Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs for this (Mac

专利摘要:
Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs for this purpose. The invention provides the use of inhibitors of repressor microRNAs of MBNL1 and/or MBNL2 genes for the manufacture of a medicament for the treatment of myotonic dystrophy 1. Inhibiting said microRNAs allows increasing the endogenous levels of the corresponding MBNL1 and/or MBNL2 proteins , thereby alleviating symptoms of the disease, especially when inhibitors are repressed that are expressed in the main affected organs: skeletal muscle, heart or organs of the central nervous system. Inhibition of the microRNAs miR-23b-3p and miR-218-5p is preferred. Antagonists of an oligoribonucleotide nature or oligoribonucleotide analogues suitable for this purpose are also provided, preferably by antagomiRs directed against the cited microRNAs with chemical modifications that enhance their interaction with the target, their stability in vivo and their ability to penetrate the cells and be distributed by tissues and organs. (Machine-translation by Google Translate, not legally binding)
公开号:ES2659845A1
申请号:ES201631216
申请日:2016-09-19
公开日:2018-03-19
发明作者:Rubén D. ARTERO ALLEPUZ；María Beatriz LLAMUSÍ TROISI；Estefanía CERRO HERREROS；Juan M. FERNÁNDEZ COSTA
申请人:Universitat de Valencia；
IPC主号:

专利说明:

5
10
fifteen
twenty
25
30
DESCRIPTION
Modulation of microRNAs against type 1 myotonic dystrophy and microRNA antagonists for this
Technical field
The invention relates to the use of small molecules comprising ribonucleotide units or analogs thereof for therapeutic application against diseases. More specifically, the invention relates to the use of microRNA antagonists, such as antagomi®, for the treatment of myotonic dystrophy type 1.
Background of the invention
Myotonic dystrophy type 1 (DM1) is an incurable neuromuscular disorder that constitutes a serious clinical concern because being the most common muscular dystrophy of adult onset joins that it is highly disabling. Clinically, DM1 is considered a multisystemic disorder that primarily affects skeletal and smooth muscle, nervous system and heart and is characterized by a reduction in muscle mass (muscular dystrophy), which can lead to respiratory failure and death, cataracts subsequent iridescent subcapsular, cardiac impulse conduction defects, endocrine changes, myotonia (difficulty in relaxing the muscle after a voluntary contraction), Central Nervous System dysfunctions that include attention deficit, characteristic personality patterns, sleep disturbances and syndrome Executive This clinical picture is completed with a highly variable age of onset, ranging from congenital forms (from birth) to infant DM1, beginning in the adult stage of life and in the third age. The most common form of the disease, that of onset in adolescence or second decade of life, reduces the life expectancy of patients to 48-55 years (Harper, 2001; Gagnon et al., 2007). DM1 is classified as a rare disease since its prevalence in the population is estimated to be less than 1 per 2000 people.
At the genetic level, DM1 is known to be an autosomal dominant inherited disease and is caused by the presence of hundreds of repetitions of the CTG * CAG motif in the 3 'untranslated region (3' UTR) of the protein kinase gene of myotonic dystrophy (DMPK: dystrophia myotonica-protein kinase) (for a recent review, see for example Thornton, 2014). The human DMPK gene (HGNC: 2933, Entrez Gene: 1760, Ensembl: ENSG00000104936, OMIM: 605377, UniProtKB: Q09013) normally houses 5-37 copies of the trinucleotide motif, but a dynamic mutation can
5
10
fifteen
twenty
25
30
increase this number to more than 5000 copies of the repetition. The severity of the disease is approximately correlated with the number of repetitions, that is, the size of the expansion.
There is also the so-called less frequent type 2 myotonic dystrophy (DM2), which is due to mutations in a different gene, the CNBP gene, present in human chromosome 23. In the DM2 also appears muscular dysfunction, but it mainly involves the muscles of the root of the extremities (shoulders, buttocks, thighs ...), while in DM1 the muscles of the distal limbs are mainly involved . In contrast to DM1, DM2 does not seem to affect life expectancy and usually manifests itself with more moderate symptoms.
Expression of expanded alleles in DM1 results in nuclear retention of mutant DMPK mRNA and reduction of DMPK protein levels (Davis et al., 1997). Mutant transcripts kidnap the splicing factors (a process referred to hereinafter by the English term splicing) that are similar to Drosophila Muscleblind (MBNL, short for Muscleblind-like), which gives rise to abnormal alternative splicing of many other transcripts and the expression of fetal forms of the corresponding proteins in adults suffering from DM1 (Lin et al., 2006; Du et al., 2010). In fact, both Drosophila Muscleblind protein (UniProtKB O16011, CG33197) and its MBNL1-3 vertebrate counterparts are known as splicing regulators. The transcripts of the MBNL1 and MBNL2 genes, meanwhile, are themselves subjected to alternative splicing, generating numerous protein isoforms (Pascual et al, 2006). MBNL1 is strongly expressed in skeletal and cardiac muscle tissue and during myoblast differentiation. Its expression is lower in other tissues such as brain, placenta, lungs, liver, kidney and pancreas. MBNL2 has a largely overlapping expression and is detected in the heart, brain, placenta, lungs, liver, skeletal muscle, kidneys and pancreas. MBNL3, meanwhile, is expressed in placenta and satellite cells. For more detailed information on all this, see the review Fernandez-Costa et al. (Fernandez-Costa et al., 2011).
Therefore, it is believed that splenic disease is the main factor underlying the pathogenesis of DM1. However, different alternative mechanisms such as additional changes in gene expression, antisense transcripts, translation efficiency, deregulation of alternative polyadenylation and deregulation of miRNAs can contribute to the pathogenesis of DM1 (Batra et al., 2014 ; Yadava et al.,
5
10
fifteen
twenty
25
30
2016; Kalsotra et al., 2014).
Several therapeutic approaches have been tested in animal models of DM1. Among them, the most interesting results derive from the blockade of the interaction between MBNLs and toxic RNA using small molecules, peptides, morpholines or antisense oligonucleotides, and spacers ("gapmers") to degrade mutant DMPK transcripts (reviewed by Klein et al. , 2015).
A less explored alternative in DM1 is the therapeutic modulation of the expression of the MBNL1 and MBNL2 genes (HGNC: 6923, Entrez Gene: 4154,
Ensembl: ENSG00000152601, OMIM: 606516, UniProtKB: Q9NR56, to which
previously identified in HGNC with the symbol MBNL). Although the expression of CUG expansions triggers different molecular alterations, current evidence points to the sequestration of MBNL proteins as the main cause of disease symptoms. The mouse model with the inactivated Mbnll gene (knockout mouse, abbreviated KO, for Mbnl1) shows myotonia, incorrect splicing of muscle transcripts and cataracts, which are all characteristic symptoms of DM1 disease (Kanadia et al., 2003). More recently, the most relevant characteristics of cardiac dysfunction (hypertrophy, interstitial fibrosis and splicing disorders) have been described in two-month-old mutant mice in Mbnl1, suggesting a role of reducing Mbnl1 in cardiac problems of DM1 (Dixon et al., 2015). In addition, genetic polymorphisms in the human MBNL1 gene promoter have been associated with the severity of the disease (Huin et al., 2013).
However, KO mice for Mbnl1 do not show the entire set of symptoms of DM1. Therefore, it has been hypothesized that Mbnl2 could compensate for the loss of Mbnl1 function in these mice. In fact, KO mice for Mbnl1 with reduced expression of Mbnl2 (Mbnl1 - / -; Mbnl2 +/-), are viable, but develop most of the cardinal defects of the disease, including reduced life expectancy, blockage cardiac, severe myotonia, atrophic fibers and progressive weakness of skeletal muscles. In support of the compensation hypothesis it can be mentioned that the levels of Mbnl2 are increased in KO mice for Mbnl1 - / - and Mbnl2 can regulate exons that are normally regulated by Mbnl1 (Lee et al., 2013).
Several observations suggest that overexpression of MBNL1 may have potential for the treatment of DM1 pathology. First, MBNL1 overexpression is well tolerated in the skeletal muscle of transgenic mice, causing only relatively minor changes in splicing, but without affecting longevity.
5
10
fifteen
twenty
25
30
(Chamberlain et al., 2012). Secondly, the administration of the recombinant Mbnll protein to an HSALR mouse DM1 model, rescue myotonia and the splicing alterations characteristic of DM1 (Kanadia et al., 2006).
Given the severity of the symptoms of DM1, which can lead to premature death of the patient, and the absence of effective treatments for it, it is of interest to explore alternative therapeutic strategies.
Thus, it would be interesting to verify whether overexpression of MBNL1, alone or in combination with modulation of MBNL2, could also have therapeutic application in humans afflicted with DM1. However, since the design and authorization of the application of safe expression vectors for administration to humans is complex, it would be interesting to find a way to increase the levels of the MBNL1 or MBNL2 protein in humans, in them. tissues where they are normally transcribed, by some alternative method to the expression of said protein from an artificial vector. It would also be preferable if said level increase occurs, at least, in one or more of the relevant tissues and organs where specifically significant symptoms of the disease appear: skeletal and smooth muscle, heart and nervous system.
The present invention provides a solution to that problem.
Summary of the invention
The present invention is based on compensating the insufficient amounts of MBNL (Muscleblind-like) proteins that are available to interact with their natural targets in patients with myotonic dystrophy 1 (DM1), because said protein, among other mechanisms that can affect at its expression, subcellular distribution and activity in vivo, it is sequestered in ribonuclear foci of which the mutant transcripts of the DMPK gene are part. By compensating the amounts of MBNL proteins, an attempt is made to improve the symptoms of said disease. And for this, the present inventors propose to achieve an upward regulation of the levels of said proteins, caused by an increase in their expression, by blocking the action of microRNAs (miRNAs) that intervene negatively in the regulation of their translation and stability, preferably by oligoribonucleotides, analogs thereof or, in general, molecules of oligoribonucleotide nature, capable of specifically blocking the action of certain repressor miRNAs of the MBNL1 and / or MBNL2 genes.
5
10
fifteen
twenty
25
30
35
Thus, in a first aspect the present invention relates to a molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog that is an antagonist of a microRNA that downregulates the expression of the human gene MBNL1 and / or MBNL2, or a mixture of two or more of said molecules. Said molecule will be considered a molecule of oligoribonucleotide nature or oligoribonucleotide analog of the invention. Preferably, the molecule is an antagonist of a microRNA that is expressed in at least one or more organs selected from the group of brain, cerebellum, hippocampus, skeletal muscle and heart, or in one or more cells of a primary culture of one of said organs. or from an established cell line derived from one of said organs (including induced pluripotent stem cells, known by its acronym in English iPSCs: induced plunpotent stem cells) or stem cells from one of said organs. It is preferred that the molecule be complementary and comprise a sequence fragment of ribonucleotide units, or ribonucleotide analogs, in which the sequence of
the nitrogen bases of the ribonucleotide units or analogs of
Ribonucleotides is complementary at least 50% (or at least 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98%, 99% or 99.5%, or 100%) to the sequence of the nitrogenous bases of the endogenous molecule (the microRNA or messenger RNA) to which it must bind. Preferably, the molecule is an antagonist of human microRNA-218-5p or human microRNA-23b-3p. Compared with any of the above preferences, it is preferred that the antagonist be an antagomi®, a blockmiR, an antimiR or a microRNA sponge, with special preference for the molecule to be an antagomiR and, within them, a
antagomiR in which the sequence of the nitrogen bases of the units of
Ribonucleotides or ribonucleotide analogs is complementary is at least 80% identical to the sequence of the nitrogenous bases of the microRNA to which it must bind. Especially in the case that the molecule is an antagomi®, an antimiR or a microRNA sponge, it is preferred that the molecule be complementary to the sequence of the microRNA-218-5p or that of the human microRNA-23b-3p or that comprises a fragment of sequence of ribonucleotide units, or of ribonucleotide analogues, in which the sequence of the nitrogenous bases of the ribonucleotide units or of ribonucleotide analogs is identical at least 80% (or at least 85%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%) to the sequence of the nitrogenous bases of the olympibonucleotide of SEQ ID NO: 1 or SEQ ID NO: 2. Especially when the molecule in an antagomi®, it is preferred that said molecule be complementary to the sequence of the human microRNA-218-5p or that of the human microRNA-23b-3p or that comprises a fragment of sequence of ribonucleotide units, or
5
10
fifteen
twenty
25
30
35
of ribonucleotide analogs, in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs is complementary to at least 50% (or at least 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%) to that of microRNA-218- 5p human or that of the human microRNA-23b-3p, with special preference because it is complementary to at least 80%. Most preferably, the molecule is an antagomi R-type oligoribonucleotide analog in which at least one of the units is a ribonucleotide analog that has one or more chemical modifications in the rest of the ribose, in the phosphate bond or in both, the The sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs is identical to the sequence of nitrogenous bases of the ribonucleotide units of the oligoribonucleotide of SEQ ID NO: 1 or of the oligoribonucleotide of SEQ ID NO: 2 and which optionally presents at the 5 'end and / or at the 3' end one or more additional moieties that are not adenoribonucleotide or ribonucleotide moieties. Most preferably, the molecule is antagomiR-218 (SEQ ID NO: 10) or antagomiR-23b (SEQ ID NO: 11). In another possible embodiment, especially interesting in the case of antimiRs, the molecule of oligoribonucleotide nature and / or the oligoribonucleotide analog comprises a fragment that is 100% complementary to the seed region of the microRNA of which it is an antagonist. Another possible embodiment, especially interesting in the case of blockmiRs, is a molecule of oligoribonucleotide nature and / or the oligoribonucleotide analog comprising a fragment consisting of a succession of ribonucleotide units or ribonucleotide analogs in which the sequence of the bases Nitrogenated from the ribonucleotide units or ribonucleotide analogues is at least 80% complementary to the sequence of the nitrogenous bases of the region recognized by the microRNA of which it is an antagonist in a target mRNA (i.e., downregulated by that microRNA).
In a second aspect, the present invention relates to a composition comprising at least one of the oligoribonucleotide nature molecules or an oligoribonucleotide analog of the present invention, a mixture thereof, or an expression vector comprising the coding sequence. of at least one of said molecules of oligoribonucleotide nature. In a possible embodiment, the composition further comprises a vehicle and / or one or more pharmaceutically acceptable excipients. In another possible preferred embodiment, compatible with the preceding one, the composition comprises the antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 10 (antagomiR-218-5p) or the antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 11 (antagomiR -23b-3p) or a mixture of
5
10
fifteen
twenty
25
30
35
same. It is also a possible embodiment, compatible with all of the above and especially preferred when the antagomi R-23b-3p and / or the antagomi R-218-5p are present in the composition, that the oligoribonucleotide or oligoribonucleotide analog molecule is in a concentration 50 nM to 200 nM, both included.
In a further aspect, the invention relates to the use of one of the molecules of oligoribonucleotide nature or an oligoribonucleotide analog of the invention, a mixture of two or more of them, or a composition comprising at least one of said molecules, for The manufacture of a medicament for the treatment of myotonic dystrophy type 1. Therefore, it is within the scope of the invention and can be considered an aspect thereof, one of the oligoribonucleotide-like molecules or an oligoribonucleotide analog of the invention. , a mixture of two or more of them, or a composition for use in the treatment of myotonic dystrophy type 1. Preferably, in this aspect of the invention referred to the use for the manufacture of a medicament and, therefore, related to the use in the treatment of myotonic dystrophy type 1, is a possible embodiment that in which the molecule is or the composition comprises an ant human microRNA-218-5p agonist, an inhibitor of human microRNA-23b-5p, a mixture thereof or a composition comprising them. In one possible embodiment, the treatment is a palliative treatment of one or more symptoms of type 1 myotonic dystrophy. Within the above, a possible preference is that the treatment is a palliative treatment of one or more of the muscle disorders that are part of the symptoms of myotonic dystrophy type 1.
Brief description of the figures
Fig. 1. Specific tissue silencing of dme-miR-277 and dme-miR-304 causes overexpression of RNA and muscleblind proteins in Drosophila muscle. (A): Muscleblind expression levels related to endogenous control obtained by qRT-PCR amplification from flies expressing miRNAs sponge constructs for dme-miR-92a, dme-miR-100, dme-miR- 124, dme-miR-277 and dme-miR-304 in muscle: muscleblind expression levels were strongly regulated in flies expressing miR-277SP and miR-304SP microRNA sponges with respect to flies expressing a UAS-scrambledSP (B) construct: Analysis of the levels of muscleblind isoforms by qRT-PCR, where it is seen that the silencing of dme-miR-277 in the muscle caused an upward regulation of the mblB isoform, while the expression levels of the mblC and mblD isoforms were reduced in flies expressing miR-277SP; on the contrary, the levels of mblC and mblD were increased and those of the mblB isoform were reduced in the flies that
5
10
fifteen
twenty
25
30
35
They expressed miR-304SP. (C) Detection of the Muscleblind protein by Western blot, where overexpression of the Muscleblind protein was detected in flies expressing miR-304SP. All indicated transgenes were directed to the muscle using Mhc-Gal4. * p <0.05, ** p <0.01, *** p <0.001 (Student's t test).
Fig. 2. Silence of dme-miR-277 and dme-miR-304 enhances muscleblind expression and rescues incorrect splicing events in a DM1 context. (A) Bar graph showing muscleblind expression levels according to the data obtained by qRT-PCR in flies i (CTG) 480 expressing the sponge constructs indicated below the graph: it is shown that muscleblind mRNA was regulated upward significantly in model flies expressing miR-277SP and miR-304SP compared to flies that do not express expansions (control, Mhc-Gal4 / +) or model flies expressing scrambled-SP (scramble-SP in the figure). (B) Western blot analysis in samples of the same flies, which showed overexpression of Muscleblind C only in model flies expressing miR-304SP. (CF) Confocal images of longitudinal sections of the MFIs (indirect flying muscles) of flies expressing or not miRNA sponges as shown in the lower right corner, showing the location of the anti-Muscleblind signal (green in the original, light gray in grayscale), with counterstaining of the nuclei with DAPI (blue signal in the original, gray more off in grayscale): Muscleblind signal can be seen in the sarcomeric bands of the control flies (c); on the contrary, Muscleblind was found in the nuclear aggregates of MFIs in which CTG expansions (d) were expressed; miR-277SP expression in model flies released Muscleblind from aggregates and restored their distribution in the sarcomere bands (e); miR-304SP expression resulted in a dispersed overexpression of Muscleblind both in the nuclei and in the cytoplasm. (G) Results obtained after RT-PCR to evaluate the inclusion of exon 16 '(+ e16') of Fhos or its exclusion (-e16 ') in flies with different genotypes and expression of microRNA sponges, as indicated on the photographs ; The results corresponding to the Rp49 transcripts detected as endogenous control are also shown. (H) Quantification of the percentage of inclusion of Fhos exon 16 'from the results shown in panel G, which confirmed an improvement in the wrong splicing of Fhos in model flies expressing miR-304SP. (I, L) Bar graphs showing the results, obtained by qRT-PCR, of expression of Seron exon 13 (Serca e13) and exon 2 of the CyP6W1 (CyP6W1 e2) gene in relation to Rp49, which confirmed a rescue significant of Serca splicing in model flies expressing miR-304SP and the relative expression of CyP6W1 in these flies. (J) Results obtained after RT-PCR to evaluate the
5
10
fifteen
twenty
25
30
35
inclusion of exons 3-5 of the TnT gene (+ e3-5), which did not differ in the genotypes studied. (K) Quantification of the percentage of inclusion of exons 3 to 5 of Tnt from the results shown in panel J. Transgenes of all indicated genotypes were directed to the muscle using Mhc-Gal4. Scale bar = 2 micrometers. * p <0.05, ** p <0.01, *** p <0.001 (Student's t test).
Fig. 3. Silence of dme-miR-277 and dme-miR-304 rescues muscle atrophy and the presence of ribonuclear foci in model flies. (ac, eg): Dorsoventral sections of thorax embedded in resin, of flies with the genotypes indicated under the photographs: it is appreciated how, in comparison with control flies (a), the expression of miR-277SP resulted in a significant reduction of the muscle area (b), while the expression of miR-304SP had no effect on this phenotype (c); in DM1 model flies, the muscle area was reduced to 40% of normal (e); however, in model flies expressing any one of miR-277SP or miR-304SP, the muscle area increased to 60% of normal (f, g). (d, h): Quantification of the average percentage of the muscle area according to the genotype indicated under the bars; the graphs show the means ± E.E.M. Six individuals were analyzed per genotype and six photographs of each were quantified. In all images the dorsal part is facing up. (ik) In situ hybridization of transverse cuts of fly muscles with the genotypes indicated under the photographs: it can be seen how, in comparison with the control flies where a clear presence of foci is observed (i) the expression of miR-277SP and miR -304SP resulted in a significant reduction of these, being practically negligible in the latter case (jyk). All indicated genotypes were directed to the muscle using Mhc-Gal4. * p <0.05, ** p <0.01, *** p <0.001 (Student's t test).
Fig. 4. Inhibition of dme-miR-277 or dme-miR-304 improves locomotion and survival of DM1 model flies. (a, e) Average landing height of flies with the relevant genotypes indicated below the graph. In control individuals (a), dme-miR-277 silencing decreased landing height while dme-miR-304 silencing did not affect the flight. In model flies of DM1 (e), the expression of miR-277SP or miR-304SP rescued the decrease in observed flight capacity. (b, f) Histograms of surface ascension velocity expressed as mean velocity ± E.E.M. in mm / s In control flies (b), the silencing of either dme-miR-277 or dme-miR-304 had no effect on ascending speed. However, in DM1 (f) model flies, which have a very low ascent rate, the expression of miR-277SP or miR-304SP rescued
5
10
fifteen
twenty
25
30
35
Significantly this phenotype. (c, g) Survival and (d, h) average survival curves, which show that the expression of miR-277SP or miR-304SP had no effect on control flies, but improved the survival of DM1 model flies. Between 140 and 160 individuals of each genotype were analyzed. All indicated transgenes were directed to the muscle with Mhc-Gal4. * p <0.05, ** p <0.01, *** p <0.001 (Student's t test).
Fig. 5. Validation of results of the primary screening of repressive miRNAs of MBNL1 or MBNL2. (ab) Logarithmic representation in base 2 (log2) of the relative expression level of MBNL1 (a) and MBNL2 (b) in HeLa cells transfected with plasmids derived from pCMV-MIR expressing different human miRNAs (miR-7, miR-23b , miR-146b, miR-218, miR-372), the reference value for both genes being the one detected in HeLa cells transfected with the empty plasmid pCMV-MIR (VTC in the figure) and the endogenous gene used to normalize GAPDH. As a transfection control the vector expressed the GFP protein. * p <0.05 **, p <0.01, *** p <0.001. (cd) Representation of the level of relative expression at the protein level of MBNL1 (panel c) and MBNL2 (panel d) in HeLa cells transfected with the plasmids of the assays shown in (a) and (b), also using as a value of reference for both genes is detected in HeLa cells transfected with the empty plasmid pCMV-MIR (VTC in the figure) and using p-actin as an endogenous control. ** p <0.01, *** p <0.001 (Student's t test).
Fig. 6. Experimental confirmation of the target sequences recognized by candidate miRNAs in 3 ’UTRs by Luciferase assays. (A) Schematic representation, at scale, of the binding sites predicted by the miRanda and Targetscan programs of the microRNAs indicated on the 3'UTRs of MBNL1. Although said gene undergoes alternative splicing, none of the known isoforms affects the presence in the transcript of the targets shown. (B) Graphical representation of the activity of the different microRNAs on luc sensors: 3'-UTR MBNL1 expressed in relative units of Gaussia luciferase, normalized with respect to the internal SEAP control (Gluc / SEAP). (C) To verify that miR-23b binding is direct, the 3'UTR sensor data of this candidate miRNA with the mutated predicted target sequence (MUT) and also its version with the perfect complementary target (PM) are shown, as well as the data obtained when the natural target (WT) is present in the 3'UTR sensor. The activity of miR-23b on the 3'UTR sensors natural, mutated and PM is expressed in relative units of Gaussia luciferase, normalized with respect to the internal control SEAP (Gluc / SEAP). * p <0.05 **, p <0.01, *** p <0.001. (D) Schematic representation, a
5
10
fifteen
twenty
25
30
35
scale, of the binding sites predicted by the miRanda and Targetscan programs of the microRNAs indicated on the 3'UTRs of MBNL2. As in the case of MBNL1, although said gene undergoes alternative splicing, none of the known isoforms affects the presence in the transcript of the targets shown. (E) Graphical representation of the activity of the different microRNAs on luc sensors: 3'UTR of MBNL2 expressed in relative units of Gaussia luciferase, normalized with respect to the internal control SEAP (Gluc / SEAP). (F, G): Graphical representation of the activity of the mirR-23b (F), miR-218 (G) microRNAs that were positive in the previous trial. As in the case of MBNL1, the data obtained with the 3'UTR sensor versions designed for each candidate miRNA with the predicted mutated target sequence (mut) and also its version with perfect complementary target (PM) are shown, as well as the data obtained when the natural target (WT) is present in the 3'UTR sensor. The activity of the different microRNAs on the 3'UTR natural, mutated and PM are expressed in relative units of Gaussia luciferase, normalized with respect to the internal control SEAP (Gluc / SEAP). * p <0.05 **, p <0.01, *** p <0.001 (Student's t test).
Fig. 7. Graphical representation of the relative expression level of the different microRNAs (miR-23b, miR-146b, miR-218, miR-372) by qPCR. As endogenous controls for the normalization of expression, the genes U1 and U6 were used. (A) Expression of microRNAs in different mouse tissues (FVB strain); (B) expression of microRNAs in fibroblasts of control individuals and patients with DM1; (C) expression of microRNAs in muscle biopsies of control individuals and patients with DM1. * p <0.05, ** p <0.01 (Student's t test).
Fig. 8. Toxicity tests with antagomiRs of microRNAs 218 and 23b in normal myoblasts Graphical representation of the percentage of cell survival inhibition at 60 h, obtained in control myoblasts caused by toxicity associated with a dose response test with increasing amounts of the antagonists, with respect to the base 10 logarithm of the nanomolar concentration of the compound. The amounts tested in control myoblasts are indicated on the corresponding curves.
Fig. 9. Dose response trials of the antagonists of microRNAs 218 and 23b: graphic representation of the level of expression of MBNL1 (a, b) or MBNL2 (c, d) in healthy control myoblasts, DM1 and treated with antagomiR -23b and antagomiR-218 (50 pM, 100 pM, 200 pM). As endogenous controls for the normalization of expression, the GAPDH and ACTB genes were used. In the left panels the expression of MBNL1 (a) or MBNL2 (c) is seen at 48 hours post-transfection and transdifferentiation with the antagomiRs, while in the right panels the expression of MBNL1 (b) is seen
5
10
fifteen
twenty
25
30
or MBNL2 (d) at 96 hours post-transfection and transdifferentiation with antagomiRs. * p <0.05, ** p <0.01, *** p <0.001 (Student's t test).
Fig. 10. Dose response trials of the antagonists of microRNAs 218 and 23b: evaluation of alternative splicing of the cTNT, DMD, SERCA1, BIN, IR and GAPDH genes by semiquantitative RT-PCR in myoblast samples from healthy controls ( CNT) and of patients with untreated DM1 (DM1), or treated with antagomiR-23b and antagomiR-218 at the indicated concentrations (50 nM, 100 nM, 200 nM). The results obtained after 48 h (panels A, C, D, E, F, G) or 96 h (panels B, H, I, J, K, L) of transdifferentiation are shown. Panels A and B show photographs of the corresponding fragments of the electrophoresis gels performed after RT-PCR; On the right side of the tests corresponding to each gene, the exon is indicated for which its inclusion (legend headed by a “+” sign) or exclusion (legends headed by a “-“ sign) was checked. Panels C, D, E, F, G (48 h test) and H, I, J, K, L (96 h test) show bar graphs with the exclusion percentages (light gray part) or inclusion (upper part, in darker gray) of each of these exons for the CNT and DM1 controls and the concentrations of each antagonist indicated under the bars.
Detailed description of the invention
As previously mentioned, the present invention is based on knowledge indicating that in patients with DM1 the activity of the MBNL family proteins is limiting, which originates, at least in part, because the mRNAs transcribed from mutant alleles of the DMPK gene, which have hundreds of additional CUG repeats in the 3 'UTR region, accumulate in foci in which Muscleblind-like proteins (MBNL) are sequestered, separating them from their functional targets. Therefore, the present inventors propose that the upregulation of levels of endogenous MBNL proteins is a therapeutic approach against DM1, which would help alleviate their symptoms.
The basis of the present invention is the identification of miRNAs that act negatively on the expression of MBNL proteins and the blocking or inhibition thereof, to decrease or prevent their negative effect on the levels of MBNL proteins, thereby giving rise to an increase in these levels.
The fundamental role of miRNA in the regulation of gene expression has been well established. MicroRNAs (commonly abbreviated as miRNAs) are non-coding endogenous RNAs, approximately 22 nucleotides in length, which act post-transcriptionally and exert their regulatory effects primarily through
5
10
fifteen
twenty
25
30
35
binding to the 3 'UTR region of the target mRNA, which results in the desdenylation of the mRNA and, thereby, causes the decrease or suppression of the translation or, rarely, the excision of the mRNA. This last effect, the mRNA cleavage, can occur when there is complete complementarity between an mRNA and a miRNA that binds to it, which allows a member of the family of proteins called argonauts, specifically Ago2, to act cleave the mRNA and lead to its direct degradation. For the binding of a microRNA to the corresponding messenger RNA, the presence in said mRNA of the so-called "seed region" is essential, which is a fragment of about 6-8 nucleotides (usually 7), which is part from the area of the mRNA to which the microRNA binds and which has a perfect complementarity with a part of the microRNA, usually nucleotides 2 to 8 or 9 thereof, which is also usually called the seed region. microRNA and its corresponding mRNA may not be perfect throughout the mating zone, it is in the seed region; with it, the microRNA can be functional in regulating the expression of the gene to which the mRNA that contains it corresponds.
Thus, the present inventors propose a therapeutic approach for the improvement of DM1 which consists in the modulation of endogenous MBNL proteins causing the sequestration of one or more of the miRNAs that act negatively on their expression, thereby giving rise to a regulation of increase and, as a consequence, an increase in the levels of endogenous MBNL proteins. Therefore, it is about causing the modulation of the endogenous protein by silencing or decreasing the repressive activity of specific miRNAs involved in the regulation of its expression. Particularly, in the present case, there is a preference for miRNAs that are expressed in muscle, as it is one of the main organs affected by the disease.
In accordance with the foregoing, and as used herein, it is called inhibitors, silencers or blockers of a miRNA to compounds that are capable of producing a decrease in the endogenous activity of said miRNA. Because it is common in the literature related to analogous strategies to speak of "antagonism" (see, eg, the article by Landford et al., 2010, on the silencing of miR-122), these three terms have been included under the name "antagonist" of a miRNA. Since the present invention is focused on decreasing the activity of repressor miRNAs for the expression of certain genes, it is said repressive ability that will be diminished by the presence of its inhibitors, silencers or blockers: its antagonists. Although, strictly speaking, the term "silencing" could be interpreted as the absolute cancellation of such activity, given that the difference between said occurrence
5
10
fifteen
twenty
25
30
35
nullification or a non-absolute decrease in repressive activity may depend on the concentration of compound used, the four terms (inhibitors, silencers, blockers or antagonists) are used as synonyms herein, it being sufficient for a compound to result in a decrease of the repressive activity of a miRNA to be considered an inhibitor, silencer, blocker or, in short, an antagonist thereof. Similarly, the effect produced by an inhibitor, silencer or blocker is called inhibition, silencing or blocking of miRNA in different parts of memory, it being understood that any of these three terms entail and mean an antagonism of the action thereof. At some specific points, particularly when referring to trials in which miRNA sponges have been used, the word “depletion” is also used to refer to the effect that occurs when said sponges are present, since the number of binding sites in said sponges results in the binding of most or practically all of the miRNA molecules that have complementary sequences to them, "depleting" the molecules of that miRNA available to interact with other molecules or compounds in the cell where sponges are present.
In the present invention, preference is given to specific antagonists of said miRNAs, which are also, in turn, oligoribonucleotides or molecules derived therefrom that incorporate, among others, some of the usual chemical modifications with which the molecules of oligoribonucleotides to make them more resistant to degradation or bioavailable, such as the modification of part or all nucleotides with 2'-methoxy (2'-O-methyl: 2'-OMe), 2'-Ometoxyethyl (2'-MOE groups ), and / or phosphorothioates. As used herein, oligoribonucleotides are the molecules that result from the binding of a maximum of 50 units of the monomers that give rise to the molecule known in abbreviated form as RNA, monomers that are composed of a phosphate group , the nitrogenous bases adenine (A), cytosine (C), guanine (G) or uracil (U), and the pentose known as ribose. For the usual use, the molecules among whose units is the nucleotide inosine are also included within that definition.
As used in the present invention, the term "molecules of oligoribonucleotide nature" includes both the oligoribonucleotides themselves, as defined above, as well as the "oligoribonucleotide analogs". Oligoribonucleotide analogs are considered molecules derived therefrom that incorporate some chemical modification in at least one of the units of
5
10
fifteen
twenty
25
30
35
ribonucleotides that compose them, either in the phosphate group, the pentose or one of the nitrogenous bases; Modifications consisting of the addition of non-nucleotide groups at the 5 ’and / or 3’ ends are also included. By extension, for the purposes of the present invention and as used herein, the terms "molecule of oligoribonucleotide nature" and "oligoribonucleotide analogue" also include sponges of miRNAs or sponge miRNAs, as the main one can be considered constituent thereof are repeats of oligonucleotides placed in tandem, with the particularity that each of said oligonucleotides are themselves or contain a binding site of a microRNA of interest.
With respect to the possible chemical modifications included in the oligoribonucleotide analogs, the term will apply especially when it concerns one or more of the usual modifications known to those skilled in the field of molecular biology, both in the field of basic research as, in particular, in the search for therapeutic applications of said molecules. Information on this type of modifications can be found in reviews such as that of Kole et al. (Kole et al., 2012). In particular, for the purposes of the invention, those modifications, valid for oligoribonucleotides or ribonucleic acids of greater length, which are considered to be included within the modifications that give rise to molecules included within the scope of the invention are considered, they give rise to RNA analogs with increased resistance to hydrolysis, and which are generally modifications in ribose, such as those resulting in: 2'-O-methyl-substituted RNAs (2'-methoxy modifications); 2'-O-methoxyethyl substituted RNAs; LNAs ("locked nucleic acids": blocked nucleic acid, in which the ribose residue is modified with an extra bridge that connects the 2 'oxygen and the 4' carbon and blocks the ribose in the 3'- conformation endo); BNAs ("bridged nucleic acid": bridged nucleic acid); PMOs (nucleic acids where ribose has been replaced by a morpholino group), or PNAs ("peptide nucleic acid": peptide nucleic acid, where the ribose phosphate group is replaced by an amino acid residue, so that the nucleotide analog It has a skeleton of a structure of repeated units of N- (2-aminoethyl) -glycine linked by peptide bonds.) Recently, nucleotides with an additional type of chemistry are also being used: CRNs ("Conformationally Restricted Nucleotides"), in which The ribose residue is blocked in a rigid conformation by a chemical moiety that acts as a connector, a modification that is mainly used to obtain antagomiRs with new properties (see, for example, the information provided on the website: http://www.marinabio.com/pipeline/nucleic-acid-drugs/). They are also common, and are considered equally included within the possible
5
10
fifteen
twenty
25
30
35
modifications that give rise to oligoribonucleotide analogs of the invention, the modifications that give rise to phosphorothioate bonds, which are modifications that affect phosphate groups that are part of the "skeleton" of the nucleotide chain, leading to the introduction of an atom of sulfur in substitution of an oxygen atom of the phosphate group that is not acting as a bridge between nucleotides; these modifications make the bonds between nucleotides resistant to degradation by nucleases, which is why they are usually introduced between the last 3- 5 nucleotides at the 5 'or 3' ends of oligonucleotides to inhibit their degradation by exonucleases, increasing their stability.It is usual to represent phosphoryotiated ribonucleotide analogs by placing an asterisk behind the base abbreviation (e.g., rA *), while 2'-O-methylated and phosphorothioate-linked bases can be found to represent adas with a letter m in front of its abbreviation and an asterisk behind (eg, mA *). Due to their frequency of use within the group of antimiRs, the 5 'methylation of the cytosine nitrogenous base (C), which seems to increase the stability of the duplexes that form with the target.
Other different chemical modifications are also possible and known, which are also included within the possible modifications that give rise to oligoribonucleotide analogs. As can be deduced from the definition of "molecules of oligoribonucleotide nature" and that of "oligoribonucleotide analogs", molecules that can be considered of a hybrid nature, in which some units have modifications and are also included within the definition of oligoribonucleotide analogs, others do not, as well as hybrids between nucleic acid and peptide analogs or even hybrid molecules in which some of the nucleotide units are ribonucleotides (or analogs thereof) and others are deoxyribonucleotides (nucleotides where sugar is deoxyribose) , as well as the analogues of the latter, that is, the RNA-DNA hybrids and their analogues.
For the purposes of the present invention, inhibitors, blockers or antagonists of miRNAs of the types known as antagonists, blockmiRs, antimiRs and sponges of miRNAs are considered included in oligoribonucleotide nature molecules or oligoribonucleotide analogs.
Thus, for example, in Example 1 of the present specification, molecules are used that correspond to this group of compounds and which are formed by several units of ribonucleotides, sponges of miRNAs or miRNAs sponge (in English, microRNA sponges), which are transcripts expressed from strong promoters containing
5
10
fifteen
twenty
25
30
35
multiple binding sites to a microRNA of interest, placed in tandem. Sponge miRNAs are usually designed to inhibit miRNAs with a complementary heptameric or octameric fragment (seed region), so that a single sponge construct can be used to block a whole family of miRNAs that share the same motif, although they can also contain all the target sequence for a specific miRNA. The term "sponge construction" is sometimes used interchangeably to refer to the vectors from which the sponge miRNAs and the RNA molecules expressed therefrom are expressed. For reasons of clarity, it has been attempted herein to reserve the term "sponge construction" for the vector from which the sponge miRNA is expressed as such or for the specific fragment of the vector encoding the expressed sponge miRNA, but The effect of these constructs is referred to when the effects found when the expression of the corresponding sponge miRNAs in the cells or tissues under test has occurred.
Since sponges of miRNAs are not totally specific, but can block, silence or inhibit several miRNAs that share the same motive, to avoid possible unwanted effects and that genes that have no involvement in DM1 are affected, In the present invention, preference is given to specific inhibitors of the groups of so-called blockmiRs, antimiRs or antagomiRs, especially the latter. In all three cases they are oligonucleotides with chemical modifications that prevent a series of molecules from binding to a specific place in an mRNA molecule, although there are some differences between them.
As used herein, blockmiRs are small special chemistry RNAs designed against the sequence that a particular miRNA detects in a particular messenger RNA (mRNA), so, initially, each of them should only depress. the effect of that miRNA on that transcript, a very specific effect being expected. Therefore, they are designed so that they have a sequence that is complementary to that of a fragment of the sequence of an mRNA that serves as a binding site for a miRNA, so that they are usually joined at the 3 'end of the region untranslated (UTR) of an mRNA, that is, in the area where endogenous miRNAs are usually joined.
AntagomiRs, on the other hand, are generally used to silence endogenous miRNAs. Thus, small synthetic RNAs, chemically modified with respect to the corresponding RNA oligomer composed only of ribonucleotide units, and which are complementary to a target miRNA are called antagomiRs. Therefore, they can
5
10
fifteen
twenty
25
30
35
considered oligonucleotide analogs that specifically bind to specific miRNAs and therefore act as inhibitors / blockers of miRNAs. As a miRNA can have many target transcripts, the use of antagomiRs can sometimes lead to undesirable side effects, because mRNAs that were not desired to modulate are affected. Typically, antagomi® include chemical modifications in their units, compared to ribonucleotides, such as 2-O-methyl groups, phosphorothioates and conjugated cholesterol moieties; It is also usual that they include at least one modification that either gives rise to some kind of impediment to the Ago2 protein's performance or to an imperfect pairing between the antagomi® and the target miRNA, thereby preventing the mediated excision from occurring. Aug2. As Wang et al. In their review of implications of microRNAs in liver diseases (Wang et al., 2012), it has been reported that antagomiRs inhibit their target miRNA, in a dose-dependent manner, in different tissues of mice when administered intravenously as molecules naked Among other effects, it is known that an antagonist of miR-221 was able to block the growth of xenografts of HCC tumors in mice and prolong their survival. The cutaneous route is also a common route of administration of antagomiRs.
On the other hand, the antimiRs, are usually complementary to only a part of the mature miRNA that is its target, the so-called seed region, but they bind to it with great affinity, because they present modifications that greatly increase the union with its target, such as those of the LNAs described above or, sometimes, as already mentioned, the 5 'methylation of the cytosine nitrogenous base (C), which also seems to increase the stability of the duplexes that form With the target. Rottiers et al. They observed not only the effective inhibition of families of miRNAs using antimiRs targeting the seed region of said miRNAs, of only 8 nucleotide analog units with LNA-like modifications, but also the efficacy and safety of these long-term treatments in non-human primates . As Wang et al., Also in the aforementioned reference (Wang et al., 2012), these small molecules have a potent activity in a whole range of mouse, rat, monkey and chimpanzee tissues after their systemic administration as molecules naked, at doses considerably lower than those of other inhibitors. The antimiR SPC3649, for example (Landford et al., 2010) has been used in phase 2a clinical studies for patients with chronic hepatitis C virus infection (ClinicalTrials.gov No. NCT01200420).
As can be deduced from the previous definitions, the design of inhibitors /
5
10
fifteen
twenty
25
30
35
microRNA antagonists usually start from a short basic ribonucleotide sequence, which may be the complementary sequence to the microRNA to be inhibited (as usual in antagomiRs and antimiRs, as well as in microRNAs sponges) or the sequence of the microRNA itself or a sequence complementary to an area of the mRNA to which the microRNA binds (case of blockmiRs). As used herein, it is understood that two chains of nucleotide-based molecules are 100% complementary (or, as expressed more briefly herein, that their sequences are complementary) when the sequence of nucleotides or nucleotide analogs of one of them, read in the 5'-3 'sense, is the sequence of nucleotides or nucleotide analogs that have the nitrogenous bases with which the nitrogenous bases of the nucleotides or nucleotide analogs of the other sequence, read in the 3'-5 'direction. That is, the sequence 5'-UAGC-3 'would be complementary to the sequences 3'-AUCG-5' (in the case of being the ribonucleotide units or ribonucleotide analogs) and 3'-ATCG-5 '(in the case if they were the dexosiribonucleotide units or analogs of dexosiribonucleotides), which would be, respectively, the sequences 5'-GCUA-3 'and 5'-GCTA-3' in the 5'-3 'direction. In some cases, particularly in the design of antimiRs, it is important that the antagonist molecule comprises a fragment that is identical to the sequence complementary to that of the seed region of the microRNA to which it wants to antagonize, at least as regards the complementarity of the nitrogen bases. And it is that often, especially in the case of antagomiRs and antimiRs, modifications are made to the corresponding ribonucleotide units, which mainly affect the ribose residue and / or phosphate, modifications that are difficult to indicate in the representations usual nucleotide sequences, where the nucleotide present in a certain position is identified by the abbreviation of the nitrogenous base that is part of it. Therefore, in the present invention, comparisons of microRNA antagonist molecules are found that refer to the percentage of identity between the sequences of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs present in said units, since it is what can indicate whether two molecules or sequence fragments are designed starting from the same basic starting ribonucleotide sequence, although different chemical modifications may have been incorporated into the ribonucleotides in each case.
In order to design the antagonist molecules, it is important to keep in mind that there is sufficient complementarity with the endogenous molecules to which they must bind so that the desired inhibition / antagonism / silencing effect really occurs. In that sense, examples of the fact that the
5
10
fifteen
twenty
25
30
35
"typical" complementarity between a miRNA and its target can be 50% (see, for example, the reference
http://mirtarbase.mbc.nctu.edu.tw/php/detail.php mirtid=MIRT000125#target), so it is recommended that the molecule of oligoribonucleotide nature of the invention comprises a sequence fragment of ribonucleotide units , or of ribonucleotide analogs, in which the sequence of the nitrogenous bases of the ribonucleotide units or of ribonucleotide analogs is at least 50% identical (or at least 55%, 60%, 70%, 80 %, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%), to the complementary sequence to that of the fragment of the endogenous molecule with which it has to be paired, that is, to the sequence of the endogenous microRNA with which it must be bound (in the case of antagomiRs and the repetitive sequence of the miRNAs sponges) or fragment sequence of the messenger mRNA (in the case of blockmiRs). In the case of antagomiRs, whose length is usually approximately equal to that of the miRNAs whose action they have to antagonize, it is especially preferred that the sequence of the nitrogenous bases of their ribonucleotide units or ribonucleotide analogs be identical at least 80 % (or at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%) , to the sequence complementary to that of the endogenous microRNA to which they have to antagonize; This is the criterion that has been followed for the design of antagomiRs against the human microRNAs miR-218-5p and miR-23b-3p. In the case of antimiRs, the most important thing is that they comprise a fragment in which the sequence of the nitrogenous bases of the nucleotides or nucleotide analogs is complementary (preferably, 100% complementary) to the sequence of the nitrogenous bases of the nucleotides of the mature miRNA seed region that is its target, so that the complementarity in the rest of the nucleotides or nucleotide analogs that are present in the antimiR, if any, is less important.
Sequence alignment for comparison can be carried out with the algorithms of Smith and Waterman, Adv. Appl. Math 2: 482 (1981); or Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); through the similarity search method of Pearson and Lipman, Proc. Natl Acad. Sci. 85: 2444 (1988); or through computer applications based on said algorithms and methodologies, including but not limited to: CLUSTAL, in the Intelligentics PC / Gene program (Mountain View, California, USA) .; GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics software package (Genetics Computer Group (GCG), Wisconsin USA) In particular, the BLAST family programs, which are based on the Altschul algorithm et al. (Altschul et al., 1990), are publicly accessible (for example, through the website of
5
10
fifteen
twenty
25
30
35
US National Center for Biotechnology Information http://blast.ncbi.nlm.nih.gov/Blast.cgi) can be used to perform searches and identity calculations, and especially for the purposes of the invention, BLASTN, dedicated to nucleotides.
As can be seen in the tests described and disclosed in the Examples herein, the present inventors have started from the realization of a proof of concept in a DM1 model of Drosophila melanogaster, in which CUG trinucleotide repeats are overexpressed in the muscle This model was used to explore the therapeutic potential of silencing specific microRNAs (miRNAs) thereby boosting muscleblind expression. The tests carried out with said model, described in Example 1, demonstrate that upward regulation of endogenous Drosophila muscleblind proteins is possible by sequestering miRNAs that negatively modulate their expression, specifically through the use of "sponge" constructs. This was based on a set of miRNA identified as potential regulators of muscleblind, finding that only the specific silencing of two of the miRNAs of the initial game, dme-miR-277 or dme-miR-304, gave rise to the desired direct effect: an increase in the levels of both the muscleblind protein and the corresponding mRNA.This upward regulation resulted in the reversal of several erroneous splicing events and, thus, the rescue of several phenotypes similar to the symptoms of DM1, such as reduction of muscular atrophy The flies in which the test was carried out showed an improvement in muscle function in the flight and Ascent by surfaces and an increase in life expectancy.
Similarly, the present specification describes the identification, in HeLa cells, of potential miRNAs that could negatively regulate MBNL in humans (MBNL1 and / or MBNL2), the selection of those that actually seemed to have regulatory effects, the verification in animal models, specifically mouse, of its expression in tissues of interest generally affected in cases of DM1, the design of inhibitors (specifically antagonists) for specific miRNAs, checking their effectiveness in increasing the expression of MBNL1 and / or MBNL2 in human myoblasts and verification that it corresponds to the rescue of several alternative splicing events typically altered in myoblasts of patients afflicted with DM1. These trials, together with the previous proof of concept carried out in Drosophila, demonstrate the effectiveness of the strategy designed.
The proof of concept performed in Drosophila, described in Example 1, is also
5
10
fifteen
twenty
25
30
35
significant because it showed some notable facts, to be taken into account for the design of specific inhibitors, blockers or silencers of miRNAs, in particular for its application in the treatment of DM1 in mammals, especially in humans. In particular, the following deserve comment:
- As mentioned, although it was based on a set of miRNA identified as potential regulators of muscleblind from previous data of the present inventors and bioinformatics analysis, only the silencing of two of them, dme-miR-277 (SEQ ID NO : 29) and dme-miR-304 (SEQ ID NO: 30), resulted in upward regulation of the expression of the Drosophila muscleblind gene, both at the level of mRNA and the proteins themselves. Therefore, the simple identification of structural reasons that may indicate that a miRNA may have an effect on the regulation of the expression of MBNL1 and / or MBNL2 does not guarantee that it is a miRNA with a negative effect on its expression or that the design of a specific inhibitor thereof can give rise to the desired effects on the elevation of the levels of one and / or another protein, especially when what is desired is that said increase in protein levels occurs in the appropriate tissues and see accompanied by an improvement in the symptoms of DM1.
- It is also interesting to comment that the quantitative analysis confirmed that each sponge construction resulted in the elevation of the levels of different muscleblind isoforms. Interestingly, both sponge constructions, miR-277SP and miR-304SP (sponge constructions designed specifically to silence dme-miR-277 and dme-miR-304), were able to negatively regulate the expression of the mblB and mblC isoforms, respectively, instead of increasing expression, which suggests some kind of interisoform regulation, as previously demonstrated for MBNL proteins (Kino et al., 2015; Terenzi et al., 2010). This fact induced the present inventors to consider the identification in human cells of miRNAs that were either MBNL1 or MBNL2 inhibitors or both, to control possible regulatory or compensatory effects between both proteins or between the miRNAs that regulate their expression.
- The immunodetection tests of the protein in the muscle tissue of flies expressing one of the sponge constructs, miR-304SP and miR-277SP, demonstrated the overexpression of Muscleblind in both cases, although in different subcellular locations: miR-277SP caused a preferably increase in sarcomeric bands and miR-304SP in the nuclei. Deserves
5
10
fifteen
twenty
25
30
35
It should be mentioned that in none of the two cases was Muscleblind retention detected in ribonuclear foci which are not detected in sections of fly chest IFMs by means of a probe designed to detect the expansions ("CAG" probe). Finally, consistent with the previous knowledge that indicates that the MblC isoform is located in the nucleus and with preferential regulation of MblC expression by miR-304SP, it could be confirmed that the expression of miR-304SP allowed to rescue a number of erroneous splicing events dependent on Muscleblind Taking them together, these data confirm that upward regulation of muscleblind achieved by silencing specific regulatory miRNAs is sufficient to rescue the critical molecular characteristics altered in DM1 models in flies.
Example 1 also describes the positive effect of the expression of the miR-277SP and miR-304SP sponge constructs on the recovery of muscular atrophy, which is a characteristic phenotype of DM1.
Expressing the sponge constructions with the driver (“driver”) Mhc-Gal4, the long-term effects of Muscleblind overexpression were also tested. In control flies, it was observed that the expression of miR-304SP, caused a 6-fold increase in the relative expression of muscleblind and had no effect on muscle area, survival or locomotor function. However, the expression of miR-277SP, which produced a 15-fold upward regulation of muscleblind, caused a significant reduction in muscle area, which correlates with a decrease in landing height. In a fund that expresses CTG, however, the expression of any of the sponge constructs caused beneficial effects, suggesting that the limited overexpression of transcripts from additional natural targets of the blocked miRNAs is insignificant compared to the positive effects of stimulating the muscleblind expression. This is important, because there could be deleterious effects of miR-277SP due to the overexpression of several of its targets, in addition to muscleblind, since dme-miR-277 is one of the miRNAs with the highest expression in muscle. Previous studies have confirmed that long-term overexpression of MBNL1 in mouse models is well tolerated when limited to skeletal muscle. Overexpression of MBNL1, increased in the range of 10 to 17 times, did not cause any detectable histopathology or functional abnormalities (Chamberlain & Raum, 2012). These results were interpreted as supporting the strategy of trying to inhibit / silence / decrease / antagonize the activity of
5
10
fifteen
twenty
25
30
35
specific miRNAs involved in the negative regulation of MBNL1 and / or MBNL2 proteins in mammals, particularly humans, as a means to alleviate the symptoms of DM1, without producing undesirable side effects in other functions of the individual who is in need of receiving treatment.
Thus, these results indicated that the blocking of MBNL repressor miRNAs in humans or other mammals could also reduce the symptoms of DM1, providing proof of concept of the therapeutic potential of upward regulation of Muscleblind by specific miRNA blockers in patients with DM1 . Thus, the study with the Drosophila model of the DM1 disclosed herein lays the groundwork for the evaluation of miRNA blockers that suppress muscleblind expression (or, rather, of homologous proteins in mammals such as humans ) as a valid and effective therapeutic target for the treatment of DM1.
On this basis, the present inventors addressed a study of identification of possible repressor miRNAs of human proteins MBNL1 and / or MBNL2, to later verify if an analogous strategy of inhibiting / blocking one or more of said miRNAs could be used to increase MBNL1 and / or MBNL2 proteins and, with this, manage to rescue characteristic DM1 phenotypes, as proof that the inhibition of said miRNAs could be used for the treatment of symptoms characteristic of said disease.
As described in Example 2, an initial screening was performed to identify potential repressors of one of these genes or both, which identified a total of 23 candidate microRNAs, among which a pre-selection was made to from bioinformatic programs, selecting those for which binding targets had been predicted in the 3 'UTR regions of one or both genes. However, the validation tests carried out indicated that only some of the preselected microRNAs actually resulted in a decrease in the levels of the corresponding protein (MBNL1 or MBNL2) resulting from the genes that in principle were regulated by said miRNA, even though The presence of binding targets for the corresponding microRNA in the 3 'untranslated region (3' UTR) was confirmed by complementary bioinformatic applications. The decrease in the levels of protein produced, in the cases in which it really existed, was not of the same level for all microRNAs, being more pronounced in some cases, highlighting those of miR-23b-3p microRNAs (referred to in abbreviated form in memory as miR-23b) and miR-218-5p (referred to in abbreviated form in memory as miR-218). This shows, as the previous tests carried out in the model of
5
10
fifteen
twenty
25
30
35
Drosophila, that the identification of hypothetical binding targets in the 3'UTR of the messenger RNA of a gene or other reasons that may indicate an alleged interaction does not guarantee or make it expected that a microRNA really is a modulator of a gene, preferably direct, nor that blocking or inhibiting said microRNA actually results in the desired modulation which, in this case, was an increase in the levels of the MBNL1 protein and / or the MBNL2 protein.
In addition, it was checked if the preselected miRNAs were expressed in the organs most affected by the characteristic symptoms of the disease, such as organs of the Central Nervous System such as the brain, cerebellum or hippocampus, as well as skeletal muscle and heart. The tests carried out with different mouse tissues showed that the expression of the endogenous microRNAs of said animal miR-23b and miR-218 in different tissues related to the mentioned organs (anterior brain, cerebellum, hippocampus, heart, quadriceps and gastronomy) were very higher than those of the remaining preselected microRNAs, especially in the case of miR-23b, which was much higher in all tissues. These data indicate that inhibition of the same microRNAs could be used to treat cases of myotonic dystrophy 1 in other mammals.
Gene expression determinations were also made from muscle biopsies of human beings, observing that the levels of miR-218 and miR-23b were clearly increased in DM1 patients with respect to controls not affected by the disease. An increase in miR-218 was also observed in fibroblasts obtained from patients with DM1 compared to controls. These data are interesting because, taken in conjunction with the efficacy tests performed with antagomiRs in Example 3, they indicate that cultures of established lines or primary cultures of cells obtained from tissues of interest to patients, such as muscle myocytes Skeletal, they can be useful to perform tests and check the efficacy of possible blockers or inhibitors of different miRNAs and see if certain molecular alterations characteristic of the disease show an improvement or are palliated by inhibitors under test, as an indication of a palliative effect of symptoms of the disease. And that is important to facilitate the studies, since the existing mouse models do not reproduce all the symptoms of human disease, but mainly the symptoms related to muscular dysfunction.
These tests, together with the tests of direct interaction of the miR-218 and miR-23b microRNAs with the corresponding messenger mRNAs (see the Gaussia luciferase assay), resulted in the choice of these microRNAs
5
10
fifteen
twenty
25
30
as the microRNAs of preference to inhibit / antagonize, for which to develop inhibitors / antagonists.
The miR-218-5p and miR-23b-3p microRNAs, unlike other initially tested microRNAs, have in common that they fulfill the desired characteristics that the candidate microRNAs had to meet to develop inhibitors against them in order to alleviate characteristic symptoms of DM1, as they are:
- Both appear to be repressor microRNAs of at least one of the genes on which it was desired to act, homologous genes in humans of the muscleblind gene of Drosophila, MBNL1 or MBNL2, repressors that, according to the tests of Example 2, have a direct action on the corresponding messenger RNAs, which reduces the risk that their potential inhibitors affect other routes or see their effect diminished by the endogenous regulation of necessary intermediate steps until their action on the desired genes occurred.
- Both show expression in tissues of organs related to characteristic symptoms of the disease, such as muscle disorders, both related to mobility and cardiac, or neurological disorders. In particular, both show a clear increase in their levels in samples of muscle biopsies of patients with DM1, so that blocking or inhibition of these microRNAs in cells and the observation of their effects on disease-related molecular alterations, such such as alterations of alternative splicing, may be indicative of the effectiveness of its blockage or inhibition to alleviate symptoms of the disease.
Despite these coincidences, which shows that the preferential choice of these microRNAs to block or inhibit them responds to the same inventive concept, the significant difference between them that miR-218 is only a repressor of MBNL2 should be highlighted, while miR-23b is a repressor of both MBNL1 and MBNL2. In addition, miR-218 is significantly increased in muscle biopsies of patients (miR-23b shows an upward trend, although not significant in the available experimental data) so that its blockage not only anticipates the release of MBNL2, which is already known to It is a therapeutic target, but will mitigate the downstream effects that overexpression of miR-218 could be causing on other muscle transcripts, thus constituting a therapeutic target in itself.
5
10
fifteen
twenty
25
30
35
In addition, although the trials presented herein confirm the expression of both microRNAs in tissues of interest related to disease symptoms, the search for expression tissues in the miRGator database, version 3.0 (v3.0) ( http://mirgator.kobic.re.kr) reveals some differences between both microRNAs, with miR-23b presenting a wider range of tissues. Specifically, according to miRGator v3.0, miR-218 is expressed in: adipose tissue, brain, central nervous system, kidney, heart, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, stem cells, testis uterus miR-23b, meanwhile, is expressed in: central nervous system, gastrointestinal tract, adipose tissue, breast, bladder, heart, keratinocytes, kidney, liver and biliary system, lung, lymphoid cells, nose, pharynx, placenta, prostate, skin, spleen, stem cells, testis, thyroid gland and uterus. Thus, a possible embodiment of the invention can be considered a molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog that is an antagonist of a microRNA that downregulates the expression of the human gene MBNL1 and / or MBNL2, or a mixture of two or more of said molecules and that is expressed in at least one or more organs selected from the group of brain, cerebellum, hippocampus or other central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis, uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or in one or more cells of a primary culture of one of these organs or of an established cell line derived from one of these organs (including induced pluripotent stem cells, known by its acronym iPSCs: induced plunpotent stem cells) or mad cells re of one of these organs. The choice of the specific microRNA to antagonize, in particular, the choice specifically between the human microRNA-218-5p or the human microRNA-23b-3p, will also determine the range of tissues where the antagonistic effect can be exerted. On the other hand, the administration of the antagonist by means of a possible expression vector thereof can allow the expression to be directed to a specific tissue or group of tissues depending on the tropism of the base vector itself and / or by choosing control elements that give place to the expression of the coding sequence linked to them only in specific tissues. In addition, some specific dosage forms may favor greater access to one or the other organs. Thus, it can also be considered that a possible embodiment, combinable with any other, of the aspect of the present invention more directly referred to the therapeutic application thereof, could be stated as: use of one of the molecules of oligoribonucleotide nature or an oligoribonucleotide analog of the invention, a mixture of two or more of them, or a composition comprising the
5
10
fifteen
twenty
25
30
35
less one of said molecules, for the manufacture of a medicament for the treatment of myotonic dystrophy type 1 by inhibiting or antagonizing the action of a microRNA that regulates the expression of the human gene MBNL1 and / or MBNL2 in al minus one or more organs selected from the group of brain, cerebellum, hippocampus or other central nervous system organ, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testis , uterus, gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or stem cells of one or more of these organs. Since there is a special preference for inhibition or antagonistic action on the human microRNA-218-5p, it is also taken because the organ or organs are selected from the group of brain, cerebellum, hippocampus or other central nervous system, skeletal muscle, heart, adipose tissue, kidney, liver and biliary system, lung, pharynx, nasopharynx, nose, placenta, spleen, testicle and uterus or stem cells of one of these organs, while the choice of miR-23b-3p allows extending the possibilities of choice, according to current knowledge, at least to the gastrointestinal tract, breast, bladder, prostate, skin, keratinocytes and lymphoid cells or stem cells of one or more of said organs, or combinations thereof, as desired or convenient.
The human microRNAs miR-218-5p (miR-218) and miR-23b-3p (miR-23b) also differ in the sequence of ribonucleotides that compose them, as well as in their seed region, which should be taken into account to the design of inhibitors / silencers / antagonists specific to each of them. The sequences of their mature versions are shown below, where the seed region of each of them appears in bold, and their access code (MIMAT) in the database of miRbase ( www.mirbse.org):
miR-128-5p (MIMAT000275): 5’- UUGUGCUUGAUCUAACCAUGU-3 ’(SEQ ID NO: 3)
miR-23b-3p (MIMAT0000418): 5’-AUCACAUUGCCAGGGAUUACC-3 ’(SEQ ID NO: 4)
Although the tests carried out in the Drosophila model demonstrated the viability of the inhibition of the action of repressor microRNAs by means of microRNA sponges, and the miR-218 and miR-23b microRNA binding assays at 3 'UTR indicated that the development of blockmiRs is also a possible strategy for blocking / inhibiting the action of miR-218 or miR23b microRNAs, the present inventors preferred to opt for antagomiRs, because, as explained above, the chemical modifications that are generally performed on they give rise to an increase in stability that is interesting for its possible direct administration to human beings, as well as because the addition of lipophilic or lipidic nature that is often
5
10
fifteen
twenty
25
30
incorporated into one of its ends usually facilitates its entry into the cells. That is why antagomiRs have been the preferred inhibitors with which the tests were continued, among the possible options for the development or identification of a molecule of oligoribonucleotide nature and / or an oligoribonucleotide analogue that is an inhibitor of a microRNA that downregulates the expression of the human MBNL1 and / or MBNL2 gene, for use in the treatment of myotonic dystrophy 1, and especially among inhibitors of human microRNA-218-5p or human microRNA-23b-3p.
As can be seen in Example 3, the specific antagomiRs developed, called antagomiR-218 and antagomiR-23b, have certain chemical modifications common in this type of oligoribonucleotide analogs, such as 2'-O-methyl (2'-methoxy) modifications in all ribose residues, the replacement of some phosphate bonds between the monomeric units of nucleotide analogs by phosphorothioate or the incorporation of cholesterol residues at one end of the molecule, specifically at the 3 'end, although, as detailed above , other different modifications are possible, which would also give molecules compatible with the present invention.
AntagomiRs-23b and 218 proved capable of penetrating cells in the transfection experiments performed. The toxicity tests showed that the concentrations that gave an appreciable signal of detection of said antagomiRs in cells were lower than the inhibitory concentration that kills 10% of the cells (IC10) which supports their safety and their chances of being candidates for molecules for its use for the treatment of myotonic dystrophy 1, in addition to allowing the trials to continue.
Dose response trials conducted in myoblasts of DM1 patients with one or another antagomiR, at different doses, showed that said antagomiRs are capable of reversing the aberrant splicing of some genes that characteristically have this process altered in DM1 patients, which supports its use for the preparation of a medicament for the treatment of myotonic dystrophy 1, in particular to alleviate symptoms of the disease, especially symptoms that correspond to muscular dysfunction. There was no absolute coincidence between the events reversed by one or another antagomi, or on the preferential concentrations, so the combination of both could be interesting in some cases, although in others it could show preference for the antagomiR-218.
Given the stability of antagomiRs, it is possible to consider their administration to beings
5
10
fifteen
twenty
25
30
35
human directly, for example subcutaneously or systemically, preferably intravenously, for example dissolved or in suspension in a pharmaceutically acceptable carrier, such as water or an aqueous solution such as saline or phosphate buffer. The composition in which they are administered may contain pharmaceutically acceptable excipients.
Also included within the scope of the present invention are compositions comprising one of these antagonists or mixtures thereof, as well as any other antagonism directed against human microRNA-218-5p or human microRNA-23b-3p or mixtures thereof, or in general any molecule of oligoribonucleotide nature and / or analog of oligoribonucleotide that is an inhibitor of one of said microRNAs or of another microRNA that downregulates the expression of the human gene MBNL1 and / or MBNL2, including compositions that also comprise a pharmaceutically acceptable carrier and / or excipients. In addition, given the direct relationship between expression vectors that express sponges of miRNAs or even precursors of mature microRNAs that ultimately have repressive effect, a composition comprising a vector is also included within the scope of the present invention. of expression of one of said molecules of oligoribonucleotide nature, in particular the vectors comprising the coding sequence of a microRNA sponge comprising multiple tandem sites complementary to the human microRNA-218-5p or the human microRNA-23b-3p or a mixture of multiple binding sites placed in tandem complementary to each of them.
For clinical application, the compositions of the present invention, which will then be considered pharmaceutical compositions of the present invention, can be prepared in a form suitable for the desired application. As stated in publications also related to the clinical application of microRNA inhibitors / antagonists, such as international application WO2012148373A1, this will generally involve the preparation of compositions that are essentially free of pyrogens, as well as other impurities that could be harmful to human beings or animals Said international application WO2012148373A1 aims at compounds analogous to those of the present invention and therapeutic applications thereof, whereby information on forms of preparation and presentation of pharmaceutical compositions, possible suitable administration vehicles, or forms and routes of administration may considered applicable to the present invention and can be taken as a reference for the compositions of the present invention. Part of bliss
5
10
fifteen
twenty
25
30
35
Information is reproduced below.
In a possible embodiment, the pharmaceutical composition comprises an effective dose of an inhibitor or antagonist of human microRNA-218-5p or human microRNA-23b-3p or a mixture thereof. For example, the pharmaceutical composition may comprise an inhibitor / antagonist of human microRNA-218-5p or human microRNA-23b-3p, or mixtures thereof. Preferably, the human microRNA-218-5p inhibitor / antagonist present is the antagomi® type inhibitor used in the examples of the present invention (represented by SEQ ID NO: 10) and the human microRNA-23b-3p inhibitor / antagonist present. it is the antagomi® type inhibitor represented by SEQ ID NO: 11. More preferably, the
present inhibitor (s) / antagonist (s) will be present at a concentration that allows the administration of a therapeutically effective dose.
An "effective dose" or "therapeutically effective dose" is an amount sufficient to effect a beneficial or desired clinical outcome. An effective dose of an inhibitor / antagonist of a microRNA, according to previous results obtained with molecules directed against other microRNAs, can be from about 1 mg / kg to about 100 mg / kg, about 2.5 mg / kg to about 50 mg / kg, or about 5 mg / kg at about 25 mg / kg. The precise determination of what would be considered an effective dose can be based on individual factors for each patient, including their size, age, and the nature of the inhibitor or antagonist (for example, if it is an expression construct, an antagomi R type oligoribonucleotide analogue or antimiR ...). Therefore, the dosages can be easily determined by those of ordinary skill in the art from this description and knowledge in the art. It may be necessary or convenient to administer multiple doses to the subject during a particular treatment period, administering daily, weekly, monthly doses, every two months, every three months or every six months. In certain embodiments, the subject receives an initial dose at first that is greater than one or more subsequent or maintenance doses.
Colloidal dispersion systems, such as complexes of macromolecules, nanocapsules, microspheres, beads and lipid-based systems that include oil-in-water emulsions, micelles, mixed micelles, and liposomes, can be used as delivery vehicles for inhibitors / antagonists. of the present invention, with which the pharmaceutical composition of the invention is formed. Commercially available fatty emulsions that are suitable for the delivery of molecules of oligoribonucleotide nature to a subject include Intralipid®,
5
10
fifteen
twenty
25
30
35
Liposyn®, Liposyn® II, Liposyn® III, Nutrilipid, and other similar lipid emulsions. A preferred colloidal system for use as an in vivo administration vehicle is a liposome (ie, an artificial membrane vesicle). The preparation and use of such systems are well known in the art. Exemplary formulations are also described in US 5,981, 505; United States 6,217,900; U.S
6,383,512; United States 5,783,565; United States 7,202,227; United States 6,379,965; US 6, 127,170; United States 5,837,533; United States 6,747,014; and WO03 / 093449, which are incorporated herein by reference in their entirety.
Another possibility, as already mentioned, is to prepare the pharmaceutical compositions of the invention using appropriate salts and buffers to make the administration vehicles stable and assist in the uptake by the target cells. The compositions of the present invention may be aqueous compositions comprising an effective amount of the delivery vehicle and comprising either the oligonucleotide molecules of the invention, independently or forming liposomes or other complexes, or expression vectors of the themselves, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The terms "pharmaceutically acceptable" or "pharmacologically acceptable" refer to molecular entities and compositions that do not produce adverse, allergic or other reactions, when administered to an animal or a human being. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption retardants and the like acceptable for use in pharmaceutical formulation products. , such as pharmaceutical products suitable for administration to humans. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredients of the present invention, its use in the pharmaceutical compositions of the invention is contemplated. Supplementary active ingredients can also be incorporated into the compositions, provided that they do not inactivate the molecules of the present invention or their expression vectors.
The active compositions of the present invention can be administered by any of the common routes, provided that the target tissue is available through that route. This includes the oral, nasal, or oral routes and also, preferably, administration can be intradermally, subcutaneously, intramuscularly, intraperitoneally or intravenously. As previously mentioned, it is usual that the compositions
5
10
fifteen
twenty
25
30
35
which comprise antagomiRs or antimiRs are formulated for intravenous or subcutaneous administration. By way of illustration, solutions of the active compounds as a free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropyl cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations generally contain a preservative to prevent the growth of microorganisms.
Pharmaceutical forms suitable for injectable use include, for example, sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Generally, these preparations are sterile and fluid to the extent that there is easy injectability. The preparations must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Appropriate solvents or dispersion media may contain, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be caused by various antibacterials and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions may be caused by the use in the compositions of agents that delay absorption, for example, aluminum monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active compounds in an appropriate amount in a solvent together with any other ingredients (for example, as specified above) as desired, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients in a sterile vehicle containing the basic dispersion medium and the other desired ingredients, for example, as specified above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred preparation methods include vacuum drying and lyophilization techniques that produce a powder of the active ingredient (s) plus any
5
10
fifteen
twenty
25
30
35
additional desired ingredient from a solution thereof previously sterilized by filtration.
The compositions of the present invention can generally be formulated in a neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (e.g., hydrochloric or phosphoric acids), or from organic acids (e.g., acetic, oxalic , tartaric, mandelic), and the like. Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (for example, from sodium, potassium, ammonium, calcium, or ferric hydroxides) or from organic bases (for example, isopropylamine, trimethylamine, histidine, procaine and the like).
In any case, it is recommended that the preparation of the compositions of the present invention follow practices that guarantee a minimum quality for use in humans, such as those set out in the Guide to Good Manufacturing Practices of Active Pharmaceutical Ingredients of Working Group Q7 of the International Conference on Harmonization of Technical Requirements for the Registration of Pharmaceutical Agents for Human Use ("ICH Q7 Guideline. Good Manufacturing Practice Guide for Active Pharmaceutical Ingredients", available online at the address: http://www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guidelines/Quality/Q7/Step4/ Q7_Guideline.pdf, together with its complement of Questions and Answers, of June 10, 2015, available at the Internet address : http://www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guidelines/Quality/Q7/ICH_ Q7-IWG_QA_v5_0_14Apr2015_FINAL_for_publication_17June2015.pdf).
Preferably, other quality guidelines of the same origin will also be taken into account, which can be accessed through the page
http://www.ich.org/products/guidelines/quality/article/quality-guidelines.html, such as Q8, related to Pharmaceutical Development, or Q10, about the Pharmaceutical Quality System.
After formulation, the solutions are preferably administered in a form compatible with the dosage formulation and in such an amount that is therapeutically effective. The formulations can be easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. For parenteral administration in an aqueous solution, for example, the solution is usually buffered properly and the liquid diluent must first be made isotonic for example, with sufficient saline or glucose. Such aqueous solutions can be used, for example, for administration.
5
10
fifteen
twenty
25
30
intravenous, intramuscular, subcutaneous and intraperitoneal. Preferably, sterile aqueous media are employed, as is known to those skilled in the art, selected particularly in light of the present disclosure. By way of illustration, a single dose can be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of hypodermoclysis fluid or injected at the proposed infusion site, (see for example, "Remington Pharmaceutical Sciences" 15th edition, pages 1035-1038 and 1570 to 1580). Some variations in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration, in any case, will determine the appropriate dose for the individual subject. On the other hand, for human administration, the preparations must meet the biological standards of sterility, pyrogenicity, general safety and purity as required, for example, the ICH Quality Guidelines mentioned above or FDA regulations.
The invention will now be illustrated in more detail with the aid of the Examples and Figures shown below.
Examples
The tests described in the Examples presented below were carried out with the following materials and methodologies:
- Drosophila stock
The MHC-Gal4 fly line of the Drosophila melanogaster species expresses the yeast Gal4 transcription factor with the expression pattern of the Drosophila myosin heavy chain gene; therefore, it is expressed throughout the insect's musculature, including the somatic or skeletal, visceral or smooth muscles, the pharynx muscles and the dorsal vessel or heart, among others. They can be purchased from centralized repositories ( http://flystocks.bio.indiana.edu/) paying a fee to contribute to its maintenance. The lines with miRNA sponges (UAS-miR-SP) for the miRNAs of Drosophila dme-miR-92a, dme-miR-100, dme-miR-124, dme-miR-277, dme-miR-304 and against a Random sequence as a negative control (known by the English term scrambled-SP, the control) were obtained from Dr. T. Fulga (Fulga et al., 2015). Briefly, the miR-SP constructs were designed with a mute cassette of 20 repetitive sequences complementary to the miRNAs separated by four nucleotide variable linker sequences (miR-92SP: SEQ ID NO: 62; miR-100SP: SEQ ID NO: 63; miR-124SP: SEQ ID NO: 64; miR-277SP: SEQ ID NO: 65; miR-304SP: SEQ ID NO: 66). The MHC-Gal4 UAS-i (CTG) 480 recombinant line was
generated as described by Llamusi et al. (Llamusi et al., 2013). The construction and characteristics of the UAS-mblC and UAS-IR-mbl fly lines have been previously described (Garcia-Casado et al., 2002; Llamusi et al., 2013, respectively): UAS-mblC is a transgene that expresses the mblC isoform (described in accession number 5 NM_176210) of muscleblind under the control of the Gal4 / UAS system, while UAS-IR-
mbl is a transgene that expresses an interfering construction to silence all the transcripts generated by alternative splicing from the muscleblind gene and that in previous tests it has been seen that it is able to reduce mbl expression to at least 50% of its normal values. All crosses were made at 25 ° C with standard 10 feed for flies.
-RNA Extraction, RT-PCR and qRT-PCR
For each biological replicate, the total RNA of 10 adult males was extracted using Trizol (Sigma). An RNA microgram was digested with DNase I (Invitrogen) and re-transcribed using SuperScript II (Invitrogen) using random hexanucleotides according to the manufacturer's recommendations. 20 ng of cDNA was used in a standard PCR reaction with Go taq polymerase (Promega) and specific primers to analyze splicing of exon 16 'of the Fhos gene and exons 3-5 of Tnt gene. As an endogenous control, Rp49 was used using 0.2 ng of cDNA. The qRT-PCR was carried out from 2 ng cDNA template with SYBR Green PCR Master Mix (Applied Biosystems) and 20 specific primers (SEQ ID NO: 31 to SEQ ID NO: 50: see Table 1). For the reference gene, Rp49, the qRT-PCR was carried out from 0.2 ng of cDNA. The thermal cycle was carried out in Step One Plus Real Time PCR system (Applied Biosystems) according to standard conditions. In each experiment, three biological and three technical replicas were carried out. The relative expression data regarding the endogenous gene and the control group were obtained by the 2 "AACt method. The pairs of samples were compared by the two-tailed t test (a = 0.05), applying the Welch correction when necessary.
Table 1: RT-qPCR expression in Drosophila melanogaster
 Primer  Sequence (5 ’^ 3’) SEQ ID NO:
 mbl fwd  TT GAATCAAAATT AT AGCCCAAGCT 31
 mbl rev  CGATTTTGCTCGTTAGCGTTT 32
 mblA fwd  CAGACACCGAAAT ACT CT CT ACAAACA 33
 mblA rev  AAAATCAGGAGTAAACAAATACACGTAGAC 34
 mblB fwd  CACACAT CCAGAT AT GCT ACTT ACCA 35
 mblB rev  T GAGCGATTTCGATT GATTTT G 36
 mblC fwd  CAGCAAACACACAT CACCTACCA 37
 mblC rev  CTATCGAGCAGGAGGATGAAGAG 38
 mblD fwd  GCCTCTG GAAAAT GCTG CAA 39
 mblD rev  CAGCAACCGCAAAAGAGCTT 40
 Serca fwd  GCAGAT GTTCCT GAT GTCG 41
 Serca rev  CGTCCT CCTT CACATT CAC 42
 Cyp6w1 fwd  TTGCGCACAAAAATCTCTCC 43
 Cyp6w1 rev  GTCCTGCAAGTT CTTTCCAA 44
 Rp49 fwd  GGATCGAT ATGCT AAGCT GT CGCACA 45
 Rp49 rev  GGTGCGCTTGTTCGATCCGTAACC 46
 Fhos fwd  GT CAT GGAGT CGAGCAGT GA 47
 Fhos rev  TGTGATGCGGGTATCTACGA 48
 Tnt fwd  CGACGAT GAAGAGT ACAC 49
 Tnt rev  ACTCGGT GAT GT ATT CTTT CAG 50
-Western Blot
For total protein extraction, 20 female thorax were homogenized in RIPA buffer (150 mM NaCl, 1.0% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-5 HCl pH 8.0) plus protease and phosphatase inhibitor cocktails (Roche Applied Science). Total proteins were quantified with the BCA protein assay kit (Pierce) using bovine serum albumin as standard. 20 pg of the samples were denatured for 5 min at 100 ° C, resolved in 12% SDS-PAGE gels and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skimmed milk powder in PBS-T (8 mM Na2HPO4, 150 mM NaCl, 2 mM KH2PO4, 3 mM KCl, 0.05% Tween 20, pH 7.4) and performed
5
10
fifteen
twenty
25
30
35
immunodetection on them following standard procedures. For the detection of Drosophila Mbl protein, the anti-Mbl antibody (Houseley et al, 2005) was pre-absorbed against wild-type embryos in the early stage (0-6 h after laying) to eliminate non-specific antibody binding. The membranes were incubated with the pre-absorbed primary antibody (overnight, 1: 1000) followed by the secondary anti-sheep IgG antibody conjugated to horseradish peroxidase (HRP) (1 h, 1: 5000, Sigma-Aldrich) . Load control was performed with an anti-tubulin antibody (overnight incubation, 1: 5000, Sigma-Aldrich) followed by incubation with a secondary anti-mouse IgG antibody conjugated to HRP (1 h, 1: 3000, Sigma-Aldrich). Bands were detected using the substrate for Western Blotting ECL (Pierce). The images were taken with an ImageQuant LAS 4000 (GE Healthcare).
-Histological analysis
Immunofluorescence detection of Muscleblind in fly muscle and analysis of the muscular area in the thorax of Drosophila were performed as previously described (Llamusi et al., 2013). For the immunodetection of Mbl, fly chest cryosections were used that were incubated 30 min with blocking solution and overnight at 4 ° C with anti-Mbl antibody at a 1: 500 dilution. The next day the excess antibody was washed with PBS-T and incubated 45 min with secondary antibody against biotin-conjugated sheep IG at a 1: 200 dilution. After washing the secondary antibody, it was incubated with ABC solution (VECTASTAIN ABC kit) 30 min, excess reagent was washed and incubated 45 min with streptavidin conjugated with the final fluorophore at 1: 1000. The preparations were mounted in mounting medium with DAPI.
Muscle area was determined from chest sections embedded in the epoxy resin. Briefly, we place the thorax in a tube with 200 μl of solution 1 (% paraformaldehyde 4%,% glutaraldehyde 8%,% Na2HPO4 0.2 M and% NaH2PO4 0.2 M) on ice. Then, 200 µl of solution 2 (mixture 1: 1 solution 1 and osmium tetraoxide) was added and incubated 30 min on ice. The mixture was then replaced with 200 µl of solution 2 and incubated on ice for 1-2 h. After fixation, the samples were dehydrated by 5 min passes in 30% ethanol, 50% and 70% on ice, and 90% and 100% (2X) at room temperature. Then, two 10 min passes in propylene oxide were carried out. Finally, the samples were left overnight in a 1: 1 mixture of propylene oxide and epoxy resin. The next day, the liquid was replaced by pure epoxy resin, and this was allowed to penetrate the samples for at least 4 h. After this time, the flies were placed and oriented in molds with resin and allowed to polymerize overnight in a Pasteur oven at 70 ° C. The
5
10
fifteen
twenty
25
30
Samples were cut with a diamond blade in 1.5 pm cross sections in an ultramicrotome. Sections were placed in gelatinized slides with a drop of DPX mounting medium and covered with a coverslip for later observation under an optical microscope.
-Foci detection
The thorax of the flies to be analyzed were fixed overnight in 4% paraformaldehyde in PBS at 4 ° C, then kept in a 30% sucrose solution in PBS for 2 days. After 2 days, the thorax were embedded in OCT and frozen in liquid nitrogen and kept at -80 ° C until processed, at which time cross sections of 15 pm were obtained with the Leica CM 1510S cryomicrotome. The slides with the chest cuts were washed three times with 1X PBS (5 min) and the acetylation buffer was added. After 10 min with this, they were washed three times (5 min) with 1X PBS and prehybridized for 30 min with hybridization solution (10 ml deionized formamide, 12 pl of 5M NaCl, 400 pl of 1M Tris-HCl pH = 8, 20 pl 0.5M EDTA pH = 8.2 g Dextran sulfate, 400 pl Denhart's 50X solution, 1 ml herring sperm (10 mg / m), H2O to a final volume of 20 ml The labeled probe (Cy3-5 'CAGCAGCAGCAGCAGCAGCA3'-Cy3: SEQ ID NO: 61, Sigma) after heating at 65 ° C for 5 min was added to slides dissolved in hybridization buffer (1/100) and allowed to hybridize at 37 ° C overnight in a damp and dark chamber The next day it was washed with SSC2X keeping the preparations at 32 ° C (2 x 15 min) and 3 x 5 min washed with PBS.The slides were finally mounted with Vectastain and photographs were taken using a confocal microscope FLUOVIEW FV1000 with the objective of 40X.
-Drosophila survival rate analysis
A total of 120 newborn flies were collected with the appropriate genotypes and kept at 29 ° C. The flies were transferred to fresh fresh nutritional media every two days and the number of deaths was counted daily. Survival curves were obtained using the Kaplan-Meier method and the statistical analysis was performed with a log-rank test (Mantel-Cox) (a = 0.05) using GraphPad Prism5 software.
-Functional tests
Flight tests were performed on day 5 as described by Babcok et al. (Babcock et al., 2014) using 100 male flies per group. The test consists of throwing a group of flies, through a funnel, to a cylinder of approximately one
5
10
fifteen
twenty
25
30
meter high and 15 cm in diameter. Said cylinder is covered by a sheet of
plastic impregnated with a glue so that flies fly well and
they remain in the air in the high part of the cylinder, and they remain stuck there, or they fall to the lower part of the cylinder and remain stuck if they fly poorly. Landing height was compared between the groups using the two-tailed t test (a = 0.05). To evaluate the speed of ascension groups of ten males of 5 days of age are
transferred to disposable pipettes (1.5 cm in diameter and 25 cm high) after
A 24-hour period without anesthesia. The height reached by each fly from the bottom of the vial in a period of 10 s was recorded with a camera. For each genotype two groups of 30 flies were tested. For the comparison of pairs of samples, the two-tailed t test (a = 0.05) was used, applying Welch correction when necessary.
-Screening based on mimetic microRNA libraries (SureFIND Transcriptome PCR Array, Qiagen)
In this study, the "Cancer miRNA SureFind Transcriptome PCR Array '(Qiagen) kit was used to identify possible regulatory miRNAs of MBNL1 and 2. The multiplex qPCR assay was carried out using commercial Taqman probes (QuantiFast Probe PCR Kits, Qiagen ) to quantify the expression of MBNL1 and 2 (genes of interest, labeled with the FAM fluorescent marker: fluorescein, from ThermoFisher) and GAPDH (as an endogenous gene, labeled with the fluorophore known as MAX or Fluoro-Max, also from ThermoFisher). Changes in the expression of MBNL1 and 2 as a result of treatment with each specific mimetic microRNA were calculated with respect to the mimetic negative control (a microRNA not existing in nature) and normalized with respect to GAPDH.The observed changes were represented in the form of log2 and undergoing AACt statistical analysis (MAD) for the selection of positive candidate miRNAs.
-Validation test
HeLa cells were grown at 37 ° C in DMEM culture medium with 1000 mg / L glucose (Sigma-Aldrich), supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (Sigma-Aldrich). The cells were seeded at a density of 4 x 105 cells / well in a volume of 2 ml of medium in 6-well plate. After 16 hours and with 80% confluence cells, they were transfected with the vector using X-tremeGENE HP Reagent (Roche) according to the manufacturer's instructions for use in HeLa cells.
5
10
fifteen
twenty
25
30
35
HeLa cells were transfected with 2 pg of each of the versions of the vector for expression of microRNAs: a vector derived from the commercial plasmid pCMV-MIR (OriGene) containing, in each case, either the coding sequence of the individual precursor of one of the 5 microRNAs (hsa-miR-7, insert sequence: SEQ ID NO: 5, hsa-miR-23b SEQ ID NO: 6, hsa-miR-146b: SEQ ID NO: 7; hsa-miR-218: SEQ ID NO: 8 and hsa-miR-372: SEQ ID NO: 9) operatively linked to and, therefore, under the control of the CMV promoter of the original vector, or its empty version, without precursor sequence of microRNA.
RNA from these cells was extracted 48 hours post-transfection with the plasmids, using Trizol (Sigma). An RNA microgram was digested with DNase I (Invitrogen) and re-transcribed with SuperScript II (Invitrogen) using random hexamers. The concentration of each RNA sample was determined with the NanoDrop-1000 spectrophotometer (Thermo Scientific, Waltham, MA). The quantification of the expression of MBNL1 and 2 at the transcript level using qPCR was carried out from 10 ng of cDNA with commercial Taqman probes (QuantiFast Probe PCR Kits, Qiagen), following the manufacturer's instructions as in the previous section. .
The total protein used in the Western blot assays was extracted at 72 hours post-transfection using RIPA buffer (150 mM NaCl, 1.0% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS , 50 mM Tris-HCl pH 8.0), plus protease and phosphatase inhibitors (Roche Applied Science). The samples were quantified using the BCA protein test kit (Pierce). 20 ng of the samples were denatured for 5 min at 100 ° C and used to load the SDS-PAGE gels (12% acrylamide), where the proteins were separated, by means of the Mini-protean Electrophoresis System (Bio-Rad). The immobilization of nitrocellulose membrane proteins (GE Healthcare) was carried out by electrotransfer in the Trans-blot SD semi-dry transfer cell (Bio-Rad) system. The transfer was carried out at constant voltage (15 V) for one hour. After electrophoresis, the membranes were equilibrated in PBST and blocked for 1 h in blocking solution (5% skim milk in PBST). These membranes were subsequently incubated with the primary anti-MBNL1 and anti-MBNL2 antibody (overnight, 1: 1000, Abcam), after washing with PBST 3 times, the secondary antibody indicated anti-mouse-HRP and anti-rabbit was added -HRP respectively (1 h, 1: 5000, Sigma-Aldrich). As a load control, anti-p-actin was used (overnight, 1: 5000, Sigma-Aldrich), followed by the relevant washes and secondary antibody, which in this case was anti-mouse-HRP (1 h, 1: 5000, Sigma-Aldrich). Chemiluminescent detection was performed using the Western Blotting Substrate ECL (Pierce). The
5
10
fifteen
twenty
25
30
35
Images were obtained using the ImageQuant LAS 4000 documentation system (GE Healthcare Australia Pty Ltd, Rydalmere, NSW, Australia).
-Test of validation of the activity of candidate miRNAs on the 3 ’UTR region (dual luciferase kit)
HeLa cells were grown at 37 ° C in DMEM culture medium with 1000 mg / L glucose (Sigma-Aldrich), supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (P / S; Sigma-Aldrich). The cells were seeded at a density of 1 x 105 cells / well in a volume of 0.5 ml of medium in 24-well plate. After 16 hours and with 80% confluence cells, they were co-transfected with the aforementioned microRNAs, expressing themselves from the corresponding derivative of the vector pCMV-MIR (OriGene), together with the vector pEZX-MT05 that carried the 3'UTR region of both MBNL1 and 2 genes (GeneCopoeia) using X-tremeGENE HP reagent (Roche) according to the manufacturer's indications for use in HeLa cells. The sequences of the part corresponding to the 3 'UTR, of the corresponding fragments inserted in each case in the vector pEZX-MT05 are indicated in SEQ ID NO: 51 (3' UTR region of the MBNL1 gene: product number HmiT011084-MT05) and SEQ ID NO: 54 (3 'UTR region of the MBNL2 gene: product number HmiT000192-MT05).
For all miRNAs that were positive for the first activity study, three types of constructions were tested: the wild-type (WT) constructions that carry the 3'UTR of MBNL1 and 2 already tested previously, and two new constructions: mutated constructs (MUT) that were designed with a deletion (that of the sequence complementary to the seed region, or "seed region": 6, 7 or 8 nucleotides normally) on the predicted target of the microRNA, in order to prevent binding from microRNA to 3 'UTR and constructions with perfect complementary target (PM). All these constructions were synthesized by the GeneCopoeia company, following the orders of the present inventors. The parts corresponding to the 3 'modified UTRs are indicated in SEQ ID NO: 52 (construct with deletion in the miR-23b junction zone to the 3'UTR of MBNL1: MUT-miR-23b), SEQ ID NO: 53 (construct with perfect complementarity in the miR-23b junction zone to the 3'UTR of MBNL1: PM-miR-23b), SEQ ID NO: 55 (deletion construct in the miR-23b junction zone to the 3'UTR of MBNL2: MUT-miR-23b), SEQ ID NO: 56 (construct with perfect complementarity in the junction zone to miR-23b to the 3'UTR of MBNL2: PM-miR-23b), SEQ ID NO : 57, SEQ ID NO: 58, SEQ ID NO: 59 (construction with deletion in the first, second or third junction zones, respectively, of miR-218 to 3'UTR of MBNL2: MUT1-miR-218, MUT2 -miR- 218, MUT3-miR-218) and SEQ ID NO: 60 (construct with perfect complementarity in
5
10
fifteen
twenty
25
30
the 3 junction zones of miR-218 to the 3’UTR of MBNL2: PM-miR-218).
In all these constructions that carry the 3'UTR (WT, MUT, PM) for both genes, it is located downstream of a reporter gene that expresses Gaussia luciferase (Gluc) that is secreted into the environment. Both sequences, the one corresponding to the luciferase and the one corresponding to the 3 ’UTR region, are transcribed together under the SV40 promoter in mammalian cell expression, giving rise to a chimeric mRNA. In addition, this vector (pEZX-MT05) has another reporter that is also secreted to the environment and constitutive expression, alkaline phosphatase (SEAP), which is expressed under the control of the CMV promoter and serves as an internal control for the normalization of readings obtained for Gaussia luciferase.
The reading of these experiments was carried out using Secrete-Pair ™ Gaussia Luciferase Dual Luminescence Assay Kits (GeneCopoeia), following the instructions marked by the manufacturer, in 96-well white plate format that was introduced into the plate reader (Infinite 200 PRO Microplate Reader, Tecan). Three technical replications were made in each of the three constructions studied in each of the three independent experiments.
-Expression of candidate miRNAs in relevant tissues
Total RNA extraction enriched with small RNAs, from mouse tissues (forebrain, cerebellum, hippocampus, heart, gastrocnemius and quadriceps), human muscle biopsies and human fibroblast cultures, was performed using the miRNeasy kit from Qiagen. From 10 ng of total RNA the fraction of miRNAs was re-transcribed with the Exiqon Universal cDNA synthesis II kit. For the qRT-PCR, 1/80 dilutions of the cDNA were made, of which 4 ml were used per technical replication. The qRT-PCR amplification of the miRNAs was performed with commercial primers specific for each miRNA (EXIQON) and the SyBR Green mastermix Universal RT. Expression differences were calculated using the 2-AACt method.
-Transfection test with antagomiRs
Healthy control fibroblasts were grown by growing them in Dulbecco's Modified Eagle Medium-high glucose (DMEM 4500 mg / l, Gibco) supplemented with 1% P / S and 10% inactivated bovine fetal serum, in cell culture bottles.
The cells for this assay were seeded at a density of 105 cels / ml in 96-well plates (10,000 cells per well). After about 16 hours after planting the cells and with them at 80% confluence, transfection was carried out
5
10
fifteen
twenty
25
30
35
of these cells with the antagomiRs whose synthesis was entrusted to Creative Biogene (core nucleotide sequence of the antagomiR-23b-3p: GGUAAUCCCUGGCAAUGUGAU (SEQ ID NO: 2), and of the antagomiR-218-5p: ACAUGGUUAGAUCAAGCACAA (SEQ ID NO: 1) using X-tremeGENE HP reagent (Roche) according to the manufacturer's instructions for use in fibroblasts, instructions on which minor modifications were made, since a smaller volume of transfection reagent (0.5 pl and 1 pl) of the recommended by the manufacturer, since antagomiRs carry a special chemistry incorporating cholesterol in their structure, which allows them to better cross cell membranes and thus favor the entry of it, not being necessary so much amount of transfection reagent which improves its viability .
Specifically, the antagomiRs used in the present application (antagomiR-218-5p: SEQ ID NO: 10, and antagomiR23b-3p: SEQ ID NO: 11), as reflected in the corresponding Creative Biogen website on synthesis of agomirs and antagomiRs ( http://www.creative-biogene.com/Services/MicroRNA-Agomir-Antagomir-Synthesis- Service.html) differ from the basic oligonucleotide sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2 in that they present the following chemical modifications: 2 phosphorothioate groups at the 5 'end, 4 phosphorothioate groups at the 3' end, 4 cholesterol groups at the 3 'end and 2'-methoxy modifications in the ribose of all nucleotide positions, that is, along of the entire oligonucleotide sequence. The basic oligonucleotide sequences of each of them, SEQ ID NO: 1 and SEQ ID NO: 2, respectively, are complementary to those of the miRNAs that are to be blocked, that is, those of miR-23b-3p, 5 ' - AUCACAUUGCCAGGGAUUACC -3 '(SEQ ID NO: 12), and miR-218, 5'-UUGUGCUUGAUCUAACCAUGU-3' (SEQ ID NO: 13).
Transfection experiments were carried out in fibroblasts from patients. Specifically, in the present trials, skin fibroblasts were used in which they have been transduced with lentiviral vectors a construction that allows the inducible expression, by doxycycline, of MyoD (which allows transdifferentiation into myoblasts), and which are cells immortalized by hTERT expression They come from the laboratory of Dr. Denis Furling, of the Institute of Myology ( http: //www.institut- myologie.org/en/)
Both antagomiRs were transfected into said fibroblasts of patients, using increasing amounts of these: 10 nM, 50 nM, 100 nM, 200 nM. As a control, only transfection reagent was placed but not antagomi®. The transfection medium was left together with the cells for 4 hours and, after this time, the medium was changed to DMEM again. At 48 hours post-transfection, images of the cells were taken
in the microscope with visible light to observe the presence and morphology of the cells, and with fluorescence to observe the distribution and presence of antagomi® since it is marked with the fluorescent marker Cy3 (red).
-Toxicity test in cell culture
5 Healthy control fibroblasts were grown by growing them in Dulbecco's Modified Eagle Medium-high glucose (DMEM 4500 mg / l, Gibco) supplemented with 1% P / S and 10% inactivated bovine fetal serum, in cell culture bottles. Given their adherent growth, to pass these cells they were washed with PBS and trypsinized 2 min at 37 ° C, and then fresh medium was added to inhibit the action of trypsin.
10 Cells for this assay were seeded at a density of 105 cels / ml in 96-well plates (10,000 cells per well). The plate was planted following the template shown in Table 2, in which the numbers of the columns can be found in the last row: in the case of column 1, no cells are seeded, since this column will be the target of the colorimetry analysis. Rows A to D (concentrations 15 underlined) correspond to the antagonism of miRNA 23b-3p, while rows E to H correspond to the antagomiR of miRNA-218 (concentrations in bold):
Table 2: Sowing template for the toxicity test in cell culture
 1 10 50 100 200 500 1000
 TO  white control
 nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 B  white control
 nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 C  white control
 nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 D  white control
 nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 AND  white control nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 F  white control nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 G  white control nM nM nM nM nM nM nM
 1 10 50 100 200 500 1000
 H  white control nM nM nM nM nM nM nM
 1 2 3 4 5 6 7 8 9 10 11 12
5
10
fifteen
twenty
25
30
Both antagomiRs were transfected into fibroblasts of patients, using increasing amounts of these: 1 nM, 10 nM, 50 nM, 100 nM, 200 nM, 500 nM and 1000 nM (1 pM), and as a control only transfection reagent was placed but no antagomiR. The transfection medium was left together with the cells for 4 hours and after this time it was changed by means of transdifferentiation. To transdifferentiate fibroblasts to myoblasts, MyoD expression was induced. For this, the complete medium was replaced by means of muscle differentiation (MDM) consisting of DMEM supplemented with 1% P / S, 2% horse serum (Gibco), 0.1 mg / ml of apotransferrin, 0.01 mg / ml of insulin and 0.02 mg / ml of doxycycline (Sigma) for 60 h.
After 60 hours, the transdifferentiation medium was replaced with 100 μl of fresh medium in all wells of the plate including column 1, and 20 μl of the MTS / PMS solution (Kit CellTiter 96® Aqueous Non-Radioactive Cell Kit) was added Proliferation Assay) to each well and incubated 2 hours at 37 ° C. After the incubation time, the colorimetric test was read on the Infinite 200 PRO Microplate Reader, Tecan plate reader, following the manufacturer's instructions. The data obtained with the reader were processed and analyzed in order to obtain the IC10 (10% inhibitory concentration of the cells) and IC50 (50% inhibitory concentration of the cells) that allow us to know how much of antagomiR we should work with so that it is not toxic in the cellular model.
-Quantitative PCR tests and splicing
Fibroblasts from DM1 patients and healthy controls were cultured in Dulbecco's Modified Eagle Medium-high glucose (DMEM 4500 mg / l, Gibco) supplemented with 1% P / S and 10% inactivated bovine fetal serum, in cell culture bottles. The cells were seeded in 60 mm Petri dishes, at a density of 125,000 cell / plate, putting 10 ml of cells in each well. After about 16 hours after planting the cells and with these at 80% confluence, the cells were transfected with the antagomiRs synthesized by order of the applicants by Creative Biogene (antagomiR-23b-3p and antagomiR-218 ) using X-tremeGENE HP reagent (Roche) according to the manufacturer's instructions for use in fibroblast cells, except that only 5 pl of transfection reagent was added.
Both antagomiRs were transfected into patient fibroblasts, using increasing amounts: 50 nM, 100 nM and 200 nM. As a control, only transfection reagent was placed but not antagomi® in both healthy control cells and fibroblasts.
patient. The transfection medium was left together with the cells for 4 hours and after this time it was changed by means of transdifferentiation (DMEM supplemented with 1% P / S, 2% horse serum (Gibco), 0.1 mg / ml of apotransferrin , 0.01 mg / ml insulin and 0.02 mg / ml doxycycline (Sigma). The fibroblasts were transdifferentiated to myoblasts during two times: 48 hours and 96 hours.
RNA from these cells was extracted at 48 and 96 hours post-transfection with antagomi®, using Trizol (Sigma). An RNA microgram was digested with DNaseI (Invitrogen) and re-transcribed with SuperScript II (Invitrogen) using random hexamers. The concentration of each RNA sample was determined with the NanoDrop-1000 spectrophotometer (Thermo Scientific, Waltham, MA).
The quantification of the expression of MBNL1 and 2 at the transcript level by qPCR was carried out from 10 ng of cDNA with commercial Taqman probes (QuantiFast Probe PCR Kits, Qiagen), to quantify the expression of MBNL1 and 2 (genes from interest, labeled with the FAM fluorescent marker: fluorescein, from ThermoFisher); GAPDH and 15 ACTB (as endogenous genes, labeled with the fluorophore known as MAX or Fluoro-Max and TAMRA respectively, these also from ThermoFisher).
For the amplification of the transcripts by RT-PCR, the GoTaq® DNA Polymerase polymerase (Promega) was used. For this, cDNA obtained as a template from the previous step was used following the manufacturer's conditions. The PCR products were separated on 2.5% agarose gel. The primers used for the analysis of each splicing event studied, the expected pattern in myoblasts of patient DM1, the exon studied and the conditions used are found in the following table:
Table 3: Transcription amplification conditions by RT-PCR in the test of
splicing
 Gen  Sequence of primers (5 ’^ 3’) (F: direct, R: reverse) cDNA (Hl) DM1 myoblast pattern cycles
 GAPDH  F: CATCTTCCAGGAGCGAGATC (SEQ ID NO: 14) 1 29 Endogenous control
 A: GTT CACACCCAT GACGAACAT (SEQ ID NO: 15)
 Gen  Sequence of primers (5 ’^ 3’) (F: direct, R: reverse) cDNA (Hl) DM1 Exon myoblast pattern cycles
 cTNT  F: ATAGAAGAGGTGGTGGAAGAGTAC (SEQ ID NO: 16) 1 27 Inclusion 5
 A: GTCT CAGCCTCTGCTT CAGCAT CC (SEQ ID NO: 17)
 GO  F: TGCTGCTCCTGTCCAAAGAC (SEQ ID NO: 18) 4 30 Exclusion 11
 A: GAAGTGTTGGGGAAAGCTG (SEQ ID NO: 19)
 BIN1  F: CTCAACCAGAACCTCAATGATGTG (SEQ ID NO: 20) 1 30 Exclusion 11
 R: CTGAGATGGGGACTTGGGGAG (SEQ ID NO: 21)
 DMD  F: GTGAGGAAGATCTTCTCAGTCC (SEQ ID NO: 22) 4 30 Exclusion 79
 A: CTCCATCGCTCTGCCCAAATC (SEQ ID NO: 23)
 SERCA1  F: GATGATCTTCAAGCTCCGGGC (SEQ ID NO: 24) 4 30 Exclusion 22
 A: CAGCTCTGCCTGAAGATGTG (SEQ ID NO: 25)
- Example 1. Proof of concept in DM1 models of Drosophila melanogaster.
1.1. Silence of dme-miR-277 or dme-miR-304 causes overexpression of muscleblind in Drosophila muscle
5 The sequestration of Muscleblind in RNA foci and the subsequent loss of protein function is one of the main triggers of the molecular pathology of DM1. In order to identify muscleblind repressing miRNAs, the inventors selected candidate miRNAs and proceeded to block their activity using specific miRNA sponges.
10 Initially they selected dme-miR-92a, dme-miR-100 and miR-dme-124 based on previous data generated by the group of the present inventors and their orthological relationship with human miRNAs; The miRanda algorithm, developed at the Computational Biology Center of Memorial Sloan-Kettering Cancer Center (downloadable 2010 version, among others,) had been used to obtain this data
From the microRNA.org download page:
http://www.microrna.org/microrna/getDownloads.do; manual available at the address: http://cbio.mskcc.org/microrna_data/manual.html). To broaden the search for candidate miRNAs, TargetScan was used, an online software provided by the Whitehead 5 Institute for the prediction of miRNA targets ( www.targetscan.org), to search for miRNA recognition sites in the 3 'UTR region of muscleblind and identified, among others, sites for two miRNAs: dme-miR-277 and dme-miR-304. Table 4 shows the recognition sites of several predicted miRNAs according to different algorithms in the 3'UTR region of muscleblind, as well as the accession number of both their precursor sequences with hairpin loops (codes headed by the abbreviation MI) and of mature miRNAs (codes headed by the abbreviation MIMAT) in the miRBase database ( www.mirbase.org).
Table 4.- Number of recognition sites of several predicted miRNAs according to different algorithms in the 3’UTR region of muscleblind
 miRNA  miRanda TargetScan Isoform of mbl
 dme-miR-92a-3p  - - mblA
 (SEQ ID NO: 26)  - - mblB
 MI0000360  - - mblC
 MIMAT0000334  1 site - mblD
 dme-miR- 100-5p  - - mblA
 (SEQ ID NO: 27)  - - mblB
 MI0000378  - - mblC
 MIMAT0000357  - - mblD
 dme-miR-124-3p  1 site - mblA
 (SEQ ID NO: 28)  - - mblB
 MI0000373  - - mblC
 MIMAT0000351  1 site - mblD
 dme-miR-277-3p  1 site - mblA
 (SEQ ID NO: 29)  2 sites - mblB
 MI0000360  - - mblC
 MIMAT0000338  2 sites 1 mblD site
 dme-miR-304-5p  - - mblA
 (SEQ ID NO: 30)  - - mblB
 MI0000411  1 site - mblC
 MIMAT0000390  - 1 mblD site
5
10
fifteen
twenty
25
30
35
To validate miRNAs that regulate Muscleblind, the expression of the sponge constructs (Fulga et al., 2015), UAS-miR-XSP, was directed to the Drosophila muscles using the Mhc-Gal4 line, abbreviations of the gene promoter elements of the myosin heavy chain ”and the coding region of the Gal4 gene corresponding to the Gal4 yeast transcription activator protein, which is known to act as a transcription activator in different organisms, including Drosophila. In this system, the UAS elements (upstream activation sequence: upstream activation sequence) act as transcription enhancers, since the GAL4 protein specifically binds to them to activate gene transcription, while the fact that the coding region of the Gal4 gene is operatively linked to the endogenous promoter of the Mhc gene directs the expression of miRNAs sponges to the muscle. Muscleblind ions were analyzed by qRT-PCR, using specific primers to amplify a region of exon 2 of muscleblind, which is shared by all the transcription isoforms known to date. As a control, a line with a random sequence (UAS-scrambled-SP) was used.
No significant increase in the level of muscleblind expression was detected in flies expressing miR-92aSP, miR-100SP or miR-124SP under the control of MHC-Gal4. In contrast, levels of muscleblind transcripts increased significantly in flies expressing miR-277SP or miR-304SP in muscle, compared to Scrambled-SP controls (Fig. 1a). Muscleblind RNA levels were 14 times higher when the blocked miRNA was dme-miR-227, while silencing of dme-miR-304 resulted in a 6-fold increase. Therefore, these results demonstrate that silencing of dme-miR-277 or dme-miR-304 causes overexpression of muscleblind.
1.2. dme-miR-277 and dme-miR-304 regulate different isoforms of Muscleblind
The muscleblind gene of Drosophila melanogaster is a large gene, covering more than 110 kb, which results in several different transcripts by alternative splicing (Begeman et al., 1997; Irion et al., 2012). Experimental evidence suggests that muscleblind isoforms are not functionally redundant (Vicente et al., 2007). To determine which muscleblind isoforms are regulated by dme-miR-277 or dme-miR-304, the MiRanda algorithm (Enright et al., 2003) was used to identify recognition sites of dme-miR-277 and dme-miR- 304 in the 3'UTRs region of the muscleblind isoforms (Table 4). It is important to note that MiRanda searches the transcripts of mblA, mblB, mblC and mblD, following the name used by
5
10
fifteen
twenty
25
30
Begemann et al. 1997 in the aforementioned reference, but does not include the recently identified isoforms, mblH, mblH ', mblJ and mblK (Irion et al., 2012).
A potential recognition site of dme-miR-277 was found in the mblA isoform and two in mblB and mblD. The qRT-PCR analyzes determined that the mblB level increased significantly when dme-miR-277 was blocked / depleted. MblD expression levels were reduced in the Mhc-Gal4 miR-277SP flies and no significant differences were detected with respect to mblA when compared to the control flies expressing the Scrambled-SP (Fig. 1b). Interestingly, mblC expression levels, an isoform for which no recognition sites for dme-miR-277 had been predicted, were significantly reduced in Mhc- Gal4 miR-277SP flies.
For dme-miR-304, a recognition site was found in the 3’UTR region of mblC and mblD, and significant upward regulation of the two isoforms was detected in Mhc-Gal4 miR-304SP flies (Fig. 1b). In particular, blocking / depletion of dme-miR-304 in the muscle caused a sharp increase in mblC levels, the most expressed isoform in adult flies (Vicente et al., 2007).
The fact that the silencing of dme-miR-277 and dme-miR-304 causes changes in the specific expression levels of each muscleblind isoform suggests a direct regulation of muscleblind transcripts by these miRNAs.
Given that a miRNA can typically act at the level of mRNA stability or blocking its translation, it was decided to analyze the levels of Muscleblind protein to validate the candidate regulatory miRNAs. With this objective, an anti-Mbl antibody was used to detect the upward regulation of the MblA, MblB and MblC proteins. Western blot analysis revealed an increase in Muscleblind protein levels only in Mhc-Gal4 miR-304SP flies (Fig. 1c). Consistent with the determinations by qRT-PCR, the band detected in the Western blot corresponded to the MblC protein. It should be mentioned that the antibody used has only previously worked in overexpression experiments (Houseley et al., 2005; Vicente-Crespo et al., 2008).
In order to analyze the silencing effect of dme-miR-277 or dme-miR-304, longitudinal sections of the indirect flight muscles (the IFMs) were stained to see the distribution of Muscleblind: the anti-Mbl signal was detected in green, while the nuclei appeared contrasted in blue with DAPI. The group of the present inventors had previously demonstrated that the endogenous Muscleblind protein is located
5
10
fifteen
twenty
25
30
mainly in the sarcomeric bands Z and H of the muscle (Llamusi et al., 2013). In line with this, the confocal images obtained from these sections allowed to detect Muscleblind proteins preferentially in the bands of the muscle sarcomeres in the control flies that expressed the construction of the Scrambled-SP, obtaining a low signal in some nuclei of said cells. Interestingly, the reduction in the function of dme-miR-277 and dme-miR-304 had different effects on protein distribution: while the silencing of dme-miR-277 increased the signal of the cytoplasmic Muscleblind protein, particularly in the Sarcomeric bands, a strong nuclear location was detected in the Mhc-Gal4 miR-304SP flies.
Taken together, these results demonstrate that Muscleblind's endogenous isoforms can be up-regulated by blocking the inhibitory activity of dme-miR-277 and dme-miR-304.
1.3. Decreased function of dme-miR-277 or dme-miR-304 favors the expression of Muscleblind in a DM1 model in Drosophila
Previous DM1 models in Drosophila had ribonuclear foci in muscle cells that contained Muscleblind proteins (Garcia-Lopez et al., 2008; Picchio et al., 2013). To test the specific silencing effect of muscleblind repressor miRNAs in a Drosophila DM1 model, Muscleblind expression was studied in flies expressing 480 interrupted CTG repeats ("i (CTG) 480") with the chain promoter Myosin weighting as a specific determinant conductor of muscle expression with simultaneous expression of sponge constructs (Mhc- Gal4 UAS-i (CTG) 480 UAS-miR-XSP).
Analysis of mbl transcript levels by qRT-PCR showed that silencing of dme-miR-277 or dme-miR-304 resulted in increased muscleblind expression in DM1 model flies (Fig. 2a). It is important to note that the positive regulation of muscleblind was stronger in DM1 model flies than in flies that only expressed sponge constructs (compare Fig. 1a and Fig. 2a). Muscleblind transcript levels were 19 times higher in flies expressing both i (CTG) 480 and miR-277SP and 7 times higher in flies Mhc-Gal4 UAS-i (CTG) 480 UAS-miR-304SP compared to controls On the other hand, in line with the protein analysis performed in the presence of different sponge constructs (Fig. 1c), the silencing of dme-miR-
5
10
fifteen
twenty
25
30
304 caused an increase in MblC protein levels in DM1 model flies (Fig. 2b).
To study the effect of silencing dme-miR-277 or dme-miR-304 on the subcellular location of Muscleblind in model flies of DM1, the distribution of Muscleblind proteins was analyzed by immunodetection in IFMs (Fig. 2c-f). Both the expression of miR-277SP (Fig. 2e) and that of miR-304SP (Fig. 2f) in DM1 model flies freed Muscleblind from ribonuclear foci and increased the level of proteins, both in the nuclei and in the cytoplasm. In the case of model flies expressing miR-277SP, the distribution of Muscleblind in the sarcomeric muscle bands, which is characteristic of control flies that do not express repetitions, was completely rescued. Similarly, the expression of miR-304SP led to a detectable increase in Muscleblind dispersed in nuclei and cytoplasm. Therefore, the silencing of dme-miR-277 or dme-miR-304 upregulates Muscleblind levels and rescues its subcellular distribution in DM1 model fly muscles.
1.4. Dme-miR-304 silencing rescues alterations in splicing and in global levels of gene expression in a DM1 model in Drosophila
Splenic disease is the main biochemical milestone of DM1 and the only one that has been directly linked to symptoms. To test whether the increase in Muscleblind, caused by the silencing of dme-miR-277 or dme-miR-304, was sufficient to rescue splicing alterations in DM1 model flies, characteristically altered splicing events were studied. These events were:
- the exclusion of exon 16 'from the Fhos gene in DM1 model flies, which the present inventors have identified, verifying that it is regulated by Muscleblind;
- the inclusion of exon 13 of the Serca gene, which is a splicing event regulated by Muscleblind.
It was also verified what happened with another molecular function described for mbl: the regulation of global levels of gene expression. Specifically, exon 2 of the CyP6W1 gene was amplified, to check the expression levels of said gene, for which an increase in its expression in DM1 model flies has been described (Picchio et al., 2013).
5
10
fifteen
twenty
25
30
In DM1 model flies, a 2-fold increase in the inclusion of Fhos exon 16 'and a 2.4-fold reduction of Serca transcripts with exon 13 were confirmed, as well as a 3-fold increase in transcribed from CyP6W1, compared to control flies that do not express repetitions.
The expression of miR-304SP in these flies achieved a complete rescue of Fhos '16' exon and the normal expression of the CyP6W1 gene and a significant 20% increase in Serca transcripts that include exon 13 (Fig. 2g-i , l). It is noteworthy that the silencing of dme-miR-304 in the muscle caused a sharp increase in mblC levels (Fig. 2b), an isoform that has previously been shown to act as a regulator of splicing (Vicente et al., 2007) . In contrast, the expression of miR-277SP, which rescued the Muscleblind expression in the cytoplasm, and reduced mblC expression levels, did not modify these splicing events. As a control, it was confirmed that the splicing pattern of exons 3-5 of Tnt, which is not altered in adult flies model of DM1 (Garcia-Lopez et al., 2008), was not modified even by the expression of the constructs sponge or alterations in the expression of muscleblind (Fig. 2j, Fig. 2k).
These results show that the level of muscleblind derepression achieved by miRNAs sponges is sufficient to potentially trigger significant molecular bailouts.
1.5. Silence of dme-miR-277 or dme-miR-304 rescues muscle atrophy and motor function in a DM1 model in Drosophila
To assess the functional relevance of the increase in Muscleblind achieved by the expression of specific sponge constructs, the effect of silencing dme-miR-277 or dme-miR-304 on muscle atrophy was studied, whose alteration is one of the features that characterize individuals with DM1. For the study of muscular atrophy, the muscle area in dorsoventral sections of the MFIs was first measured in the control flies expressing either miR-277SP or miR-304SP in the muscle (Fig. 3a-d). The decrease in the function of dme-miR-277 induced a 15% reduction in the IFM area, compared to flies expressing Scrambled-SP as a control. Importantly, the expression of miR-304SP had no effect on this parameter.
The research group of the present inventors had previously reported the existence of muscular atrophy in flies expressing i (CTG) 480 in the musculature. In these DM1 model flies, we found that tissue specific silencing of
5
10
fifteen
twenty
25
30
35
dme-miR-277 or dme-miR-304 was enough to rescue the percentage of muscle area significantly (Fig. 3e-h). Compared to control flies that did not express CUG repeats, the average area of MFIs in model flies expressing scrambled-SP was significantly reduced to 40%. Simultaneous expression of CUG repeats and any one of miR-277SP or miR-304SP resulted in a 20% increase in muscle area in these flies. In addition, in situ hybridization assays of cross-sections of fly musculature (Fig. 3-k) showed how the expression of miR-277SP (Fig. 3j) and miR-304SP (Fig. 3k) resulted in a significant reduction of a typical histopathological parameter of the disease, the ribonuclear foci of the DM1 model in fly (Fig. 3i), which were practically negligible after miR-304SP expression. These data confirm that upward regulation of different muscleblind isoforms was sufficient to rescue muscle atrophy and the formation of ribonuclear foci in Drosophila.
To assess the correlation between muscle area and locomotive activity, the ability to climb and fly flies of different genotypes was analyzed. The expression of miR-277SP in the muscle resulted in a reduction in the average landing height of about 10% compared to the control flies that expressed scrambled-SP, indicating that the reduction in muscle area that found in these flies has a functional correlation (Fig. 4a). However, muscle atrophy was apparently specific to MFIs, since the rate of surface ascent remained unchanged in these flies (Fig. 4b). On the contrary, the silencing of dme-miR-304 in the muscle did not affect the locomotion activity of the flies (Fig. 4a, b). In DM1 model flies, compared to control flies that did not express repetitions, simultaneous expression of CUG repetitions and scrambled-SP construction resulted in a drastic reduction in average landing height and ascent rate by surfaces (Fig 4e, f). However, the expression of any one of miR-277SP or miR-304SP in model flies resulted in the rescue of all these parameters to similar levels (Fig 4e, f). Therefore, these results demonstrated that the specific silencing of miRNAs that regulate muscleblind can rescue muscular atrophy and the functional phenotype characteristic of DM1.
1.6. Functional depletion of dme-miR-277 or dme-miR-304 extends the survival rate of DM1 model flies
Reduction of muscle function, particularly of the respiratory system, is the leading cause of death in DM1. The group of the present inventors had reported
5
10
fifteen
twenty
25
30
previously that the flies that express i (CTG) 480 in the musculature have a reduced rate and average survival compared to the control flies (Garcia-Lopez et al., 2008). To study whether the silencing of dme-miR-277 or dme-miR-304 rescue the survival rate of DM1 model flies, analyzes of survival curves in flies of different genotypes were carried out. Importantly, the survival curves of flies expressing miR-277SP or miR-304SP in the muscle were not different from those treated as scrambled-SP, indicating that the silencing of dme-miR-277 or dme -miR-304 did not alter the survival rate (Fig. 4c, d). The survival rate of DM1 model flies expressing scrambled-SPs was significantly reduced compared to control flies that did not express CTG repeats (Fig. 4 g, h). The expression of miR-277SP or miR-304SP in model flies increased the survival and average survival rate. Silence of dme-miR-277 increased the average survival by eight days, while a six-day increase was detected for DM1 model flies expressing miR-304SP (Fig. 4 g, h). Therefore, the positive regulation of muscleblind caused by the decreased function of dmemR-277 or dme-miR-304 improves the survival of DM1 model flies.
Taken together, these results demonstrate that the silencing of specific miRNAs in Drosophila causes an increase in muscleblind levels that is sufficient to rescue several molecular and physiological characteristics, including an increase in survival. Therefore, they provide support to consider resorting to the repression of miRNAs by Muscleblind counterparts as a potential strategy for the treatment of DM1 in humans and other mammals.
Therefore, the present inventors went on to identify repressive miRNAs of MBNL1 and / or 2 and, among them, look for those that were expressed in tissues where symptoms of DM1 are manifested and whose blockage is effective to rescue molecular characteristics of DM1 and, with This, improve symptoms of the disease.
- Example 2: Identification, validation and characterization of repressive miRNAs of MBNL1 and / or MBNL2
2.1. Screening for the identification of miRNAs that negatively regulate MBNL1 or MBNL2
An initial screening based on libraries of mimetic miRNAs was started, using the commercial kit SureFIND Transcriptome PCR array, from Qiagen, as described in the previous methodological section. This study allowed the identification
5
10
fifteen
twenty
25
30
initial, in HeLa cells, of 18 miRNAs as potential repressors of MBNL1 and 9 potential microRNAs of MBNL2 repressors in HeLa cells, for showing a repression of the expression of said genes a minimum of 4 times with respect to the control, GAPDH. Four of these miRNAs initially seemed able to inhibit the expression of both.
2.2. Confirmation of the repressive action
Since it was a large number of microRNAs to be validated, the number of microRNAs with which to continue the trials was limited to a total of 6, basing the choice on the number of bioinformatic predictions collected in the mirDIP databases ( https://omictools.com/mirdip-tool) and myRecords ( https://omictools.com/mirecords-tool), which collect information from a total of 9 prediction programs by providing information on the existence of the targets of a particular microRNA in the transcripts of a given gene, suggesting that there is a regulation.
To perform the confirmation tests of the initial results by checking the possible modulation by direct regulation, several miRs were initially selected, including both potential regulators of both genes, as specific repressors of MBNL1 or MBNL2. miR-146b and miR-23b as potential regulators of both MBNL1 and MBNL2; and miR-218 and miR-372 as specific repressors of MBNL2.
The above results were confirmed for some miRNAs, by transfection in HeLa cells of expression plasmids derived from pCMV-MIR (Origene) expressing precursors of the selected miRNAs, together with the empty pCMV-MIR plasmid and miR-7 as controls negative, the latter for not having been identified as an inhibitor of MBNL1 or MBNL2 in the initial screening. The expression of MBNL1 or MBNL2 was then quantified at the mRNA and protein level, as described in the part dedicated to the "Validation assays" in the previous methodological section. The results are shown in Fig. 5 obtained for miR-146b and miR-23b (initially identified as potential regulators of both MBNL1 and MBNL2), as well as for miR-218 and miR-372 (initially identified as specific repressors of MBNL2).
Indeed, it was observed both in the case of MBNL1 (Fig. 5a) and in the case of MBNL2 (Fig. 5b), that the selected microRNAs exerted a repressive effect on the messenger of the genes for which an effect had initially been detected repressor although the repressive effect caused by miR-146b was less pronounced.
5
10
fifteen
twenty
25
30
Regarding protein quantification, a decrease was observed at the level of MBNL1 protein in the case of miR-23b (Fig. 5c), at 72 hours post-transfection, while in the case of MBNL2 (Fig. 5d), this decrease at the protein level occurred with both miR-23b and miR-218 microRNA. The decrease caused by miR-372 was much smaller than with the two previous microRNAs.
Therefore, the data obtained confirmed that miR-23b regulates both MBNL1 and MBNL2 at the protein level, while miR-218 represses MBNL2.
2.3. Identification of the target sequences of miRNAs and demonstration of the functional relevance of the potential miRNA-mRNA interaction
Next, the specific sequences to which the miRNAs have to join to exert their repressive action were identified. This is necessary to design inhibitors of the "blockmiRs" type and to confirm the direct binding of the miRNA to its target, ruling out that the regulation is indirect.
For this, a bioinfomatic prediction of the targets of the preselected miRNAs was performed after screening, using the miRanda and TargetScan applications already used in the tests carried out in Drosophila. Figs. 6A and 6F show a schematic representation, at scale, of the binding sites predicted by the aforementioned programs on the 3’UTR regions of MBNL1 and MBNL2, respectively. In both cases, none of the isoforms of these genes, resulting from alternative splicing, affects the presence in the corresponding transcript of the predicted targets.
To demonstrate the functional relevance of a potential miRNA-mRNA interaction, the use of sensors that demonstrated that, in effect, preselected microRNAs bind to their predicted targets in the 3'UTR of both genes was used. This was experimentally demonstrated by generating a construct in which the 3'UTR ends of MBNL1 or MBNL2 are fused to a luciferase coding sequence as a reporter gene, so that the eventual repressive regulation resulting from overexpressing the miRNA is observed as a reduction in the amount of luciferase detected. Specifically, the methodology detailed in the section "3’UTR binding test (dual luciferase kit)" was used.
As explained in the same methodological section, in this trial, a lower signal of Gaussia luciferase (Gluc) indicates the binding of the microRNA to the 3'UTR, since its binding to the 3'UTR prevents the reporter's translation and therefore a decrease
5
10
fifteen
twenty
25
30
of Gluc released into the medium (see the schemes offered on the specific GeneCopoeia page, http://www.genecopoeia.com/product/mirna-targets/).
Of the readings observed 48 hours after co-transfection of both the plasmid from which the test microRNA is expressed and the pEZX-MT05 vector (which carries the 3'UTR region of both genes, MBNL1 and MBNL2, downstream of the coding sequence of Gaussia luciferase), it was observed that all microRNAs under test, with the exception of miR-146b and the negative control, miR-7, exert a repressive effect on the reporter, from which their specific binding of 3'UTR sequence of its target gene (see Figs 6B and 6E).
Once the previous experiment was carried out, it was verified that the observed union was direct, which indicates a direct regulation of the microRNA on the 3'UTR. For this, additional versions of the construction were designed with the 3'UTR sensor for each candidate miRNA, where the predicted target sequence was mutated (mut) by deletion, and also another version where said predicted target in the 3'UTR had been mutated giving rise to a perfect complementary target (PM) of the corresponding miRNA, perfect target to which microRNAs bind completely and with the greatest efficiency. As explained in the methodological section mentioned above, the binding of the different microRNAs to the 3'UTR mutated and with PM targets was expressed in relative units of Gaussia luciferase, normalized with respect to the internal control of the alkaline phosphatase SEAP (Gluc / SEAP ). These target mutagenesis assays were performed for miR-23b in MBNL1 (Figs. 6C) and for miR-218 and miR-23b in MBNL2 (Figs. 6F and 6G).
In the case of MBNL1, the direct binding of the miR-23b microRNA can be seen from Fig. 6B, because when transfecting HeLa cells with the mutated (mut) versions of the MBNL1 and miR-23b reporter constructions (Fig 6C), said miRNA stopped repressing, observing an increase in luciferase similar to what happens with the control, where the sensor construction is transfected with the empty vector pCMV-MIR. The constructs with the perfect version (PM) of the binding target were also transfected together with the microRNAs, which allows to know how effective is the binding of a microRNA to the natural 3'UTR (WT: wild type) of the gene in question regarding perfect union that we see with the PM. These tests are very useful as they are an important basis in the design of the blockmiRs. In all cases, a decrease in the luciferase signal was observed superior to that observed with the natural target.
In the case of MBNL2, it was demonstrated that there is a direct union of the miR-23b and miR-218 microRNAs, because by transfecting HeLa cells with the constructs with the versions
5
10
fifteen
twenty
25
30
mutated (mut) of the targets together with the different miR-23b microRNAs (Fig 6F), and miR-218 (Fig 6G), the repression of the reporter was lost, again observing an increase in luciferase similar to what occurs with the control, where the sensor construction was transfected with the empty vector pCMV-MIR. Again, the constructs with the perfect version (PM) of the binding target were also transfected with the microRNAs. In both cases, a decrease in the luciferase signal was observed superior to that observed with the natural target.
2.4. Expression of candidate miRNAs in relevant tissues
In addition to checking the repressive capacity, it is important to confirm if the miRNAs on which you want to act are expressed in tissues relevant to the disease (heart, muscle and brain, among others), so that the action on them can have a Palliative effect of disease symptoms associated with these tissues. Therefore, this is important, because if a repressor is identified, but not expressed in the relevant tissues, blocking it will have no effect.
The expression of the candidate miRNAs in human muscle biopsies of healthy individuals and patients of DM1, in cultures of human fibroblasts also from healthy individuals or of patients of DM1 and in mouse tissues (forebrain, cerebellum, hippocampus, was checked) heart, gastrocnemius and quadriceps), as described in the methodological section "Expression of candidate miRNAs in the relevant tissues".
The results obtained in mice (Fig. 7A) were consistent with the previous expression data available to the present inventors, either from public databases or their own data, which indicated that certain miRNAs are expressed in tissues relevant to the disease (heart, muscle, brain). The results obtained with miR-23b and miR-218 are especially relevant, especially with the first one, where the relative expression in all tissues was much higher than that of the miR-146b microRNA and, particularly, that of miR-372, with the one that no expression was detected.
In line with this, the results obtained in muscle biopsies of human individuals (Fig. 7C) show a significant increase in the expression of miR-218 and a clear trend, although not significant with the data of the experiment performed, for miR-23b in the samples of patients with DM1, much higher than that observed for miR-146. Even in trials with human fibroblasts (Fig. 7B), the relative expression of miR-218 is much higher in the case of fibroblasts from
5
10
fifteen
twenty
25
30
of patients with DM1 with respect to fibroblasts of control individuals not suffering from the disease.
- Example 3. Transfection effects of antagomiRs of miR-218 and miR-23b
Taking together the confirmation tests of potential repressor of the expression of mRNAs and proteins, the confirmation of direct action on the mRNAs of MBNL1 and / or MBNL2 and the expression data in different tissues, it was decided to concentrate on designing blockers or inhibitors of miR-23b and miR-218, which were the two microRNAs with more expression in these tissues involved in the pathology.
AntagomiRs inhibitors of oligoribonucleotide nature were chosen, which, as previously explained, are analogs of RNAs with a particular chemistry that make their binding to miRNA more stable, make them less susceptible to degradation and increase their ability to cross cell membranes (It is usual, as in the present case, to include cholesterol).
The supplier of the specific antagomiRs with which the following tests were performed has been: http://www.creative-biogene.com/Services/MicroRNA-Agomir-
Antagomir-Synthesis-Service.html. As previously described, the antagomiRs referred to herein, in abbreviated form, antagomiR-218 (antagomiR-218-5p: SEQ ID NO: 10) and antagomiR-23b (antagomiR-23b-3p: SEQ ID NO: 11), which differ from the basic sequences SEQ ID NO: 1 and SEQ ID NO: 2 (complementary, respectively, of the human microRNAs miR-218-5p and miR-23b- 5p) in the detailed modifications in the sequence listing and the methodological section "Transfection test with antagomiRs".
3.1. AntagomiRs transfection assays
As described in this section, a transfection test of fibroblasts of patients with DM1 with increasing concentrations (10 nM, 50 nM, 100 nM) of each of the antagomiRs, labeled with the Cy3 fluorophore, (which emits one red signal) and two different concentrations of the XtremGene transfection reagent (0.5 pl and 1 pl).
This fibroblast transfection test experiment was performed with the purpose of determining the threshold concentration at which the antagonism inside the cells is detectable, as well as the amount of transfection reagent to be used, trying to use the minimum possible amount , because said reagent is highly toxic to human fibroblasts.
Due to the presence of Cy3 in its structure, when antagomi® enters the cells they look red under a fluorescence microscope, which indicates the presence of antagomi®.
At the concentration of 10 nM, only a red signal was detected, which indicated that the presence of any of the antagonists was scarce in the cells, with concentrations of 50 nM or higher being necessary for the signals to be intense. Therefore, they are the ones that were used in the subsequent tests carried out with antagomiRs.
3.2. Toxicity tests
A first approach was to perform a dose-response cellular toxicity test 10 to establish at what concentration threshold of antagomiR these began to be toxic for their work in cells, since whenever working with compounds in a cellular model it is convenient to work at a concentration lower than IC10.
Toxicity profiles of both antagomiRs were obtained in healthy human myoblasts at 60 h of their addition to the medium (Fig. 8a), as described in section 15 "Cell culture toxicity test." The colorimetric assay performed allowed a rapid and sensitive quantification of cell proliferation and viability, with the addition of increasing concentrations of antagomi R. With the data obtained, the IC10 was calculated (which shows the concentration at which 10% of the cells have died due to the toxicity associated with compound) and the IC50 (which is the concentration at which 50% of the 20 cells have died due to toxicity.) The values obtained were:
 antagomiR-23b antagomiR-218
 IC10  654.7 nM 347.0 nM
 IC50  32281 nM 1968 nM
The value of the Z factor was also calculated, as a positive Z factor indicates that the toxicity test is being carried out properly. In this case it was: 0.46.
Once the study was carried out, it was decided to continue with three concentrations (50 nM, 100 nM and 200 nM) with which to carry out the following tests, since these are 25 concentrations below the IC10.
3.3. Dose response trials of antagomiRs in cells of patients with DM1
With the above-mentioned concentrations, transfection tests of fibroblasts transdifferentiated to myoblasts of patients with DM1 were performed, with the antagomiR-23 or the antagomiR-218, as described in the methodological section of "Trials of
splicing ”and began performing quantification assays of the MBNL1 and MBNL2 RNA. As can be seen in Fig. 9, it was observed that both antagomiR miR-23b and antagomiR miR-218 increased the expression of MBNL1 and MBNL2 at the mRNA level by qPCR and that this increase responds to the dose of antagomiR (by 5 transfection). This was done at 48 and 96 h.
It was also verified whether the rescue of some alternative splicing events typically altered in DM1, in myoblasts of patients, in the presence of antagomiR23b or antagomiR218 could be achieved, following the methodology described in the section "Splicing assays." These experiments were performed 48 h (Figs. 10A, C, D, E, F, G) and 10 96 h (Figs. 10 B, H, I, J, K, L) after transfection of antagomi®.
As can be seen in these figures, treatment of DM1 cells with antagomi® improved the inclusion of exon 11 of BIN1 with both antagomi®, at all concentrations and at two times after transfection.
The treatment with antagomi® increases the inclusion percentage of exon 79 of 15 DMD as it is reflected in the gel (upper band), with both antagonists and at all concentrations in the 48 h test. In contrast, in the 96-hour trial, no change was observed in aberrant DMD splicing.
In the trial conducted at 48 h, no change was observed with the antagomi® at any concentration on the aberrant splicing of SERCA1, while in the 20 hr trial of 96 h the treatment with both antagomiRs and at all concentrations leads to an increase of the inclusion percentage of exon 22 of SERCA1; this increase was noticeably more visible with the antagomiR-23b.
The test at 48 h after transfection did not give rise to any change on aberrant IR splicing. The inclusion of IR exon 11 only improved in a manner similar to what is seen in the case of healthy myoblasts at the lower concentration of antagomiR-23b (50 nM) at 96 h and the highest concentration of antagomiR-218 ( 200 nM).
No change was observed with antagomiRs at any concentration on aberrant cTNT splicing.
Bibliographic references
Altschul, S.F. et al. Basic local alignment search tool. J. Mol. Biol., 215: 403-410 (1990)
Babcock, D. T. & Ganetzky, B. An improved method for accurate and rapid measurement of flight performance in Drosophila. J Vis Exp, e51223, doi: 10.3791 / 51223 (2014)
Batra, R. et al. Loss of MBNL leads to disruption of developmentally regulated alternative polyadenylation in RNA-mediated disease. Mol Cell 56, 311-322,
doi: 10.1016 / j.molcel. 2014.08.027 (2014)
Begemann, G. et al. muscleblind, a gene required for photoreceptor differentiation in Drosophila, encoders novel nuclear Cys3His-type zinc-finger-containing proteins. Development 124, 4321-4331 (1997)
Chamberlain, C. M. & Ranum, L. P. Mouse model of muscleblind-like 1 overexpression: skeletal muscle effects and therapeutic promise. Hum Mol Genet 21, 4645-4654, doi: 10.1093 / hmg / dds306 (2012)
Davis, B. M., McCurrach, M. E., Taneja, K. L., Singer, R. H. & Housman, D. E. Expansion of a CUG trinucleotide repeat in the 3 'untranslated region of myotonic dystrophy protein kinase transcripts results in nuclear retention of transcripts. Proc Natl Acad Sci U S 94, 7388-7393 (1997)
Dixon, D.M. et al. Loss of muscleblind-like 1 results in cardiac pathology and persistence of embryonic splice isoforms. Sci Rep 5, 9042, doi: 10.1038 / srep09042 (2015).
Du, H. et al. Aberrant alternative splicing and extracellular matrix gene expression in mouse models of myotonic dystrophy. Nat Struct Mol Biol 17, 187-193, doi: 10.1038 / nsmb. 1720 (2010)
Enright, A. J. et al. MicroRNA targets in Drosophila. Genome Biol 5, R1, doi: 10.1186 / gb- 2003-5-l-rl (2003)
Fernandez-Costa, J. M. et al. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biol. Rev. Camb. Philos Soc. 86 (4), 947-58, (2011).
Fulga, T. A. et al. A transgenic resource for conditional competitive inhibition of conserved Drosophila microRNAs. Nat Commun 6, 7279, doi: 10.1038 / ncomms8279 (2015)
Gagno n, C. et al. Towards an integrative approach to the management of myotonic dystrophy type 1. Journal of Neurology, Neurosurgery & Psychiatry 78, 800-806 (2007)
Garcia-Casado, M. Z., Artero, R. D., Paricio, N., Terol, J. & Perez-Alonso, M. Generation of GAL4-responsive muscleblind constructs. Genesis 34, 111-114,
doi: 10.1002 / gene. 10147 (2002)
Garcia-Lopez, A. et al. Genetic and chemical modifiers of a CUG toxicity model in Drosophila. PLoS One 3, e1595, doi: 10.1371 / journal.pone.0001595 (2008)
Harper, P. Myotonic dystrophy. (Saunders, 2001)
Houseley, J. M. et al. Myotonic dystrophy associated expanded CUG repeat muscleblind positive ribonuclear foci are not toxic to Drosophila. Hum Mol Genet 14, 873-883, doi: 10.1093 / hmg / ddi080 (2005)
Huin, V. et al. MBNL1 gene variants as modifiers of disease severity in myotonic dystrophy type 1. J Neurol 260, 998-1003, doi: 10.1007 / s00415-012-6740-y (2013)
Irion, U. Drosophila muscleblind codes for proteins with one and two tandem zinc finger motifs. PLoS One 7, e34248, doi: 10.1371 / journal.pone.0034248 (2012)
Kalsotra, A., et al .. The Mef2 transcription network is disrupted in myotonic dystrophy heart tissue, dramatically altering miRNA and mRNA expression. Cell Rep. 6 (2): 336-345. (2014). doi: 10.1016 / j.celrep. 2013.12.025. Epub 2014 Jan 9 Kanadia, R. N. et al. A muscleblind knockout model for myotonic dystrophy. Science 302, 1978-1980, doi: 10.1126 / science. 1088583 (2003)
Kanadia, R.N. et al. Reversal of RNA missplicing and myotonia after muscleblind overexpression in a mouse poly (CUG) model for myotonic dystrophy. Proc Natl Acad Sci U S A 103, 11748-11753, doi: 10.1073 / pnas. 0604970103 (2006)
Kino, Y. et al. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Hum Mol Genet 24, 740-756, doi: 10.1093 / hmg / ddu492 (2015)
Klein, A.F., et al .. Therapeutic Approaches for Dominant Muscle Diseases: Highlight on Myotonic Dystrophy. Curr. Gene Ther. 15 (4), 329-337 (2015).
Kole, R., et al. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nature Reviews 11, 125-140 (2012)
Landford, R. E., et al. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science 327 (5962): 198-201 (2010).
Doi: 10.1126 / science. 1178178
Lee, K. Y. et al. Compound loss of muscleblind-like function in myotonic dystrophy. EMBO Mol Med 5, 1887-1900, doi: 10.1002 / emmm.201303275 (2013)
Lin, X. et al. Failure of MBNL1-dependent post-natal splicing transitions in myotonic dystrophy. Hum Mol Genet 15, 2087-2097, doi: 10.1093 / hmg / ddl132 (2006)
Llamusi, B. et al. Muscleblind, BSF and TBPH are mislocalized in the muscle sarcomere of a Drosophila myotonic dystrophy model. Dis Model Mech 6, 184-196,
doi: 10.1242 / dmm.009563 (2013)
Needleman, S.B., Wunsch, C.D. A general method applicable to the search for similarities in the amino acid sequence of two proteins., J. Mol. Biol. 48: 443-453 (1970)
Pascual, M., et al., The Muscleblind family of proteins: an emerging class of regulators of developmentally programmed alternative splicing. Differentiation 4 (2-3): 65-80 (2006). Pearson, W.R., Lipman, D.J. Improved tools for biological sequence comparison. Proc. Natl Acad. Sci. U.S.A. 85: 2444-2448 (1988)
Picchio, L., Plantie, E., Renaud, Y., Poovthumkadavil, P. & Jagla, K. Novel Drosophila model of myotonic dystrophy type 1: phenotypic characterization and genome-wide view of altered gene expression. Hum Mol Genet 22, 2795-2810, doi: 10.1093 / hmg / ddt127 (2013)
Rottiers, V. et al. Pharmacological inhibition of a microRNA family in non-human primates by a seed-targeting 8-mer antimiR. Sci Transl Med. 5 (212), 212ra162, doi: 10.1126 / scitranslmed.3006840 (2013)
Smith, T.F., Waterman, M.S. Comparison of biosequences. Adv. Appl. Math 2: 482 (1981);
Terenzi, F. & Ladd, A. N. Conserved developmental alternative splicing of muscleblind-like (MBNL) transcripts regulates MBNL localization and activity. RNA Biol 7, 43-55 (2010) Thornton, C. A. Myotonic dystrophy. Neurol Clin 32, 705-719, viii,
doi: 10.1016 / j.ncl. 2014.04.011 (2014)
Vicente, M., et al. Muscleblind isoforms are functionally distinct and regulate alpha-actinin splicing. Differentiation 75, 427-440, doi: 10,1111 / j.1432-0436.2006.00156.x (2007) Vicente-Crespo, M. et al. Drosophila muscleblind is involved in troponin T alternative splicing and apoptosis. PLoS One 3, e1613, doi: 10.1371 / journal.pone.0001613 (2008) Wang, X.W., et al. MicroRNAs in liver disease. Gastroenterology 142 (7), 1431-1443 (2012) Yanava, R. S., et al. TWEAK Regulates Muscle Functions in a Mouse Model of RNA Toxicity. PLoS One. 22; 11 (2): e0150192. doi: 10.1371 / journal.pone.0150192 (2016). eCollection 2016.

权利要求:
Claims (22)
[1]
5
10
fifteen
twenty
25
30
35
1. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog that is an antagonist of a microRNA that regulates the expression of the human gene MBNL1 and / or MBNL2, or a mixture of two or more of said molecules.
[2]
2. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 1, which is an antagonist of a microRNA that is expressed in at least one or more organs selected from the group of brain, cerebellum, hippocampus, skeletal muscle and heart , or in one or more cells of a primary culture of one of said organs or of an established cell line derived from one of said organs or stem cells thereof.
[3]
3. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 1 or 2, comprising a sequence fragment of ribonucleotide units, or ribonucleotide analogs, in which the sequence of the nitrogenous bases of the units of ribonucleotides or ribonucleotide analogs it is at least 50% complementary to the sequence of the nitrogenous bases of the endogenous molecule fragment (the microRNA or messenger RNA) to which it is to be bound.
[4]
4. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 3, comprising a sequence fragment of ribonucleotide units, or ribonucleotide analogs, in which the sequence of the nitrogenous bases of ribonucleotide units or of ribonucleotide analogs is complementary to at least 55%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, or 100%, to the sequence of the nitrogenous bases of the fragment of the endogenous molecule to which it is to be bound.
[5]
5. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to any one of claims 1 to 4, which is an antagonist of human microRNA-218-5p or human microRNA-23b-3p.
[6]
6. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 5, comprising a fragment consisting of a succession of ribonucleotide units, or ribonucleotide analogs, in the
5
10
fifteen
twenty
25
30
35
that the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs is identical at least in a percentage selected from the group of 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99%, 99.5%, 100%, to the sequence of the nitrogenous bases of the oligoribonucleotide of SEQ ID NO: 1 or of the oligoribonucleotide of SEQ ID NO: 2.
[7]
7. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to any one of claims 1 to 6, which is an antagomi®, a blockmiR, an antimiR or a microRNA sponge.
[8]
8. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 7, which is an antagomi R type oligoribonucleotide analog whose sequence is complementary to the sequence of the human microRNA-218-5p or the human microRNA-23b-3p , or comprising a fragment of ribonucleotide units, or ribonucleotide analogues, in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs is at least 80% identical to the sequence of the bases nitrogenated oligoribonucleotide SEQ ID NO: 1 or oligoribonucleotide SEQ ID NO: 2.
[9]
9. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 8, which is an olgibonucleotide analog of the antagomi® type in which
to. at least one of the monomer units that compose it is a ribonucleotide analog that has one or more chemical modifications in the rest of the ribose, in the phosphate bond or in both,
b. the sequence of the nitrogenous bases of the monomeric units of ribonucleotides or analogs of ribonucleotides is identical to the sequence of nitrogenous bases of the monomeric units of ribonucleotides of the oligoribonucleotide of SEQ ID NO: 1 or of the oligoribonucleotide of SEQ ID NO: 2, and that ,
C. optionally, it has one or more additional residues that are not deoxyribonucleotide or ribonucleotide residues at the 5 'end and / or at the 3' end.
[10]
10. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 8, which is an olgibonucleotide analog of the antagomi® type in which
5
10
fifteen
twenty
25
30
35
to. all monomeric analog units of ribonucleotides included in its structure have 2’-O-methyl (2’-methoxy) modifications in the rest of the ribose,
b. the first two monomer units analogous to ribonucleotides at its 5 ’end and the last four monomer units analogous to ribonucleotides at its 3’ end are linked to the next component moiety of the molecule by phosphorothioate groups instead of phosphate groups,
C. it has 4 cholesterol residues at the 3 ’end, attached to the last monomeric analogue ribonucleotide unit of said 3’ end,
d. the sequence of the nitrogenous bases of their monomeric analogue units of ribonucleotides is identical to the sequence of nitrogenous bases of the monomeric ribonucleotide units of the oligoribonucleotide of SEQ ID NO: 1 (antagomiR-218-5p) or the oligoribonucleotide of SEQ ID NO: 2 (antagomiR-23b-3p),
[11]
11. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to claim 9 or 10, which is an antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 10 (antagomiR-218-5p) or the antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 11 (antagomiR-23b-3p).
[12]
12. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to any one of claims 1 to 5, comprising a fragment complementary to the seed region of the microRNA of which it is antagonistic or comprising a fragment composed of a succession of units of ribonucleotides or ribonucleotide analogs in which the sequence of the nitrogenous bases of the ribonucleotide units or ribonucleotide analogs is 100% complementary to the sequence of the nitrogenous bases of the seed region of the microRNA of which it is an antagonist.
[13]
13. A molecule of oligoribonucleotide nature and / or an oligoribonucleotide analog according to any one of claims 1 to 5, which is a blockmiR comprising a fragment consisting of a succession of ribonucleotide units or ribonucleotide analogs in which the sequence of the nitrogenous bases of ribonucleotide units or ribonucleotide analogs is
5
10
fifteen
twenty
25
30
35
at least 80% complementary to the sequence of the nitrogen bases in the region of a target messenger RNA recognized by the microRNA of which blockmiR is an antagonist.
[14]
14. A composition comprising at least one of the oligoribonucleotide-like molecules or an oligoribonucleotide analog of any one of claims 1 to 13, a mixture of two or more of them, or an expression vector comprising the coding sequence of at least one of said molecules of oligoribonucleotide nature.
[15]
15. A composition according to claim 14, further comprising a pharmaceutically acceptable carrier and / or one or more excipients.
[16]
16. A composition according to any one of claims 14 or 15, comprising the antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 10 (antagomiR-218-5p) or the antagomiR type oligoribonucleotide analog represented by SEQ ID NO: 11 (antagomiR-23b-3p) or a mixture thereof.
[17]
17. A composition according to any one of claims 14 or 15, comprising an expression vector comprising the coding sequence of a microRNA sponge comprising multiple tandem sites complementary to the human microRNA-218-5p or the microRNA-23b -3p human or a mixture of multiple binding sites placed in tandem complementary to each of them.
[18]
18. A composition according to any one of claims 14 to 16, wherein the oligoribonucleotide or oligoribonucleotide analog molecule is in a concentration of 50 nM to 200 nM, both included
[19]
19. Use of one of the molecules of oligoribonucleotide nature or an oligoribonucleotide analog of any one of claims 1 to 13, a mixture of two or more thereof, or a composition of any one of claims 14 to 18, for the manufacture of a medicament for the treatment of myotonic dystrophy type 1.
[20]
20. The use according to claim 19, wherein the treatment is a palliative treatment of one or more symptoms of type 1 myotonic dystrophy.
[21]
21. The use according to claim 20, wherein the treatment is a palliative treatment of one or more of the muscle disorders that are part of the symptoms of type 1 myotonic dystrophy.
5
[22]
22. The use according to any one of claims 19 to 21, wherein the oligoribonucleotide or oligoribonucleotide analog molecule is an inhibitor of human microRNA-218-5p or human microRNA-23b-3p.
The use according to claim 22, wherein the molecule of nature
oligoribonucleotide or oligoribonucleotide analog is the antagonist of the antagonistic microRNA-218-5p type represented by SEQ ID NO: 10 or the inhibitor of the human microRNA-23b-3p type antagomiR represented by SEQ ID NO: 11.
fifteen
P-Tub
4 ^
n
scramble-SP
miR-92a-SP
miR-IOOSP
miR-124SP
miR-277
miR-304SP
Expression related to Rp49
P P r *
O Ln O Ln
image 1
01
Relative expression of mbl
O Ui O Ui
image2
c5 ‘

Fig. 2
i (CTG) 480 i (CTG) 480
image3
Relative expression of mbl “
image4
Inclusion of Tnt e13 (%)
Inclusion of Fhos e16 (%)
image5
Relative expression of CyP6W1 e2
O - * NJ W
control
scramble-SP
miR-277
miR-304SP
—I
OR
s 3
4*
00
or
Relative expression of Serca e13
o o o o o - *
or KJ or> i »or
control
scramble-SP
miR-277
miR-304SP
Y
image6

类似技术:

---

公开号 | 公开日 | 专利标题

---

Sobczak et al.2013|RNA interference targeting CUG repeats in a mouse model of myotonic dystrophy

---

ES2656904T3|2018-02-28|Method for effective exon skipping | in Duchenne muscular dystrophy and associated media

---

US9951330B2|2018-04-24|Micrornas that silence tau expression

---

US20140128449A1|2014-05-08|Oligonucleotide modulation of splicing

---

ES2812561T3|2021-03-17|MicroRNAs that modulate the effect of glucocorticoid signaling

---

US20100204309A1|2010-08-12|Oligonucleotide compositions for the treatment of alzheimer&#39;s disease

---

EP2298359A1|2011-03-23|Nucleic acid capable of controlling degranulation of mast cell

---

US10053690B2|2018-08-21|Anti-miR-27b and anti-miR-148a oligonucleotides as therapeutic tools for treating dyslipidemias and cardiovascular diseases

---

EP2663323A1|2013-11-20|Methods targeting mir-128 for regulating cholesterol/lipid metabolism

---

ES2855577T3|2021-09-23|Functional nucleic acid molecule and its use

---

JP2016530887A|2016-10-06|Antisense oligomers and methods for treating SMN-related pathologies

---

ES2856555T3|2021-09-27|Methods and pharmaceutical compositions for the treatment of cystic fibrosis

---

ES2659845A1|2018-03-19|Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs for this |

---

JPWO2005074988A1|2007-10-11|Neuronal differentiation inducer

---

KR20210010549A|2021-01-27|Compositions and methods for reducing splicing abnormalities and treating RNA dominant diseases

---

TW202108763A|2021-03-01|Viral vectors and nucleic acid for use in the treatment of ipf and pf-ild

---

WO2015138960A2|2015-09-17|Molecular re-engineering of excitation-inhibition balance in memory circuits

---

Overby2022|Proof of Concept of Therapeutic Gene Modulation of MBNL1/2 in Myotonic Dystrophy

---

Overby et al.2022|Proof of concept of peptide-linked blockmiR-induced MBNL functional rescue in myotonic dystrophy type 1 mouse model

---

US20160304869A1|2016-10-20|Materials and Methods for Treatment of Pulmonary Arterial Hypertension

---

Zivkovic et al.2012|MicroRNA miR-107 is overexpressed in pituitary adenomas and in vitro inhibits the expression of aryl hydrocarbon receptor-interacting protein | 2

---

Swiezewski2011|Session 1 & 2: Post-transcriptional regulation

---

WO2015038593A1|2015-03-19|Targeting microrna-26a/b for the treatment of neurodegenerative disease

同族专利:

---

公开号 | 公开日

---

US11202794B2|2021-12-21|

---

ES2659845B1|2019-01-04|

---

CA3037288A1|2018-03-22|

---

WO2018050930A1|2018-03-22|

---

EP3516059A1|2019-07-31|

---

AU2017328728B2|2021-07-29|

---

AU2021257890A1|2021-11-18|

---

US20190231809A1|2019-08-01|

---

JP6919098B2|2021-08-18|

---

IL265461D0|2019-05-30|

---

JP2019531092A|2019-10-31|

---

AU2017328728A1|2019-05-16|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

WO2005079397A2|2004-02-13|2005-09-01|Rockefeller University|Anti-microrna oligonucleotide molecules|

---

EP1648914A4|2003-07-31|2009-12-16|Regulus Therapeutics Inc|Oligomeric compounds and compositions for use in modulation of small non-coding rnas|

---

US20070099196A1|2004-12-29|2007-05-03|Sakari Kauppinen|Novel oligonucleotide compositions and probe sequences useful for detection and analysis of micrornas and their target mRNAs|

---

EP2560001B1|2006-09-21|2016-04-13|University of Rochester|Compositions and methods related to protein displacement therapy for myotonic distrophy|

---

AU2008232316A1|2007-03-26|2008-10-02|Newcastle Innovation Limited|Therapeutic targets and molecules|

---

US8222221B2|2008-06-04|2012-07-17|The Board Of Regents Of The University Of Texas System|Modulation of gene expression through endogenous small RNA targeting of gene promoters|

---

WO2009148137A1|2008-06-04|2009-12-10|協和発酵キリン株式会社|Nucleic acid capable of controlling degranulation of mast cell|

---

WO2010115050A2|2009-04-01|2010-10-07|The Regents Of The University Of California|Embryonic stem cell specific micrornas promote induced pluripotency|

---

WO2010139026A1|2009-06-05|2010-12-09|Centenary Institute Of Cancer Medicine And Cell Biology|Therapeutic and diagnostic molecules|

---

KR101900770B1|2010-07-19|2018-09-20|아이오니스 파마수티컬즈, 인코포레이티드|Modulation of dystrophia myotonica-protein kinase expression|

---

US8729046B2|2011-12-07|2014-05-20|Albert Einstein College Of Medicine Of Yeshiva University|MIR27B is a novel target for treatment of liver fibrosis|

---

GB201202228D0|2012-02-08|2012-03-28|Queen Mary & Westfield College|Reversal of replicative senescence|

---

EP2839005B1|2012-04-20|2021-01-06|Aptamir Therapeutics, Inc.|Mirna modulators of thermogenesis|

---

法律状态:
2019-01-04| FG2A| Definitive protection|Ref document number: 2659845 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190104 |

优先权:

---

申请号 | 申请日 | 专利标题

---

ES201631216A|ES2659845B1|2016-09-19|2016-09-19|Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs for this|ES201631216A| ES2659845B1|2016-09-19|2016-09-19|Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs for this|

---

US16/334,725| US11202794B2|2016-09-19|2017-09-19|Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor|

---

EP17776976.7A| EP3516059A1|2016-09-19|2017-09-19|Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor|

---

JP2019536689A| JP6919098B2|2016-09-19|2017-09-19|Modulation of microRNAs for myotonic dystrophy type 1 and microRNA antagonists for that purpose|

---

AU2017328728A| AU2017328728B2|2016-09-19|2017-09-19|Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs therefor|

---

CA3037288A| CA3037288A1|2016-09-19|2017-09-19|Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor|

---

PCT/EP2017/073685| WO2018050930A1|2016-09-19|2017-09-19|Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor|

---

IL265461A| IL265461D0|2016-09-19|2019-03-19|Modulation of micrornas against myotonic dystrophy type 1 and antagonists of micrornas therefor|

---

AU2021257890A| AU2021257890A1|2016-09-19|2021-10-25|Modulation of microRNAs against myotonic dystrophy type 1 and antagonists of microRNAs therefor|