专利摘要:
Variants of the non-virionic protein of viral septicemic hemorrhage virus and its use in the treatment of proliferative disorders. The present invention relates to viral polypeptides derived from the non-virionic protein (NV) derived from the virus Oncorhynchus 2 novirhabdovirus, (known as viral septicemic hemorrhage virus, VHSV), and to the use thereof for the treatment of diseases that occur with proliferative disorders, in particular, for the treatment of cancer and metastasis. Likewise, the polypeptides of the present invention are useful for inhibiting cell proliferation in vitro, as well as the activity of inflammatory proteins and cell cycle regulatory proteins. Likewise, the pharmaceutical composition and the kit comprising said peptides are also included within the present invention. (Machine-translation by Google Translate, not legally binding)
公开号:ES2679570A1
申请号:ES201730260
申请日:2017-02-27
公开日:2018-08-28
发明作者:Eduardo GÓMEZ-CASADO;Blanca CHINCHILLA RODRÍGUEZ
申请人:Instituto Nacional de Investigacion y Tecnologia Agraria y Alimentaria INIA;
IPC主号:
专利说明:

The present invention relates to a set of polypeptides comprising an amino acid sequence having a sequence identity of at least 99% with the non-virionic protein (NV) of the Oncorhynchus 2 novirhabdovirus virus, (known as hemorrhage virus viral septicemic, HSVV) comprising SEO ID NO: 2, and said polypeptides further comprise at least one substitution of the natural amino acid present in any of positions 33 to 41 of said SEO ID NO: 2, by the amino acid alanine ( TO). Such polypeptides are useful for the treatment of diseases that occur with cell proliferation, in particular for
15 the treatment of cancer and metastasis. Therefore, the present invention is included within the field of biology, molecular biology and medicine, in particular, in the field of cancer treatment, as well as any proliferative disorder.
STATE OF THE TECHNIQUE
20 Tumors appear due to deregulation in cell proliferation, differentiation and death programs, the immune system and chronic inflammation processes having a determining role. MAPK signaling cascades (MitogenActivated Protein Kinase) are involved in cell proliferation, differentiation and
25 survival or cell death. In mammals, four MAPK pathways whose terminal kinases are ERK1 / 2, JNK1 / 2/3, p38 kinases and ERK5 have been characterized. These MAPKs activate substrates that exert various functions such as gene transcription regulation and cell cycle regulation resulting in increased proliferation. In the study of tumor progression, the role has been established
30 determinant of the pathway in which ERK participates, and the previous indicators in the progression of cancer (Shields, JM, al., Trends Cell Biol, 2000. 10 (4): 147-54) denominating the RAS-RAF pathway -MEK-ERK. It has been estimated that ERKs can regulate the activities of 160 proteins (Yoon, S. and R. Seger. Growth Factors, 2006. 24 (1): 21-44) that are located in organelles, cytoplasm and mostly in the
35 core When ERK is activated, it translocates to the nucleus where it regulates several transcription factors resulting in gene expression changes (Zuber, J., al., Nat Genet, 2000. 24 (2): 144-52; Schulze, A. , al., Mol Biol Cell, 2004. 15 (7): 3450-63).
In many types of cancer, the RAS-RAF-MEK-ERK pathway is deregulated with a
In excess, due to the mutation of some of its components, such as, for example, the EGFR, RAS and RAF proteins, which leads to uncontrolled proliferation. Mutations in the gene coding for B-RAF (BRAF) cause 70% of the mela noma tumors studied and to a lesser extent other tumors (Davies, H., al., Nature, 2002. 417 (6892): 949-54).
10 One of the main objectives in the treatment of cancer is to decrease the deregulation of proliferation by inhibiting the initial, middle and final markers, and thus promoting apoptosis for the elimination of tumor cells. Different inhibitors have been developed for different signaling devices
15 such as A-RAF, BRAFV600E or MEK kinases (Table 1), but over time the tumor cells generate resistance to such treatments, thus ceasing to be useful. In melanoma, resistance to treatment appears one year, while in colon carcinomas this resistance appears from the beginning of treatment because there is a feedback due to the activation of the factor receptor.
20 epidermal growth (S un, C., al., Nature, 2014. 508 (7494): 118-22). More recently, compounds that inhibit ERK (Table 1) and that are functional in cells with BRAF mutations, resistant to other inhibitors (Morris, E.J., Al., Cancer Discov, 2013. 3 (7): 742-50). However, the study with greater
number of cases have been shown to also show resistance to inhibition 25 due to ERK mutations (Jha, S., et al., Mol Cancer Ther, 2016. 15 (4): p. 548-59).
Table 1. Inhibitors used in the RAS-RAF-MEK-ERK pathway.
Compound CompanyTarget proteinClinical trialType of cancer
Sorafenib (Nexavar) Bayer / OnyxB-Ral, Ral-1Phase 11-1 1 approvedAdvanced RCC, NSCLC, Pancreas, Melanoma, Ovaries, AML, Hematologic
Ral265 (CHIR-265) NovartisA-Ral, B-Raf, c-Raf-1Phase IMelanoma
PLX4032 Roche!Mutant B-Phase ICancer
Compound CompanyTarget proteinClinical trialType of cancer
Plexxikon Raf (V600E)
PD0325901 PfizerMEK, MEK2Phase IIBreast, CRC, NSCLC, Melanoma
AZD6244 AstraZeneca IArrayMEK, MEK2Phase IINSCLC, Melanoma, Pancreas, Inflammation
ARRY-142886 Biopharma
ARRY -438162 Array BioPharmaMEK, MEK2Phase IRheumatoid arthritis
SCH772984 ERK1 / ERK2
VX-11e ERK2
Ulixertinib (BVD-523, VRT752271) ERK2Phase IPancreas
GDC-0994 ERKlIERK2Phase IMetastasis Solid tumors
FR 180204 ERK1 / ERK2
AML Aeute Mye / ogenous Leukemla, CReo Coloreetal eaneer, MEK. mllogen-aetlvated protein kinase / extracellular signal-regulated kinase kinase; NSClC: non-small-eelf lung cancer, RCC: renal cell caneer.
5 As mentioned above, in addition to the imbalance in MAPK pathways and their effector kinases, there is also an imbalance in the cell proliferation and tumor growth between the different phases of the cell cycle, its promoter proteins (cyclines A, B, OYE), and cyclin kinase inhibitors (CDKs), leading to uncontrolled cell division. In this regard, it has
10 determined an overexpression of cyclin B1 in breast, cervical, gastric, colorectal and lung tumors (Banerjee, SK, et al., Am J Pathol, 2000. 156 (1): 217-25; Wang, A., etal., J Cancer Res Clin Oncol, 1997. 123 (2): 124-7; Zhao, M., et al., Exp Oncol, 2006. 28 (1): 44-8), this increase being cyclin B1 a poor prognosis factor in several types of cancer, including breast cancer (Soria, JC, et
15 al., Cancer Res, 2000. 60 (15): 4000-4; Suzuki, T., et al., Cancer Sci, 2007. 98 (5): 64451; Nozoe, T., et al., Clin Cancer Res, 2002. 8 (3): 817-22). In addition, overexpression of cyclin B1 is involved in radiotherapy resistance in head and neck carcinoma (Hassan, KA, et al., Cancer Res, 2002. 62 (22): 6414-7). Studies in breast and cervical cancer cells showed that the decrease in cyclin B1 by transcriptional inhibition (inhibition by siRNA) led to lower cell proliferation and increased sensitization of cells to proapoptotic compounds (Androic, l., Al., 8MC Cancer, 2008. 8: 391). Alternatively to the decrease in cell proliferation, it was observed that cyclin 81 inhibition
5 also induces an increase in the number of cells in the G2 / M phase, suggesting aarrest at this point in the cell cycle (Androic, l., al., BMC Cancer, 2008. 8: 391).
The role of cyclin 81 as a promoter of cell proliferation in cancer has been revealed in other studies. Thus, an inverse relationship has been established between the concentration of the miR-379 microRNA, the cyclin 81 concentration and the prognosis of breast cancer. Patients with breast cancer showed less concentration of miR-379 than controls, and this concentration decreased further in advanced stages of the disease. In addition, it was observed that the lower concentration of miR-379 increased the concentration of cyclin 81 (Khan, S.,
15 et al., PLoS One, 2013. 8 (7): e68753).
In view of the foregoing, there is in the prior art the
need to provide new alternative compounds to those described in the
state of the art, capable of inhibiting cell proliferation, acting on both
20 MAPK pathway proteins, such as cell cycle proteins, that are capable of reducing resistance to treatments already used in proliferative disorders, such as cancer, and improving the efficacy of classical treatments such as radiotherapy .
25 DESCRIPTION OF THE INVENTION
The inventors have discovered that variants (also called mutants) of the non-virionic protein (NV) of the Oncorhynchus 2 novirhabdovirus virus (known as viral septicemic hemorrhage virus, HSVV) comprising SEQ ID NO: 2, and 30 which is encoded by the nucleotide sequence comprising SEQ ID NO: 1, it inhibits the gene and protein expression of genes and proteins involved in cell proliferation and in the cell cycle, such as MAPK pathway proteins, inflammatory proteins and cyclin, respectively. Additionally, the variants of the NV protein of the VHSV virus described in the present invention induce an increase in cell death of the cells that express them and therefore, such variants may be useful in the treatment of proliferative disorders, such as Cancer,
being used in antitumor therapies either alone and / or in combination with others
anti-tumor therapies The variants described in the present invention are capable of improving the effectiveness of antitumor treatments, including those resistant to radiotherapy.
To demonstrate the effectiveness of the polypeptide variants described in the present invention, the inventors transfected different tumor and notumoral cell lines with a vector containing the different polypeptides described herein, and observed that the expression of said variants inhibited the protein activity of the
10 via MAPK, inflammatory proteins and cyclines, and as a consequence of such inhibition, a lower cell proliferation occurred and an increase in cell death is also induced.
The use of the polypeptide variants described in the present invention have the
The added advantage that it is possible to join cell internalization sequences so that, when administered to an individual, they can be internalized in the cell to exert their effect without the need for gene therapy techniques.
Based on this discovery, a series of inventive aspects 20 have been developed which are described below.
Polypeptides of the invention
In a first aspect, the present invention relates to polypeptide variants
25 of the NV protein of the VHSV virus comprising SEO ID NO: 2, and which is encoded by the nucleotide sequence comprising SEa ID NO: 1, wherein said polypeptide variants comprise at least 99% identity with the SEO sequence ID NO: 2, or a functionally equivalent variant thereof.
In the context of the present invention, "polypeptide" means a molecule formed by the binding, in a defined order, of alpha-amino acids via a peptide bond, and includes modifications or derivatives thereof, for example, glycosylation, phosphorylation, acetylation , amidation, etc. The amino acids of the pOlipypeptide of the invention, depending on the orientation of the amino group carrying the carbon atom
35 alpha, can belong to the L series or the O series.
The polypeptide of the invention can be obtained by techniques widely known in the state of the art, such as chemical synthesis, genetic recombination, expression of the polynucleotide encoding the polypeptide of the invention, etc. All these techniques are routine practice for the person skilled in the art.
Additionally, the carboxyl and amino terminal ends of the polypeptide of the invention may be protected against proteolysis. For example, the amino terminal end may be in the form of an acetyl group and / or the carboxyl end may be in the form of an amide group. It is also possible to carry out 10 internal modifications of the peptides so that they are resistant to proteolysis. Examples of these internal modifications include, but are not limited to, modifications in which at least one peptide bridge -CONH- is modified and replaced by a reduced bond (CH2NH), a retroinverse bond (NHCO), an oxymethylene bond (CH2-0) , a thiomethylene bond (CH2-S), a ketomethylene bond (CO-CH2), a hydroxyethylene bond (CHOH-CH2), a bond (NN), an E-alcene bond or a CH = CH- bond. The peptides can also be stabilized by intramolecular crossing, for example, by modifying at least two amino acid residues with oleophin side chains, preferably, C3-C8 alkenyl chains, preferably, pentel-2-yl chains, followed by crosslinking of the chains
20 as described in the technology called "staple" (Walensky et al., 2004, Science 205: 1466-1470). All of these chemically modified peptides to resist proteolysis are also contemplated within the present invention.
Additional modifications to the polypeptide of the invention comprise binding
Covalent to a polyethylene glycol (PEG) molecule by its terminal carboxyl end or to a lysine residue, in order to decrease its urinary elimination and therapeutic dose, and increase the half-life of the polypeptide in the blood plasma. The half-life of the polypeptide can also be increased by including the polypeptide in a biodegradable and biocompatible polymeric material to form
30 microspheres that are used as a drug delivery system. Polymers and copolymers include, but are not limited to, poly (D, L-I-co-glycolic acid) or PLGA. The techniques and procedures of how to manufacture lipid microspheres or nanocapsules for use in the administration of drugs are widely known to those skilled in the art. Any method of administration of targeted drugs
Selectively a tumor population can be employed in the context of the present invention.
For the purposes of the present invention, the term "variant" or "mutant" used interchangeably throughout the present invention and referred to NV proteins of HSVV viruses and having at least one mutation, as described herein. invention and which result in a greater activity in the inhibition of cell proliferation, modifying the expression of proteins of the MAPK pathway and the cell cycle, as well as in an increase in cell death, with respect to the NV-type protein
wild-type of the VHSV virus.
The variants or polypeptide mutants of the NV protein of the HSVV virus described in the present invention comprise the substitution of the natural amino acid present in any of positions 33 to 41 of SEO ID NO: 2, by the amino acid alanine (A), giving rise to the variants described in Table 2.
15 Table 2.
Name MutationNucleotide sequencePolypeptide sequence
wt-NV -SEO ID NO: 1SEO ID NO: 2
VHSV (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACTTTGATCGG TCGGACATATCCACCGTGG ACTTCTTTGAAACGACCCTC CCCAGGATCCTAGATGATCT GAGGGCCAGTACACGGCTT CCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG(MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLNCOF DRSDISTVOFFETTLPRILO DLRASTRLPHLHVLOMRIS LLERTHYMFRNVPSSPAT TGRLTDPGLVIISHAEVGLL TRGSGLTS)
Name MutationNucleotide sequencePolypeptide sequence
TGGGGCTATTGACAAGAGG CTCTGGGCTCACCTCCTGA)
NV33 L33ASEO ID NO: 3 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACg ctAACTGTGACTTTGATCGGT CGGACATATCCACCGTGGA CTTCTTTGAAACGACCCTCC CCAGAATCCTAGATGATCTG AGGGCCAGTACACGGCTTC CTCACCTCCATGTGCTCGA CATGAGGATAAGTCTCCTAG AGAGAACCCACTACATGTTC AGGAACGTCCCCTCTAGTC CCGCCACAACCGGTAGGCT GACAGATCCTGGACTCGTC ATCATTTCACATGCAGAGGT GGGGCTATTGACAAGAGGC TCTGGGCTCACCTCCGCTA GCTCCGGAGTTTAA)SEO ID NO: 4 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNY8 NCD FD RSDI STVDFFETTLPRIL DDLRAS TRLPH LHVLD MRI SLLERTHYMFRNVPSSPA TTGRLTD PGLVIIS HAEVG LL TRGSGLTSASSGV)
NV34 N34ASEO ID NO: 5 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCGCCTGTGACTTTGATCG GTCGGACATATCCACCGTGACGGGCCGGGGGGGGGGGSEO ID NO: 6 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLACDF DRSDISTVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FRNVPSS PAT TGRLTD PGLVIIS HAEVG LL TRGSGLTSASSGV)
Name MutationNucleotide sequencePolypeptide sequence
TCCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG TGGGGCTATTGACAGAGGGGCTCGAGGGG)
NV35 C35ASEO ID NO: 7 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACGCCGACTTTGATCG GTCGGACATATCCACCGTG GACTTCTTTGAAACGACCCT CCCCAGAATCCTAGATGATC TGAGGGCCAGTACACGGCT TCCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG TGGGGCTATTGACAAGAGG CTCTGGGCTCACCTCCGCT AGCGCTAGCTCCGGAGTTT AA)SEO ID NO: 8 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLN8 DF DRSDISTVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLE RTH YM FR NVPSS PAT TGRLTD PGLVIIS HAEVG LL TRGSGLTSASASSGV)
NV36 D36ASEO ID NO: 9 (ATGGCGACCCAACCCGGGSEO ID NO: 10 (MATOPGLSTTSFSPLVLR
Name NV37 Mutation Nucleotide sequence CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTgctTTTGATCGGT CGGACATATCCACCGTGGA CTTCTTTGAAACGACCCTCC CCAGAATCCTAGATGATCTG AGGGCCAGTACACGGCTTC CTCACCTCCATGTGCTCGA CATGAGGATAAGTCTCCTAG AGAGAACCCACTACATGTTC AGGAACGTCCCCTCTAGTC CCGCCACAACCGGTAGGCT GACAGATCCTGGACTCGTC ATCATTTCACATGCAGAGGT GGGGCTATTGACAAGAGGC TCTGGGCTCACCTCCGCTA GCTCCGGAGTTTAA) F37A SEO ID NO: 11 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACGCCGATCG GTCGGACATATCCACCGTG GACTTCTTTGAAACGACCCT CCCCAGAATCCTAGATGATC TGAGGGCCAGTACACGGCT TCCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT polypeptide sequence EMITHRLKFD PSNYLNCAF DRSDISTVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FR NVPSS PAT TGRLTD PGLVIIS HAEVG LL TRGSGLTSASSGV) SEO ID NO: 12 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLNCD 8 DRSDISTVDFFETTLPRIL DDLRAS TRLPH LHVLD MRI SLLERTHYMFRNVPSSPA TTRL D PGLVIIS HAEVG LL TRGSGLTSASSGV)
Name MutationNucleotide sequencePolypeptide sequence
CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG TGGGGCTATTGACAAGAGG CTCTGGGCTCACCTCCGCT AGCTCCGGAGTTTAA)
NV38 D38ASEO ID NO: 13 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACTTTGCCCG GTCGGACATATCCACCGTG GACTTCTTTGAAACGACCCT CCCCAGAATCCTAGATGATC TGAGGGCCAGTACACGGCT TCCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG TGGGGCTATTGACAAGAGG CTCTGGGCTCACCTCCGCT AGCTCCGGAGTTTAA)SEO ID NO: 14 (MATOPGLSTTSFSPLVLR EMITHR LKFDPSNYLNCDF 8 RSDISTVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FR NVPSS PAT TGRLTD PGLVIIS HAEVG LL TRGSGLTSASSGV)
NV39 R39ASEO ID NO: 15 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACTTTGATgetTSEO ID NO: 16 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLNCDF DASDI STVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FRNVPSS PAT TGRLTD PGLVIIS HAEVG LL
Name NV40 Mutation Nucleotide sequence CGGACATATCCACCGTGGA CTTCTTTGAAACGACCCTCC CCAGAATCCTAGATGATCTG AGGGCCAGTACACGGCTTC CTCACCTCCATGTGCTCGA CATGAGGATAAGTCTCCTAG AGAGAACCCACTACATGTTC AGGAACGTCCCCTCTAGTC CCGCCACAACCGGTAGGCT GACAGATCCTGGACTCGTC ATCATTTCACATGCAGAGGT GGGGCTATTGACAAGAGGC TCTGGGCTCACCTCCGCTA GCTCCGGAGTTTAA) S40A SEO ID NO: 17 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACTTTGATCGG GCCGACATATCCACCGTGG ACTTCTTTGAAACGACCCTC CCCAGAATCCTAGATGATCT GAGGGCCAGTACACGGCTT CCTCACCTCCATGTGCTCG ACATGAGGATAAGTCTCCTA GAGAGAACCCACTACATGTT CAGGAACGTCCCCTCTAGT CCCGCCACAACCGGTAGGC TGACAGATCCTGGACTCGT CATCATTTCACATGCAGAGG TGGGGCTATTGACAAGAGG CTCTGGGCTCACCTCCGCT polypeptide sequence TRGSGLTSASSGV) SEO ID NO: 18 (MATQPGLSTTSFSPLVLR EMITHRLKFDPSNYLNCDF DRADISTVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FR NVPSS PAT TGR LTD PG LVII SHAEVG LL TRGSGLTSASSGV)
Name MutationNucleotide sequencePolypeptide sequence
AGCTCCGGAGTTTAA)
NV41 D41ASEO ID NO: 19 (ATGGCGACCCAACCCGGG CTCAGCACAACCAGCTTCTC TCCGCTCGTCCTCCGTGAG ATGATCACACACAGACTCAA ATTTGACCCAAGCAACTACC TCAACTGTGACTTTGATCGG TCGgccATATCCACCGTGGA CTTCTTTGAAACGACCCTCC CCAGAATCCTAGATGATCTG AGGGCCAGTACACGGCTTC CTCACCTCCATGTGCTCGA CATGAGGATAAGTCTCCTAG AGAGAACCCACTACATGTTC AGGAACGTCCCCTCTAGTC CCGCCACAACCGGTAGGCT GACAGATCCTGGACTCGTC ATCATTTCACATGCAGAGGT GGGGCTATTGACAAGAGGC TCTGGGCTCACCTCCGCTA GCTCCGGAGTTTAA)SEO ID NO: 20 (MATOPGLSTTSFSPLVLR EMITHRLKFDPSNYLNCDF DRSAI STVDFFETTLPRILD DLRASTRLPHLHVLDMR IS LLERTH YM FRNVPSS PAT TGRLTD PGLVIIS HAEVG LL TRGSGLTSASSGV)
Therefore, the invention relates to a polypeptide, hereinafter polypeptide of the invention, comprising an amino acid sequence having an identity of
5 sequence of at least 99% with SEO ID NO: 2, and also comprises at least one substitution of the natural amino acid between positions 33 to 41 of SEO ID NO: 2 by the amino acid alani na (A), or a functionally equivalent variant thereof.
In a particular embodiment, the polypeptide of the invention comprises an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a substitution of the amino acid aspartic acid
(O) original by alanine (A) at position 41 (041A). In a more preferred embodiment, the polypeptide of the invention is characterized in that it comprises SEO ID NO: 20, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises a sequence.
5 amino acids that have a sequence identity of at least 99% with theSEO ID NO: 2, and also includes a substitution of the amino acid leucine (L)original by alanine (A) at position 33 (L33A). In a more preferred embodiment thePolypeptide of the invention is characterized in that it comprises SEO ID NO: 4, or afunctionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a replacement of the original asparagine (N) amino acid with alanine ( A) at position 34 (N34A). In a more preferred embodiment the
Polypeptide of the invention is characterized in that it comprises SEO ID NO: 6, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence having a sequence identity of at least 99% with the
20 SEO ID NO: 2, and further comprises a replacement of the original amino acid cysteine (C) with alanine (A) at position 35 (C35A). In a more preferred embodiment, the polypeptide of the invention is characterized in that it comprises SEO ID NO: 8, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a substitution of the amino acid aspartic acid.
(D) original by alanine (A) at position 36 (D36A). In a more preferred embodiment
The polypeptide of the invention is characterized in that it comprises SEO ID NO: 10, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a substitution of the original leucine amino acid (L) for phenylalanine. (F) at position 37 (F37 A). In a more preferred embodiment
The polypeptide of the invention is characterized in that it comprises SEO ID NO: 12, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence 5 that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a substitution of the amino acid aspartic acid
(D) original by alanine (A) at position 38 (D38A). In a more preferred embodiment, the polypeptide of the invention is characterized in that it comprises SEO ID NO: 14, or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and further comprises a substitution of the original amino acid arginine (R) for alanine ( A) at position 39 (R39A). In a more preferred embodiment the
Polypeptide of the invention is characterized in that it comprises SEO ID NO: 16., or a functionally equivalent variant thereof.
In another particular embodiment, the polypeptide of the invention comprises an amino acid sequence having a sequence identity of at least 99% with the
20 SEO ID NO: 2, and further comprises a substitution of the original serine amino acid (S) with alanine (A) at position 40 (S40A). In a more preferred embodiment, the polypeptide of the invention is characterized in that it comprises SEO ID NO: 18, or a functionally equivalent variant thereof.
In a still more preferred embodiment, the polypeptide of the invention is selected from the list consisting of: SEO ID NO: 10, SEO ID NO: 16, SEO ID NO: 20, or a functionally equivalent variant thereof. More preferably, the polypeptide of the invention comprises SEO ID NO: 20, or a functionally equivalent variant thereof.
The Rhabdoviridae family of viruses, particularly the genus Novirhabdovirus, groups four species called Oncorhynchus 1 novirhabdovirus (known as infectious hematopoietic necrosis virus, IHNV), Oncorhynchus 2 novirhabdovirus (known as viral septicemic hemorrhage virus, HSVV), 35 Hira Novirhabdovirus (HIRV) and Snakehead Novirhabdovirus (SHRV). Virus infections of this genus affect more than 50 species of wild fish
(Brudeseth, BE AND O. Evensen, Ois Aquat Organ, 2002. 52 (1): 21-28) and fish farm (Skall, HF, al. J Fish Ois, 2005. 28 (9): 509-529) , producing large economic losses in commercial species. Novirhabdoviruses are negative polar RNA viruses whose genome codes for five virion proteins (N, P, M, G and 5 L) and for the NV protein. The presence of the gene coding for the NV protein is a common characteristic of all viruses belonging to this genus, and that is why they have been classified as novirhabdovirus, unlike other rhabdoviruses, such as the SVCV virus (spring virus of the carp) that lacks the NV protein. NV protein is necessary for efficient replication of novirhabdoviruses
10 IH NV and VHSV in trout and Japanese flounder (Paralichthys olivaceus), respectively. On the other hand, SHRV NV protein is not necessary for efficient replication of this virus in hot water fish.
In the present invention, "identity" or "sequence identity" is understood as
15 degree of similarity between two nucleotide or amino acid sequences obtained by aligning the two sequences. Depending on the number of common residues between the aligned sequences, a degree of identity expressed as a percentage will be obtained. The degree of identity between two amino acid sequences can be determined by conventional methods, for example, by
20 standard sequence alignment algorithms known in the state of the art, such as BLAST (Altschul S.F. et al. J Mol Biol. 1990 Oct 5; 215 (3): 403-10). The BLAST programs, for example, BLASTN, BLASTX, and TBLASTX, BLASTP and TBLASTN, are in the public domain on the website of The National Genter for Biotechonology Information (NCBI).
The introduction of the polypeptide into the cell can be done by any of the procedures known in the state of the art, such as direct injection, electroporation, transfection, transformation, etc. but these are relatively complex techniques and with limitations when they have to be applied in vivo and
30 access the entire population of tumor cells or that have uncontrolled cell proliferation. In case the polypeptide is to be administered to an individual, the polypeptide can be introduced into the cell by means of gene therapy techniques thanks to the use of viral vectors, or by means of cellular internalization sequences that allow the polypeptide to cross the plasma membrane.
Thus, in a particular embodiment, the polypeptide of the invention is covalently linked to an amino acid sequence of cellular internalization.
In the present invention, "amino acid sequence of"
5 cell internalization "or" cell internalization sequence "or" peptides ofcellular penetration "(CPPs) to amino acid sequences that possess the abilityof transporting molecules across the plasma membrane, without loss of theirintegrity. Among the most used sequences are TAT, Antennapedia(Antp) and oligo-arginines, whose characteristic in common is the presence of groups of
10 cationic amino acids. These internalization sequences allow internalization of the polypeptide directly to the cell. As the person skilled in the art understands, the cell internalization polypeptide can come from a natural source,
or it can come from chemical synthesis and be an artificial sequence that does not exist in
nature. Likewise, the cell internalization polypeptide can be linked to 15 markers (for example, without limiting, fluorophors) that facilitate its localization.
The cell internalization sequence may be linked to the polypeptide of the invention to both the amino terminal and the carboxyl terminal of the polypeptide.
As previously indicated, the pOlipypeptide of the invention can be obtained by techniques widely known in the state of the art, such as expression in a cell of the polynucleotide encoding the polypeptide of the invention, and its subsequent isolation. Therefore, in another aspect, the invention relates to a
25 polynucleotide, hereinafter "polynucleotide of the invention", which encodes the polypeptide of the invention.
The term "polynucleotide," as used in the present invention, refers to a polymeric form of nucleotides of any length and formed by ribonucleotides.
30 and / or deoxyribonucleotides. The term includes both single chain and double chain polynucleotides, as well as modified polynucleotides, that is, methylated, protected polynucleotides and the like. The polynucleotide of the invention can be DNA, RNA or cDNA.
In a second aspect the present invention therefore relates to the polynucleotide encoding the polypeptide of the invention. In a preferred embodiment, the polynucleotide of the invention is selected from the list consisting of: SEO ID NO: 3, SEO ID NO: 5, SEO ID NO: 7, SEO ID NO: 9, SEO ID NO: 11, SEO ID NO: 13, SEO ID NO: 15, SEO ID NO: 17, SEO ID NO: 19 and / or any combination thereof. In yet another more preferred embodiment, the polynucleotide of the invention is selected.
5 from the list consisting of SEO ID NO: 9, SEO ID NO: 15 and SEO ID NO: 19. In yet another preferred embodiment, the polynucleotide of the invention is the SEO polynucleotide ID NO: 19.
In another aspect, the invention relates to a gene construct, hereinafter "gene construct of the invention", which comprises the polynucleotide of the invention.
Preferably, the gene construct of the invention comprises the polynucleotide of the invention operably linked to regulatory sequences of the expression of the
15 polynucleotide of the invention. In principle, any promoter can be used in the gene constructs of the present invention, provided that said promoter is compatible with the cells in which it is desired to express the polynucleotide.
A promoter, or promoter region, is a nucleotide sequence that controls the transcription of a particular gene (nucleotide sequences). In the present invention it refers to a nucleotide sequence that controls the transcription of the polynucleotide of the invention. Promoter sequences can be unidirectional or bidirectional. A unidirectional promoter is one that controls the transcription of one gene or more genes that are placed in tandem with the first. A tandem UE "means that the 3 'end of the first gene is followed, either consecutively or separated by a particular nucleotide sequence, by the 5' end of the second gene. A bidirectional promoter refers to the promoter region that controls transcription in two opposite directions, that is, that a bidirectional promoter directs the transcription of two genes located divergently, that is in the opposite direction, the 5 'end of both nucleotide sequences being closer to each other than the 3' end. the present invention uses the terms "promoter" and "promoter region" interchangeably. In addition, the promoters in the present invention may be constitutive or inducible. The term "inducible", as used herein, refers to the possibility that the promoter has a control element that allows activating or deactivating
(repress) the transcription of the gene that regulates, in the presence of a factor external to the
promoter.
Additionally, the gene construct of the invention may contain markers or 5 tags that allow isolation of the polypeptide of the invention once it is
synthesized in the cell.
On the other hand, the polynucleotide or gene construct of the invention may be part of a vector. Thus, in another aspect, the invention relates to a vector, hereinafter "vector of the invention", which comprises the polynucleotide or the gene construct of the invention.
The person skilled in the art will appreciate that there is no limitation as to the type of vector that can be used, since said vector may be a suitable cloning vector for propagation or an expression vector. Thus, suitable vectors according to the present invention include, but are not limited to, (i) prokaryotic expression vectors
such as pUC18, pUC19, Bluescript and its derivatives, mp18, mp19, pBR322, pMB9, Col El, pCRI, RP4, lakes and shuttle vectors such as pSA3 and pAT28, (ii) vectors of expression in yeasts such as 2 micron plasmid type vectors,
20 integration plasmids, YEP vectors, centromeric plasmids and the like, (iii) insect cell expression vectors such as pAC series and pVL series vectors, (iv) plant expression vectors such as plant vectors plBI series, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE and the like and
(v) expression vectors in upper eukaryotic cells well based on viral vectors, including, but not limited to, adenoviruses, adenovirus-associated viruses as well as retroviruses and lentiviruses, as well as non-viral vectors among which
including, but not limited to, pSilencer 4.1-CMV (Ambion), pcDNA3, pcDNA3.1 / hyg
pHCMVIZeo, pCR3.1, pEFVHis, pIND / GS, pRcJHCMV2, pSV401Ze02, pTRACER HCMV, pUB6N5-His, pVAXI, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and 30.
The vector of the invention can be used to transform, transfect or infect cells capable of being transformed, transfected or infected by said
vector.
35 Such cells can be prokaryotic or eukaryotic. By way of example, the vector where said DNA sequence is introduced can be a plasmid or a vector that, when introduced into a host cell, is integrated into the genome of said cell and replicated together with the chromosome / s in the / those that have been integrated. The
Obtaining said vector can be carried out by conventional methods known to those skilled in the art.
Therefore, in another aspect, the invention relates to a cell, hereinafter "cell of the invention", comprising a polypeptide, a polynucleotide, a gene construct or a vector according to the present invention, for which said cell has been able to be transformed, transfected or infected with the construct or vector provided by this invention. Transformed, transfected or infected cells can be obtained by conventional methods known to those skilled in the art. In a particular embodiment, said host cell is a
An animal cell, preferably a mammalian cell and more preferably a human cell, transfected or infected with an appropriate vector.
Suitable host cells for expression of the polypeptide of the invention include, without limitation, mammalian cells, plant cells, insect cells, fungal cells and bacterial cells. Mammalian cells suitable for the present invention include epithelial cell lines (swine, human, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinomas (human, etc.). .), glial cells (murine, human, etc.), liver cell lines (mono, etc.), CHO cells (Chinese
25 Hamster Ovary), COS cells, BHK cells, HeLa cells, 911, AT1080, A549, 293 or PER.C6, human ECCs 5 NTERA-2 cells, D3 cells of the mESCs line, human embryonic stem cells such as HS293 and BGV01, SHEF1, SHEF2 AND HS181, NIH3T3, 293T, REH and MCF-7 cells and hMSCs (human mesenchymal stem cells), and GliNS2 (glioma stem cells) cells.
Uses of the polypeptide of the invention
The inventors have discovered that the NV protein of the VHSV virus (SEO ID NO: 2), as well as the variants or mutants that are derived from said protein and that are described in the present invention, and more particularly the SEO ID NO variants : 10, 16 and 20, more particularly the SEO ID NO: 20 variant, are capable of
inhibit cell proliferation, by cell arrest in the G2 / M phase, in particular, to inhibit the proliferation of tumor cells, preferably HeLa cells, and also to promote cell death of cells expressing said variants, which allows the use of the polypeptides of the invention in the treatment of disorders
5 proliferative, such as tumors or cancer, present in a subject.
Thus, in another aspect, the invention relates to the use of a polypeptide that
comprises an amino acid sequence that has a sequence identity of at
minus 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEO ID
10 NO: 2, in preparation of a medicine. Alternatively, the present invention relates to a polypeptide comprising an amino acid sequence having a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEO ID NO: 2 for use as a medicine. The techniques and procedures for developing medications are described below.
Thus, in another aspect, the invention relates to the use of a polypeptide comprising an amino acid sequence having a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%. , 96%, 97%, 98% or 99% with SEO ID NO: 2, in preparation of a drug for the prevention and / or treatment of
20 tumors, cell proliferation and / or metastasis. Alternatively, the present invention relates to a pOlipypeptide comprising an amino acid sequence having a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with SEO ID NO: 2 for use as a medicine for the prevention and / or treatment of tumors, cell proliferation and / or metastasis. The
25 techniques and procedures for developing medications are described below.
In a preferred embodiment of these aspects of the invention, the polypeptide comprises SEO ID NO: 2. In another preferred embodiment, the polypeptide is a polypeptide comprising an amino acid sequence having an identity of
30 sequence of at least 99% with SEO ID NO: 2, and also a replacement of the original aspartic acid (D) amino acid with alanine (A) at position 41 (D41A), or a replacement of the aspartic acid amino acid (D ) original by alanine (A) at position 36 (D36A), or a substitution of the original amino acid arginine (R) by alanine (A) at position 39 (R39A).
In another preferred embodiment of the uses of the polypeptides of the invention, these are characterized in that the pOlipypeptide is selected from the list consisting of SEO ID NO: 10, SEO ID NO: 16 or SEO ID NO: 20. In another embodiment Even more preferred, the polypeptide is the polypeptide comprising SEO ID NO: 20.
In another preferred embodiment of the uses of the polypeptides of the invention, these are
characterized by the fact that the tumors are benign or malignant and / or to prevent
cell proliferation and / or prevent metastasis.
In the present invention, "treatment" is understood as the set of means that are used to treat, alleviate or cure a disease, in particular, diseases that occur with proliferative disorders, such as tumors or cancer.
In this report "proliferative disorders" means any growth of a
15 tissue by uncontrolled proliferation of cells, such as, for example, benign prostatic hyperplasia, familial adenomatosis, polyposis, neurofibromatosis, psoriasis, vascular smooth cell proliferation associated with atherosclerosis, pulmonary fibrosis, arthritis, glomerulonephritis and stenosis and post-surgical restenosis. Proliferative disorders, also sometimes called tumors, can be
20 benign or malignant. A tumor is considered benign when the cells that make up the tumor do not invade other tissues or cause metastases in other parts of the body. Normally, the benign tumor is well encapsulated and the cells have no structure changes. On the contrary, a tumor is considered to be malignant when the cells that form the tumor invade adjacent tissues, which
25 is known as metastasis, and its cells have anaplasia. In general, malignant tumors are known as cancer. Thus, in a particular embodiment, "malignant proliferative disorders" or "malignant tumors" comprise, but is not limited to: carcinoma such as bladder, breast, colon, kidney, liver, lung, including small cell lung cancer, esophagus, gallbladder, ovary, pancreas,
30 stomach, cervix, thyroid, prostate and skin, including squamous cell carcinoma; hematopoietic tumors of lymphoid lineage, including leukemia, acute lymphocytic leukemia, acute lymphoblastic leukemia, B-cell lymphoma, T-cell lymphoma, Hodgkin lymphoma, non-Hodking lymphoma, hair cell lymphoma, and Burkett lymphoma; hematopoietic tumors of myeloid lineage, including leukemia s
35 acute and chronic myelogenous, myelodysplastic syndrome and promyelocytic leukemia; tumors of mesenchymal origin, including fibrosarcoma and rhabdomyosarcoma; tumors of the central and peripheral nervous system, including astrocytoma, neuroblastoma, glioma and schwannommas; other tumors, including melanoma, semi-noma, teratocarcinoma, osteosarcoma, pigmentary xeroderma, keratoacanthoma, thyroid follicular cancer and Kaposi's sarcoma.
It is known in the state of the art of the existence of tumor or cancerous stem cells that, in addition to possessing the typical properties of a stem cell, that is, self-renewal and the ability to differentiate into multiple types of cells, are resistant to Conventional treatments and persist in tumors as a distinct population, causing relapse and metastasis of the tumor by giving rise or origin to new tumors. Thus, in a particular embodiment, the tumor comprises stem cells, in particular tumor stem cells.
In addition to the therapeutic applications that the peptides of the invention may have and the inventive aspects derived therefrom, their application in experimental in vitro tests is also possible. Therefore, in another aspect, the invention relates to the use of the polypeptides described in this section as a reagent to inhibit cell proliferation in vitro.
Thus another aspect of the invention relates to the use of a polypeptide comprising an amino acid sequence having a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% with SEO ID NO: 2, as a reagent to inhibit cell proliferation in vitro. In a more preferred embodiment, the polypeptide comprises SEO ID NO: 2.
In another more preferred embodiment of this aspect of the invention the polypeptide comprises the polypeptides, polynucleotides, the gene construct, the vector or the cell of the invention. In another more preferred embodiment, the polypeptide comprises the sequences of the list consisting of: SEO ID NO: 10, 16 or 20. In yet another more preferred embodiment, the polypeptide comprises SEO ID NO: 20.
In the present invention, "inhibition of cell proliferation" is understood as the reduction, decrease, attenuation or blockage of cell division or cycle.
In the present invention, "subject" means any animal, preferably
a mammal, more preferably a primate, in particular, a human being, of any race, sex or age.
Another aspect of the present invention relates to the use of a polypeptide thatcomprises an amino acid sequence that has a sequence identity of atminus 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% with SEO ID NO:2, as a reagent to inhibit the expression of inflammatory proteins in vitroselected from the list consisting of: mx, ERK-1 and IL-8; or the activity of
10 cell cycle regulatory proteins selected from the list consisting of cyclin 8 and A. In a preferred embodiment of the present aspect of the invention, this is characterized in that the polypeptide comprises SEQ ID NO: 2. In a more preferred embodiment, The pOlipypeptide of the invention is characterized in that it inhibits the expression of ERK-1 and cyclines A and 8.
In another preferred embodiment, this aspect of the invention is characterized in that the polypeptide comprises at least one of the polypeptides of the present invention, more preferably it comprises a polypeptide comprising an amino acid sequence having a sequence identity of at least one 99% with SEO ID
20 NO: 2 and a substitution of the original aspartic acid (O) amino acid with alanine (A) at position 41 (041A), or a substitution of the original aspartic acid (O) amino acid with alanine (A) at position 36 (D36A ), or a substitution of the original amino acid arginine (R) with alanine (A) at position 39 (R39A). In another more preferred embodiment the polypeptide comprises SEO ID NO: 10, 16, 20 and / or any of its
25 combinations
Pharmaceutical Composition of the Invention
As explained in the previous inventive aspect, the polypeptide, polynucleotide, genetic construct, vector or cell of the invention can be used in the preparation of a pharmaceutical composition.
Therefore, in another aspect, the invention relates to a pharmaceutical composition, hereinafter, pharmaceutical composition of the invention, which comprises a polypeptide having a sequence identity of at least 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% with SEO ID NO: 2, as
describes in the present invention, in a therapeutically effective amount, and a pharmaceutically acceptable carrier.
In the present invention, "pharmaceutical composition" or "medicament" is understood
5 to any preparation or pharmaceutical form, whose formula of composition expressed in units of the international system, is constituted by a substance or mixture of substances, with constant weight, volume and percentages, elaborated in legally established pharmaceutical laboratories, packaged or labeled to be distributed and marketed as effective for diagnosis, treatment, mitigation and prophylaxis of
10 a disease, physical abnormality or symptom, or the restoration, correction or modification of the balance of the organic functions of human beings and animals. The preparation of the pharmaceutical composition can be carried out by any of the methods described in the state of the art.
The dosage to obtain a therapeutically effective amount depends on a variety of factors, such as age, weight, sex or tolerance, of the mammal. In the sense used in this description, the term "therapeutically effective amount" refers to the minimum amount of the compound or pharmaceutical composition of the invention necessary to produce the effect.
20 desired and, in general, will be determined, among other factors, by the characteristics of said compound or said pharmaceutical composition and the therapeutic effect to be achieved. "Adjuvants" and / or "pharmaceutically acceptable carriers" that can be used in the compositions of the invention are widely known in the state of the art.
In the present description, the term "vehicle" refers to a diluent or excipient with which the active ingredient is administered. Such pharmaceutical vehicles may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, or may proceed from a natural source
or be a diluent or excipient that does not exist naturally. Preferably water or aqueous solutions of saline solution and aqueous solutions of dextrose and glycerol are used as vehicles, particularly for injectable solutions. Preferably, the vehicles of the invention are approved by the
35 regulatory agency of a state or federal government or are listed in the United States Pharmacopoeia or other pharmacopoeia generally recognized for use in animals, and more particularly in humans. The vehicles and auxiliary substances necessary to manufacture the desired pharmaceutical form of administration of the pharmaceutical composition of the invention will depend, among other factors, on the pharmaceutical form of administration chosen. Said pharmaceutical forms of
Administration of the pharmaceutical composition will be manufactured according to conventional methods known to those skilled in the art.
In a preferred embodiment of the pharmaceutical composition of the invention, this is characterized in that the polypeptide comprises SEO ID NO: 2.
In another preferred embodiment of the composition of the invention, it is characterized in that the polypeptide has a sequence identity of at least 99% with SEO ID NO: 2, and also a replacement of the original aspartic acid (O) amino acid by alanine (A) at position 41 (041A), or a substitution of the amino acid aspartic acid
15 (O) original by alanine (A) at position 36 (036A), or a substitution of the original amino acid arginine (R) by alanine (A) at position 39 (R39A). Preferably, the polypeptide comprises SEO ID NO: 20, SEO ID NO: 10, SEO ID NO: 16 and / or any combination thereof. In a more preferred embodiment, the pharmaceutical composition of the invention may further comprise at least one
20 of the polypeptides that are selected from the list consisting of: SEO ID NO: 22, SEO ID NO: 26 and / or any combination thereof.
The compositions of the present invention can be formulated for administration to an animal, and more preferably to a mammal, including man, in a variety of ways known in the state of the art. Thus, they can be, without being limited to, in aqueous or non-aqueous solutions, in emulsions or in suspensions. Alternatively, the compositions can be prepared for administration in solid form. The compositions may be combined with various inert vehicles or excipients, including but not limited to: binders,
30 excipients, dispersing agents, lubricants, glidants, sweetening agents, or flavoring agents. Additionally, the composition of the invention may comprise an adjuvant. By "adjuvant" is meant any substance that enhances the effectiveness of the pharmaceutical composition of the invention.
In a particular embodiment, the pharmaceutical composition of the invention further comprises a chemotherapeutic agent.
By "chemotherapeutic agent" is meant any substance that is capable of inhibiting cell proliferation without necessarily killing the cell, or that is capable of inducing cell death. Agents capable of inhibiting cell proliferation without causing cell death are generically called cytostatic agents, while those that are capable of inducing cell death normally by activating apoptosis are generically called cytotoxic agents. Non-limiting examples of chemotherapeutic agents suitable for use in the compositions of the invention include, but are not limited to, (i) microtubule stabilizing agents such as taxanes, paclitaxel, docetaxel, epothilones and laulimalides, (ii) kinase inhibitors such as Iressa (R), Gleevec, Tarceva ™, (Erlotinib Hel), BAY-43-9006, (iii) specific antibodies to receptors with kinase activity including, but not limited to, Trastuzumab (Herceptin (R)), Cetuximab (Erbitux (R) )), Bevacizumab (Avastin TM), Rituximab (ritusan (R)), Pertuzumab 15 {Omnitarg ™); (iv) mTOR pathway inhibitors, such as rapamycin and CCI-778; (v) Apo2L 1 Trail, (vi) anti-angiogenic agents such as endostatin, combrestatin, angiostatin, thrombospondin and vascular endothelial growth inhibitor (VEGI);
(vii) antineoplastic vaccines including activated T cells, nonspecific immunopotentiating agents (for example interferons, interleukins); (viii) 20 antibiotic cytotoxic agents such as doxorubicin, bleomcin, dactinomycin, daunorubicin, epirubicin, mitomycin, mitozantrone, etc; (ix) alkylating agents such as Melphalan, Carmustine, Lomustine, cyclophosphamide, ifosfamide, Chlorambucil, Fotemustine, Busulfan, Temozolomide and thiotepa; (x) antineoplastic hormonal agents such as Nilutamide, Cyproterone Acetate, Anastrozole, Exemestane, Tamoxifen, Raloxifene, Bicalutamide, Aminoglutethimide, Leuprorelin Acetate, Toremiphene Citrate, Letrozole, Flutamide, Megestrol Acetate and Gelsrel Acetate; (xi) gonadal hormones such as cyproterone acetate and medoxiprogesterone acetate; (xii) antimetabolites such as Citara bina, Fluorouracil, Gemcitabine, Topotecan, Hydroxyurea, Thioguanine, Methotrexate, Colaspase, Raltitrexedo and capicitabine; (xiii) anabolic agents such as nandrolone; (xiv) steroid adrenal hormones such as methylprednisolone acetate, dexamethasone, hydrocortisone, prednisolone and prednisone; (xv) antineoplastic agents such as Carboplatin, Cisplatin, Oxaliplatin, Etoposide and Dacarbazine e (xvi) topoisomerase inhibitors such as topotecan e
35 Irinotecano.
Such compositions and / or their formulations may be administered to an animal, including a mammal and, therefore, to man, in a variety of ways, including, but not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intrathecal, intraventricular, intraarticular. intratumoral oral enteral
5 parenteral, intranasal, ocular or topical. A preferred route of administration of the compositions and / or formulations of the compound of the invention for the prevention or treatment of a cancer is the intratumoral route. In a particular embodiment, the pharmaceutical composition of the invention is formulated for oral, parenteral, nasal or sublingual administration.
Invention kit
Administration of the pOlipypeptide of the invention requires a series of components that can be arranged together in the form of a pack or kit.
In another aspect, the invention relates to a kit, hereinafter "kit of the invention", comprising a polypeptide, a polynucleotide, a gene construct, a vector or a cell of the invention described in the above inventive aspects together to their corresponding particular embodiments.
Particularly, the kit of the invention comprises a pOlipypeptide having a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% with SEO ID NO: 2. More preferably, the polypeptide comprises SEO ID NO: 2.
In another particular embodiment of the kit of the invention, this is characterized in that the polypeptide comprises an amino acid sequence having a sequence identity of at least 99% with SEO ID NO: 2 and, in addition, a substitution of the acidic amino acid original aspartic (O) by alanine (A) at position 41 (041A), a substitution of the original aspartic acid (D) amino acid by alanine (A) at position 36 (036A), or a substitution of the amino acid arginine (R ) original by alanine (A) at position 39 (R39A). More preferably, the polypeptide is selected from the list consisting of SEO ID NO: 20, SEO ID NO: 10 or SEO ID NO: 16. In a more preferred embodiment the kit of the invention comprises SEO peptides ID NO: 2 , 20, 10 and 16.
In another more preferred embodiment, the kit of the invention further comprises peptides comprising SEO ID NO: 22 and / or SEO ID NO: 26.
Components useful for the administration of the pOlipptide of the invention and which
may be included within the kit include, but are not limited to, solution
buffer, lysis solution, sterile material (syringes, swabs, swabs, tweezers, etc.),
5 distilled water, alcohols (ethanol), etc. Additionally, the kit may contain instructions or indications that guide the person skilled in the art in the administration of the polypeptide of the invention.
In another aspect, the invention relates to the use of the kit of the invention for the
Determination of the effect of said polypeptide of the invention on the tumorigenicity of a cell line, to inhibit in vitro cell proliferation and / or to inhibit in vitro the activity of inflammatory proteins selected from the list consisting of: mx, ERK-1 and IL-8; preferably ERK-1, or the regulatory protein activity of the cell cycle selected from the list consisting of cyclin B and A.
15 The terms and expressions used in the present inventive aspect have already been defined in previous inventive aspects.
Method of treatment of the invention
In another aspect, the invention relates to a method for the treatment and / or prevention of tumors in a subject, both benign and malignant (cancer or metastasis), which comprises administering to said subject a therapeutically effective amount of the polypeptide. , of the polynucleotide, of the construction
Gene, of the vector, of the cell or of the pharmaceutical composition according to the invention.
The invention also relates to a method for inhibiting (in vivo vitrolin) the activity of inflammatory proteins selected from the list consisting of: mx, ERK-1 and IL-8; preferably ERK-1, or the cycle regulatory protein activity
30 cell selected from the list consisting of cyclin B and A.
The terms and expressions used in the present inventive aspect have already been defined in previous inventive aspects. In turn, all the particular embodiments described above in the present invention are applicable to
35 methods of the invention.
Throughout the description and claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or
Steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1. Mortality analysis of EPC cells expressing the NVGFP protein (A)
or GFP (B). Quantification of the mortality of EPC cells expressing the NVGFP or GFP (C) protein, the difference between them being statistically significant
(p <O.05).
Fig. 2. Analysis of the expression of the mx gene in ZF4 cells transfected with the plasmids encoding the native NV (wild-type) VHSV protein and the different NV mutants described in the present invention. The asterisks (*) denote statistically significant differences (p <O.05) with respect to the native NV HSV protein (wt-NV VHSV). Fig. 3. Analysis of the expression of the mx gene in ZF4 cells transfected with the plasmids encoding the native NV protein (wild-type), the different NV mutants described in the present invention and the NV proteins of IHNV, SHRV and HIRV The asterisks (*) denote statistically significant differences (p <O.05) with respect to the native NV HSV protein (wt-NV VHSV). Fig. 4. Analysis of the expression of the ILB gene in ZF4 cells transfected with plasmids encoding the native NV (wild-type) VHSV protein and the different NV mutants described in the present invention. The asterisks (*) denote statistically significant differences (p <O.05) with respect to the native NV HSV protein (wt-NV VHSV). Fig. 5. Analysis of the expression of the ccnb1 gene encoding the cyclin B1 protein in ZF4 cells transfected with plasmids encoding the VHSV native wild-type NV protein and for the different VHSV NV mutants of the invention. The graph also shows the expression of the ILB gene to see the correlation between both genes. The asterisks (*) denote statistically significant differences (p <O.05) with respect to the native NV HSV protein (wt-NV VHSV). Fig. 6. Analysis of the gene expression of ccna1, ccnd1 and dine 1 in HeLa cells after
Plasmid transfection treatment expressing NV41 protein (SEO ID
NO: 20), NV41 GFP (SEO ID NO: 64) at 96hpt or control at 48hpt (ControI48).
Fig. 7. Analysis of ccnb1 gene expression in HeLa cells after treatment
5 by transfection with plasmids expressing the NV41 protein at 48hpt and 96hpt (SEO
ID NO: 20), NV41GFP (SEO ID NO: 64), GFP (SEO ID NO: 30) at 48hpt or control at 48hpt.
Fig. 8. Analysis of erk1 gene expression in HeLa cells after treatment by
48 and 96hpt transfection with plasmids expressing the NV41 protein (SEO ID NO: 10 20), NV41 GFP (SEO ID NO: 64) or control (at 48hpt).
Fig. 9. Ct values obtained in the qPCR for gadph genes (gray bars) and
erk1 (black bars) in the analyzed samples of HeLa cells transfected with the
Plasmid NV41 (SEO ID NO: 21) at 48hpt, 96hpt and compared with a 48h control.
Fig. 10. Analysis of ERK1 kinase protein expression in HeLa 15 cells transfected with plasmids expressing GFP proteins (SEO ID NO: 30), NV41 (SEO ID NO: 20) or control at 48hpt and 96hpt. The data is normalized by GFP at 48hpt for samples at this time, and by control at 96hpt for samples at
This weather.Fig. 11. Analysis of cyclin B protein expression in transfected HeLa cells
20 with plasmids expressing GFP proteins (SEO ID NO: 30), NV41 (SEO ID NO: 20) at 48hpt and 96hpt or control at 48hpt and 96hpt. The data has been normalized with the
GFP expression at 48hpt.
Fig. 12. Analysis of cyclin A protein expression in transfected HeLa cells
with plasmids expressing GFP proteins (SEO ID NO: 30), NV41 (SEO ID NO:
25 20) or control at 48hpt and 96hpt. The data has been normalized by expressing
GFP at 48hpt.
EXAMPLES
The invention will now be illustrated by tests carried out by the inventors, which demonstrates the effectiveness of the product of the invention.
MATERIAL AND METHODS
35 Cell lines The cell lines used were HeLa, of cervical carcinoma (ATCC® CCL
2 '"), the zebrafish cell line (Oanio rerio) ZF4 (ATCC® CRL-2050'") and the line
EPC fish cell (ATCC® CRL-2872 ™). All of them were grown in a 5% C02 atmosphere, with DMEM medium: F12 (SIGMA, Spain), ZF4 and HeLa cells, and the 5 EPC cells with RPMI 1640 medium (SIGMA, Spain). The media were supplemented
with 2 mM L-glutamine (Gibco, USA), 1mM sodium pyruvate (Gibco, USA),
penicillin / streptomycin (Gibco, USA) and 10% fetal calf serum (FBS). ZF4 cells were maintained at 28 ° C and the rest of the lines at 37 ° C.
10 Plasmids used By means of standard PCR techniques (Polymerase Chain Reaction) the primary sequence of the NV gene of the VHSV-07.71 virus strain (GenBank # AJ233396: SEO ID NO: 1) was obtained. This gene was cloned into an expression vector called pMCV 1.4 comprising the cytomegalovirus promoter. From the
15 nucleotide sequence of the natural NV of the VHSV (SEO ID NO: 1), nine mutated NV proteins were obtained where each of the mutated proteins comprised the change of the original amino acid to alanine (A) between positions 33 to 41, both
inclusive, of SEO ID NO: 2. The mutants obtained are: L33A (SEO ID NO: 4), N34A (SEO ID NO: 6), C35A (SEO ID NO: 8), D36A (SEO ID NO: 10) , F37A (SEO ID 20 NO: 12), D38A (SEO ID NO: 14), R39A (SEO ID NO: 16), S40A (SEO ID NO: 18), D4 1A (SEO ID NO: 20).
The mutant proteins L33A (SEO ID NO: 4), D36A (SEO ID NO: 10) and R39A (SEO
ID NO: 16), were generated by PCR using overlapping primers, and 25 were cloned into the same vector as previously used, vector pMCV 1.4. For another
On the other hand, mutants N34A (SEO ID NO: 6), C35A (SEO ID NO: 8), F37A (SEO ID NO: 12), D38A (SEO ID NO: 14), S40A (SEO ID NO: 18) and D41A (SEO ID NO: 20)
by chemical synthesis (Invitrogen, Thermofisher, USA), and subsequently cloned into the expression vector mentioned above, the vector pMCV 1.4.
For the comparative examples included herein, the above-mentioned pMCV 1.4 vector has been used in which the nucleotide sequences encoding the NV protein of the IHNV virus have been cloned (Oregon69 strain, UniProtKB: locus NV_IHNVO, n 'Access 008455 SEO ID NO: 22), virus NV
35 SHRV (access no NC_000903.1 SEa ID NO: 24), NV of the HIRV virus (access no. U47847.1 SEO ID NO: 26) or the GFP fluorescent protein (SEO ID NO: 30).
Plasmid Transfection
ZF4 or He La cells were distributed in 24-well culture plates (SPL Life
Sciences Co., Ud) at a concentration between 50-100 x103 cells / well, 24 hours
5 before use. For the transfection of the different plasmids, indicated above, which code for the different natural and mutant NVs proteins described in the present invention, Lipofectamine 3000 was used following the manufacturer's instructions (Thermofisher, USA). ZF4 and EPC cells transfected with the different plasmids encoding native and mutant NVs proteins
10 of the present invention were collected at 48h post-transfection (hpt), while in the case of HeLa cells were collected at 48hpt and 96hpt.
RNA extraction and retrotranscription After the estimated transfection time, cells are collected from the plates of
15 culture using trypsin (Gibco, Thermofisher). Subsequently, RNA extraction is carried out through the use of the E.z.N.A.® HP Total RNA Kit (OMEGA bio-tek, USA). An additional step of DNAse incubation was performed to ensure that we completely removed the DNA from each sample. RNA quantification is carried out using Nanodrop ND1000 (Thermo
20 Scientific, USA). To obtain the cONA, an RNA back transcript was performed with the PrimeScriptlM RT reagent Kit (Takara, Japan) following the manufacturer's instructions.
IgCRCR quantitative PCR
25 For quantification of the different RNAs, these were re-transcribed to cDNAs and subsequently qPCRs were performed using different primer pairs (Table 3) and the SYBR green technology of the SYBR® Premix Ex Taq ™ commercial kit (TIi RNaseH Plus) (TAKARA, Japan), following the manufacturer's instructions. To perform the qPCR, the ASI 7500 Fast real-time PCR equipment (ASI, Thermofisher,
30 USA). The reference genes used to normalize the expression of the genes of interest have been the RPLPO gene for ZF4 cell cultures and the GADPH gene for HeLa cell cultures. The formula for obtaining the amount of expression is based on the Delta Ct method, with DeltaCt = CtRef-Ctgen and the reference genes RPLPO (ZF4) and GADPH (HeLa), and subsequently calculating the power according to the formula
35 Pot = 2-Del! Ac !.
Table 3. Sequences of the primers used in qPCR.
Gene Sense (5 ', n Antisense (5', 3 ')
rplpO (Pray) SEO ID NO: 31SEO ID NO: 32
(CACGCTGCTGAACATGCTG (AATCCTCCTIGGGTGCCTCCTC)
AAC)
mx (Pray) SEO ID NO: 33SEO ID NO: 34
(GGTCTCTGGGAGTCGAAAA (AACTCTnCCCGAGCTnGGT)
GG)
// 8 (Pray) SEO ID NO: 35SEO ID NO: 36
(AAACAGAAAGCCGACGCAT (AGCAGAGGGGTCCAGACAGAT
TGG) C)
ccnbl (Pray) SEO ID NO: 37SEO ID NO: 38
(CCGGAAAAGCAGTTGTAGC (CCTGTCGTGTTTGCGGATIG)
G)
NV (VHSV) SEO ID NO: 39SEO ID NO: 40
(AAAAAGCTIATGGCGACCC (TTTGCTAGCGGAGGTGAGCCCA
AACCCGG) GAGCC)
NV (IHNV) SEO ID NO: 41SEO ID NO: 42
(GGACCACCGCGACATAAAC (CTICAATCAGGATCAGATGTCT
AC) DC)
NV (HIRV) SEO ID NO: 43SEO ID NO: 44
(CAGCGTTGAAGGATCTGCT (GGAGGAACTCGTCTACTGGA)
GAG)
NV (SHRV) SEO ID NO: 45SEO ID NO: 46
(CCCGGCAACAACCACAATG (CCAGGAGTCGTIGTCTTCAT)
AC)
gadph SEO ID NO: 47SEO ID NO: 48
(Hasa) (CCCCTTCATTGACCTCAAC(GATGACAAGCTTCCCGTTCTC)
TAC)
mx (Hosa) SEO ID NO: 49SEO ID NO: 50
(CAGCACCTGATGGCCTATC (TGGAGCATGAAGAACTGGATGA
TO) )
i / 8 (Hasa) SEO ID NO: 51SEO ID NO: 52
(AGGTGCAGTTTTGCCAAGG (TTTCTGTGTTGGCGCAGTGT)
TO)
dinner 1 SEO ID NO: 53SEO ID NO: 54
(Hasa) (GCCATTAGTnACCTGGAC(CACTGACATGGAAGACAGGAAC
CCAGA) CT)

Gene Sense (5'-3 ') Antisense (5'-3')
ccnb1
SEO ID NO: 55
SEO ID NO: 56
(Hosa)
(AAGAGCTTT AAACTTTGGT
(CTTTGTAAGTCCTTGATTTACCA
CTGGG)
TG)
ccnd (Hosa)
SEO ID NO: 57
SEO ID NO: 58
(TGTTCGTGGCCTCTAAGAT
(AGGTTCCACTTGAGCTTGTTCA
GAAG)
C)
Dine (Hosa)
SEO ID NO: 59
SEO ID NO: 60
(GTT AT AAGGGAGACGGGG
(TGCTCTGCTTCTTACCGCTC)
AG)
erkl (Hosa)
SEO ID NO: 61
SEO ID NO: 62
(CCAGGGACATGGAATGCAA
(CCAGTGGGACCTCGATCTCC)
one )
Hosa HeLa human cell line. Dre. Lady rerlo (Zebrafish).
In the comparative study of the expression of transcripts in ZF4 with the different
5 versions of the NV protein, both native and mutant, normalized each potency value of mx by its relative power of expression. For example, for the NV41 mutant, the NV41 power potency ratio was made.
Western blot
10 In order to determine the relative amount of proteins involved in promoting tumor progression, HeLa cells transfected with plasmids expressing GFP and mutant NV41 (SEO ID NO: 20) have been used, and compared with a control of non-transfected cells. The tests were performed at 48hpt and 96hpt. Western blot (WB) was determined by monoclonal antibodies (Santa
15 Cruz Biotechnology, Ouimigen) the amount of the proteins cyclin B1 (monoclonal antibody sc-245), cyclin A (monoclonal antibody sc-271682) and the kinase ERK1 (monoclonal antibody sc-271269). Briefly, the transfected cells were collected at the mentioned study times and the total soluble protein was extracted with PBS in the presence of protease inhibitors (cOmplete ™ Protease Inhibitor
20 Cocktail, Sigma-Aldrich), through 3 freeze-thaw cycles. Once quantified by the Nanodrop 1000 spectrophotometer (Thermo Scientific, USA), 10 micrograms of total soluble protein were subjected to 10% PAGE-SDS and subsequent transfer to nitrocellulose membrane. Next, WB was carried out as standard using the concentrations of the monoclonal antibodies
25 suggested by the commercial house. WB image capture was performed with the
Gel OocTM XR + documentation system (SioRad) and the relative quantification of
Bands were performed with Image Lab software v5.2 (BioRad). The study by WS was repeated in three independent trials.
5 Flow cytometryThe viability of EPC cells (Epithe / joma Papu / osum Cyprim) was analyzed byflow cytometry with the SO FACSCANTO II cytometer (SO Siosciences, Spain) a48hpt with: (a) the plasmid expressing the GFP protein, and (b) the plasmid expressingNVGFP construction, with NV protein being the native SEO ID NO: 1 protein.
10 The results were analyzed with the FACSOiva v6.1.3 program. The study was done in duplicate.
Statistical analysis The results obtained are shown as mean ± the standard error of the mean
15 (SEM). The significant differences between the means of two, three or more data sets were calculated using ANOVA (One-way ANOVA). The differences between 2 data sets and their level of significance were calculated using the t test of
Student The criterion of statistical significance in all cases was established at p <0.05.
Example 1. The HSV NV protein (SEa ID NO: 2) increases the mortality of EPC cells.
The cellular viability of EPC cells (Epithelioma Papulosum Cyprini) was determined
25 by flow cytometry at 48h post-transfection with: (a) the plasmid comprising the SEO ID NO: 29 nucleotide sequence encoding the SEO ID NO: 30 GFP protein, and (b) the plasmid comprising the sequence nucleotide SEO ID NO: 27, which codes for the NVGFP protein of SEO ID NO: 28. The results obtained show that there is an increase in mortality (1.65
30 times) of EPC cells transfected with the plasmid encoding the NVGFP construct (SEQ ID NO: 28) with respect to EPC cells transfected with the plasmid encoding the GFP protein (SEQ ID NO: 30) (Figure 1) .
These results show that the NV protein (SEO ID NO: 2) induces an increase in mortality in the cells in which it is expressed. Example 2. The mutants of the invention inhibit the gene expression of mx and Il
8 in zebrafish cells (ZF4).
The analysis of the expression of the mx gene in ZF4 cells expressing the NV 5 protein native to VHSV, wt-NV (SEO ID NO: 2) or any of the mutants analyzed in the
Present invention: NV33 (SEO ID NO: 4), NV34 (SEO ID NO: 6), NV35 (SEO ID NO: 8), NV36 (SEO ID NO: 10), NV37 (SEO ID NO: 12), NV38 ( SEO ID NO: 14), NV39 (SEO ID NO: 16), NV40 (SEO ID NO: 18) or NV41 (SEO ID NO: 20), have revealed that the NV36 mutants (SEO ID NO: 10), NV39 (SEO ID NO: 16) and NV41
10 (SEO ID NO: 20) decrease the gene expression of mx with respect to natural NV (wt)
(Figure 2). Specifically, said mutants NV36 (SEO ID NO: 10), NV39 (SEO ID
NO: 16) and NV41 (SEO ID NO: 20) induce an inhibition of mx gene expression of the order of 3.3 times, 2 times and 5 times respectively, with respect to the protein
wt-NV. fifteen
Additionally, the expression of the mx gene in ZF4 cells expressing the NV protein of other different novirhabdoviruses such as: IHNV (SEO) was also analyzed.
ID NO: 22), snakehead rabdovirus (SHRV) (SEO ID NO: 24) and hirame rabdovirus (HIRV) (SEO ID NO: 26). The results show that SHRV NV protein
20 (SEO ID NO: 24) induces an increase in the expression of the mx gene (Figure 3). These results are consistent with the information in the state of the art where it is shown that the NV protein of this virus does not behave like the rest of NV proteins of other novirhabdoviruses (Alonso M., al. J Virol. 2004 Jun; 78 (1 1): 5875-82).
25 On the other hand, the NV proteins of IHNV (SEO ID NO: 22) and HIRV (SEO ID NO: 26) inhibit the expression of mx, even more than the natural NV of VHSV (SEO ID NO: 2), but less than the mutant NV41 (SEO ID NO: 20) (Figure 3).
In addition to the analysis of the expression of the mx gene, the expression of the ILB gene in ZF4 cells transfected with the different NV plasmids described in the present invention and mentioned above was also analyzed. The results obtained have been similar to those shown for the mx gene, the cells expressing the mutants NV36 (SEO ID NO: 10), NV39 (SEO ID NO: 16) and NV41 (SEO ID NO: 20) being 35 showing greater inhibitory capacity of the expression of the 'LB gene (Figure 4).
Example 3. The mutants of the invention inhibit the gene expression of the
cyclin 81 in zebrafish cells (ZF4).
In addition to the expression of the mx and ILB genes, it was analyzed in ZF4 cells that
5 express the different NV proteins (mutants and native) described in the invention, theexpression of the ccnb1 gene that codes for cyclin B 1, a protein that regulates a pointof control (checkpoint) G2 / M of the cell cycle and that allows mitosis of the cell.
The results show that the mutants NV35 (SEO ID NO: 8), NV36 (SEO ID
10 NO: 10), NV37 (SEO ID NO: 12), NV39 (SEO ID NO: 16) and NV41 (SEO ID NO: 20) are those with the highest inhibitory capacity of ccnb1 gene expression (Figure 5). In addition, the correlation in the same graph of the expression levels of {LB and ccnb1 is analyzed to observe the behavior of each mutant, determining that they are the mutants NV36 (SEO ID NO: 10), NV39 (SEO ID NO: 16) and NV41 (SEO ID
15 NO: 20) are those that show a greater inhibition of the expression of both genes.
Example 4. The mutant protein NV41 (SEO ID NO: 20) inhibits the gene expression of ERK1 and cyclin A and 8 in cervical cancer cells (HeLa).
20 Once the inhibitory capacity of the NV41 protein (SEO ID NO: 20) on the transcription of the cyclin B1 gene (ccnb1 gene) in zebrafish ZF4 cells was demonstrated, the effect of the mutant protein NV41 (SEO ID) was analyzed NO: 20) can cause human HeLa tumor cells. To that end, said cells were transfected with the plasmids encoding the mutant protein NV41 (SEO ID
25 NO: 20), the GFP control protein (SEO ID NO: 20) and its comparison with a control (non-transfected cells analyzed at the same times) and were cultured for 48h and 96h post-transfection. Subsequently, the expression levels of cyclins A, B, O, E, proteins that participate in the cell cycle, and ERK1 kinase, as a signaling and effector molecule of the MAPK pathway, were determined by PCR.
30 quantitative (qPCR).
The HeLa cell line study showed that the mutant protein NV41 (SEO ID NO: 20) inhibits the expression of transcripts of the ccna1 gene that codes for cyclin A1 and of transcripts of the ccnb1 gene that codes for cyclin 81, with respect to the control (untransfected cells 35) at 48hpt, and said inhibition is even greater than 96hpt (Figure 6 and 7, respectively). On the other hand, cyclin 01 (encoded by the ccnd1 gene) increases
its expression of transcripts in those HeLa cells that express the proteinmutant NV41 (SEO ID NO: 20), while cyclin E1 (encoded by the genedine1) remains unchanged in said cells whether or not they express the mutant proteinNV41 (SEO ID NO: 20) (Figure 6). In the same way, the expression levels of5 transcripts cidine 81 also decreased in HeLa cells expressing NV41(SEO ID NO: 20) with respect to HeLa cells that express GFP (SEO ID NO: 30), and tothose that express the NV41GFP construction (SEO ID NO: 64) (Figure 7). How I knowobserves in said Figure 8, the expression of NV41GFP (SEO ID NO: 64) in cellsHeLa induced an increase in the concentration of cenb1 gene transcripts (cidine
10 81) at both 48hpt and 96hpt.
Additionally, erk1 gene expression levels were analyzed for their relevance as a signaling protein in the MAPK pathway. The results showed that erk1 gene expression decreases due to NV41 (SEO ID 15 NO: 20). This decrease in erk1 is time dependent since at 48hpt a very significant decrease in its expression is observed, but at 96hpt it was so low that it was not possible to detect the expression of said gene in HeLa cells that express NV41 (SEO ID NO: 20) (Figure 8). However, at this same time (96hpt) the transcripts of the gadph internal control gene are detected (Figure 9), indicating that said
The absence of expression is not due to degradation of cell culture, but to the absence of gene expression induced by the mutant protein NV41 (SEO ID NO: 20).
Example 5. The mutant protein NV41 (SEO ID NO: 20) inhibits expression
Protein of ERK1 and cyclin 81, and increases protein expression of cyclin A1 in Hel a cells.
Once it has been demonstrated that the different mutant proteins described in the present invention, particularly the mutant NV41 (SEQ ID NO: 20), modulate the gene expression of erk1, mx, IL-8, eiclina b1 and define a1, it is analyzed whether said Modulation at the gene level also occurs at the protein level.
For this, protein expression was determined by Western-blot (WB) with the use of monodonal antibodies (see materials and methods) that detect ERK1, cidine 35 81 and cyclin A 1 in cellular extracts of Hel cells treated at different times, such as It has been described above. As seen in Figure 10, the cells
HeLa transfected with the plasmid expressing the mutant protein NV41 (SEO ID NO: 20) show a reduction in ERK1 expression by 32% compared to cells treated with GFP (SEO ID NO: 30), and 26% compared to the control (untransfected cells), analyzed at 48hpt. On the other hand, ERK1 expression at 96hpt
5 showed that GFP expression was reduced by 4% with respect to the control (non-transfected cells), while HeLa cells transfected with the plasmid expressing the mutant protein NV41 (SEO ID NO: 20) showed a decrease in expression ERK1 by 45% with respect to the control (non-transfected cells) (Figure 10).
These data correlate with those shown for erk1 gene expression (Figure 8) and demonstrate that the mutant protein NV41 inhibits ERK1 gene and protein expression by interfering with the MAPK pathway.
15 Next, the protein expression of cyclines B and A, at 48 and 96hpt, was analyzed, as indicated above. Regarding cyclin 81, HeLa cells at 48 hpt show a reduced expression of said protein when treated with the plasmid that expresses the mutant protein NV41 (SEO ID NO: 20) by 30% compared to cells treated with GFP ( SEO ID NO: 30), and show a similar level to the control
20 (untransfected cells) (Figure 11). Expression of cyclin 81 to 96hpt shows that He La treated with GFP (SEO ID NO: 30) decreased cyclin 8 expression with respect to control (untransfected cells), while HeLa cells transfected with the plasmid which expresses the mutant protein NV41 (SEO ID NO: 20) decreased the expression of cyclin B by 43% compared to the control (cells not
25 transfected) (Figure 11). In addition, 25% less cyclin B is observed in He La cells treated with NV41 compared to those treated with GFP. These data correlate with the data obtained for ccnb1 gene expression, demonstrating that the mutant protein NV41 (SEO ID NO: 20) lowers the cyclin 8 protein and protein levels.
30 When protein expression of cyclin A is analyzed by WB, HeLa cells treated with GFP (SEO ID NO: 30) or NV41 (SE ID NO: 20) for 48 hpt maintain cyclin A expression with respect to control (cells not transfected), although it decreases with respect to cells transfected with GFP (Figure 12). However, to
35 96hpt the expression of cyclin A increases in HeLa cells treated with NV41 (SEO ID NO: 20) or GFP (SE ID NO: 30) with respect to the control (non-transfected cells) and
with respect to their 48hpt counterparts (Figure 12). However, it is observed that at 96hpt the HeLa cells treated with NV41 (SEO ID NO: 20) decrease the cyclin A compared to the cells treated with GFP (SEO ID NO: 30), indicating that NV41 inhibits the expression of cyclin A in 20% -30%. These results contrast in part with the 5 shown in Example 4 for cyclin A, where ccna1 gene expression at both 48hpt and 96hpt is decreased by treatment with the mutant protein NV41 (SEO ID NO: 20). One possible explanation for this fact is that there is not always a real-time correlation between the amount of mRNA transcripts and the amount of protein. This could be due to the fact that cyclin A protein could have a longer half-life, that is, it degrades less and in order to detect a decrease in it by inhibiting mRNA expression, this expression should be analyzed at greater times. than those carried out in the examples shown here.
权利要求:
Claims (21)
[1]
1. Variation of the non-virionic protein of the Oncorhynchus 2 novirhabdovirus virus comprising an amino acid sequence that has a sequence identity of at least 99% with SEO ID NO: 2, and a replacement of the original aspartic acid (O) amino acid by alanine (A) at position 41 (D41A), or a substitution of the original aspartic acid (O) amino acid by alanine CA) at position 36 (D36A), or a substitution of the amino acid arginine
(R) original by wing or CA) in position 39 (R39A), and which also inhibits cell proliferation and / or metastasis.
[2]
2. Variant according to claim 1 characterized in that it comprises SEO ID NO: 20, SEO SEO NO: 10 or SEO ID NO: 16.
[3]
3. Polynucleotide encoding a variant according to any one of claims 1 to 2.
[4]
Four. Gene construct comprising a polynucleotide according to claim
[3]
3.
[5]
5. Vector comprising a polynucleotide according to claim 3 or a gene construct according to claim 4.
[6]
6. Cell comprising a variant according to any one of claims 1 to 2, a polynucleotide according to claim 3, a gene construct according to claim 4 or a vector according to claim 5.
[7]
7. Use of a variant according to claim 1, in preparation of a medicament.
[8]
8. Use of a variant according to claim 1, in the preparation of a medicament for the treatment and / or prevention of tumors, cell proliferation and / or metastasis.
[9]
9. Use according to any of claims 7 to 8 wherein the variant comprises SEO ID NO: 20, SEO ID NO: 10, SEO ID NO: 16 and / or any combination thereof.
[10]
10. Use according to claim 8, wherein the tumor is a malignant or benign tumor.
[11]
eleven. Use according to claim 10, wherein the malignant tumor is cancer.
[12]
12. Use of a variant according to claim 1, as a reagent to inhibit cell proliferation in vitro.
[13]
13. Use according to claim 12 wherein the variant comprises SEO ID NO: 20, SEO ID NO: 10, SEO ID NO: 16 and / or any combination thereof.
[14]
14. Use of a variant according to claim 1, as a reagent to inhibit ERK-1 protein expression in vitro; or the activity of regulatory proteins of the cell cycle selected from the list consisting of cyclin B and A.
[15]
15. Use according to claim 14 wherein the polypeptide comprises SEO ID NO: 5 20, SEO ID NO: 10, SEO ID NO: 16 and / or any combination thereof.
[16]
16. Pharmaceutical composition comprising a variant according to claim 1, in a therapeutically effective amount, and a pharmaceutically acceptable carrier.
[17]
17. Pharmaceutical composition according to claim 16 characterized in that the
10 variant comprises SEQ ID NO: 20, SEQ ID NO: 10, SEQ ID NO: 16 and / or any combination thereof.
[18]
18. Pharmaceutical composition according to any of claims 16 to 17, further comprising a chemotherapeutic agent.
[19]
19. Kit comprising a variant according to claim 1.
A kit according to claim 19, wherein the variant is selected from the list consisting of SEQ ID NO: 20, SEQ ID NO: 10, SEQ ID NO: 16 and / or any combination thereof.
[21]
21. Use of the kit according to any of claims 19 to 20, to inhibit cell proliferation in vitro and / or to inhibit ERK-1 protein activity in vitro;
20 or the regulatory protein activity of the cell cycle selected from the list consisting of cyclin B and A.
类似技术:
公开号 | 公开日 | 专利标题
JP6946486B2|2021-10-06|Nucleic acid containing or encoding a histone stem-loop and a poly | sequence or polyadenylation signal to increase the expression of the encoded tumor antigen.
JP2018513104A|2018-05-24|Compositions and methods for the treatment of malignant tumors with RNAI molecules targeting HSP47 and P21
DK2040728T3|2015-10-26|FKBP-L and uses thereof such as angiogenesis inhibitors
ES2682056B1|2019-06-28|HYBRID ORGANIC POROUS MATERIAL - INORGANIC, METHOD OF OBTAINING AND USES
ES2718174T3|2019-06-28|Polyvinyl alcohol powder and methods to produce the same
CA2574531C|2016-10-25|Hat acetylation promoters and uses of compositions thereof in promoting immunogenicity
Tian et al.2012|Suppression of tumor invasion and migration in breast cancer cells following delivery of siRNA against Stat3 with the antimicrobial peptide PR39
BR112012033363A2|2020-08-18|recombinant tumor vaccine and method of producing such a vaccine
JP6230635B2|2017-11-15|Methods for inhibiting HIV replication in mammalian and human cells
US20150202248A1|2015-07-23|E2f as a target of hormone refractory prostate cancer
JP5625143B2|2014-11-19|Cancer therapeutic agent containing mortalin siRNA
ES2679570B1|2019-06-28|Variants of the non-virionic protein of viral septicemic hemorrhage virus and its use in the treatment of proliferative disorders.
Gao et al.2015|Gene therapy targeting hepatocellular carcinoma by a dual-regulated oncolytic adenovirus harboring the focal adhesion kinase shRNA
US20160002667A1|2016-01-07|Pseudomonas exotoxins for cancer treatment
ES2718121A1|2019-06-27|PROCEDURE FOR THE EFFECTIVE CONTROL OF COCOIDE INSECTS PESTS |
ES2526109B1|2015-10-14|PEPTIDE AND PHARMACEUTICAL COMPOSITION FOR CANCER TREATMENT
WO2015092756A1|2015-06-25|Recombinant fusion protein prostat and uses thereof
US20200199624A1|2020-06-25|Recombinant oncolytic virus
KR101374585B1|2014-03-17|The shRNA downregulating HSP27 for treatment of tumor
JP5898304B2|2016-04-06|Use of calcineurin modulator 1 for the manufacture of a medicament for the treatment of diseases associated with increased NF-κB activity
JP2010530743A|2010-09-16|Cell growth inhibiting VPg protein, fragments or analogs thereof, and applications thereof
BR112021004451A2|2021-06-01|method for producing an antitumor arenavirus as well as arenavirus mutants
WO2020132465A1|2020-06-25|Methods and compositions related to therapeutic peptides for cancer therapy
BR112015017692A2|2019-11-19|INFECTIVE DISEASE VIRUS, INFECTIOUS MV-DELTAC, METHOD FOR PREPARING CELLS, VACCINE PDCS, PHARMACEUTICAL COMPOSITION AND GROUPING OF ACTIVE INGREDIENTS
同族专利:
公开号 | 公开日
ES2679570B1|2019-06-28|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题

法律状态:
2018-08-28| BA2A| Patent application published|Ref document number: 2679570 Country of ref document: ES Kind code of ref document: A1 Effective date: 20180828 |
2019-06-28| FG2A| Definitive protection|Ref document number: 2679570 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190628 |
优先权:
申请号 | 申请日 | 专利标题
ES201730260A|ES2679570B1|2017-02-27|2017-02-27|Variants of the non-virionic protein of viral septicemic hemorrhage virus and its use in the treatment of proliferative disorders.|ES201730260A| ES2679570B1|2017-02-27|2017-02-27|Variants of the non-virionic protein of viral septicemic hemorrhage virus and its use in the treatment of proliferative disorders.|
[返回顶部]