Watermelon plants with cucumber vein yellowing virus (cvyv) resistance

专利摘要:
The application relates to the field of plant breeding, in particular watermelon breeding. Provided are CVYV resistant watermelon plants (and seeds from which these plants can be grown). Also provided is a QTL for CVYV resistance (cyv_3.1) and markers and methods for screening plants for the presence of the QTL.
公开号:ES2667441A2
申请号:ES201890019
申请日:2016-10-06
公开日:2018-05-10
发明作者:Erik de Groot；Marion Van de Wal；Richard Bernard Berentsen；Elena CHIAPPARINO；Ebenezer OGUNDIWIN
申请人:Nunhems BV；
IPC主号:

专利说明:

5 Field of the invention
The present invention relates to the field of plant cultivation and plant improvement. Watermelon plants resistant to yellow cucumber vein virus (CVYV) and SNP (Single Nucleotide Polymorphism) markers closely linked alloy resistance to CVYV are provided. These markers can be used to select watermelon plants, or parts of plants, that comprise the CVYV resistance locus and are resistant to CVYV when resistance idol is homozygous in a diploid plant, or in three or four copies in a triploid or tetraploid respectively. Markers can also be used to distinguish plants (or parts of plants from such plants) that comprise CVYV resistance locus of plants (or parts of plants) 15 that lack CVYV resistance locus, CVYV resistance locus is a recessive locus only. Ellocus is located on chromosome 3 of the watermelon-loving gene. On the same chromosome Ling et al. (Cucurbitaceae 2008, Proceedings of the IXth Eucarpia Meeting, May 21-24th) reported a marker in the elF4E gene that is related to resistance to ZYMV (Zucchini Yellow Mosaic Virus) conferred by a recessive gene called zym. Cultivated watermelon plants of the invention, which comprise a homozygous introgression of wild watermelon that confers resistance to CVYV, do not comprise resistance to ZYMV and do not comprise the marker in the elF4E gene reported by Ling et al. 2008 (supra). The CVYV resistance locus of the invention can, therefore, be used alone, or optionally combined with resistance to ZYMV (the recessive 25 zym gene), to produce plants with double resistance. Watermelon plants of the invention, comprising an introgression fragment on chromosome 3, are cultivated plants of C. lanatus ssp. vulgaris that produce marketable fruits with a brix grade of at least 8.0 or 9.0, preferably at least 10.0, or at least 11.0. Plants or parts of plants thus comprise a genome of cultivated watermelon (C. lanatus ssp. Vulgaris), which comprises a fragment of introgression of a wild watermelon on chromosome 3 (either of a plant of the species C. lanatus ssp Lanatus or a plant of the species C. lanatus ssp. Mucosospermus), whereby said introgression fragment comprises the CVYV resistance locus. The CVYV ellocus and / or the introgression fragment can be identified in the cells, plants, plant parts or DNA thereof by
closely linked markers, that is, using the SNP genotype (or SNP haplotype) of one or more of the SNP markers provided herein.
Background of the invention
CVYV is a potyvirus (family Potyviridae) that causes severe damage to the
5 cucurbitaceae, such as cucumber, melon, watermelon and zucchini. The virus cantransmitted mechanically and by the natural vector for CVYV, which is the whiteflyBemisia tabaci. The B. tabaci whitefly vector is endemic in many of themain areas of watermelon cultivation in the world. CVYV infects both crops in thefield, as in plastic tunnels.
10 Resistance against CVYV has been identified in melon and cucumber, but not yet in watermelon. For example, W0201 0/025747 describes a QTL resistance against CVYV in melon, derived from the Cuc6491 landrace. Document W02011003440 describes the resistance to CVYV in cucumber.
The symptoms of CVYV in watermelon are sometimes mild leaf chlorosis, but often
15 external symptoms are discrete or not expressed, CVYV infection is only observed when it is discovered that fruits develop an internal necrosis not seen from the outside, but that makes the fruits unsuitable for consumption.
CVYV identification is possible by PCT reverse transcriptase (RT-PCR) and by nucleic acid hybridization, as for example described in the 2007 OEPP / EPPO
20 Bulletin 37, pp554-559, entitled "Cucumber vein yellowing virus (Ipomovirus)". This document also describes mechanical and whitefly transmissions to test plants to identify CVYV.
It is an object of the invention to provide cultivated watermelon plants, C. lana tu ssp. vulgaris, and parts of such plants, which comprise a resistance locus in the
25 chromosome 3, which confers resistance against CVYV when it is homozygous in a diploid plant, or when it is in three or four copies in a triploid or tetraploid plant, respectively. This locus is a Quantitative Trait Locus (QTL) identified in two different wild accessions of Citrullus lanatus ssp. lanatus and Citrullus lanatus ssp. mucosospermus, which have white or yellowish pulp fruits that
30 are bitter in taste and have a very low brix (for example, a brix of 3.0 or less), and this locus was intrigued in cultured watermelon (Citrullus lanatus ssp. Vulgaris) that has marketable fruits, that is, good quality fruits with a brix of at least 8.0 09.0
or preferably at least 10.0, 11.0 or higher. This QTL that confers resistance to CVYV is referred to herein as cyv_3.1.
Cultivated watermelon plants comprising cyv_3.1 in one, two, three or four copies include diploid plants or double haploid plants. tetraploid plants and triploid plants (for example, triploid hybrid plants that produce seedless fruits), as well as seeds from which these plants can be grown, and any part of them
5 plants comprising cyv_3.1 (fruits, fruit parts, rootstocks, stems, cells,pollen, anthers, ovules, stems, leaves, cotyledons, hypocotyls, flowers, cell cultures orin vitro tissues, in vitro propagation, etc.).
It is also an object of the invention to provide molecular markers closely related to CVYV resistance conferred by QTL cyv_3.1 and the use of one or more 10 such molecular markers in a) cultured watermelon plants comprising cyv_3.1 in one (per example, heterozygous) in a diploid), two (for example, homozygous in diploid and double haploid plants), three (in a triploid) or four copies (in a tetraploid) and / or) screening of plants, plant parts, cells or genomic DNA for the presence of one or more of these molecular markers and, therefore, for the presence
15 from cyv_3.1. Such culture methods and screening methods are included in this document.
General definition
The verb "to understand" and its conjugations are used in their non-limiting sense to mean that the elements that follow the word are included, but the 20 elements that are not specifically mentioned are not excluded. In addition, the reference to an element by the indefinite article "a" or "a" does not exclude the possibility that more than one element is present, unless the context clearly requires that there be one and only one of the elements. Therefore, the indefinite article "a" or "a" means "at least one", for example "One plant" also refers to several cell plants, etc. By way of
Similarly, "a fruit" or "a plant" also refers to a plurality of fruits and plants.
As used herein, the term "plant" includes the whole plant or any part or derivatives thereof, preferably with the same genetic composition as the plant from which it is obtained, such as plant organs (for example, harvested or unharvested fruits, leaves, flowers, anthers, etc.), plant cells, 30 plant protoplasts, plant cell tissue cultures from which whole plants can be regenerated, plant corns, plant cell clusters , plant transplants, seedlings, intact plant cells in plants, plant clones
or micropropagation, or parts of plants, such as plant cuttings, embryos, pollen,
anthers, ovules, fruits (for example, harvested tissues or organs), flowers, leaves, seeds, 35 clonally propagated plants, roots, thalliums, root tips, grafts (stem and / or rootstocks) and the like. It also includes any stage of development, such as seedlings, cuttings before or after rooting, etc. When referring to the "seeds of a plant", they refer to the seeds from which the plant can be grown or the seeds produced in the plant, after self-fertilization or cross-fertilization.
As used herein, the term "variety" or "cultivate" means a grouping of plants within a single botanical taxon of the lowest known range, which can be defined by the expression of the characteristics resulting from a genotype or combination of genotypes. dices.
The term "allele (sr means any one or more alternative forms of a gene in a particular locus, all of which alleles are related to a trait or characteristic in a specific locus. In a diploid cell of an organism, the alleles of a This gene can be found in a specific location, or locus (plural Ioci) on a chromosome.An allele is present on each chromosome of the pair of homologous chromosomes.A species of diploid plant can comprise a large number of different alleles in a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).
"F1, F2, F3, etc." refers to the related consecutive generations after a cross between two parental plants or parental lines. Plants grown from seeds produced crossing two plants or lines are called F1 generation. Self-fertilization of F1 plants results in F2 generation, etc.
The "F1 hybrid" plant (or F1 hybrid seed) is the generation obtained by crossing two inbred parental lines. Therefore, F1 hybrid seeds are seeds from which F1 hybrid plants grow. F1 hybrids are more vigorous and better performance, due to heterosis. The inbred lines are essentially homozygous in most loci in the genome.
A "plant line" or "reproduction line" refers to a plant and its progeny. As used herein, the term "inbred line" refers to a plant line that has been repeatedly self-fertilized and is almost homozygous. Therefore, an "inbred line" or "parental line" refers to a plant that has undergone several generations (for example, at least 5, 6, 7 or more) of inbreeding, resulting in a plant line with a high uniformity
The term "gene" means a DNA (genomic) sequence that comprises a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked regulatory region (eg, a promoter ). the different alleles of a gene are, therefore, different alternative forms of the gene, which may be in the form of, for example, differences in one or more nucleotides of the genomic AON sequence (for example, in the promoter sequence, the sequences of
5 exon, intron sequences, etc.), mRNA and / or amino acid sequence of the proteincoded
The term "Iocus" (plural Ioci) means a specific place or places or a site on a chromosome where, for example, there is an OTl, a gene or genetic marker. The CVYV locus (or locus that confers resistance to CVYV) is, therefore, the location in the genome of the watermelon, where the QTl called cyv_3.1 is located. Ellocus cyv_3.1 is embedded in chromosome 3 of cultured watermelon (using the chromosome mapping of the published watermelon genome found at httpJ / www.icugi.org / cgibin / ICuGI / index.cgi under "Watermelon: Genome", Watermelon: Genome "(97103) -version 1" and as described in Guo S, Zhang J, Sun H, Salse J, Lucas W, Zhang H, Zheng Y,
15 Mao l, Ren Y, Wang Z (2013) "The watermelon genome project (Citrullus lanatus) and resequencing of 20 different accessions" (Nature Genetics 45: 51-58) that is, cyv_3.1 is embedded in the Genome of the cultivated watermelon (that is, on chromosome 3) of a wild watermelon.
A "quantitative trait Iocus" or "QTl" is a chromosomal locus that codes for one or
20 more alleles that affect the expressiveness of a continuously distributed (quantitative) phenotype. The resistance to CVYV that confers quantitative trait locus (or "CVYV OTl") is called cyv_3.1 in this document.
"Diploid plant" refers to a plant, part (s) of vegetative plant (s), or seed from which a diploid plant can be grown, which has two sets of chromosomes,
25 designated here as 2n.
A "DH plant" or "double haploid plant" is a diploid plant produced by duplicating the haploid genome of the diploid plant using, for example, in vitro techniques. A DH plant is, therefore, homozygous in all loci.
"Triploid plant" refers to a plant, part (s) of vegetative plant (s), or seed from
30 of which a triploid plant can be grown, which has three sets of chromosomes, designated here as 3n.
"Tetraploid plant" refers to a plant, vegetative plant part (s), or seed from which a tetraploid plant can be grown, which has four sets of chromosomes, designated here as 4n.
"Polinizad ora plant" or "pollinator" refers to the diploid plant (inbred or hybrid),
or parts thereof (for example, its pollen or stem), suitable as a pollinator to induce fruiting of triploid plants. A pollinator plant can, therefore, lead to a good fruiting (and a good yield of triploid fruits) of triploid plants, producing an appropriate amount of pollen on the appropriate day and for an appropriate period of time.
The "triploid hybrid plant" or "triploid F1" or "triploid hybrid" is a triploid plant grown from hybrid, triploid seeds obtained from the cross fertilization of a male diploid parent with a female tetraploid parent. The male parent (the pollinator plant) is used to induce fruiting and seed production in a female tetraploid parent, resulting in fruits containing F1 hybrid triploid seeds. Both the male and female parents used to produce the F1 triploid seeds are inbred, so that each parental line is almost homozygous and stable.
"Seedless fruits" are triploid fruits, produced in a triploid plant after a pollinator plant induces the fruiting of fruits, which do not contain mature seeds. The fruit may contain one or more small, edible and white eggs.
"Interplanting" refers to the combination of two or more types of seeds and / or transplants sown or transplanted in the same field, especially the sowing and / or transplantation of pollinators in the same field as the triploid hybrid plants (for the production of seedless fruits in triploid plants and production of diploid fruits in pollinator plants). For example, the pollinator can be sown in separate rows or interspersed with triploid plants in the same row (for example, in hills within each row). Pollinators can also be planted between rows of triploids. Also the seeds of triploid pollinators and hybrids can be mixed before sowing, which results in random sowing. Transplants of triploid and / or pollinator hybrid plants can also comprise a rootstock of a different plant. Suitable rootstocks are known in the art. Watermelon plants with a different rootstock are known as "grafted."
"Planting" or "planted" refers to sowing (direct sowing) or transplanting seedlings (seedlings) in a field by machine or by hand.
"Vegetative propagation" or "clonal propagation" refers to the propagation of plants from vegetative tissue, for example, by in vitro propagation or grafting methods (using stems). In vitro propagation involves cell or tissue culture in vitro and the regeneration of a complete plant from in vitro culture. Grafting involves the propagation of an original plant by grafting on a rootstock. Therefore, clones (ie, genetically identical vegetative propagation) of the original plant can be generated by in vitro culture or grafting. "Cell culture" or "tissue culture" refers to the in vitro culture of cells or tissues of a plant. "Regeneration" refers to the development of a plant from cell culture or tissue culture or vegetative propagation. "Non-propagating cell" refers to a cell that cannot regenerate in a complete plant.
"Recessive" refers to an allele that expresses its phenotype (for example, resistance to CVYV) when a dominant allele is not present in the genome. The cyv_3.1 according to the invention results in a CVYV resistant plant when it is present in two copies in a diploid plant, in four copies in a tetraploid plant or in three copies in a triploid plant, so that a dominant allele It is absent in these plants. The dominant allele is referred to herein as wild-type allele (WT), which is found in plants that lack cyv_3.1 introgression.
"Cultivated watermelon" refers in this document to Citrullus lanatus ssp. Vulgaris with good agronomic characteristics, especially producing fruits, markets good quality fruit and fruit uniformity.
"Wild watermelon" refers in this document to Citrullus lanatus ssp. lanatus and Citrullus lanatus ssp. mucosospermus, producing fruits of poor quality and low uniformity.
"SNP marker" refers to a single nucleotide polymorphism between cultured and wild watermelon and the SNP markers provided herein are closely related to the cyv_3.1 found in wild watermelon accessions resistant to CVYV. SNP_02 comprises a "G" (guanine) in the nucleotide
7,664,093 of chromosome 3 instead of an 'A' (adenine) and SNP_03 comprises a 'C' (cytosine) in nucleotide 7.693 .225 of chromosome 3, instead of a 'T' (Thymine). The term "SNP genotype" refers to the nucleotide present in the particular SNP. When referring to the "resistance genotype" or "CVYV genotype" or "cyv_3.1 genotype", reference is made to the nucleotide of the wild accession resistant to CVYV. Therefore, the "resistance genotype" for SNP _02 is 'G' (guanine) in nucleotide 7.664.093 of chromosome 3 and that of SNP _03 is 'C' (cytosine) in nucleotide 7.693.225 of chromosome
3. The other (alternative) nucleotide refers to the nucleotide found in cultured watermelon that lacks introgression and can be called the WT genotype or susceptible genotype.
The term "SNP haplotype" refers to the nucleotide present in several SNP locations. When referring to the "CVYV haplotype", "resistance haplotype" or "cyv_3.1 haplotype", reference is made to the SNP genotype of several of the SNP markers linked to cyv_3.1. For example, haplotype-A comprises G-G-C nucleotides for
5 SNP _01, SNP _02 and SNP _03, respectively. Haplotype B comprises nucleotides A-G-C for SNP _01, SNP_02 and SNP_03, respectively.
"Cultivated watermelon genome" and "physical position in the cultivated watermelon genome" and "chromosome 3" refers to the physical genome of cultivated watermelon, world wide web at http://www.icugi.org/cgi-bin/ICuGI /index.cgien "Watermelon: Genome", "Watermelon 10 genome (97103) -version 1" and the physical chromosomes and the physical position on the chromosomes. Then, for example, SNP _01 is located in nucleotide (or 'base') physically positioned in nucleotide 7,586,752 of chromosome 3, SNP 02 is located in nucleotide (or 'base') physically positioned in nucleotide 7.664. 093 of chromosome 3, and SNP _03 is located in the nucleotide (or 'base') physically positioned
15 in nucleotide 7.693.225 of chromosome 3. Chromosome 3 has a physical size of O at 28.9 Mb.
"Introgression fragment" or "introgression segment" or "introgression region" refers to a chromosome fragment (or part or chromosomal region) that has been introduced into another plant of the same species or related species by crossing or 20 techniques of traditional reproduction, such as backcrossing, that is, the intrigued fragment is the result of the reproduction methods referred to by the verb "introgresar" (such as backcrossing). In watermelon, wild watermelon accessions can be used to intrigue fragments of the wild genome into the genome of the cultivated watermelon genome. Such a cultivated watermelon plant thus has a "genome of 25 Citrullus lanatus ssp. Vulgaris" cultivated, but comprises in the genome a fragment of a wild watermelon, for example, an introgression fragment of Citrullus lanatu5 ssp. lanatus or Citrullus lanatus ssp. mucosospermus Thus, for example, this document provides a cultured watermelon comprising a genome of cultured watermelon, and in that genome a fragment of introgression of wild watermelon on chromosome 3 that comprises the QTL that confers resistance to CVYV and is named here cyv_3.1. It is understood that the term "introgression fragment" never includes a complete chromosome, but only a part of a chromosome. The introgression fragment may be large, for example, even three quarters or half of a chromosome, but is preferably smaller, about 15 Mb or less, about 10Mb or less, about 35 Mb or less, about 8 Mb or less, about 7 Mb or less, about 6 Mb or less, about 5 Mb or less, about 4 Mb or less,


approximately 3 Mb or less, approximately 2.5 Mb or 2 Mb or less,
approximately 1 Mb (equal to 1,000,000 base pairs) or less, or approximately
0.5 Mb (equal to 500,000 base pairs) or less, such as approximately 200,000 bp
(equivalent to 200 kilograms of base) or less, approximately 100,000 bp (100 kb) or
5 less, approximately 50,000 bp (50 kb) or less, approximately 30,000 bp (30 kb)
or less .
A chromosome 3 of cultured watermelon comprising a fragment of intrusion that
includes the QTL cyv _3.1 that confers resistance to CVYV is also called here
"recombinant chromosome 3".
1 o 'CVYV resistance' refers to the absence of CVYV symptoms in adult leaves
(and preferably also in fruits) or statistically significantly less
symptoms that susceptible control plants, such as the susceptible variety Sugar Baby.
Resistance to CVYV can, for example, be evaluated using a resistance test to
CVYV or, alternatively, in the field or tunnel in quantitative areas where the
fifteen Natural CVYV infection. Various CVYV resistance tests are possible, by
example, as described in the Examples, but in general a resistance test to
CVYV may, for example, involve artificial inoculation of the first true leaf
expanded of a plurality of seedlings, optionally followed by a second
inoculation of the leaf, for example, four or five days later, incubate the seedlings and
twenty control the plants for a suitable period of time and under appropriate conditions
and evaluate the symptoms of the virus one or more times after inoculation (for example,
20 days, 30 days, 40 days, 50 days, 60 days after inoculation). Susceptible control
It must be severely symptomatic for the test to succeed. Preferably, it
include at least 10, 11, 12, 13, 14 or more plants per genotype in each replica and
25 preferably several replicas are carried out. In one aspect, when testing resistance,
a line or variety is considered resistant if at least 70%, 80%, 90% or 100% of the
plants of the line or variety show no symptoms, while at least 50%, 60%, 70
%, 80%, 90% or more plants of the line or variety of susceptible control show
symptom.
30 "Brix" or "Brix grade" 0 "° brix" refers to the total average soluble solids content measured
in several ripe fruits using a refractometer. Preferably, the average is calculated
of at least three fruits, each measured between the center and the crust of the cut fruit
open
"Marketable" in relation to fruit quality means that watermelon fruits
35 They are suitable to be sold for fresh consumption, with good flavor (without flavors
unpleasant), a brix grade of at least 9.0, preferably at least 10.0 or at least
11.0 and preferably also a uniform color of fruit pulp, for example, white (for example, variety of cream of Saskatchewan), yellow (for example, variety Yamato Cream 1), orange (for example, variety Tendersweet), pink (for for example, Sadul variety), pink red (for example, Crimson Sweet variety), red (for example, Sugar Baby variety) or dark red (for example, Dixie Lee variety).
"Uniform color of the fruit pulp" means that the color in all ripe fruits, when cut open in half (middle section), is distributed evenly throughout the fruit pulp, that is, not in the form of patch. Therefore, a red fruit is red throughout the pulp of the fruit and does not contain white spots. An example of a fruit with uniform red color is the diploid Premium F1 variety (Nunhems).
The "physical distance" between the loci (for example, between molecular markers and / or between phenotypic markers) on the same chromosome is really the distance expressed in bases or base pairs (bp), kilobases or kilograms of bases (kb) or megabases or base megapares (Mb).
The "genetic distance" between loci (for example, between molecular markers and / or between phenotypic markers) on the same chromosome is measured by crossover frequency, or recombination frequency (RF) and is indicated in centimorgans (cM). A cM corresponds to a recombination frequency of approximately 1%. If recombinants cannot be found, the RF is zero and the loci are very close physically or identical. The further two loci are, the greater the RF.
"Uniformity" or "uniformity" is related to the genetic and phenotypic characteristics of a plant line or variety. The inbred lines are genetically very uniform since they are produced by several generations of inbreeding. Similarly, and F1 hybrids and triploid hybrids that are produced from such inbred lines are highly uniform in their genotypic and phenotypic characteristics and performance.
The term "CVYV allele" or "CVYV resistance allele" refers to an allele found in ellocus cyv_3.1 embedded in cultured watermelon (on chromosome 3 cultivated from C lanatus ssp. Vulgaris) of a wild watermelon. The term "CVYV allele", therefore, also encompasses the CVYV alleles that can be obtained from different wild watermelons. When no susceptible dominant allele (wild type, WT) is present in it in the genome (that is, two copies of the CVYV allele are present in the diploid watermelon, in triploid watermelon 3 copies and in 4-copy tetraploid watermelon), Plant line or variety will be resistant to CVYV. In cultured watermelon plants that lack the introgression fragment, the allele found in the same locus on chromosome 3 is referred to herein as the "wild type ~ (WT) allele. Since cyv_3.1 is recessive, it should not be present no wild-type allele to express the CVYV resistance phenotype, therefore, two recombinant chromosomes 3 (in watermelon lines or varieties
5 diploid), three recombinant chromosomes 3 (in lines or varieties of triploid watermelon) or four recombinant chromosomes 3 (in lines or varieties of tetraploid watermelon) must be present to express the CVYV resistance phenotype SNP genotypes and haplotypes SNPs provided in this document are indicative of the presence of the introgression fragment comprising cyv_3.1.
10 It is said that a genetic element, an introgression fragment or a gene or allele that confers a trait (such as resistance to CVYV) "obtainable from" or can be "obtained from" or "derivable from ~ or can be" derive from "or ~ as present in ~ or" as found in "a plant or seed or tissue or cell if it can be transferred from the plant or seed in which it is present to another plant or seed in which it is not present ( how
15 in a line or variety susceptible to CVYV) that uses traditional reproduction techniques without producing a phenotypic change of the recipient plant apart from the addition of the trait conferred by the genetic element, locus, introgression fragment, gene or allele. The terms are used interchangeably and the genetic element, locus, introgression fragment, gene or allele can be transferred to any other genetic background that
20 lack the trait. Not only can deposited seeds be used and they comprise the genetic element, locus, introgression fragment, gene or allele, but also progeny / descendants of such seeds that have been selected to retain the genetic element, locus, introgression fragment, gene or allele, be used and covered in this document, such as commercial varieties developed from
25 seeds deposited or descendants or ancestors thereof. Similarly, other wild sources that contain the genetic element, locus, introgression fragment, gene or allele (for example, cyv_3.1 or a variant thereof) can be identified and used to transfer it to cultivated watermelon. If a plant (or genomic DNA, cell or tissue of a plant) comprises the same (or variant) genetic element, locus,
Introgression fragment, gene or allele that can be obtained from deposited seeds, can be determined by one skilled in the art using one or more techniques known in the art, such as phenotypic assays, complete genome sequencing, molecular marker analysis, trait mapping, chromosome painting, allele assays and the like, or combinations of techniques.
A sequence "Variant ~ or" orthologue "or a" variant cyv_3.1 "refers to a resistance to CVYV that confers QTL (cyv_3.1), or an introgression fragment comprising the
OTL, which is derived from different wild watermelon plants that cyv_3.1 present in NCIMB42449 or in NCIMB42450. or in NCIMB42666. but whose variant comprises one or more of the resistance genotype of the SNP markers, or of the SNP haplotypes, linked to cyv_3.1 and in which the variant genomic sequence comprises identity of substantial sequence with the SEO ID NO comprising the SNP (any SEO ID NO: 1, SEO ID NO: 2 or SEO ID NO: 3), that is, at least 85%, 90%, 92%, 95%, 98%, 99% sequence identity or more. The SNP in said variant sequence is then called "in a nucleotide corresponding to" or "in a nucleotide position corresponding to" the position of the SNP in SEO ID NO. Therefore, when the original sequence 10 and the variant sequence are aligned in pairs over the entire length, an SNP in, for example, position 76 in the original sequence will be, in the variant, present in the nucleotide corresponding to nucleotide 76 in the original sequence. Therefore, when a certain SNP resistance genotype is referred to here in a specific genomic sequence (selected from SEO ID NO: 1 to SEO ID NO: 3), this also encompasses the 15 SNP resistance genotype in variants of the Genomic sequence, i.e. SNP resistance genotype in a genomic sequence comprising at least 85%, 90%, 92%, 95%, 98%, 99% sequence identity with the referred sequence (selected from SEO ID NO : 1 to SEQ ID NO: 3). Thus. Any reference in this document to any SEO ID NO: 1 to 3 in one aspect also covers a variant of any
SEO ID 20 NO: 1 to 3, said variant comprising at least 85%, 90%, 95%, 98%, or 99% sequence identity with said sequence.
The term "marker assay" refers to a molecular marker assay that can be used to assess whether an introgression of a wild watermelon is present on chromosome 3 of cultured watermelon, whose introgression fragment comprises the QTL of CVYV resistance ( cyv_3.1 or variant) (or if a wild watermelon access comprises cyv_3.1 or a variant thereof in its genome), determining the genotype of one or more markers linked to cyv_3.1, for example the genotype of one or plus SNP markers selected from SNP _02 and SNP _03 and (optionally) any specific marker of the wild watermelon genome at a distance of 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 30 kb. 50 kb 20kb 10kb 5kb 2kb 1kb or less of SNP _02 or SNP _03. The "determine genotype" step can also be called "genotyping." Optionally, the marker assay may also include genotyping of SNP _01 and / or SNP _04 and / or any specific wild watermelon genome marker at a distance of 5 Mb, 3 Mb, 2 Mb, 1 Mb. 0.5 Mb. 0.1 Mb 74 kb. 50 kb 20kb 10kb 5kb 2kb 1kb or less of SNP_01 and / or
35 SNP 04.
"Average" or "average" refers here to the arithmetic mean and both terms are used interchangeably. The term "average" or "average" refers to the ethical average of several measurements. The expert understands that the phenotype of a plant line or variety depends to some extent on the growth conditions and, therefore, the arithmetic means of at least 10, 15, 20, 30, 40, 50 or more plants ( or parts of plants) are measured, preferably in randomized experimental designs with various replicas and suitable control plants (for example, plants of the Sugar Baby variety, or any other variety or line susceptible to CVYV) grown under the same conditions in the same experiment. "Statistically significant" or "statistically significant"
10 different or "significantly" different refers to a characteristic of a plant line or variety that, when compared to a suitable control, shows a statistically significant difference in that characteristic (for example, the p-value is less than 0.05, p < 0.05, using ANOVA) (mean) conlrol
The term "traditional reproduction techniques" encompasses crossover, backcrossing,
15 self-fertilization, selection, double haploid production, chromosome duplication, embryo rescue, protoplast fusion, marker-assisted selection, mutation reproduction, etc., all known to the breeder (ie deCir, methods other than genetic modification / transformation / transgenic methods), whereby, for example, a recombinant chromosome 3 can be obtained, identified and / or transferred.
20 "Backcrossing" refers to a method of reproduction whereby a (single) trait, such as CVTV resistance QTL, can be transferred from a genetic background (often inferior) (for example, a wild watermelon, also called "donor") in another genetic background (often higher) (also called "recurring father"), for example, cultivated watermelon. An offspring of a crossing (for example, an F1 plant
25 obtained by crossing, for example, a wild watermelon with a cultivated watermelon, or an F2 plant or an F3 plant, etc., obtained by self-fertilization of F1), "backcrosses" the parent with, for example, the superior genetic background, for example, to the cultivated father. After repeated backcrossing, the trait of the single genetic background (often inferior) will have been incorporated into the other genetic background (often superior).
30 "Marker-assisted selection" or "MAS" is a process that uses the presence of molecular markers (such as SNP markers), which are genetically linked to a particular locus or to a particular chromosomal region (for example, introgression fragment), to select plants by the presence of locus or the specific region (for example, the introgression fragment). For example, a genetically molecular marker
Linked to CVYV resistance QTL, it can be used to detect and / or select watermelon plants, or parts of plants, that comprise the QTL on chromosome 3. The more one
bring the genetic linkage of the molecular marker closer to the locus, the marker is less likely to be dissociated from the locus through meiotic recombination. Similarly, the closer two markers are to each other, the less likely it is that the two markers will separate from each other (and the more likely they will be harvested as
5 a unit).
A molecular marker within 5 Mb, 3 Mb, 2.5 Mb, 2 Mb, 1 Mb, 0.5 Mb, OAMb, 0.3Mb, 0.2Mb, 0.1 Mb, 74kb, 50kb, 20kb, 10kb, 5kb, 2kb, 1kb or less another marker, or a locus, refers to a marker that is physically within 5 Mb, 3 Mb, 2.5 Mb, 2 Mb, 1 Mb, 0.5 Mb, OAMb, 0.3Mb, 0.2Mb, 0.1 Mb, 74kb , 50kb, 20kb, 10kb, 5kb, 2kb,
10 1kb or less of the genomic AON region flanking the marker (ie, on each side of the marker). See, for example., The diagram of Figure 1, which shows an intricate region of wild watermelon comprising cyv_3.1, in which markers within 5Mb of the enlarged region in the diagram are shown.
The "lOO score" (logarithm (base 10) of probabilities) refers to a test
15 statistics often used for linkage analysis in animal and plant populations. The LOO score compares the probability of obtaining the test data if the two loci (molecular marker Ioci and / or phenotypic trait locus) are really linked, with the probability of observing the same data by chance. Positive LOD scores favor the presence of a link and an LOD score greater than 3.0
20 is considered evidence for linkage. An LOD score of +3 indicates 1000 to 1 probability that the observed linkage does not occur by chance.
"Transgene" or "chimeric gene" refers to a genetic locus comprising a DNA sequence, such as a recombinant gene, that has been introduced into the genome of a plant by transformation, such as Agrobacterium-mediated transformation. A plant
25 which comprises a transgene stably integrated in its genome is called a "transgenic plant".
An "isolated nucleic acid sequence ~ or" isolated AON ~ refers to a sequence of
nucleic acid that is no longer in the natural environment from which it was isolated, for example, the
nucleic acid sequence in a bacterial host cell or in the nuclear genome
30 or plastic of the plant. When referring to a "sequence" in this document, it is understood that reference is made to the molecule having said sequence, for example, the nucleic acid molecule.
A "host cell ~ or a" recombinant host cell "or" transformed cell "are terms that refer to a new individual cell (or organism)
which arises as a result of at least one nucleic acid molecule, which has been introduced into said cell. The host cell is preferably a plant cell
or a bacterial cell. The host cell may contain the nucleic acid as an extrachromosomal (episomal) replication molecule, or comprises the acid
5 nucleic integrated into the nuclear or plastid genome of the host cell, or as an introduced chromosome, for example, minichromosome.
"Sequence identity" and sequence usimilitude "can be determined by aligning two peptide sequences or two nucleotide sequences using global or local alignment algorithms. Then, the sequences may be referred to as" substantially identical "or" essentially similar "when optimally aligned, for example, the GAP or BESTFIT programs or the Emboss" Needle "program (using the default parameters, see below) share at least a certain minimum percentage of sequence identity (as defined below.) These programs use the global alignment algorithm of Needleman and Wunsch to align two two sequences along their entire length, which maximizes the number of matches and minimizes the number of gaps. Generally, the default parameters are used, with a penalty for creation of hole = 10 and penalty for extension of hole = 0.5 (for alignments of n ucleotides as protein). For nucleotides, the default scoring matrix used is DNAFULL and for proteins the default scoring matrix 20 is Blosum62 (Henikoff and Henikoff, 1992, PNAS 89, 10915-10919). Sequence alignments and scores for percent sequence identity can be determined, for example, using computer programs, such as EMBOSS, as available on the world wide web at ebLac.ukfTools / psa / emboss_needle /). Alternatively, sequence identity or similarity can be determined by searching 25 databases such as FASTA, BLAST, etc., but hits must be retrieved and aligned in pairs to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences have "substantial sequence identity" if the percentage sequence identity is at least 85%, 90%, 92%, 95%, 98%, 99% or more (for example, at least 99.1.99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9
30 or more (as determined by Emboss's "needle" using the default parameters, ie gap creation penalty = 10, gap extension penalty = 0.5, using the DNAFULL scoring matrix for nucleic acids and Blosum62 for proteins)
When referring to a nucleic acid sequence (eg, genomic DNA or DNA) that has a "substantial sequence identity with" a reference sequence or that has a sequence identity of at least 80%, for example, at least
85%, 90%, 92%, 95%, 98%, 99%, 99.2%, 99.5%, 99.9% nucleic acid sequence identity with a reference sequence, in one embodiment said nucleotide sequence is considered substantially identical to the given nucleotide sequence and can be identified using stringent hybridization conditions. In another embodiment, the
The nucleic acid sequence comprises one or more mutations compared to the given nucleotide sequence, but can still be identified using stringent hybridization conditions.
"Rigorous hybridization conditions" can be used to identify nucleotide sequences, which are substantially identical to a given nucleotide sequence. The 10 rigorous conditions depend on the sequence and will be different in different circumstances. Generally, stringent conditions are selected to be approximately 5 ° C lower than the thermal melting point (Tm) for specific sequences at a defined ionic strength and pH. Tm is the temperature (under a defined ionic strength and pH) at which 50% of the target sequence hybridizes with a perfectly adapted probe. Typically stringent conditions will be chosen in which the salt concentration is approximately 0.02 molar at pH 7 and the temperature is at least 60 c C. Decreasing the salt concentration and / or increasing the temperature increases the stringency. The stringent conditions for RNA-DNA hybridizations (Northern blots using a probe of, for example, 100nt) are, for example, those that include at least one wash in 0.2X SSC at 63 ° C for 20 min, or conditions equivalent. The stringent conditions for DNA-DNA hybridization (Southern transfers using a probe of, for example, 100nt) are, for example, those that include at least one wash (usually 2) in 0.2X SSC at a temperature of at least 50 ° C, usually around 55 ° C. for 20 minutes or equivalent conditions. See also Sambrook
25 al. (1989) and Sambrook and Russell (2001).
The "allelism test" refers to a genetic test by which you can test whether a phenotype, for example, CVYV resistance, observed in two lines or varieties of plants, is determined by the same gene or locus or by different genes
or loci. For example, the plants to be tested cross each other (preferably after
30 self-fertilization to ensure that they are homozygous), the segregation of the phenotypes between F1 or the subsequent progeny of self-fertilization or backcrossing is determined. The segregation ratio indicates whether the genes or loci are allelic or if they are different. So, for example, if the alleles are of the same gene, F1 plants (produced crossing two homozygous plants) will have (100%) the same phenotype, while perhaps
35 may not be the case if the alleles are of different genes. Similarly, in F2 plants, phenotypic segregation will indicate whether they are the same or different genes.
"Fine mapping" refers to the methods by which the position of a QTL can be determined more precisely (restricted). For example, a large population that is segregated by the trait can be analyzed for segregation of the trait (eg resistance to CVYV) and DNA markers on chromosome 3 and plants that comprise recombination events in the region of chromosome 3 that It comprises the CVYV resistance locus (see, for example, Figure 1, scratched area) can be selected, to determine which pair of SNP markers the OTL is. Additional markers can also be searched among the pair of more linked markers to reduce the range in which the OTL is located.
Figure 1:
Figure 1 shows in the diagram on the left a recombinant chromosome 3 comprising a wild watermelon introgression fragment (striped region) that encompasses a 5 Mb region on each side of the SNP markers. Cultivated regions of watermelon have no stripes (white). In the two extensions (center and diagram on the right) the SNP markers SNP_01 to SNP_04 are shown for a plant resistant to CYCV and sensitive to ZYMV (central diagram) and for a plant resistant to CVYV and resistant to ZYMV (diagram on the right ), which includes SNP Genotypes and locations (chromosome location is indicated in Mb, for example, 7.5Mb for SNP _01 and 7.7Mb for SNP _04): SNP _01 can be AA or GG depending on the haplotype; SNP_02 has the GG resistance genotype; SNP_03 has the CC resistance genotype; and SNP _04 has the TT genotype (which indicates susceptibility to ZYMV) or the GG genotype (which indicates resistance to ZYMV, that is, presence of a region (striped region) comprising homozygous estocus zym).
Detailed description
The inventors found a recessive OTL on chromosome 3 of the accesses of wild watermelon, which comprises a locus that confers resistance to CVYV. They found two different haplotypes linked to OTL that confer resistance, haplotype A comprised nucleotides G-G-C in SNP _01, SNP _02 and SNP _03, respectively, and haplotype B comprised nucleotides A-G-C in SNP_01, SNP_02 and SNP_03, respectively.
In addition, SNP_02 and SNP_03 (the two common SNPs of both resistance haplotypes) were closely related to ellocus cyv_3.1 and were used to backcross the OTL cyv_3.1 in cultured watermelon susceptible to CVYV from two different accesses of wild watermelon, thus introducing resistance to CVYV to cultivated watermelon producing fruit markets bies.
Seeds of two diploid inbred lines that comprise cyv_3.1 in a homozygous manner have been deposited by Nunhems B.V. in the NCIMB under the accession numbers NCIMB 42449 and NCIMB42450. These two lines comprise SNP _02 and SNP _03 in a homozygous manner and have the SNP haplotype B. Fruits are seeds, fruits of 5 red pulp that have a brix of 11.0 and are marketable fruits. The plants are resistant to CVYV and susceptible to ZYMV (and also lack the elF4E marker of Ling et al., 2008 supra). One of the lines has fruits with Crimson Sweet type crust (NCIMB 42449), the other (NCIMB42450) has fruits with a Jubilee crust (as in Premium F1). The average weight of the fruit is 7 kg and 8 kg respectively. Also I know
10 have generated several cultivated inbred lines that comprise the locus cyv_3.1, which have average fruit weights that vary from approximately 2 kg to approximately 12 kg.
Seeds of another inbred elite diploid line comprising cyv_3. 1 in homozygous form have been deposited by Nunhems BV in the NCIMB under the access number
15 NCIMB 42666. This line comprises SNP _02 and SNP _03 in a homozygous manner and has the SNP haplotype A. The fruits are fruits with red pulp seed that are marketed bias.
Table 1 - SNP markers linked to cyv_3.1 and location of SNP on chromosome 3 of the cultured watermelon genome published on the World Wide Web ícugLorglcgí
20 bin / lCuGl / index.cgi under "Watermelon:" Genome ", Watermelon Genome (97103) -version 1"
Name introgressionintrogressionVarietyGenomic sequence (direction
of the cyv_3.1IcyvJ1cyvJ1Icyv_3.of watermelon5 'to 3') comprising the SNP
marked of C. lanatus1 of C. lanatuswithout cyv_3.1in nucleotide 76 of the
rSNP ssp. mucosospermu sssp. lanatus(WTIWT)sequence and location of the physical SNP on chromosome 3 (") of cultivated watermelon
SNP_01 GGAAGGGGGGCGAAT AAAA T AAAAT A AATAAATTTGGTAGGGTTGG AGTGGAATAAAGGAGATTTT ATTTTATTTGGTTGA [A / G) "GAAACAAAAAGGGAAAAA TT GGAATTAAGGGTTTAAGGAG GGATAGGATATATAGTC.
SNP_02 GGGGAATCAGTCATAGTATAGTGGAA TATTTGACTGCAGGTATAAG ACTCAACTTCAGAAAGATCC AGACCTTTTTTTTAA [AlGl "AGAGAGAGAGAGAGAGAGAGA G AGAGAGAACTAGAAACAACA ATTTCCACCAAAAGAATGAA AAGAGACTAAGACTC 2 nucleotide"
SNP_03 DCDCTTCGAGTTGGCTATTAGAGTTG ATCGTTGGAGATGATTGACT GAGTTAGTTGCTAGAGGTGG TCGTTGAGTTGGTTG [CfT) "CGAAGGTATTCGTCAGGGCT AGTTGCGAAGTTGGGCTTTG GATTGATT
Phenotype CVYV resistantCVYV resistantCVYV susceptible
haplotype Haplotype A ofHaplotype B of
of the SNP resistance: GG-C for SNP _01, SNP_02 and SNP_03resistance: AG-C for SNP _01, SNP _02 and SNP _03
Watermelon plants grown diploid. seeds and parts of plants. comprising cvv 3.1
In one aspect of the invention (seed of) a diploid cultivated watermelon plant of the Citrullus lanatus ssp species. vulgaris, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, where said introgression fragment comprises a locus that confers resistance to CVYV and is optionally detectable by (or comprises) a marker selected from the group consisting in:
a) a guanine (G) in nucleotide 76 of SEO ID NO: 2 (SNP_02) or in nucleotide 76 of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) an eitosin (e) in nueleotide 76 of SEO ID NO: 3 (SNP _03) or in nueleotide
5 76 of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; and / or (optionally)
e) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20kb, 10kb, 5kb, 2kb, 1kb or less than 10 SNP _02 or SNP _03.
The above watermelon plant thus comprises an introgression fragment on chromosome 3 (which comprises cyv_3.1), which is detectable by the SNP _02 and / or SNP _03 resistance genotype and / or optionally another specific watermelon genome marker wild within 5 Mb of SNP _02 or SNP _03. Although SNP _02 and SNP _03 are closely related to OTL, it is possible to generate introgression fragments that have lost SNP _02 and / or SNP _03, but retain the OTL and one or more different wild watermelon genome markers closely linked to cyv_3 .1, as mentioned in c) above. The important contribution to the technique is that the introgression fragment comprises evcus resistance resistance referred to herein as cyv_3. 1. 20 The plant does not need to be phenotypically resistant to evyv, since CVYV resistance it can be heterozygous (only one recombinant chromosome 3 may be present). Therefore, the diploid genotype for SNP _02 can be heterozygous GA (guanine / adenine) or homozygous GG (guanine / guanine) and the diploid genotype for SNP _03 can be heterozygous eT (cytosine / thymine) or homozygous ce (cytosine / cytosine ). In another 25 words, a plant can be heterozygous for the introgression fragment (and the OTL), which has only one guanine (G) in nueleotide 76 of SEO ID NO: 2 (SNP _02), or in a corresponding nucleotide to nucleotide 76 of SEO ID NO: 2 in a variant sequence, that is, in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99% sequence identity with SEO ID NO: 2, and only one cytosine 30 in nucleotide 76 of SEO ID NO: 3 (SNP _03), or in a nucleotide corresponding to nucleotide 76 of SEO ID NO: 3 in a variant sequence, that is, in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; or it may be homozygous for the introgression fragment (and the OTL) that has two guanines in nucleotide 76 of SEO ID NO: 2 35 (SNP _02) or in a nucleotide corresponding to nucleotide 76 of SEO ID NO: 2 in a variant sequence, that is, in a sequence of a sequence comprising at least
90%, 91%, 92% .93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2 and having two cytosine (e) in the nucleolide 76 SEO ID NO: 3 (SNP _03)
or in a nucleotide corresponding to nucleotide 76 of SEO ID NO: 3 in a variant sequence, that is, in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 5 95%, 96% , 97%, 98% or 99% sequence identity with SEO ID NO: 3. The same applies to specific wild watermelon-genome markers, linked to cyv_3.1, in e) above, that is, this marker It can be heterozygous or homozygous. Markers in e) can be identified, for example, by sequencing the region. These markers can be any bookmark that is related to cyv_3.1 and that are
10 polymorphs between the wild watermelon genomic AON and the cultivated watermelon genomic AON, such as SNP markers, insertions or deletions of one or more nucleotides (eg, INOEL markers), AFLP markers, etc.
In one aspect, the introgression fragment is in homozygous form, and the introgression fragment comprising ellocus of cyv_3.1 of CVYV is homozygous, so that the plant is resistant to CVYV, as for example., Determinable in a CVYV resistance test and / or a molecular marker test. Therefore, in one aspect SNP _02, SNP _03 and / or the specific marker of the wild watermelon genome are homozygous, that is, SNP _02 and SNP _03 have the resistance genotype GG and ce, respectively, and the plant is CVYV resistant, for example., when tested in a
20 resistance test to CVYV and preferably also when grown in the field or tunnel under natural CVYV pressure.
As mentioned, the specific markers of the wild watermelon genome can be any type of molecular marker present in the introgression fragment comprising cyv_ 3.1 and distinguish the introgression fragment from the chromosome region of cultured watermelon 3 (WT genotype, which lacks cyv_3.1), for example, one or more SNP markers, CAPS markers, RFLP markers, AFLP markers, microsatellite markers, minisatellite markers, insertions or deletions of one or more nucleotides (for example, INOEL), etc. Therefore, a "wild watermelon genome specific molecular marker" is a marker that is polymorphic or distinct between the wild watermelon genome introgression fragment comprising cyv_3. 1 and the genome of cultured watermelon that lacks the introgression fragment. Polymorphic SNP markers have already been provided here, but those skilled in the art can easily develop other markers, for example, by mapping or fine mapping or sequencing the region on chromosome 3 comprising the introgression fragment. For example, the region of chromosome 3 of the deposited plants, which comprises the homozygous introgression fragment, can be sequenced and compared with the same region
of the watermelon chromosome 3 cultured to identify other specific molecular markers of the syllable watermelon genome in 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 2 kb , 1 kb or less of SNP _02 or SNP _03, that is, other genome-specific wild watermelon markers linked to SNP _2 and / or SNP _03 and therefore indicative of the introgression fragment comprising cyv_3.1.
Therefore, in one aspect, said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of:
a) a GG diploid genotype (guanine / guanine) in nucleotide 76 of SEO ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a diploid CC (cytosine / cytosine) genotype in nucleotide 76 of SEO ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; I
e) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP _02 or SNP _03 whose marker is homozygous.
When reference is made herein to a SNP genotype at a specific position, for example, in SEO nucleotide 76 ID NO: 2, "or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 099% sequence identity with SEO ID NO ", this means that the SNP genotype is present in a variant sequence in a nucleotide corresponding to the same nucleotide ( for example, corresponding to nucleotide 76 of SEO ID NO: 2) in the variant sequence, that is, in a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NOT mentioned. It may be, for example, that the variant sequence is one or a few shorter nucleotides, but when the variant sequence is aligned in pairs with the SEO ID NOT mentioned, it can be seen that the nucleotide of the variant sequence corresponds to the same nucleotide. In the variant sequence, this may be, for example, the number of nucleotides 75 or 77 of that variant sequence corresponding to nucleotide 76 of the mentioned sequence.
The previous plant is, therefore, also resistant to CVYV in its phenotype, as can be determined in a CVYV resistance test such as described in the Examples, or in the field or tunnel in areas where CVYV occurs naturally. . It is understood that a plurality of plants (for example, at least 10, 11, 12, 13, 14 or more) of the line or variety are tested in a CVYV resistance test, preferably in several repetitions (for example, 2, 3, 4 or more), and optionally in several locations, and including a plurality of plants of a susceptible control variety in the same assay. The seeds of the deposited lines can be included as a positive control. All current varieties of watermelon are susceptible to evyv, so any variety or parental line of that variety can be used as a susceptible control, for example, the old diploid variety Sugar Baby or Oumara (Nunhems) can be used.
In a specific embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species eitrullus lanatus ssp vulgaris is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, wherein said fragment Introgression comprises a locus that confers resistance to evyv and is detectable by (or comprises):
a) a guanine (G) in nucleotide 76 of SEQ ID N °: 2 (SNP_02) ° a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a cytosine (e) in nucleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3.
The plant comprises evcus evyv in homozygous or heterozygous form.
In one aspect, the plant comprises the homozygous introgression fragment, that is, the introgression fragment is detectable by (or comprises):
a) a GG diploid genotype (Guanine / Guanine) for nucleotide 76 of SEO ID NO: 2 (SNP _02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a diploid ce (cytosine / cytosine) genotype in nucleotide 76 of SEO ID NO: 3 (SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 3.
The above diploid plants may in one embodiment have SNP haplotype A or SNP haplotype B. Therefore, in one aspect the plants comprise the SNP haplotype A having GGC for SNP _01-SNP_02 and SNP _03, respectively (for example, in diploid form the SNP haplotype A is GG-GG-ee in homozygous form, or GG-GA-eT in heterozygous form). In another aspect, the plant comprises the SNP haplotype B that has AGC for SNP _01-SNP _02 and SNP _03, respectively (for example, in diploid form the SNP haplotype A is homozygous AA-GG-CC, or AG -GA-CT in heterozygous form). Thus. in nucleotide 76 of SEO ID NO: 1 (SNP _01) or of a sequence comprising at least 90%. 91% 92%, 93%, 94%, 95%. 96% 97% 98% or 99% sequence identity with SEO ID NO: 1, the SNP genotype can be a guanine
5 or an Adenine. SNP _01 can distinguish the two different resistance haplotypes.
Any of the diploid watermelon plants described above can be of any type, that is, the cyv_3.1 resistance locus can be introduced into any watermelon grown to produce lines or varieties that comprise CVYV ellocus. Cultivated watermelons produce various fruit sizes (for example, very small, as described in W02012069539, for example, less than 0.9 kg or even less than or equal to
0.65 kg; personal size of approximately 3-7 pounds, that is, around 1.4 to 3.2 kg; cooler sizes of about 6 to 12 pounds, that is, about
2.7 to 5.5 kg, and larger sizes are up to 35 pounds, that is, around 15.9 kg), fruit pulp colors and fruit shapes and with different crust colors. Locus 15 cyv_3.1 can, therefore, be introduced into cultured watermelon producing any form of fruit (for example, elongated, oval, elongated oval, elongated block or block, spherical or round). fruit surface (for example. furrowed. smooth). pulp color (for example red, dark red, scarlet red, coral red, orange, salmon or pink, yellow, canary yellow or white), bark color (for example, light green; dark green; striped green with stripes 20 narrow, medium or wide; gray types; or without spots, golden yellow, Crimson bark, Jubilee bark, Allsweet bark, black / dark green), bark thickness, bark hardness. bark pattern (for example, scratched, no scratches, mesh), pulp structure / firmness of pulp, lycopene and / or vitamin content, different proportions of sugar to acid, very good taste of fruit, etc. by reproduction. 25 See Guner and Wehner 2004. Hort Science 39 (6): 1175-1182. in particular pages 11801181 that describe the genes of the characteristics of the fruit. The main cultivation objectives are: early maturity. high fruit yield, high internal fruit quality (good uniform color, high sugar content, adequate proportion of sugar: acid, good taste, high vitamin and lycopene content, firm pulp texture, pulp texture
30 non-fibrous, absence of defects such as hollow heart, bark necrosis, flower end rot or cross stitch and good bark characteristics and resistance to cracking).
The fruits produced by the diploid line or variety are preferably fruit marketed bias.
In one aspect, the average brix is at least 6.0, 7.0, 8.0 or at least 9.0, preferably at least 10.0, more preferably at least 11.0 or more.
The color of the fruit can be any color, such as red, dark red, scarlet red, coral red, orange, salmon, pink, pinkish red, yellow, Canary yellow or white. Preferably, the color of the fruit pulp is uniform.
The diploid can be an inbred line or a diploid hybrid, produced by crossing two
5 inbred lines. In one aspect, both inbred progenitor lines are homozygous for cyv_3.1, so that the hybrid is also homozygous. The diploid plant can be an inbred line, a variety, an F1 diploid hybrid, an OP (open pollinated) variety, a pollinated plant (for example, a dedicated pollinator that produces marketable fruits as described in W02012069539) or
10 any other cultivated diploid, including any clonally propagated plant. Since the CVYV resistance phenotype is preferably expressed phenotypically, the introgression fragment is homozygous in the diploid, as are one or more of the markers linked to cyv_3.1.
The wild watermelon introgression fragment comprising cyv_3.1 can be of
15 different sizes, for example, about 15 Mb or less, about 10Mb or less, about 9Mb or less, about 8Mb or less, about 7Mb or less, about 6Mb or less, about 5Mb
or less, about 4Mb or less, about 3Mb or less, about 2.5Mb or 2 Mb or less, about 1 Mb (equal to 1,000,000 20 base pairs) or less, or about 0.5 Mb (equal to 500,000 base pairs) or less, such as approximately 200,000 bp (equal to 200 kilograms of base) or less, approximately 100,000 bp (100 kb) or less, approximately 50,000 bp (50 kb) or less, approximately 30,000 bp (30 kb) or less. Smaller introgression fragments are generally preferred, since negative traits can be located in the same fragment. The size of an introgression fragment can be reduced by meiotic recombination (for example, by self-fertilizing the plant) and by selecting recombinant progeny plants that have a smaller introgression fragment but that retains cyv_3.1, using, for example, an assay phenotypic and / or a molecular marker assay as described herein. If SNP_01 and / or SNP_02 and / or 30 SNP_03 are lost by recombination, but the plant retains the cyv_3.1 locus, the phenotypic selection can be used to select a plant that retains cyv_3.1 and / or the introgression fragment can be detect using another method, for example, sequencing the region of chromosome 3 where the QTL is located (for example, the region between about 2.50 Mb and about 12.8 Mb of chromosome 3, see Figure 1) or
35 other wild markers specific to the watermelon genome linked to cyv_3.1. Said other specific markers of the wild water genome can be developed using methods known to the skilled person, such as fine mapping, sequencing, etc.
In one aspect, the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and in which the introgression fragment is introgressed from a wild watermelon plant) is a fragment that comprises (or encompasses) the region that starts in
2.50 Mb And ends at 12.80 Mb of chromosome 3 and comprises the locus cyv_3.1 or a variant thereof.
In another aspect, the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and in which the introgression fragment is introgressed from a wild watermelon plant) is a fragment comprising a fragment (part) more small of the region that starts at 2.50 Mb and ends at 12.80 Mb of chromosome 3, for example having a size of, for example, 9Mb, 8Mb, 7Mb, 6Mb, 5Mb, 4Mb, 3Mb, 2Mb, 1Mb, O.5Mb, 100kb, 50kb, 35kb, 30kb, 20kb, or less (as described above) and comprising the locus cyv_3.1 or a variant thereof. In one aspect, the part is at least 5kb, 10kb, 20kb in size or more.
In a further aspect, the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and in which the introgression fragment is introgrested from a wild watermelon plant) consists of a smaller fragment (subfragment) of the region starting at 2.50 Mb and ending at 12.80 Mb of chromosome 3, for example, having a size of, for example, 9Mb, 8Mb, 7Mb, 6Mb, 5Mb, 4Mb, 3Mb, 2Mb, 1 Mb, O.5Mb, 100kb , 50kb, 35kb, 30kb, 20kb, or less (as described above) and that comprise ellocus cyv_3.1 or a variant thereof. In one aspect, the part is at least 5kb, 10kb, 20kb in size or more.
In a further aspect, the introgression fragment of the invention (comprising cyv_3.1 or a variant thereof and in which the introgression fragment is introgrested from a wild watermelon plant) comprises the region that begins at 7.50 Mb and ends in 7.75Mb of chromosome 3, or the region that begins at 7.60 Mb and ends at 7.70 Mb, where the fragment comprises the locus cyv_3.1 or a variant thereof. In one aspect, the part is at least 5kb, 10kb, 20kb in size or more.
Seeds are also provided here from which the plants of the invention can be grown.
Also, the plant parts of the plants of the invention are included herein, such as cells, roots, leaves, fruits, fruit parts, pollen, ovules, flowers, rootstocks, stems, cuttings, stems, DNA extracted from such parts or cells. , etc. Said parts of plants comprise in their genome at least one recombinant chromosome 3 comprising the introgression fragment, detectable by one or more markers as described. Also, genomic DNA extracted from such cells or parts of plants comprises in its genome at least one recombinant chromosome 3 comprising the introgression fragment, detectable by one or more markers as described.
The source of resistance to CVYV C. lanatus ssp. mucosospermus was a wild access obtained from the GRIN collection of the United States. It has small fruits (approximately 13 cm x 13 cm) of white pulp with a brix of approximately 3.0. The access of C. lanatus ssp lanatus was also a wild access obtained from the GRIN collection of the United States. It had yellow bitter fruits of about 16 cm x 24 cm, with a brix below 3.0.
The resistance cyv_3.1 receded from these two diploid wild accesses to elite watermelon lines susceptible to CVYV, thus generating cultured diploid watermelon comprising cyv_3.1 and which is resistant against CVYV, when the introgression fragment was homozygously present. .
As mentioned earlier, the seeds of two diploid inbred cultured watermelon lines comprising cyv_ 3.1 in a homozygous manner have been deposited in the NCIMB under the accession numbers NCIMB42449 and NCIMB42450. These two lines comprise SNP _02 and SNP _03 in a homozygous manner and have the SNP haplotype B. The fruits are fruits of red pulp, with seeds, which have a brix of 11.0 and, therefore, are fruits marketed bias. The plants are resistant to CVYV but susceptible to ZYMV (and also lack the elF4E marker of Ling et aL, 2008 supra). One of the lines has fruits with Crimson sweet crust, the other has fruits with Jubilee crust. Cyv_3.1 can be transferred from these two lines to any other watermelon line or variety grown by traditional selection, using phenotypic selection or marker selection, or both.
Also the seeds of another inbred elite diploid line comprising cyv_3.1 in a homozygous manner have been deposited by Nunhems BV in the NCIMB under the accession number NCIMB 42666. This line comprises SNP _02 and SNP _03 in a homozygous form and has the haplotype A SNP The fruits are fruits of red pulp with seed. The plants are resistant to CVYV.
In one aspect, cyv_3.1 can be obtained from (can be obtained from them as is present in) seeds deposited under NCIMB42449 or NCIMB 42450 or NCIMB 42666. for example, by crossing plants grown from such seeds (or progeny of same) with another watermelon plant and selecting the progeny comprising the introgression fragment. In one aspect, the other watermelon plant is a cultivated watermelon that lacks cyv_3.1.
Alternatively, other wild accesses of C. lanatus ssp. mucosospermus or C. lanatus ssp. lanatus can comprise cyv_3.1 (or a variant thereof) and can be used to introgress cyv_3.1 (or a variant thereof) in cultured watermelon. To identify such other wild accesses, one or more of the markers provided herein may be used, optionally in combination with CVYV resistance tests. For example, it was discovered that the seeds of wild watermelon access P1189318, comprise cyv_3.1, as shown in Example 6, when the progeny of wild watermelon access from the GRIN collection of the United States is screened. Using the SNP markers provided here. PI189318 produces white pulp hard fruits, which are bitter and have a very low brix (around 3.0). The cyv_3.1 locus can be intrigued from this, or other accesses of wild watermelon, in cultured watermelon as described herein, optionally using one or more of the SNP markers provided herein. Therefore, in one aspect, the cultured watermelon plant of the invention comprises an introgression fragment of, for example, PI189318 or progeny thereof, or of other wild watermelons, where the introgression fragment comprises resistance idols cvy_3. 1 and is detectable by one or more markers linked to cvy_3.1 as described in this document. Wild watermelons can be from SNP haplotype A or B. For example, PI189318 has the A SNP haplotype homozygously.
In an embodiment of the invention (seed of) a diploid cultivated watermelon plant of the species eitrullus lanatus ssp vulgaris, it is provided wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, wherein said fragment of introgression comprises a locus that confers resistance to evyv, whereby said introgression fragment comprises:
a) a guanine (G) in nucleotide 7.664.093 of chromosome 3 of the cultured watermelon genome (SNP_02); I
b) a cytosine (e) in nucleotide 7.693.225 of chromosome 3 of the cultured watermelon genome (SNP_03); and / or optionally
c) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20 kb. 10 kb. 5 kb 2 kb. 1 kb or less of SNP _02 or SNP _03.
In another embodiment of the invention (seed of) a diploid cultivated watermelon plant of the Citrullus lanatus ssp vulgaris species, it is provided where said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, where said introgression fragment it comprises a locus that confers CVYV resistance and by which said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of:
a) a guanine (G) in nueleotide 76 of SEO ID NO: 2 (SNP _02) or a nucleic acid molecule that hybridizes under stringent conditions with SEO ID NO: 2; I
b) a cytosine (C) in nucleotide 76 of SEO ID NO: 3 (SNP _03) or a nucleic acid molecule that hybridizes under stringent conditions with SEO ID NO: 3; and / or optionally
c) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20 kb 10 kb 5 kb 2 kb. 1 kb or less of SNP _02 or SNP _03.
In a different embodiment of the invention (seed of) a diploid cultivated watermelon plant of the Citrullus lanatus ssp vulgaris species. it is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, wherein said introgression fragment comprises a locus that confers resistance to CVYV and by which said introgression fragment is detectable by (or comprises) a bookmark selected from the group consisting of:
a) a guanine (G) in nueleotide 76 of SEO ID NO: 2 (SNP _02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) an eitosin (C) in nueleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; and / or optionally
c) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20 kb 10 kb 5 kb 2 kb. 1 kb or less of SNP _02 or SNP _03.
In one aspect, the introgression fragment and the markers are homozygous.
In one aspect, the plants of the invention lack a locus that confers resistance to ZYMV on chromosome 3. However, resistance to CVYV can also be combined with resistance to ZYMV on chromosome 3 as described below.
Also parts of plants, such as fruits or parts of them, cells, leaves, flowers, etc.5 of the above plants are included here. As mentioned earlier, fruits aremarketable diploid fruits.
In one embodiment, the cultivated watermelon plant or the part of the plant comprising the locus that confers CVYV resistance as found in seeds deposited with accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666 or as found in watermelon wild PI 189318 or other wild watermelons. Thus, in one aspect, cyv_3.1 is obtainable (obtainable) by crossing a watermelon plant whose seeds were deposited with the accession number NCIMB42449 or NCIMB42450 or NCIMB42666, or the progeny of any of these plants (for example, obtained by self-fertilization and / or crossing and whose progeny retains the cyv_3.1), with another watermelon plant, for example a line
15th elite variety of cultivated watermelon. In another aspect, the cyv_3.1 gene can be obtained by introgression of the resistance of wild watermelons, such as PI189318 or other wild watermelons, to cultivated watermelon.
In another aspect, the cultivated watermelon plant or part comprising the introgression fragment that confers CVYV resistance as found in the
20 seeds deposited with access numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or a shorter part thereof, which retains cyv_3.1. Thus, in one aspect, the introgression fragment comprising cyv _3.1 is obtainable (can be obtained by) crossing a watermelon plant whose seeds were deposited with the accession number NCIMB42449
or NCIMB42450 or NCIM842666, or the progeny of any of these plants (for example,
25 obtained by self-fertilization) and / or crossing and whose progeny retains the cyv_3.1), with another watermelon plant.
Therefore, the CVYV resistance gene on chromosome 3 is in one aspect the gene present in the seeds deposited under Accession Number NCIMB42449 or NCIMB42450 or NCIMB42666, or its progeny, but it can also be the resistance gene of another wild watermelon, especially a wild watermelon comprising one or more of the SNP markers, that is, the resistance genotype of the SNP markers, linked to cyv_3.1. Examples are wild accesses like PI189318 or others. In addition to the marker analysis or as an alternative, for example, the expert can easily carry out an allelism test to determine if said CVYV resistance is conferred by the same resistance gene, specifically cyv_3.1. Of the same
mode, other methods or combinations of methods, such as mapping, fine mapping, sequencing, genetic inheritance and the like can be used to confirm that the same gene, cyv _3.1, is responsible for the CVYV resistance phenotype.
Combine cvv 3.1 that confers resistance to CVYV with resistance to ZYMV
5 The inventors found that cyv_3.1 is located on the same chromosome as the generecessive zym, which confers resistance against ZYMV. Therefore, cyv_3.1 can becombine with zym on chromosome 3 to provide a chromosome comprisingloci that confer resistance to CVYV and ZYMV in the coupling phase.
ZYMV is a virus transmitted by Midos and can cause deformation and discoloration of 10 mild to severe fruits.
Sources for zym resistance are, for example, PI595203 as described by Ling et al. 2008 (supra). The inventors have converted the CAPS marker described by Ling et al. 2008 on an SNP marker called SNP _04, see Table 2.
Table 2 - SNP marker in the elF4E gene linked to resistance to ZYMV and localization
15 SNP on chromosome 3 of the cultivated watermelon genome published in the world wide webred world icugi.org/cgi-bin/ICuGl/index.cgi, "Watermelon: Genome", "Watermelon genome (97103) -version 1"
Name Sandái withVariety ofGenomic sequence (direction 5 'to 3') that
of the introgressionwatermelon withoutcomprises the SNP in nucleotide 70 of the
marker zym / zym de porzym / zymsequence, and physical location on the chromosome
SNP ex. PI5952033 (*) of cultivated watermelon
SNP_04 GGTTTGAAGTTCTACCTCCAAAAC TCCTCAACAGTAGAGAAGGT ATAGATCGGTCGGATAGACG CACCCCAGG [GIT] 'GGCTT GCTTAGACTTGGCGGATGGG TTATCGAACCAAAAGGTCCA AGAGTGCTCAAGAGGGTGAG GCTGATGCACTATCGCCGCC GACAAATTGGACGAGTCAAG GTCGTCGTCTCCGACGATCT CTCCTTCCTCAAGTTCCTCA TCTTCATCACCGCCTCGTCC TCTAGGGTTTTGATTTGCAA TGGTATTAGAAAGATCTTCC
GTGGATGTAGCTTTGATCGT CTCTTCGACTACCATTTTCC TTTCACTACTTGTGGAATTG AGCGT (SEO ID NO: 4) * Located in nucleatide 7,767,975
Phenotype ZYMV resistantSusceptible to ZYMV
The diploid watermelon plants of the invention described above can, therefore, further comprise the zym gene on chromosome 3.
Therefore, in one aspect of the invention (seed of) a cultivated watermelon plant
5 diploid of the species Citrullus lanatus ssp. Vulgaris is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3 comprising a locus that confers resistance to CVYV, whereby said introgression fragment is detectable by (or comprises) a marker selected from the group consisting of:
10 a) a guanine (G) in nucleotide 76 of SEQ ID NO: 2 (SNP_02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99% sequence identity with SEO ID NO: 2; and I or
b) a cytosine (e) in nueleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% 15 sequence identity with SEO ID NO: 3; Y! or
c) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20kb 10kb 5kb 2kb 1kb or less of SNP_02 or SNP _03; Y
d) where the plant additionally comprises the zym gene on chromosome 3.
Optionally, the presence of (a fragment of introgression that comprises) the zym gene is by detecting a guanine (G) in nueleotide 70 of SEO ID NO: 4 (SNP_04) or a sequence comprising at least 90% 91% 92% 93% 94% 95% 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 4. However, SNP 04 is probably not very related to zym, so phenotypic selection or the development of a marker more closely Linked may be preferred to ensure that zym is present.
The recombinant chromosome 3, therefore, comprises the introgression fragment comprising the CVYV resistance locus cyv_3.1 and may further comprise (an introgression fragment comprising) the zym gene on the same chromosome. The plant does not need to be phenotypically resistant to CVYV and resistant to ZYMV, since the CVYV resistance locus and the zym gene may be in heterozygous form (only a recombinant chromosome 3 may be present). In one aspect, the plant is homozygous for the recombinant chromosome 3 and, therefore, is resistant against both CVYV and ZYMV.
Thus, in one aspect, the introgression fragment comprising CVYV resistance cyc_3.1 estocus is homozygous, and the zym gene (introgression fragment it comprises) is homozygous, so the plant is resistant to CVYV and ZYMV. In one aspect, the specific marker (s) of the wild watermelon genome linked to cyv_3.1 are homozygous and zym is homozygous (zym / zym), and optionally SNP _04 (if present) is homozygous GG (Guanina) / Guanine).
In a specific embodiment of the invention (seed of) a diploid cultivated watermelon plant of the Citrullus lanatus ssp species. vulgaris is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3 comprising a locus that confers resistance to CVYV called cyv_3.1, whereby said introgression fragment is detectable by (or comprises) :
a) a guanine (G) in nucleotide 76 of SEO ID NO: 2 (SNP _02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; Y
b) a cytosine (C) in nucleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; Y
c) wherein chromosome 3 additionally comprises the zym gene.
In one aspect, the plant comprises the introgression fragment on chromosome 3 in a homozygous manner, that is, the introgression fragment is detectable by (or comprises):
a) a GG diploid genotype (Guanine / Guanine) for nucleotide 76 of SEO ID NO: 2 (SNP _02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2;
Y
b) a diploid ce (cytosine / cytosine) genotype in nucleotide 76 of SEO ID NO: 3(SNP_03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%,95%, 96%, 97%, 98% or 99% sequence identity with SEQ ID NO: 3; Y
c) where chromosome 3 further comprises the zym gene in a homozygous manner
(zym / zym); Y
d) where the plant is resistant to CVYV and ZYMV.
The above diploid plants may have, in one embodiment, a SNP haplotype A
10 in CVYV or a SNP haplotype B combined with the zym gene. Therefore, in one aspect, the plants comprise the SNP haplotype A having GGC for SNP _01 and SNP _02 and SNP _03, respectively (for example, in diploid form, the haplotype A of the SNP is homozygous GGGG-CC or GG-GA-CT in heterozygous form) and the zym gene linked on the same chromosome as cyv_3. 1 (and optionally SNP _04 has the diploid genotype
15 GT, heterozygous or GG, homozygous). In another aspect, the plant comprises the SNP haplotype B that has AGC for SNP _01 and SNP _02 and SNP _03, respectively (for example, in diploid form, the haplotype A of the SNP is homozygous M-GG-CC or AG -GACT in heterozygous form) and the zym gene linked on the same chromosome as cyv_3.1 (and optionally SNP _04 has the GT diploid genotype, GG heterozygous, homozygous). By
Therefore, in nucleotide 76 of SEO ID NO: 1 (SNP _01) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 1, the SNP genotype can be a Guanine or an Adenine. SNP _01 can distinguish the two different haplotypes of CVYV resistance, but any haplotype can be combined with the zym gene on the same chromosome 3.
25 A CVYV and ZYMV resistant diploid plant can therefore comprise one of the following two genotypes:
SNP marker and gene on chromosome 3 3 SNP diploid genotypeSNP diploid genotype
SNP_01 GGAA
SNP_02 GGGG
SNP_03 ECEC
gen zym / zymzym / zym

I Optionally SNP_04
To combine CVYV cyv_3.1 resistance with the zym gene, the skilled person will cross a plant of the invention, comprising cyv_3.1, with a plant comprising the zym gene and select a recombinant progeny plant comprising the locus
5 cyv _3.1 of CVYV and the zym gene on a recombinant chromosome 3.
In one embodiment, the cultivated watermelon plant or part that comprises ellocus cyv_3.1 that confers resistance to CVYV as found in seeds deposited with accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666 and also comprises the zym gene .
In one embodiment, the cultivated watermelon plant or part comprising the introgression fragment (comprising cyv_3.1) as found in seeds deposited with accession numbers NCIMB 42449 or NCIMB 42450 or NCIMB 42666,
or a smaller fragment thereof (which retains the cyv_3.1 locus) and also comprises the zym gene.
In one aspect, diploid watermelon plants (and the seeds from which the plants can be grown) according to the invention are inbred lines, produced by self-fertilization several times.
In another aspect, diploid watermelon plants (and the seeds from which the plants can be grown) according to the invention are F1 hybrids produced by crossing two diploid inbred lines according to the invention and collecting the seeds from the cross. .
Plants grown from the deposited seeds were also analyzed to determine resistance to CGMMV (green cucumber virus), but were susceptible, indicating that cyv_3.1 does not confer resistance to CGMMV.
25 watermelon plants grown tetraploids. v parts of plants. comprising cyv 3.1 (or a variant thereof)
The production of seedless triploid watermelon implies the use of pollen from male diploid progenitor plants to fertilize the flowers of tetraploid maternal parental plants (2n = 4x = 44). Pollination of tetraploid flowers with diploid pollen leads to 30 F1 seeds that are triploid (Kihara, 1951, Proceedings of American Society for Horticultural Science 58: 217-230, Eigsti 1971, Hort Science 6: 1-2). Triploid hybrid plants,
grown from these F1 seeds, they are self-infertile since they produce sterile pollen due to chromosomal imbalance (Fehr, 1987). Triploid hybrids, therefore, need to be pollinated by a diploid pollinator to produce watermelon fruit. Therefore, triploid plants are interspersed with pollinator plants for the production of
5 fruit The "seedless" fruit produced after pollination in the triploid hybrid plant is often not really seedless, but may contain some small, pale, undeveloped seeds that are edible.
Therefore, to produce such seedless triploid varieties, a tetraploid female parental line (preferably an inbred line) and a male diploid parental line (preferably an inbred line) are crossed. The seeds produced in the fruits of the tetraploid parent by cross-pollination are triploids, which have two sets of chromosomes from the tetraploid mother and a set of chromosomes from the diploid father. These seeds are harvested and sold as triploid varieties. Triploid plants grown from these seeds still need pollen to induce
15 the fruit (provided by a pollinator), but the fruits produced are fruits of seedless watermelon.
In one aspect, a tetraploid watermelon plant is provided comprising four recombinant chromosomes 3, that is, each comprises the introgression fragment of a wild watermelon comprising cyv_3.1. Therefore, the tetraploid plant
20 comprises four copies of cyv_3.1. When crossed with a male diploid parental line comprising two copies of cyv_3.1, the resulting triploid seeds comprise three copies of cyv_3.1.
To make such a tetraploid plant, any of the CVYV resistant diploid plants described above, which are homozygous for the introgression fragment, can be used as a starting material to generate tetraploid plants. Chromosome duplication techniques known to those skilled in the art can be used to generate a tetraploid plant from such diploid plants. For example, Noh et al. (2012) Hort. Reign. Biotechnol 53 (6): 521-529, evaluated different methods to generate tetraploid watermelons. In all methods, an antimitotic agent, such as colchicine, dinitoalanine or orizaline, is used to induce chromosome duplication. Optionally, tissue culture can be used to generate tetraploid plants from parts of plants. To verify that the plants are tetraploids, the number of chromosomes can be confirmed. Ploidy can easily be determined by chromosome count or flow cytometry or other known methods (Sari et aL, 1999, Scientia
35 Horticulturae 82: 265-287, incorporated herein by reference).
Therefore, in one aspect of the invention (seed of) a CVYV resistant tetraploid cultivated watermelon plant of the Citrullus lanatus ssp vulgaris species. it is provided, where said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, whereby said introgression fragment confers CVYV resistance due to the presence of the cyv_3.1 dellocus and whereby recombinant chromosome 3 is present in four copies.
The introgression fragment is detectable by (or comprises) a marker selected from the group consisting of:
a) a guanine (G) in nucleotide 76 of SEO ID NO: 2 (SNP_02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a cytosine (C) in nucleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; I
e) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP 02 or SNP 03.
As mentioned, the tetraploid plant comprises four copies of said recombinant chromosome 3.
Therefore, in one embodiment, the above tetraploid watermelon plant comprises:
a) a GGGG tetraploid genotype (guanine / guanine / guanine / guanine) for nucleotides 76 of SEO ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a tetraploid CCCC genotype (eitosin / eitosin / eitosin / eitosin) in nueleotide 76 of SEO ID NO: 3 (SNP _03) or of a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; I
e) a tetraploid genotype for the watermelon-wild-type genome molecular marker within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP _02 or SNP _03.
Genotyping of tetraploid plants or parts of plants (cells, leaves, DNA, etc.) can be done in the same manner as for diploids, using, for example, a KASP test to distinguish genotypes of SNPs, for example, plants or parts comprising GGGG for SNP _02 can be distinguished from plants or parts comprising GGGA,
5 GGAA, GAAA or AAAA for SNP_02 in your genome.
Since the tetraploid is obtained by duplicating the chromosomes of a CVYV resistant diploid described above, the aspects described for the anterior diploid also apply to the tetraploid. For example, the tetraploid may also comprise the zym gene in the coupling phase on the recombinant chromosome 3 and, therefore, may comprise
10 four copies of cyv_3.1 (or a variant thereof) and four copies of zym. Similarly, haplotype A or haplotype B can be present in four copies.
Then, the following tetraploids can be derived from the above diploids:
SNP marker and gene in the
SNP diploid genotype ~
SNP diploid genotype ~
chromosome 3
tetraploid SNP genotype
tetraploid SNP genotype
SNP _01
GG ~ GGGG
AA ~ AAAA
SNP_02
GG ~ GGGG
GG ~ GGGG
SNP_03 CC ~ cccc
ce ~ CCCC
Optionally zym gene
zym / zym ~ zym / zym / zym / zym
zym / zym ~ zym / zym / zym / zyrn
Optionally SNP_04
GG ~ GGGG
GG ~ GGGG
The CVYV-resistant tetraploid is preferably self-fertilized several times, to produce an inbred tetraploid, which can be used as a female parent in the production of triploid seeds.
In one aspect, CVYV resistant diploid plants whose seeds were deposited with accession numbers NCIMB 42449 and NCIMB 42450, or progeny thereof (for example, which comprise a smaller introgression fragment) are used to prepare tetraploids. These plants do not understand the zym gene and are susceptible to ZYMV.
In one aspect, CVYV-resistant diploid plants whose seeds were deposited with accession numbers NCIMB 42666, or progeny thereof (for example, which comprise a smaller introgression fragment) are used to prepare tetraploids.
In another aspect, cultured watermelon plants comprising a cyv_3.1 gene from a different wild watermelon, such as PI189318 or others, are used to prepare a CVYV resistant tetraploid plant.
In addition, plants comprising both cyv_3.1 (or a variant) and the zym gene can be used to prepare tetraploids. The cyv_3.1 (or a variant thereof) can be easily combined with the zym gene, such as that found in P1595203, by traditional reproduction techniques and recombinant selection, optionally with the help of markers described herein, comprising both cyv_3.1 and zym on chromosome 3. PI595203 is available at USDA, ARS, National Genetic Resources Program, Germplasm Resource Information Network - (GRIN).
Therefore, in one aspect a tetraploid watermelon plant (and seed from which the plant can be cultivated) is provided here comprising the locus that confers resistance to CVYV as found in NCIMB 42449 or NCIMB 42450 or NCIMB 42666
or in PI189318 or other wild watermelons and optionally comprising the zym gene.
In one aspect, the tetraploid watermelon plants (and the seeds from which the plants can be grown) according to the invention are inbred lines, produced by self-fertilization several times. In one aspect, the plants are suitable as parental lines for the production of triploid seed, which is described below.
The seeds from which such tetraploid plants can be grown are included here. Also included here are parts of plants of the tetraploid plants according to the invention, such as cells, pollen, flowers, fruits, leaves, stems, etc. Fruits are preferably marketable fruits. The brix is preferably at least 6.0, 7.0.8.0 at least 9.0, preferably at least 10.0, more preferably at least 11.0
or more. The color of the fruit can be any color, such as red, dark red, scarlet red, coral red, orange, salmon, pink, pinkish red, yellow, Canary yellow or white. Preferably, the color of the fruit pulp is uniform.
In one aspect, the tetraploid plant of the invention is a vegetative propagation.
Tetraploid plants can self-fertilize one or more times, but they can also cross into another tetraploid watermelon plant. If that other tetraploid watermelon plant lacks cyv_3.1, the F1 produced by the crossing contains only two copies of cyv_3.1. If such a plant intersects again with a tetraploid plant that lacks cyv_3.1, a progeny can be generated with only one copy of cyv_3.1. Similarly, if said plant is self-fertilized, a progeny can be generated with one or three copies of cyv_3.1. Therefore, a tetraploid watermelon comprising 3, 2 or only 1 copy of cyv_3.1 is also included here.
Watermelon triDloid plants v Dartes of plants comprising cvv 3.1 (or a variant thereof)
In one aspect, the CVYV resistant tetraploid plant described above is used as a female parent and is pollinated with pollen from a CVYV resistant diploid male parent (also as described above) and the seeds of the cross are collected. These seeds are triploids, that is, they comprise three copies of the cyv_3.1 locus of the invention. Plants grown from these seeds are resistant to CVYV and produce seedless watermelon fruits (triploid fruits). Optionally, the plants are also resistant to ZYMV, that is, they comprise the zym gene.
Therefore, all aspects described above for diploid and tetraploid plants of the invention apply to triploid seeds and to plants grown from such seeds. So, for example, in one aspect, locus cyv_3.1 is locus eyv_3.1 found in seeds deposited under NCIMB 42449 or NCIMB 42450
or NCIMB 42666. But it can also be the cyv_3.1 gene found in wild watermelons, such as PI189318 or others. In another aspect, the introgression fragment (comprising ellocus cyv_3.1) found in the seeds deposited under NCIMB 42449 or NCIMB 42450 or NCIMB 42666 is encompassed here, or a smaller fragment thereof, whose smaller fragment retains the cyv_3 locus .one. But other variants of cyv_3.1 are also included here, for example, from other accesses of wild watermelon.
Seeds from which CVYV resistant triploid plants can be grown are an embodiment herein, as are the parts of plants grown from such seeds, as well as seedless watermelon fruits produced by these plants.
Triploid seedless fruits are preferably marketable. Preferably they have an average brix of at least 6.0, 7.0, 8.0 or preferably at least 9.0, preferably at least 10.0, more preferably at least 11.0.
Fruits can be of any size, shape, color and bark pattern. Preferably, the color of the fruit pulp at maturity is uniform. In one aspect, the pulp of the fruit is red or dark red.
The average fruit weight of a triploid hybrid comprising cyv_3.1 (or a variant thereof) in three copies may be equal to or greater than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13 or 14 kg. In another embodiment, the average fruit weight of a triploid hybrid comprising cyv_3.1 (or a variant thereof) in three copies may be equal to or less than 5 kg, for example 4, 3, 2, 1.5 or 1 kg or even less.
Seedless fruits can be of any shape (for example elongated, oval, compact, spherical or round), fruit surface (furrowed, smooth), pulp color (red, dark red, scarlet red, coral red, orange, salmon , pink, pink red, yellow, canary yellow or white), bark color (for example, light green; dark green; green stripes with narrow, medium or wide stripes; gray types; with or without spots; golden yellow), crust thickness, crust hardness, crust pattern (e.g., scratched, scratch-free, mesh), pulp structure / firmness of the pulp, lycopene and / or vitamin content, different proportions of sugar to acid, fruity taste, etc.
Therefore, the CVYV resistance conferred by ellocus cyv_3.1 (or variant) can be used to reproduce a range of seedless varieties, producing fruits of different shapes and sizes, etc. through traditional cultivation. See Guner and Wehner 2004, Hort Science 39 (6): 1175-1182, in particular pages 1180-1181 describing the genes of fruit characteristics. The main cultivation objectives are: early maturity, high fruit yield, high internal fruit quality (good uniform color, high sugar content, adequate proportion of sugar: acid, good taste, high vitamin and lycopene content, pulp texture firm, non-fibrous pulp texture, freedom from defects such as hollow heart, bark necrosis, flower end rot or cross stitch and good crust characteristics and resistance to cracking).
In one aspect, the triploid plant of the invention is a vegetative propagation.
Vegetative propagation and cell or tissue cultures
The above diploid plants, tetraploid plants or triploid plants can also reproduce vegetatively (clonally) and such vegetatively propagated plants, or "vegetative propagations" are an embodiment of the invention. They can be easily distinguished from other watermelon plants by one or more (or all) of the markers related to cyv_3.1 (or a variant thereof) and / or phenotypically.
Vegetative propagation can be done by different methods. For example one
or more stems of a plant of the invention can be grafted onto a different rootstock, for example a rootstock tolerant to biotic or abiotic stress.
Other methods include in vitro cell or tissue culture methods and regeneration of vegetative propagation of said cultures. Such cell or tissue cultures comprise or consist of various cells or tissues. In one aspect, said cell or tissue culture comprises or consists of vegetative cells or vegetative tissues.
5 In another aspect, a cell or tissue culture comprises or consists of cells or tissuesreproductive, such as anthers or ovules. Such cultures can be treated with agentsof duplication of chromosomes to make, for example, double haploid plants, orthey can alternatively be used to make haploid plants (for example, to formdiploids from a tetraploid or to form haploids from a diploid).
10 An in vitro cell or tissue culture may, therefore, comprise or consist of cells or protoplasts or plant tissue of a part of the plant selected from the group consisting of: fruit, embryo, meristem, cotyledon, pollen, ovule, leaf , anther, root, root tip, pistil, flower, seed, thallium. Parts of any of these are also included, such as only the seed coating (maternal tissue).
Therefore, in one aspect of the invention. a cell culture or a tissue culture of cells of a plant comprising one is provided. two, three or four copies of cyv_3.1 (or a variant), all as described above. As mentioned, a cell culture or a tissue culture comprises cells or protoplasts or plant tissue of a part of the plant of a plant comprising cyv_3.1 may comprise or consist of cells
20 or selected tissues from the group consisting of: embryo, meristem, cotyledon, pollen, leaf. anther, root, root tip, pistil, flower, seed, thallium; or parts of any of these.
A regenerated watermelon plant is also provided from said cell culture or tissue culture, where the regenerated plant (or progeny thereof, for example obtained after self-fertilizing the regenerated plant) comprises ellocus cyv_ 3.1 (or a variant
25 thereof). Therefore, in one aspect, the watermelon plant comprising cyv_3.1 (or a variant thereof) in one or more copies is a vegetatively propagated watermelon plant.
In a different aspect, the cells and tissues of the invention (and optionally also cell or tissue culture). comprising cyv_3.1 (or a variant thereof) in one or more
30 copies are cells or tissues that do not spread.
Methods and uses of QTL cvv 3.1 (or a variant) vIo of markers linked to cw 3.1 (or a variant thereof)
Ellocus cyv_3.1 recessive of the invention (or a variant thereof), that is, the introgression fragment comprising the locus, can be transferred to, or introduced into, any other cultivated watermelon plant, for example, making crosses with the plants of the invention, for example, plants grown from the deposited seeds, or with plants of the
5 invention vegetatively propagated, or identifying wild watermelon plants comprising cyv_3.1 (or a variant thereof) and intruding cyv_3.1 (or a variant thereof) from such wild access to cultivated watermelon as described in the present document
For example, watermelon wild accesses can be selected with one or more
10 allocus linked markers cyv_3.1 (for example, SNP _02 and / or SNP _03 and / or one or more different markers linked to cyv_3.1) to identify putative wild accesses comprising cyv_3. 1 or a variant thereof. Such accesses can also be selected optionally or alternatively phenotypically in a CVYV resistance test and / or can be crossed with cultivated watermelon plants and
15 descendants of the crossing can be selected for the CVYV resistance marker genotype and / or CVYV resistance phenotype. The person skilled in the art can, therefore, identify the QTL cyv_3.1 or a variant thereof in other accesses of wild watermelon, transfer it to watermelon grown on chromosome 3, for example, by backcrossing 4, 5, 6, 7 or more times to watermelon lines grown to generate diploid watermelon plants from
The invention. These can then be used to generate tetraploids and triploids as described herein.
Therefore, CVYV resistance conferred by cyv_3.1, or a variant thereof, can be crossed into different genetic backgrounds of cultivated watermelon for example, using seed deposited herein as a source of cyv_3.1, as described elsewhere
25 of this document, or identifying the cyv_3.1 (or a variant thereof) in accesses of wild watermelon and (retro) crossing it in cultivated watermelon.
Cyv_3.1 (or a variant) can be introduced into other watermelon plants that lack cyv_3.1 (or a variant) using known cultivation methods. Known culture methods can be used alone or in combination, such as (but not limited to) recurrent selection, pedigree culture, backcross culture, inbred development, hybrid testing, marker-assisted culture, etc. . Then the progeny that retain cyv_3.1 (or a variant) is selected using one or more of the markers provided herein and / or CVYV resistance (when a dominant WT allele is not present). Therefore, the selection of progeny plants 35 that have cyv_3.1 (or a variant) can be performed by phenotypic selection of CVYV resistance in self-fertilized plants one or more times and discarding plants
that are susceptible to CVYV. For example, if the progeny that secretes for CVYV resistance is inoculated or planted in an area infested with CVYV, CVYV resistant plants can be easily identified.
Therefore, in one aspect, a method for generating a cultured diploid watermelon of the Citrullus lanatus ssp species. vulgaris it is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, wherein said introgression fragment comprises a locus that confers resistance to CVYV, which comprises the steps of:
Crossing a wild watermelon plant comprising a locus that confers resistance to CVYV on chromosome 3 with a cultivated diploid watermelon plant and selecting progeny of said crossroads comprising a cultivated watermelon master gene and an introgression fragment on chromosome 3 of the wild watermelon plant, by means of which said introgression fragment comprises ellocus that confers resistance to CVYV.
The presence of the locus that confers resistance to CVYV in the wild watermelon plant and / or in the progeny can be determined phenotypically using a CVYV resistance test and / or molecular level, detecting the presence of one or more of the markers described here. linked to cyv_ 3.1 (or a variant), for example, one or more markers selected from the group consisting of:
a) a guanine (G) in nueleotide 76 of SEQ ID NO: 2 (SNP_02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a cytosine (C) in nucleotide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; and / or (optionally)
e) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20 kb 10 kb 5 kb 2 kb. 1 kb or less of SNP _02 or SNP _03.
The introgression fragment can also be transferred to other diploid cultivated watermelon plants, for example, to combine CVYV resistance with other traits. Therefore, in another aspect, a method to generate a diploid cultured watermelon of the Citrullus lanatus ssp species. vulgaris is provided, wherein said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, wherein said introgression fragment comprises a locus that confers resistance to CVYV, which comprises the steps of:
Crossing a cultivated diploid watermelon plant comprising a locus that confers resistance to CVYV on chromosome 3 (as described above) with another plant 5 of cultivated diploid watermelon, especially a plant that lacks a locus that confers resistance to CVYV in chromosome 3, and select progeny of said cross (for example, F1, F2, F3 or additional self-breeding progeny or backcross progeny) comprising a cultured watermelon genome and an introgression fragment on chromosome 3 of the watermelon plant wild, so said introgression fragment 10 comprises ellocus that confers resistance to CVYV. The progeny may also be the result of one or more backcrossings optionally combined with one or more self-fertilizations, for example, BC1, BC1S1, BC1S2, BC2, BC2S1, BC3, etc. Again, the presence of the introgression fragment in the progeny can be determined using one or more of the described markers and / or resistance tests.
15 CVYV.
A selection method is also provided for selecting or identifying watermelon seeds, plants or parts of plants or DNA of such seeds, plants or parts of plants comprising in its genome a fragment of introgression on chromosome 3 comprising a locus that confers CVYV resistance, said method comprises:
20 Select watermelon seeds, plants or parts of plants (eg cells) or AON from such seeds, plants or parts of plants for the presence of one or more markers described in this document linked to cyv_3.1 (or a variant) , for example, one or more markers selected from the group consisting of:
a) a guanine (G) in nucleotide 76 of SEO ID NO: 2 (SNP_02) or a sequence 25 comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) an eylosin (C) in nueleolide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; I
30 e) a specific molecular marker of the wild watermelon genome within 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP 02 or SNP 03.
The seeds, plants or parts of watermelon plants can be haploid, doublehaploid, diploid, triploid or tetraploid. Obviously, the selection for the presenceof one or more markers may involve the selection (detection) of several copies of themarker, for example, four copies of Guanine (G) of SNP_02 in a tetraploid. From5 similarly, alternatively or in addition, the selection for the absence of the genotype ofSNP WT (susceptible) is covered here. So when it refers to a plantdiploid, part of the plant or DNA comprising a guanine (G) in nucleotide 76 ofSEO ID NO: 2 (SNP _02) or in a sequence comprising at least 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98% OR 99% sequence identity with SEO ID NO: 2, the
10 marker assay may alternatively or in addition detect the presence or absence of adenine (A) in nucleotide 76 of SEQ ID NO: 2 (SNP_02) or of a sequence comprising at least 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 9S% 099% sequence identity with SEO ID NO: 2.
Optionally, the method further comprises selecting one or more seeds, plants or
15 parts of plants comprising the introgression fragment in one copy (for example, for Haploides or diploids), in two copies (for example, for diploids or double haploids), in three copies (for example, for Triploides or in four copies (for example, for tetraploids).
The molecular markers described herein can be detected according to the
20 standard method. For example, SNP markers can be easily detected using a KASP assay (see www.kpbioscience.co.uk) or other SNP genotyping assays. To develop a KASP test, for example, 70 base pairs upstream and 70 base pairs downstream of the SNP can be selected and two direct allelespecific primers and one reverse primer can be designed
25 allele-specific allele. See for example, Allen et al. 201 1, Plant Biotechnology J. 9, 1086-1099, especially p097-109S for the KASP test method.
Therefore, in one aspect, SNP markers and the presence / absence of the marker associated with cyv_3.1 are determined using a KASP assay, but other SNP genotyping assays can also be used. For example, a genotyping test
30 TaqMan SNP, a high resolution fusion assay (HRM), SNP genotyping matrices (eg, Fluidigm, IlIumina, etc.) or DNA sequencing can also be used.
In a different aspect, a method for generating a tetraploid cultured watermelon of the Citrullus lanatus ssp species. vulgaris is provided, in which said plant comprises
An introgression fragment of a wild watermelon plant on chromosome 3, where said introgression fragment comprises a locus that confers resistance to CVYV, which comprises the steps of:
Fold the chromosomes of a cultured diploid watermelon or part thereof, said diploid is resistant to CVYV due to the presence of an introgression fragment on chromosome 3 that comprises a locus that confers homozygous CVYV resistance, as described in another part, and identify (or select) tetraploid plant or part of plant and optionally regenerate a complete plant from it.
The tetraploid plant is optionally self-pollinated one or more times to produce an inbred tetraploid line, comprising four copies of cyv_3.1 or a variant thereof.
See for example, http://cuke.hort.ncsu.edu/cucurbit/wmelon/seedless.html to bend the chromosome by colchicine treatment and tetraploid identification.
Again, the presence of the cyv_3 .1 or variant thereof can be determined by detecting one or more or all linked markers.
A method is provided to generate a tetraploid endogenous plant that has resistance to CVYV, which comprises the steps of:
a) providing a diploid inbred line comprising an introgression fragment of a wild watermelon plant on chromosome 3, said introgression fragment comprising a locus that confers CVYV resistance, in a homozygous manner, and
b) folding the chromosomes of said inbred line or planting part of the line to generate a tetraploid line or part of the tetraploid plant and regenerating a tetraploid plant of the line, and
c) self-fertilize the tetraploid line for several generations.
In step a), the diploid plant can be any diploid plant of the invention as described above, for example, it can be a plant derived from seeds deposited under NCIMB 42449 or NCIMB 42450 or NCIMB 42666, or progeny of any of them, or it can be a diploid plant in which cyv _3.1 has been transferred from the seed deposit NCIMB 42449 or NCIMB 42450 or NCIMB 42666 by crossing. The diploid can also be a new diploid plant generated by cyv _3.1 introgression or a variant thereof from a watermelon resistant to wild CVYV in watermelon
cultivated The introgression can be, for example, from PI189318 or other accesses of wild watermelon.
In another aspect, a method to generate triploid hybrid watermelon plants of the Citrullus lanatus ssp species. Vulgaris is provided, comprising:
5 Cross a tetraploid female parental line comprising four copies of cyv_3.1 (ora variant thereof) with a male diploid parental line comprising twocopies of cyv_3.1 (or a variant thereof) and collect the seeds produced in theparental line female. Optionally, harvested seeds can be dried.
Pollination of the female tetraploid line can be done by hand or by insects
10 (for example, bees) in isolation blocks. To ensure the pollination of female tetraploid flowers with pollen of the male diploid, different methods can be used, such as collecting male flowers by hand and pollinating female flowers, followed by covering the pollinated flower. Alternatively, all male (staminated) flowers that develop in tetraploid plants can be removed to ensure pollination of
15 pistillate flowers in tetraploid plants with diploid pollen. When the fruits in the tetraploid plants are ripe, the triploid F1 hybrid seeds (resulting from cross pollination) are collected and collected. These can then be classified (for example, by size), dried, optionally treated, and packaged for sale. Therefore, containers or containers that comprise or consist of seeds obtained
20 by the above method are an embodiment of the present invention.
In one embodiment, a method of producing seedless triploid fruits is provided, comprising:
a) Collate triploid hybrid watermelon plants comprising three copies of cyv_3.1
or a variant thereof and diploid pollinator plants,
25 b) allow pollination of female flowers to occur in hybrid triploid plants, and, optionally,
c) harvest the fruits of the triploid hybrid plants.
Thus, for the production of seedless fruits, the CVYV resistant triploid hybrid according to the invention can be intercalated with a suitable diploid pollinator, such as Jenny or Polimax, or Superpollinators (SP-1, SP-2, SP -3, SP-4, SP-5), Sidekick, Escort-4, Companion or others. Optionally, the pollinator may be a dual purpose pollinator as described in document W02012 / 069539 A 1. The
Diploid pollinator should produce enough pollen at the right time of day and for an appropriate period of time to induce fruiting fruits in triploid hybrids. Pollinator plants can be hybrid diploids (F1 diploids) or open pollination pollinators (OP). The fruits are harvested after the triploid plants of the invention.
Triploid plants can be grafted onto different rootstocks. The method is preferably carried out in the open field. Interplantation in a field can be done by sowing or transplants of the pollinator and triploids. Various interplantation methods can be used, as is known in the art and various pollinator ratios can be used: triploid hybrid. A row of pollinator plants may be present, for example, at least every 2, at least every 3 or at least every 4 rows of triploids, but other interplantation methods can also be used. Pollination is usually done by bees, and hives can be provided to fields unless there are enough wild bees present naturally. Pollination can also be done by manual or mechanical means. The harvest at maturity can be done by hand or mechanized.
Triploid fruits, which contain three copies of cyv_3. 1 (or a variant thereof), have no seeds. The fruits can be harvested for fresh consumption or for processing. Containers that comprise or consist of a plurality of such fruits
or parts of fruit are a further embodiment of the invention. Harvested fruits can, therefore, be classified, packaged in containers, etc. Containers that comprise or consist of triploid fruits preferably comprise or consist of marketable fruits, which comprise three copies of cyv_3.1 (or a variant) in their genome. Containers comprising parts of fruit and food or food products comprising parts of fruit are also encompassed herein.
Uses according to the invention
The use of cyv_3.1 (or a variant thereof) to generate cultivated watermelon plants resistant to CVYV, which produce marketable fruits, is an aspect of the invention. Similarly, the use of any of the markers related to cyv_3.1 (or a variant thereof) to identify and / or select plants or parts of plants or progeny comprising or retaining cyv_3.1 (or a variant of the same).
In one aspect, the use of a diploid or double haploid plant according to the invention is also provided as a male or female parent, whereby the plant is crossed with another watermelon plant or allowed to self-fertilize to produce progeny.
In one aspect, the use of a tetraploid plant according to the invention is provided as a male or female parent, whereby the plant intersects with another watermelon plant (for example, with a male diploid parent) or is authorized to self-fertilize to produce progeny. Especially included is the use of a tetraploid as a female parent in the production of hybrid triploid watermelon seed (i.e., F1 seed production).
In another aspect, the use of triploid plants according to the invention in the production of seedless triploid fruits is provided.
Seeds and parts of plants and progeny
It is understood that it is also an object of the invention to provide seeds from which diploid, triploid or tetraploid plants described herein can grow. Also included here are seedlings, stems and rootstocks, as well as cells and tissues of diploid, double haploid, triploid or tetraploid plants of the invention. Said parts of plants comprise cyv_3.1 (or a variant) according to the invention. A part of the plant's plant can, for example, be selected from a stem, fruit, pollen, ovule, stem, cotyledon, leaf, cell, embryo, meristem, anther, root, root tip, pistil, flower and / or seed.
Progeny of any of the plants according to the invention are also provided herein, such as seeds that can be obtained by crossing a plant comprising cyv_3.1 (or a variant) described herein with another watermelon plant and / or self-fertilizing a plant according to the invention for producing F1 seeds and additional generation progeny (F2, F3, etc.). The presence of cyv_3.1 (or a variant) in the progeny can be determined by CVYV resistance tests and / or marker analysis.
Watermelon plants obtained (derived) or obtainable (derivable) from plants according to the invention (for example, from plants comprising cyv_3.1 or a variant thereof) include plants obtained by reproduction methods, such as self-fertilization, crossover, backcrossing, recurrent selection, double haploid production, marker-assisted selection, clonal propagation, transformants, etc., in which the derived plants comprise at least one recombinant chromosome 3 comprising cyv_ 3.1 (or a variant) according to the invention.
In one aspect, a watermelon plant is provided, of which a representative number of seeds with the accession number NCIMB 42449 or NCIMB 42450 or NCIMB 42666 has been deposited, or progeny of any such plant, for example, obtained by crossing and / or self-fertilization. In one aspect, a watermelon seed is provided, from which a representative number of seeds with the accession number NCIMB 42449 or NCIMB 42450 or NCIMB 42666 has been deposited. Also pollen, an ovule, cells, tissues, vegetative propagation obtained from These plants, or progeny thereof, are provided. In one aspect, the progeny retains the cyv_3.1 of plants whose seeds were deposited under NCIMB 42449 or NCIMB 42450, NCIMB 42666. In one aspect, the progeny retains the introgression fragment on chromosome 3 (comprising cyv_3.1) of the plants of which it was deposited under NCIMB 42449 or NCIMB 42450 NCIMB 42666, or a smaller fragment of the introgression fragment, whereby the smaller fragment retains ellocus that confers resistance to CVYV (cyv_3.1).
Fine mapping sequencing and allelism tests
The cyv_3.1 locus was found in the region between approximately 2.50 Mb and approximately 12.8 Mb of chromosome 3, see Figure 1. Fine mapping can be carried out using methods known in the art to determine the exact position of the locus. For example, recombinant lines comprising smaller parts of the introgressed region can be generated and then CVYV assays can be used to determine which fragment confers resistance against CVYV (and thus retains it). Alternatively, the region can also be sequenced to identify candidate resistance genes. Using such similar methods or methods, markers more closely linked with the locus cyv_3.1 (or variant) can be identified, for example, a specific molecular marker of the wild watermelon genome linked to cyv_3.1 (or a variant can be identified ), at a physical distance of 5 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20kb, 10kb, 5kb, 2kb, 1kb or less of SNP_02 or SNP _03.
Similarly, any access of wild watermelon resistant to CVYV, for example, PI189318 or others, can be crossed with watermelon susceptible to cultivated CVYV to generate a new mapping population and determine whether CVYV resistance is conferred by cyv_3.1 or a variant thereof, that is, if a QTL resistance to CVYV is assigned to the same region of chromosome 3, the wild access clearly contains ellocus cyv_3.1
or a variant thereof.
If two watermelon plants have resistance to CVYV and it is not clear if the resistance is caused by the same QTL, different methods can be used to verify if the same locus is involved (i.e., cyv_3.1 or a variant). As mentioned, marker and / or sequencing and / or QTL mapping or fine mapping tests can be used to determine if an introgression fragment that confers resistance from a wild watermelon is present in the region of chromosome 3. Alternatively or in addition
Allelism test can be carried out, that is, the two plants can be crossed and the segregation of the phenotype (CVYV resistance) in progeny plants can be analyzed.
The following non-limiting examples describe plants comprising cyv_3.1 according to the invention. Unless otherwise indicated in the Examples, methods for conventional watermelon cultivation are used, such as, for example, described in Maynard 2001, Watermelons-Characteristics, Production and Marketing, ASHS Press; Mohr H.C. Watermelon Breeding in Mark J. Bassett (editor) 1986 Breeding Vegetable Crops, AVI Publishing Company.
Deposit Information
Nunhems BV has deposited seeds of a cultivated diploid watermelon line, which comprises cyv_3 .1 in a homozygous manner and produces fruits with Sweet Crimson type crust with accession number NCIMB 42449 and seeds of a cultivated diploid watermelon line, which comprises cyv_3.1 in a homozygous way and producing fruits with a Jubilee bark under the accession number NCIMB 42450. The seeds were deposited by Nunhems BV on August 18, 2015 in NCIMB Ud., Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom. Access to the deposits will be available during the processing of this application to the persons determined by the Commissioner of Patents and Trademarks, who will be entitled to do so upon request.
Nunhems BV. It has deposited seeds from an elite line of diploid cultivated watermelon, which comprises homozygous cyv_3.1 and produces red pulp fruits with the accession number NCIMB 42666. The seeds were deposited by Nunhems BV. on September 26, 2016 at NCIMB you, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, United Kingdom.
All seed deposits were made under the Budapest Treaty and using the expert solution.
Subject to 37 C.F.R. § 1,808 (b), all restrictions imposed by the depositor on the availability to the public of one or more deposits will be irrevocably removed by granting the patent by allowing access to the deposits. Deposits will be maintained for a period of 30 years, or 5 years after the last application, or for the life of the patent, whichever is longer, and will be replaced if it ever becomes unfeasible during that period. The applicant does not waive any rights granted under this patent in this application or under the Plant Variety Protection Act (7 USC 2321 seq.).
Examples
Example 1: Resistance to CVYV - QTL mapping
Two F2 mapping populations were generated from crosses between the access of wild watermelon and an inbred proprietary CVYV line. The populations were 5 genotyped with> 3000 SNPs.
The phenotyping of the F3 lines was performed using a CVYV test in air-conditioned cells in Italy. The first expanded true leaf (15 to 20 days after sowing) was inoculated by hand, with a second inoculation 4-5 days after the first. Control plants were inoculated with buffer only.
10 A total of 14 plants were inoculated per genotype with inoculum containing CVYV (Almeria type strain), in two repetitions and including Sugar Baby as a susceptible control. A randomized block design was used. CVYV remained in frozen infected leaf tissue. To prepare inoculum, the pre-multiplication of the virus was carried out in the variety of susceptible cucumber Sheila. Then fresh, young, symptomatic leaves of the
15 Sheila variety to prepare the inoculum (1 gram of fresh leaf per 5 ml of 0.03 M phosphate lamp, with activated carbon and diatomaceous earth were crushed with a mortar on an ice bed).
The inoculated plants were incubated with 12-14 hours of light, day temperature 25 degrees Celsius and night temperatures of 18 degrees Celsius. The sheets were scored for the 20 symptoms of CVYV at regular intervals (for example, 20 days after inoculation (dpi), 35 dpi, 50 dpi, 65 dpi). The susceptible control, Sugar Baby, must be severely symptomatic after 30 dpi. The individual plants were scored in three classes: a) susceptible - presence of symptoms on the leaves, b) resistant - no symptoms on the leaves, c) doubtful. At least 90% of the plants in a line must be classified as
25 "resistant" so that the line is considered resistant.
The QTL mapping revealed a higher QTL for CVYV resistance on chromosome 3 in both mapping populations, which was called cyv_3.1.
To better locate the QTL, more SNP markers were identified in the confidence interval. Three markers closely related to QTL were identified, see Table 1 (supra), called SNP _01, SNP _02 and SNP _03.
Table 3: Example 2: CVC 3.1 backcrossing on elite lines
SNP ChromosomeBase position on chromosome 3
SNP _01 Chr_037,586,752
SNP_02 Chr_037,664,093
SNP_03 Chr_037,693,225
Using marker-assisted backcrossing, cyv_3.1 was backcrossed (4 to 6 backcrosses) on several elite lines and seeds of two elite lines 5 with accession numbers NCIMB 42449 and NC IMB 42450 were deposited.
The NCIMB 42449 and NCIMB 42450 plants, and their self-fertilization progeny, were evaluated (phenotyped) for resistance against CVYV in two consecutive years in heated cells in Murcia, in the same way as described in Example 1.
10 The results are shown in Table 4 below:
2014 phenotyping:
Vegetable line RepetitionNo. of plantsFirst evaluation (% of resistant plants)Second evaluation (% of resistant plants)
NCIMB42449 one10100100
NCIMB42449 210100100
NCIMB42449 310100100
NCIMB42450 one108080
NCIMB42450 210100100
Susceptible line one10OROR
Susceptible line 21030twenty
Susceptible line one1040OR
Susceptible line 210fiftytwenty
Susceptible line 3104010
Sugar Baby (control) Multiplefifty22OR
2015 phenotype:
Progeny of NCIMB42449 one14100100
Progeny of NCIMB42449 213100100
Progeny of NCIMB42449 314100100
Progeny of NCIMB42449 4fifteen100100
Progeny of NCIMB42450 onefifteen100100
Progeny of NCIMB42450 2fifteen100100
Progeny of NCIMB42450 314100100
Progeny of NCIMB42450 414100100
Progeny of NCIMB42450 514100100
Sugar Baby (control) Multiple3527OR
Example 3: Marker Validation
The validation of these markers on a collection of different watermelon materials resulted in the discovery of two haplotypes for CVYV resistance, so SNP_01 could distinguish the haplotypes. All commercial hybrids evaluated had the same genotype as Sugar Baby and all were susceptible to CVYV.
Table 5:
SNP _01 SNP _02SNP_03CVYV Resistance
Inbred line -NCIMB 42666 GGGGDCResistant
Inbred line -NCIMB 42449 AAGGDCResistant
Inbred line NCIMB42450 AAGGDCResistant
SUGAR BABY GGAATTSusceptible
Example 4: ZYMV resistance is an independent locus on chromosome 3
10 From the literature, it was known that resistance to ZYMV is also located on chromosome 3, the inventors wanted to know if CVYV resistant plants were also resistant
to ZYMV. NCIMB 42449 and NCIMB 42450 were inoculated with the European or American strain of ZYMV. They also re-analyzed the SNP marker data so that the published SNP is linked to the zym gene, referred to herein as SNP _04.
Table 6:
SNP_01 SNP_02SNP_03SNP_04Evyv ResistanceZYMV Resistance
Inbred line not deposited GGGGDCGGResistantResistant
Inbred line -NCIMB 42449 AAGGECYOUResistantSusceptible
Inbred line -NCIMB42450 AAGGDCYOUResistantSusceptible
SUGAR BABY GGAAYOUYOUResistantSusceptible
The results showed that cyv_3.1 and zym are independent loci on chromosome 3 and that SNP _04 can be used to differentiate between resistant and ZYMV susceptible plants.
Example 5: Tetraploid lines
NCIMB 42449 and NCIMB 42450 were used to generate CVYV resistant tetraploid lines using colchicine treatment. For NCIMB 42449 five putative tetraploid lines were made, while for NCIMB 42450 ten putative tetraploid lines were made.
Example 6: Selection of wild watermelon accessions
15 Progeny of wild access, diploid, of watermelon that originate, for example. in the US GRIN collection. UU. were analyzed to determine CVYV resistance and its SNP genotype for SNP_01, S NP_02 and SNP_03.
It was found that a line, derived from P1 189318, has the following SN P genotype and the following resistance phenotype:
20 Table 7:
I Resistance to CVYV

I PI189318 I Resistant
This wild watermelon can, therefore, be used to introgress cyv_3.1 into cultured watermelon, for example, by backcrossing.
Optionally, an allelism test can be carried out, crossing PI189318 with plants grown from seeds deposited here to confirm that PI189318 contains the cyv_3.1 gene.

权利要求:
Claims (16)
[1]
1. A diploid plant of cultivated watermelon of the species CitruJ / us lanatus ssp. vulgaris, characterized in that said plant comprises an introgression fragment of a wild watermelon plant on chromosome 3, where said introgression fragment comprises a locus that confers resistance to CVYV and where the introgression fragment comprises a marker selected from the group consisting of in:
a) a guanine (G) in nucleolide 76 of SEO ID NO: 2 (SNP _02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 2; Y
b) a cilosina (e) in nucleolide 76 of SEO ID NO: 3 (SNP _03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; Y
c) a specific molecular marker of the wild watermelon genome within 5 Mb. 3 Mb. 2 Mb. 1 Mb. 0.5 Mb. 0.1 Mb. 74 kb. 50 kb 20 kb 10 kb 5 kb 2 kb 1 kb or less of SNP _02 or SNP _03.
[2]
2. The plant according to claim 1, characterized in that the introgression fragment is a fragment comprising the region that begins at 2.50 Mb and ends at 12.80 Mb of chromosome 3, or a part thereof where the part It has a size of at least 5 kb.
[3]
3. The plant according to claim 1 or 2, characterized in that the plant produces fruits comprising a brix grade of at least 7.0.
[4]
Four. The plant according to any one of the preceding claims, characterized in that said plant is homozygous for the introgression fragment and the plant is resistant to CVYV and optionally resistant to ZYMV.
[5]
5. A tetraploid watermelon plant made by folding the plant chromosomes of any one of the preceding claims.
[6]
6. The tetraploid watermelon plant according to claim 5, characterized in that the plant is an inbred line.
[7]
7. A triploid watermelon seed made by pollinating the tetraploid plant of claim 5 or 6 with pollen of the diploid watermelon plant of claim 4.
[8]
8. A triploid plant grown from the seed of claim 7.
[9]
9. Seed from which a plant of any one of claims 1 to 6 can be grown.
[10]
10. A vegetative propagation of a plant according to any one of claims 1 to 6 or 8.
5 11. A cell or tissue culture of a plant according to any one of theclaims 1 to 6 or 8, characterized in that the cells or tissues comprise theIntrusion fragment.
[12]
12. The cell or tissue culture according to claim 11, comprising cells or protoplasts or plant tissue of a part of the plant selected from the group that
10 consists of: stem, fruit, embryo, meristem, cotyledon, pollen, ovule, leaf, anther, root, root tip, pistil, flower, seed, stem.
[13]
13. A plant part of the plant according to any of claims 1 to 10, characterized in that said part is selected from a stem, fruit, pollen, ovule, stem, cotyledon, leaf, cell, embryo, meristem, anther, root root tip pistil
15 flower, seed and where the cells of said part of the plant comprise the introgression fragment.
[14]
14. A watermelon plant regenerated from the cell or tissue culture of claim 11.
[15]
fifteen. A method to select watermelon seeds, plants or parts of plants or AON
20 of such seeds, plants or parts of plants for the presence of one or more markers related to CVYV resistance on chromosome 3, wherein said method comprises determining the presence of:
a) a guanine (G) in nucleotide 76 of SEQ ID NO: 2 (SNP_02) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 25 97%, 98% or 99% sequence identity with SEO ID NO: 2; I
b) a cytosine (e) in nucleotide 76 of SEQ ID NO: 3 (SNP_03) or a sequence comprising at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with SEO ID NO: 3; I
e) a specific molecular marker of the wild watermelon genome within 5 30 Mb, 3 Mb, 2 Mb, 1 Mb, 0.5 Mb, 0.1 Mb, 74 kb, 50 kb, 20 kb, 10 kb, 5 kb, 2 kb, 1 kb or less of SNP_02 or SNP_03.


[16]
16. A method to produce triploid hybrid watermelon seeds inthe one that plants
grown from such seeds are resistant to CVYV, in which said method
understands:
to) provideaplantfromwatermelondiploidaccordinganyonefromthe
5 claims 1 to 4 and a tetraploid plant according to claim 5 or 6,
b) allow the pollination of the flowers of the tetraploid plant with pollen from the
diploid plant, and
C) harvest seeds produced in the fruits of the tetraploid plant.
[17]
17. A method for the production of seedless triploid watermelon fruit, in which said
10 method comprises:
(to) interleave seedstriploid hybrids or hybrid plantstriploids accordingthe
claim 7 or 8 with diploid pollinator plants, and optionally
(b) harvest watermelon fruits without seeds produced in triploid plants
of (a).
fifteen

类似技术:

---

公开号 | 公开日 | 专利标题

---

ES2864573T3|2021-10-14|Capsicum plants resistant to PMMOV

---

US11019777B2|2021-06-01|Multiple-virus-resistant melon

---

ES2786507T3|2020-10-13|Melon plants with resistance to melon yellowing virus |

---

EA034396B1|2020-02-04|Hybrid seed potato breeding

---

US11172629B2|2021-11-16|CGMMV resistant citrullus plants

---

CA2867220A1|2013-09-19|Tomato plants with intense phenotype and tylcv resistance

---

ES2667441B1|2019-02-27|Watermelon plants with resistance to yellow cucumber vein virus |

---

EP2814316B1|2021-04-07|Triploid watermelon plants with a bush growth habit

---

US10582683B2|2020-03-10|Triploid watermelon plants with a bush growth habit

---

US20130254914A1|2013-09-26|Spinach hybrid variety callisto

---

US10694696B2|2020-06-30|Citrullus lanatus producing fruits with high texture fruit flesh

---

US11072800B2|2021-07-27|Parthenocarpic watermelon plants

---

AU2016289682A1|2017-12-21|White celery

---

US20210137044A1|2021-05-13|Cucumber Variety NUN 09103 CUL Comprising Fruits with a Small Seed Cavity and/or Increased Dry Matter Content

---

US20220046876A1|2022-02-17|Cgmmv resistant citrullus plants

---

US20210000048A1|2021-01-07|Introgression of two yield qtls in cucumis sativus plants

---

ES2877278T3|2021-11-16|Triploid watermelon plants with bush growth habit

---

WO2021249826A1|2021-12-16|Capsicum annuum plants having improved thrips resistance

---

WO2021213892A1|2021-10-28|Solanum lycopersicum plants having improved tobamovirus resistance

同族专利:

---

公开号 | 公开日

---

EP3358943A1|2018-08-15|

---

MX2018004283A|2018-05-16|

---

MA42216A1|2019-04-30|

---

IL258282D0|2018-05-31|

---

ES2667441B1|2019-02-27|

---

US20180310514A1|2018-11-01|

---

CN108770332A|2018-11-06|

---

US10687494B2|2020-06-23|

---

WO2017060350A1|2017-04-13|

---

MA42216B1|2020-05-29|

---

MA44269A|2019-01-09|

---

ZA201802936B|2020-07-29|

---

TR201804601T1|2018-07-23|

---

ES2667441R1|2018-05-18|

---

AU2016335065A1|2018-04-19|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

ES2205998B1|2001-12-14|2005-08-16|Consejo Sup. Investig. Cientificas.|Detection of cucumber vein yellow virus comprises preparation of a nucleic acids probe from a CVYV genome fragment|

---

WO2010025747A1|2008-09-02|2010-03-11|Enza Zaden Beheer B.V.|Cvyv-resistant plants of the species cucumis melo|

---

CN102770018A|2009-07-07|2012-11-07|安莎种子公司|Cucumber vein yellowing virus resistant cucumber plants |

---

EP2298382A1|2009-09-18|2011-03-23|SMC-Swiss Medical Care S.A.|Device for injecting contrast products|

---

JP6140079B2|2010-11-24|2017-05-31|ヌンヘムス・ベー・ヴェーＮｕｎｈｅｍｓ Ｂ．Ｖ．|Dual purpose pollinated watermelon|

---

EP2514304A1|2011-04-20|2012-10-24|Syngenta Participations AG|Cucurbita plant resistant to potyvirus|CN112080497B|2020-10-21|2021-04-27|北京市农林科学院|SNPsite primer combination for identifying watermelon germplasm authenticity and application|

---

CN113005120A|2021-03-19|2021-06-22|中国农业大学|Method for effectively extracting dormant grape grafted DNA and application|

法律状态:
2019-02-27| FG2A| Definitive protection|Ref document number: 2667441 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190227 |

优先权:

---

申请号 | 申请日 | 专利标题

---

EP15188630|2015-10-06|

---

EP15188630|2015-10-06|

---

PCT/EP2016/073875|WO2017060350A1|2015-10-06|2016-10-06|Watermelon plants with cucumber vein yellowing virusresistance|

---