, Espoo. Finland). The fragments were cloned into the pSPL3 vector (Invitrogen Corporation, Carlsbad, CA) at Xhol / Nhel restriction sites (New England Biolabs, Ipswich, Massachusetts, USA) using the enzyme T4 AON ligase (Invitrogen Corporation, Carlsbad , CA) to generate wild-type and mutated constructs. 35 Ligation and transformation was carried out in the same manner described in 25Luciferase assays section (5). However, competent E. coli OH5a cells were used for bacterial transformation. Cloning was confirmed by PCR using the specific oligonucleotide primers CATGCTCCTTGGGATGTTGAT (direct; Sec ID No. 87) and ACTGTGCGTTACAATTTCTGG (reverse; Sec ID No. 88) and 5 by automatic sequencing. For the luciferase assay, CaS-7 cells were used. The cell line was cultured in OMEM medium (Gibco, Grand Island, USA), supplemented with 10% fetal bovine serum (FBS, Gibco, Grand Island, USA), 1% L-glutamine (Lanza , Basel, Switzerland) and 10% penicillin / streptomycin (Lanza, Basel, Switzerland), in a humidified atmosphere at 37 ° C with 5% Ca2. Cells were cultured in 6-well plates and CaS-7 cells were transfected, with a confluence of 80-90%, using 2 .Jg of the pSPL3 construct (with the exon of the BMPR2 gene, wild-type and mutated) . Transfection was performed using Lipofectamine 2000 (Invitrogen Corporation, Carlsbad, 15 CA, USA) in a 1: 3 ratio of .Jg of plasmid AON and .JI of Lipofectamine, respectively, and following the manufacturer's instructions. CaS-7 cells were incubated for 36 hours after transfection and all experiments were performed in duplicate. RNA extraction was performed with the Nucleospin RNA II kit (Macherey-Nagel, Oüren, Germany) according to the manufacturer's protocol. RT-PCR was carried out with the geneAmp Gold RNA PCR Core Kit (Applied Biosystems, California, USA) and the resulting complementary AON was amplified with the high fidelity Phusion polymerase (Finnzymes, Espoo, Finland) with the oligonucleotide primers TCTGAGTCACCTGGACAACC (direct; Sec 25 ID No 89) and ATCTCAGTGGTATTTGTGAGC (reverse; Sec ID No 90), which hybridize with exons S06 and SA2 in vector pSPL3, using 2 ~ L of complementary AON and amplification conditions were : 30 seconds at 98 oC, 35 cycles of 10 seconds at 98 oC, 30 seconds at 58 oC and 30 seconds at 72 oC, finally 7 minutes at 72 ° C. PCR products were separated by 30 2% agarose gel electrophoresis to analyze changes in the transcription pattern, and sequenced with the BigOye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, California, USA) to identify changes of sp / icing. To verify that missense, nonsense or synonym 35 gene variants affect the splicing mechanism, hybrid minigenes of 25 variants were made 26genetics and 9 variants were identified that affect messenger RNA processing. Three of the variants that affect splicing are gene variants of the synonym type (c.633A> G, c.835G> T and c.981T> C), 3 gene variants of the missense type (c.251G> T, c.412C > G and c.1400A> G) and 3 nonsense 5 gene variants (c.156_157deITC, c.654T> A and c.893G> A). The c.633A> G gene variant prevents recognition of the main acceptor site. The direct sequence of the complementary DNA confirmed the creation of a new alternative 3 'site, which produces a deletion of 12 base pairs in the 5' region of exon 10 6 of the gene. The c.835G> T gene variant produces the complete elimination of exon 6, generating a smaller 77 amino acid protein. Finally, the gene variant c.981T> C produces the complete elimination of exon 8 and, therefore, a truncated protein of 985 amino acids. 15 3 of the missense gene variants produce alterations in splicing. The gene variant c.251G> T produces the complete elimination of exon 3, generating a change in the reading pattern and producing a premature stop codon in exon 4. The gene variant c.412C> G produces an alternative 5 'site resulting in a shorter protein of two amino acids since the mutation eliminates the main donor site 20 and would generate a new donor splice site. Finally, the c.1400A> G gene variant eliminates the main donor site, creating a new splice donor site and therefore, the new mutated protein would have only 494 amino acids. As for the three nonsense gene variants, which generate shorter proteins due to premature stop codons (c.156_157deITC, c.654T> A and c.893G> A), of 54, 218 and 298 amino acids of length respectively, affect the mechanism of splicing. 30 7. Statistical analysis: Values are expressed as mean ± standard deviation. Differences between the groups were examined to determine statistical significance using the Student's t-test (luciferase assays). To compare the clinical and hemodynamic variables between the genotypes, the Chi-square test was used (variables 35 were classified according to the best cut-off point using ROC curves). These 27correlations were analyzed using the Spearman test. Probability values below 0.05 were considered statistically significant. Statistical analyzes were performed with SPSS for Windows (v19.0). 5 Following the statistical and in vitro analysis of the identified gene variants, a total of 19 pathogenic mutations have been classified in 22 of the 60 patients analyzed. A genotype-phenotype comparison of the clinical and hemodynamic characteristics of patients carrying pathogenic mutations with patients not carrying pathogenic mutations was performed (Table 4). Following this analysis, it was observed that patients with pathogenic mutations have systolic pulmonary arterial pressure, mean pulmonary arterial pressure and statistically higher pulmonary vascular resistance than patients without mutations (p = 0.039, p = 0.029 and p = 0.015, respectively). The group of patients with pathogenic mutations also presented a statistically significant lower result for the 6-minute running test (p = 0.041). Patients with pathogenic mutations have a significantly lower diagnostic age than patients without pathogenic mutations (p = O'030) and also have a lower heart rate (p = 0.002). Finally, patients with pathogenic mutations do not respond well to treatment, compared to patients without pathogenic mutations (p = 0.010), with Sildenafil (phosphodiesterase-5 inhibitor) being the treatment administered in non-responders. . Therefore, these results indicate that patients with pathogenic mutations, tested by in vitro analysis, have a more severe phenotype than patients without pathogenic mutations. For this reason, these patients would be classified as "patients with a worse prognosis." Patients without Patients with mutations Clinical characteristics and pathogenic hemodynamic pathogenic mutations Clinical data p-value Number 38 22 --18 men / 20 6 men / 16 Gender 0.360 women women Age of diagnosis (years) 49 ± 16 36 ± 16 0.030 Pulmonary blood pressure mean 47 ± 14 58 ± 6 0.029 285 10 15 (mmHg) Systolic pulmonary arterial pressure 60 ± 19 73 ± 9 0.039 (mmHg) Pulmonary vascular resistance 6.2 ± 3.3 7.9 ± 0.5 0.015 (mmHg.l. 1.01) Cardiac index (I.m01.m02) 3.2 ± 0.7 201 ± 0.3 00002 6MWT (m 415 ± 146 570 ± 86 0.041 Response to treatment 4 non-responders 19 non-responders 00010 or, Table 2: Genotype / phenotype correlation of patients with pathogenic mutations with patients without pathogenic mutations. 8. Applications : In a first aspect, the present invention has a clinical applicability, since it would help physicians to predict the evolution of the disease based on their genetic heritage, after an in vitro functional analysis of the BMPR2, ACVRL 1 and ENG genes. In a second aspect, the present invention relates to a method for selecting a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension in need of treatment, wherein a personalized therapy is selected for For said subject, depending on the signaling pathways affected. In a fourth aspect, the invention relates to a kit comprising the reagents necessary to genotype the genes involved in the development of the disease, where these genes are associated with the evolution of the disease. 20 Finally, the pharmaceutical market could be considered since, depending on the genetic characterization of the patients, they could adjust a more effective treatment that acts on the affected targets. 29 
    权利要求:
    Claims (9)
    [1]
    CLAIMS 1. In vitro method to determine the prognosis in subjects diagnosed with Pulmonary Arterial Hypertension characterized in that the determination of the 5 pathogenic mutations of the BMPR2, ACVRL 1 and ENG genes, where an increase in these mutations is indicative of a serious prognosis of Pulmonary Arterial Hypertension.
    [2]
    2. Method for determining the prognosis in subjects diagnosed with Pulmonary Arterial Hypertension according to claim 1, characterized by comprising the following stages: 15 20 25 30 i) ii) determining the genetic profile of patients diagnosed with Pulmonary Arterial Hypertension, sequencing the genes BMPR2, ACVRL 1 and ENG, associated with the disease, and obtain the corresponding genetic profile of a biological sample from a subject with pulmonary arterial hypertension; in vitro analysis of the genetic profile using luciferase assays and hybrid minigenes, in order to identify pathogenic mutations of the genetic variants identified in the BMPR2, ACVRL 1 and ENG genes determined in step (i), therefore it is an indication of a serious prognosis of Pulmonary Arterial Hypertension when: Those gene variants, located in the 5'UTR region, that after the luciferase test produce an alteration of the transcriptional activity greater than 10% are classified as pathogenic mutations; Those gene variants that affect the splicing mechanism after their analysis using hybrid minigenes are classified as pathogenic mutations.
    [3]
    3. Method according to any of claims 1 to 2, characterized in that the biological sample is a biopsy sample, tissues, cells or fluids, for example blood, saliva, plasma, serum, secretions, milk, preferably a blood sample peripheral. 30
    [4]
    4. Method according to any of claims 1 to 2, in which a patient is classified as a patient with a prognostic risk of developing Pulmonary Arterial Hypertension with severe prognosis if he is a carrier of one or more pathogenic mutations of the BMPR2, ACVRL 1 and ENG.
    [5]
    5. Method to design a personalized therapy for a subject diagnosed with Pulmonary Arterial Hypertension with severe prognosis, according to the method according to any of claims 1 to 4, where those subjects with pathogenic mutations of the BMPR2, ACVRU and ENG genes must be treated with a combination of drugs that affect different pathways, including treatments that act on the endothelin pathway, the calcium channel pathway, and the TGF-¡3 pathway. fifteen
    [6]
    6. Kit according to any of the preceding claims that comprises the reagents necessary to genotype the genes BMPR2, ACVRL 1 and ENG, associated with Pulmonary Arterial Hypertension, which will allow knowing the genetic heritage of the subjects. twenty
    [7]
    Kit according to any of the preceding claims, further comprising the reagents necessary to functionally analyze the gene variants identified by luciferase assays and hybrid minigenes, after genetic analysis of BMPR2, ACVRL 1 and ENG, to classify them according to their pathogenicity. 25
    [8]
    8. Use of a kit according to any of the preceding claims, to predict whether a subject diagnosed with Pulmonary Arterial Hypertension is indicative of a serious prognosis of Pulmonary Arterial Hypertension.
    [9]
    9. Use of a kit according to any of the preceding claims, to select a subject diagnosed with Pulmonary Arterial Hypertension for an individual therapy that comprises determining if said subject is classified as a patient with a severe prognosis of Pulmonary Arterial Hypertension, in which the classification of said subject as a patient with a severe prognosis of Pulmonary Arterial Hypertension selects said subject for said individual therapy. 31
    类似技术:
    公开号 | 公开日 | 专利标题
    Gazda et al.2006|Ribosomal protein S24 gene is mutated in Diamond-Blackfan anemia
    Zhang et al.2005|Identification of functional genetic variants in cyclooxygenase-2 and their association with risk of esophageal cancer
    US7807364B2|2010-10-05|Angiogenesis pathway gene polymorphisms for therapy selection
    Stobdan et al.2015|Endothelin receptor B, a candidate gene from human studies at high altitude, improves cardiac tolerance to hypoxia in genetically engineered heterozygote mice
    ES2650387T3|2018-01-18|Epigenetic signatures as a marker of cardiomyopathies and myocardial insufficiencies
    Yamamoto et al.2012|Hereditary angioedema in Japan: genetic analysis of 13 unrelated cases
    Vural et al.2009|Genetic polymorphisms in DNA repair gene APE1, XRCC1 and XPD and the risk of pre-eclampsia
    US8216783B2|2012-07-10|Over-expression and mutation of a tyrosine kinase receptor FGFR4 in tumors
    Krzystek-Korpacka et al.2017|Midkine is up-regulated in both cancerous and inflamed bowel, reflecting lymph node metastasis in colorectal cancer and clinical activity of ulcerative colitis
    CN101921831A|2010-12-22|Rapid detection of BRCA | genic mutation
    Kuratomi et al.2007|NRSF regulates the developmental and hypertrophic changes of HCN4 transcription in rat cardiac myocytes
    US6627401B2|2003-09-30|Method for detecting a single nucleotide polymorphism in p21waf1/cip1 gene as an indicator of risk of esophageal cancer
    ES2733369T3|2019-11-28|R2R1 / 2 in diagnosis and therapy
    Zhang et al.2016|Association of polymorphisms in PATE1 gene with idiopathic asthenozoospermia in Sichuan, China
    ES2683921B1|2019-04-22|Method for determining the prognosis in subjects diagnosed with pulmonary arterial hypertension
    Ruppert et al.2013|Identification of a missense mutation in the melusin-encoding ITGB1BP2 gene in a patient with dilated cardiomyopathy
    US20020132234A1|2002-09-19|Nitric oxide synthase gene diagnostic polymorphisms
    ES2370491T3|2011-12-16|METHODS OF DETECTION OF ALZHEIMER&#39;S DISEASE.
    ES2544265T3|2015-08-28|Combinations of polymorphisms to determine the specific expression of IGF2 allele
    Bazalii et al.2016|Transcriptional regulation of NOX genes expression in human breast adenocarcinoma MCF-7 cells is modulated by adaptor protein Ruk/CIN85
    US9567637B2|2017-02-14|Association of HTRA1 mutations and familial ischemic cerebral small-vessel disease
    KR20140064923A|2014-05-28|Responsiveness to angiogenesis inhibitors
    Zhang et al.2018|FOXA1 is upregulated in glioma and promotes proliferation as well as cell cycle through regulation of cyclin D1 expression
    Harendra et al.2012|Haplotypes of heparin‐binding epidermal‐growth‐factor‐like growth factor gene are associated with pre‐eclampsia
    US10160971B2|2018-12-25|Methods of modulating WARS2
    同族专利:
    公开号 | 公开日
    ES2683921B1|2019-04-22|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US20140135358A1|2011-05-02|2014-05-15|Edda Spiekerkoetter|Use of FK506 for the Treatment of Pulmonary Arterial Hypertension|
    法律状态:
    2018-09-28| BA2A| Patent application published|Ref document number: 2683921 Country of ref document: ES Kind code of ref document: A1 Effective date: 20180928 |
    2019-04-22| FG2A| Definitive protection|Ref document number: 2683921 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190422 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201700285A|ES2683921B1|2017-03-28|2017-03-28|Method for determining the prognosis in subjects diagnosed with pulmonary arterial hypertension|ES201700285A| ES2683921B1|2017-03-28|2017-03-28|Method for determining the prognosis in subjects diagnosed with pulmonary arterial hypertension|
    [返回顶部]