Tumor treatment using specific anti-L1 antibodies

专利摘要:

公开号:ES2658342T9
申请号:ES13000027.6T
申请日:2008-06-13
公开日:2018-06-06
发明作者:Daniela Kelm；Peter Altevogt；Sandra Lüttgau；Achim Krüger；Gerhard Moldenhauer；Frank Breitling；Silke Bärreiter；Yi Li；Ulrich Möbius；Susanne Prof. Dr. Sebens；Heiner Prof. Dr. Schäfer
申请人:Deutsches Krebsforschungszentrum DKFZ；Medigene AG；
IPC主号:

专利说明:

5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
DESCRIPTION
Tumor treatment using specific anti-L1 antibodies Field of the invention
Conventional treatment of advanced cancer is often chemotherapy or radiotherapy. However, despite the initial response to therapy, it is often observed that different carcinomas acquire resistance to chemotherapeutic drugs or radiotherapy, which leads to tumor recurrence and frequent death of patients. Often, it is then decided to switch to another chemotherapeutic drug or at higher dosages. However, there is usually no improvement in the clinical situation.
L1 is a type I membrane glycoprotein of 200 to 230 kDa that structurally belongs to the Ig superfamily (Moos M, Tacke R, Scherer H, Teplow D, Fruh K, Schachner M. Neural adhesion molecule L1 as a member of the immunoglobulin superfamily with binding domains similar to fibronectin. Nature 1988; 334: 701-3). L1 plays a crucial role in the orientation of axons and cell migration in the developing nervous system (Hortsch M. Structural and functional evolution of the L1 family: are four adhesion molecules better than one Mol Cell Neurosci 2000; 15: 1 -10, Schachner M. Neural recognition molecules and synaptic plasticity. Curr Opin Cell Biol 1997; 9: 627-34). Recent studies have also involved the expression of L1 in the progression of human carcinomas. L1 expression was found in different tumors including lung cancer (Katayama M, Iwamatsu A, Masutani H, Furuke K, Takeda K, Wada H, et al. Expression of neural cell adhesion molecule L1 in human lung cancer cell lines. Cell Struct Funct 1997; 22: 511-6), gliomas (Senner V, Kismann E, Puttmann S, Hoess N, Baur I, Paulus W. L1 expressed by glioma cells promotes adhesion but not migration. Glia 2002; 38: 146- 54), melanomas (Thies A, Schachner M, Molí I, Berger J, Schulze HJ, Brunner G, et al. Overexpression of the cell adhesion molecule L1 is associated with metastasis in cutaneous malignant melanoma. Eur J Cancer 2002; 38: 1708 -1, Fogel M, Mechtersheimer S, Huszar M, Smirnov A, Abu DA, Tilgen W, et al. L1 adhesion molecule (CD 171) in development and progression of human malignant melanoma. Cancer Lett 2003; 189: 237-47) , renal carcinoma (Meli ML, Carrel F, Waibel R, Amstutz H, Crompton N, Jaussi R, Moch H, Schubiger PA, Novak-Hofer I. Anti-neuroblastoma antibody chCE 7 binds to an isoform of L1-CAM present in renal carcinoma cells. Int J Cancer, 1999; 83: 401-408, Allory Y, Matsuoka Y, Bazille C, Christensen El, Ronco P, Debiec H. The L1 cell adhesion molecule is induced in renal cancer cells and correlates with metastasis in clear cell carcinomas. Clin Cancer Res 2005; 11: 1190-7) and colon carcinoma (Gavert N, Conacci-Sorrell M, Gast D, Schneider A, Altevogt P, Brabletz T, et al. L1, a novel target of beta-catenin signaling, transforms cells and is expressed at the invasive front of colon cancers. J Cell Biol 2005; 168: 633-42). Furthermore, it is known in the art that L1 is overexpressed in ovarian and endometrial carcinomas in a stage-dependent manner (Fogel M, Gutwein P, Mechtersheimer S, Riedle S, Stoeck A, Smirnov A, et al. L1 expression as a predictor of progression and survival in patients with uterine and ovarian carcinomas. Lancet 2003; 362: 869-75).
In the art, the use of anti-L1 antibodies for the treatment of ovarian and endometrial tumors has been suggested (see WO 02/04952, WO 06/013051 and Arlt MJ, Novak-Hofer I, Gast D, Gschwend V , Moldenhauer G, Grunberg J, et al. Efficient inhibition of intra-peritoneal tumor growth and dlssemination of human ovarian carcinoma cells in nude mice by anti-L1-cell adhesion molecule monoclonal antibody treatment. Cancer Res 2006; 66: 936-43) . Various anti-L1 antibodies are known in the art (for example, mAb 14.10: Huszar M, Moldenhauer G, Gschwend V, Ben-Arie A, Altevogt P, Fogel M: Expression profile analysis in multiple human tumors identifies L1 (CD171) as a molecular marker for diferential diagnosis and targeted therapy Hum Pathol 37: 1000-1008, 2006, mAb chCE7: Meli ML, Carrel F, Waibel R, Amstutz H, Crompton N, Jaussi R, Moch H, Schubiger PA, Novak- Hofer I: Anti-neuroblastoma antibody chCE7 binds to an isoform of L1-CAM present in renal carcinoma cells Int J Cancer 83: 401-408, 1999, mAb UJ 127.11: Patel K, Kiely F, Phimister E, Melino G, Rathjen F, Kemshead JT: The 200/220 kDa antigen recognized by monoclonal antibody (MAb) UJ127.11 on neural tissues and tumors is the human L1 adhesion molecule.Hybridoma 10: 481-491, 1991, mAb 5G3: Wolff JM, Frank R , Mujoo K, Spiro RC, Reisfeld RA, Rathjen FG: A human brain glycoprotein related to the mouse cell adhesion molecule L1. J Biol Chem 263: 11943-11947, 1988). In addition, in Sebens Müerkoster et al., Oncogene. April 26, 2007; 26 (19): 2759-68, Epub, November 6, 2006, has suggested the use of anti-L1 antibodies to sensitize tumor cells for treatment with a chemotherapeutic drug or radiotherapy.
There is always a need for improved anti-tumor agents.
The present invention relates in one aspect to a binding molecule capable of binding to L1,
(a) being selected from the group consisting of single chain antibodies, scFv, scFv multimers such as diabodies, triabodies or tetrabodies, antibody fragments, Fab, TanDabs, Flexibodies, bispecific antibodies and chimeric antibodies,
I
(b) comprising at least one Ig domain,
and in which the binding molecule capable of binding to L1:
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
(i) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: RASQDISNYLN (SEQ ID No .: 24), lCdR2: YTSRLHS (SEQ ID No .: 25), LCDR3: QQGNTLPWT (SEQ ID No .: 26), HCDR1: RYWML (SEQ ID No .: 27), HCDR2: EINPRNDRTNYNEKFKT (SEQ ID No .: 28) and HCDR3: GGGYAMDY (SEQ ID No .: 29),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M, or
(ii) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: QDISNY (SEQ ID No .: 30), LCDR2: YTS, LCDR3: QQGNTLPWT (SEQ ID No .: 31), HCDR1: GYTFTRYW (SEQ ID No .: 32), HCDR2: INPRNDRT (SEQ ID No .: 33), and HCDR3: ALGGGYAMDY (SEQ ID No .: 34),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M.
In the context of the present invention, it has been surprisingly found that monoclonal antibody 9.3, produced by the hybridoma cell deposited as DSMZ ACC2841, has improved anti-tumor capabilities (see examples). Especially, monoclonal antibody 9.3 has the best ability to inhibit tumor growth and tumor cell invasion of all antibodies tested. In addition, monoclonal antibody 9.3 appears to suppress chemoresistance to a greater extent than antibody 11A tested in Wo 2008/046529 (see example 13).
Monoclonal antibodies and the production of monoclonal antibodies belong to the state of the art and are also described in the references cited in the Materials and Methods section of the examples. In general, monoclonal antibodies can be prepared, for example, according to the known method of Winter & Milstein (Winter, G. & Milstein, C. (1991) Nature, 349, 293-299). As an alternative to the preparation of monoclonal antibody secreting hybridomas, a monoclonal antibody directed against a polypeptide of the invention can be identified and isolated by examining a recombinant combinatorial immunoglobulin library (eg, an antibody phage display library) with the polypeptide of interest. Kits for generating and examining phage display libraries are commercially available (eg, Pharmacia's recombinant phage antibody system, catalog No. 27-9400-01; and Stratagene's SurfZAP phage display kit, n Catalog No. 240612). Additionally, examples of methods and reagents particularly suitable for use in the generation and examination of an antibody presentation library can be found, for example, in US Patent No. 5,223,409; WO 92/18619; WO 91/17271; WO 92/20791; WO 92/15679; WO 93/01288; WO 92/01047; WO 92/09690; WO 90/02809; Fuchs et al., 1991, Bio / Technology 9: 1370-1372; Hay et al., 1992, Hum. Antibod Hybridomas 3: 81-85; Huse et al., 1989, Science 246: 1275-1281; Griffiths et al., 1993, EMBO J. 12: 725-734.
Since the effect of an antibody is mediated by its ability to bind to a specific epitope, the description refers to all monoclonal antibodies that recognize the same epitope as antibody 9.3. Methods for determining the epitope of a given antibody are known in the art and include the preparation of synthetic linear peptides of a given region of interest and subsequent tests of whether the antibody binds to said peptides (see Epitope Mapping, A practical approach, Oxford University Press 2001, Editors: Olwyn Westwood and Frank Hay). Alternatively, different recombinant proteins that cover the region of interest can be produced and tested for antibody binding (Oleszewski, M., Gutwein, P., von der Lieth, W., Rauch, U., Altevogt, P. Characterization of the L1-neurocan binding site Implications for L1-L1 homophilic binding J. Biol. Chem. 275: 34478-34485 (2000).
In addition, once a specific epitope of a monoclonal antibody is known, it is within the skill of the art expert to identify or prepare other antibodies, especially monoclonal antibodies, or binding molecules, as defined below that bind to the Same epitope. For example, it is possible to use the peptides or proteins described above in the context of epitope mapping also for the identification or production of said antibodies or binding molecules.
As can be deduced from the examples, the epitope of antibody 9.3 is with the first immunoglobulin-like domain of L1. Thus, the epitope of the monoclonal antibody is also preferably within the first immunoglobulin-like domain of L1.
An anti-L1 monoclonal antibody is described, which has the same ability to inhibit tumor growth as monoclonal antibody 9.3, produced by the hybridoma cell deposited as DSMZ ACC2841. This ability can be tested using the same tumor growth assay described in example 1, section 1.3.9. According to the Invention, "the same capacity" means that the monoclonal antibody has a capacity for inhibiting tumor growth that does not differ by more than 5% of the capacity for inhibition of tumor growth of the monoclonal antibody 9.3.
Preferably, this antibody also inhibits the dimerization of L1, as shown for the 5G3 antibody (see above).
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
An anti-L1 monoclonal antibody is described, characterized in that at least one of its complementarity determining regions (CDR)
a) have the following sequences RASQDISNYLNRASQDISNYLN, YTSRLHS, QQGNTLPWT, RYWML, EINPRNDRTNYNEKFKT, or GGGYAMDY, or
b) has a sequence that, in comparison to the sequences mentioned in a), has at least one conservative amino acid exchange.
The sequences mentioned above show the CDRs of monoclonal antibody 9.3 determined according to the Kabat method (see example 2). Said monoclonal antibody can be produced, for example, by CDR grafting or by recombinant antibody production. Such methods are known in the art (see, for example, Queen, U.S. Patent No. 5,585,089 and Winter, U.S. 5,225,539, Cabilly U.S. 4,816,567).
An anti-L1 monoclonal antibody is disclosed, characterized in that at least one of its complementarity determining regions (CDR)
a) has one of the following sequences QDISNY, YTS, QQGNTLPWT, GYTFTRYW, INPRNDRT or ALGGGYAMDY or
b) has a sequence that, in comparison to the sequences mentioned in a), has at least one conservative amino acid exchange.
These sequences again show the CDRs of monoclonal antibody 9.3 (see Figure 12), but the CDRs have been determined using another method known in the art, specifically according to the IMGT® method of the ImMunoGeneTics® international information system.
A monoclonal antibody, produced by the hybridoma cell deposited as DSMZ ACC2841, is described. This hybridoma cell was deposited in the German Collection of microorganisms and cells on April 25, 2007 according to the Budapest Treaty.
A humanized antibody based on the monoclonal antibody is described as described above.
Humanized antibodies are antibody molecules of non-human species that have one or more complementarity determining regions (CDR) of the non-human species and a framework region (FR) of a human immunoglobulin molecule. (See, for example, Queen, U.S. Patent No. 5,585,089 and Winter, U.S. 5,225,539). Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art.
In general, in order to obtain a humanized antibody, nucleic acid sequences encoding variable heavy chains and human variable light chains can be altered by replacing one or more CDR sequences of the human (acceptor) sequence with the sequence coding for the Respective CDR in the mouse antibody sequence (donor sequence). The human acceptor sequence may comprise FR derived from different genes.
In a preferred embodiment, the described humanized antibody has at least one non-human CDR residue and human frame region (FR).
Subsequently, sequences encoding full-length antibodies can be obtained by linking the modified variable and light variable heavy chain sequences with constant constant and light chain heavy human regions. Preferred human constant light chain sequences include kappa and lambda constant light chain sequences. Preferred human constant heavy chain sequences include IgG1, IgG2 and sequences encoding IgG1 mutants that have modified immunostimulatory properties. Such mutants may have a reduced ability to activate complement-dependent and / or antibody-dependent cellular cytotoxicity and are described in US 5,624,821; WO 99/58572, US 6,737,056. An especially preferred constant heavy chain is an IgG1 comprising substitutions E233P, L234V, L235A, A327G, A330S, P331S and a deletion of residue 236.
In another embodiment, the full length antibody comprises a sequence of IgA, IgD, IgE, IgM, IgY or IgW.
Suitable human donor sequences can be determined by comparing sequences of the peptide sequences encoded by the mouse donor sequences with a group of human sequences, preferably with sequences encoded by mature antibody genes or human germline immunoglobulin genes. A human sequence with a high sequence homology, preferably with the highest homology determined, can serve as the acceptor sequence for the humanization process.
5
10
fifteen
twenty
25
30
35
40
Four. Five
In addition to the exchange of mouse CDR with human CDR, additional manipulations in the human donor sequence can be carried out to obtain a sequence encoding a humanized antibody with optimized properties (such as affinity of the antigen).
In a preferred example, residues 31-35, 50-58 and 95-102 and heavy chain residues 6, 23, 24, and 49 in the human acceptor sequence are altered to correspond to the respective residues of the sequence of mouse (Adair, document US 5,859,205).
In addition, the modified human acceptor antibody variable domain sequences can also be modified to code for one or more amino acids (according to the Kabat numbering system) of position 4, 35, 38, 43, 44, 46, 58, 62 , 64, 65, 66, 67, 68, 69, 73, 85, 98 of the light variable region and 2, 4, 36, 39, 43, 45, 69, 70, 74, 75, 76, 78, 92 of the heavy variable region corresponding to the mouse donor sequence (Carter and Presta, US 6,407,213).
Humanization of an antibody against mouse L1 is described in example 2.
It is known that CDRs can be altered, preferably by exchanges that lead to a conservative amino acid exchange.
In general, manipulations can result in alterations in the FR as well as the CDR regions and include exchanges, deletions and insertion of residues. Alterations can be induced by random or directed mutagenesis. An antibody phage display system, as described above, can be employed for the selection of mutants with desired and / or improved properties.
A human antibody that can recognize the same epitope as antibody 9.3 is disclosed. Methods for generating human antibodies are known in the art. These methods employ, for example, mice in which the endogenous immunoglobulin genes have been partially or completely inactivated and human immunoglobulin loci have been introduced. Following immunization with an immunogenic epitope, these mice can produce human antibodies (U.S. 5,545,807; 5,545,806; 5,569,825; 5,589,369; 5,591,669; 5,625,126; 5,633,425; 5,661,016).
In a further description, the humanized antibody comprises the sequence of L1_9.3hu or L1_9.3hu3 as shown in Figure 8 a) and b).
A binding molecule comprising:
a) at least one of the following sequences RASQDISNYLN, YTSRLHS, QQGNTLPWT, RYWML, EINPRNDRTNYNEKFKT or GGGYAMDY or
b) at least one sequence that has, in comparison to the sequences provided in a), at least one conservative amino acid exchange.
As explained above, these sequences show the CDRs of antibody 9.3 (see example 2).
A binding molecule comprising:
a) at least one of the following sequences QDISNY, YTS, QQGNTLPWT, GYTFTRYW, INPRNDRT or ALGGGYAMDY or
b) at least one sequence that has, in comparison to the sequences provided in a), at least one conservative amino acid exchange.
As explained above, these sequences again show the CDRs of monoclonal antibody 9.3, determined by another method known in the art.
The present invention relates in one aspect to a binding molecule capable of binding to L1,
(a) being selected from the group consisting of single chain antibodies, scFv, scFv multimers such as diabodies, triabodies or tetrabodies, antibody fragments, Fab, Tandabs, Flexibodies, bispecific antibodies and chimeric antibodies,
I
(b) comprising at least one Ig domain,
and in which the binding molecule capable of binding to L1:
(i) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: RASQDISNYLN (SEQ ID No .: 24), LCDR2: YTSRLHS (SEQ ID
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
No .: 25), LCDR3: QQGNTLPWT (SEQ ID No .: 26), HCDR1: RYWML (SEQ ID No .: 27), HCDR2: EINPRNDRTNYNEKFKT (SEQ ID No .: 28), and HCDR3: GGGYAMDY (SEQ ID No .: 29),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M, or
(ii) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: QDISNY (SEQ ID No .: 30), LCDR2: YTS, LCDR3: QQGNTLPWT (SEQ ID No .: 31), HCDR1: GYTFTRYW (SEQ ID No .: 32), HCDR2: INPRNDRT (SEQ ID No .: 33), and HCDR3: ALGGGYAMDY (SEQ ID No .: 34),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M.
According to the invention, a molecule is a molecule that can bind to L1. The binding molecule is a molecule comprising immunoglobulin, that is, it comprises at least one Ig domain, and / or the binding molecule of the invention is selected from the group consisting of single chain antibodies (eg scFv, multimeters of scFv-like diabodies, triabodies or tetrabodies, antibody fragments (eg, Fab), TandAbs, Flexibodies, bispecific antibodies and chimeric antibodies).
The structure of an antibody and especially the function of its CDRs are known in the art (Carter PJ. Potent antibody therapeutics by design. Nature Rev. Immunol. 6: 343-357, 2006).
scFv and the multimers thereof, TandAbs, diabody and Flexibodies are conventional antibody formats known in the art, for example, from WO 88/1649, WO 93/11161, WO 99/57150 and EP1293514B1.
In single chain Fv (scFv) the two variable regions of light and heavy chain antigen binding (VH Fv and VL Fv) of an antibody are artificially connected by a binding peptide, designated as a single chain variable fragment or antibody single chain (Bird, et al. (1988) Science 242: 423-426; Orlandi, et al (1989) Proc Natl Acad Sci USA 86: 3833-3837; Clarkson et al., Nature 352: 624-628 (1991 )). The antigen binding site is composed of the light and heavy chain variable domains of a monoclonal antibody. Several investigations have shown that the Fv fragment has, in fact, the complete intrinsic antigen binding affinity of a complete antibody binding site.
In the context of this invention, the diabodies are scFv with two binding specificities and can be either monospecific and bivalent or bispecific and bivalent.
TandAbs and Flexibodies are additional antibody formats that are defined, for example, in US2007031436 and EP1293514, respectively.
Antibody fragments containing protein idiotypes can be generated by techniques known in the art. For example, such fragments include, but are not limited to, the F (ab ') 2 fragment that can be produced by pepsin digestion of the antibody molecule; the Fab 'fragment that can be generated by reducing the disulfide bridges of the F (ab') 2 fragment; the Fab fragment that can be generated by treating the molecular antibody with papain and a reducing agent; and fragments Fv.
A chimeric antibody is a molecule in which different parts of different animal species are derived, such as those that have a variable region derived from a murine mAb and a constant region of human immunoglobulin. (See, for example, Cabilly et al., U.S. Patent No. 4,816,567; and Boss et al., U.S. Patent No. 4,816,397).
Bifunctional, or bispecific, antibodies have antigen binding sites of different specificities. Various forms of bispecific antibodies have been produced. These include BSIgG, which are IgG molecules that comprise two different heavy chains and two different light chains that are secreted by so-called "hybrid hybridomas" and heteroantibody conjugates produced by the chemical conjugation of antibodies or antibody fragments of different specificities (Segal DM, Weiner GJ, Weiner lM. Bispecific antibodies in cancer therapy. Current Opin. Immunol. 11: 558-562, 1999, Van Spriel AB, Van Ojik HH, Van de Winkel JGJ. Immunotherapeutic perspective for biespecific antibodies. Immunology Today 21: 391-397, 2000).
Bispecific antibodies have been generated to deliver cells, cytotoxins or drugs to specific sites. An important use has been to deliver host cytotoxic cells, such as cytotoxic or natural cytolytic T cells, to specific cell targets. (P. J. Lachmann, Clin. Exp. Immunol. 79: 315 (1990)). Another important use has been to deliver cytotoxic proteins to specific cell targets. (V. Raso, T. Griffin, Cancer Res. 41: 2073 (1981); S. Honda, Y. Ichimori, S. Iwasa, Cytotechnology 4:59 (1990)). Another important use has been to deliver non-protein anticancer drugs to specific cell targets (J. Corvalan, W. Smith, V. Gore, Intl. J. Cancer Sup. 2:22 (1988); M. Pimm et al., British J of Cancer 61: 508 (1990)). Such bispecific antibodies have been prepared by chemical crosslinking (M. Brennan et al., Science 229: 81 (1985)), disulfide exchange or the production of hybrid hybridomas (quadromas). Quadromas are constructed by fusing hybridomas that secrete
two different types of antibodies against two different antigens (Kurokawa, T. et al., Biotechnology 7.1163 (1989)).
In a preferred embodiment of the invention, the binding molecule of the invention is bound to an active substance, preferably a toxin, a nanoparticle, a cytokine or a radionuclide. Such antibodies are known in the art (Wu AM, Senter PD. Arming antibodies: prospects and challenges for immunoconjugates. Nature Biotechnol. 23: 1137-1146, 2005, Pastan I, Hassan R, FitzGerald DJ, Kreitman RJ. Immunotoxin treatment of cancer Annu. Rev. Med. 58: 221-237, 2007, documents WO 90/12592, WO 2007/030642, WO 2004/067038, WO 2004/003183, US 2005/0074426, WO 94/04189).
The binding molecule of the invention binds to L1 with an affinity (KD) of at least 10-10 or 10-11 M.
10 Preferably, the antibody does not bind significantly to other members of the L1 protein family, such as, for example, CHL1 (near homologue of L1, registration number NM_006614), NrCAM (neuronal cell adhesion protein, number of registration NM_001037132 or NM_005010) and / or NfAsC (neurofascin, registration number NM_015090). Preferably, the antibody binds to the other members of the L1 family with at least 100 times lower affinity, more preferably at least 1000 times lower affinity compared to L1 affinity. The affinity of the antibody for the different proteins can be determined, for example, by measuring the affinity of binding to recombinant proteins, as described in example 6. The binding of the antibody to the different members of the L1 family of the L1 family It can also be determined by expressing said proteins in CHO cells and measuring antibody binding by FACS analysis, as described in Example 1.2 and Example 7.
20 It is described that the antibody does not significantly increase cytokine release, for example, tumor necrosis factor-alpha or interferon gamma. Preferably, the release is not increased by more than 30%, more preferably not more than 20% and most preferably not more than 10%. The release of cytokines can be tested as described in example 8. Alternatively, the concentration of cytokines can be determined in the blood of an animal before and after administration of the antibody. The concentration of 25 cytokines can be determined by an ELISA or other methods known in the art.
It is described that the antibody does not significantly induce T cell proliferation or inhibit T cell proliferation. The effect of an antibody on T cell proliferation can be determined as described in Example 9.
A binding molecule that can bind to the same L1 epitope recognized by monoclonal antibody 9.3, produced by the hybridoma cell deposited as DSMZ ACC2841, is also disclosed. With respect to this disclosed binding molecule, the same defined embodiments also apply to this binding molecule with respect to the structure of the binding molecule described above.
Preferably, the binding of the antibody to the epitope is not significantly increased or decreased by the glycosylation state of the L1 protein. The influence of the glycosylation state on antibody binding can be determined as described in example 10.
In addition, the description refers to a hybridoma cell that produces the monoclonal antibody.
In addition, the description refers to the hybridoma cell deposited as DSMZ ACC2841.
As explained above and as described in the examples section, the described monoclonal antibody or the binding molecule of the invention is especially suitable for the treatment of tumoriological diseases.
Therefore, in another aspect, the invention relates to the binding molecule of the invention for use in a method of treating a tumoriological disease.
In addition, the description also refers to a method for treating a tumorgenic disease, in which an antibody or binding molecule is administered to a subject in an amount effective to treat said disease.
As mentioned earlier, the use of anti-L1 antibodies to sensitize tumor cells for treatment with a chemotherapeutic drug or with radiation therapy has been suggested (see Sebens Müerkoster et al., Oncogene. April 26, 2007; 26 (19): 2759-68, Epub, November 6, 2006). Accordingly, in another aspect, the present invention relates to the binding molecule of the invention for use in a method of sensitizing tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy.
This aspect of the present invention is especially useful in cases in which the tumor cells are at least partially resistant to chemotherapy or radiotherapy.
Therefore, in a preferred embodiment of the invention, the cells to be sensitized are at least partially resistant to treatment with said chemotherapeutic drug or radiotherapy.
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
In the context of the present invention, the term "sensitize" should be understood as that after treatment with the binding molecule of the invention, tumor cells are more sensitive to treatment with a chemotherapeutic drug or with radiation therapy than before said treatment. This can be tested, for example, by isolating the patient's tumor cells and testing them in vitro to see if treatment with said binding molecule of the invention results in sensitization of the cells. This test can be performed as described in the reference (Sebens Müerkoster et al., Oncogene. April 26, 2007; 26 (19): 2759-68, Epub November 6, 2006).
In a preferred embodiment, the cells, prior to administration of the binding molecule of the invention, were not sensitive to treatment or were only sensitive to a degree that treatment with a chemotherapeutic drug or radiotherapy did not result in the effect. Desired therapeutic.
Preferably, with the aid of the binding molecule of the invention, the sensitivity is increased by at least 20%, more preferably at least 40% and even more preferably at least 100%.
In Remmingtons Pharmaceutical Sciences, 5th ed., Chapter 33, in particular pages 624 to 652, for example, a summary of chemotherapeutic drugs and radiotherapy is provided.
Any of the numerous chemotherapeutic drugs can be used in the uses of the invention. These compounds fall into several different categories, including, for example, alkylating agents, antineoplastic antibiotics, antimetabolites and derivatives from a natural source.
Examples of alkylating agents that can be used in the invention include busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide (i.e., Cytoxan), dacarbazine, ifosfamide, lomustine, mechlorethamine, melphalan, procarbazine, streptozocin and thiotepacin.
Examples of antineoplastic antibiotics include bleomycin, dactinomycin, daunorubicin, doxorubicin, idarubicin, mitomycin (eg, mitomycin C), mitoxantrone, pentostatin and plicamycin.
Examples of antimetabolites include fluorodeoxyuridine, cladribine, cytarabine, floxuridine, fludarabine, fluorouracil (for example, 5-fluorouracil (5FU)), gemcitabine, hydroxyurea, mercaptopurine, methotrexate and thioguanine.
Examples of derivatives of a natural source include docetaxel, etoposide, irinotecan, taxanes (eg, paclitaxel), teniposide, topotecan, vinblastine, vincristine, vinorelbine, prednisone and tamoxifen.
Additional examples of chemotherapeutic agents that can be used in the invention include asparaginase and mitotane.
In addition, ceramide C2 can also be used.
In an especially preferred embodiment, the chemotherapeutic drug is selected from the group consisting of actinomycin D, mitomycin C, cisplatin, doxorubicin, etoposide, verapamil, podophyllotoxin, 5-FU, taxanes such as paclitaxel and carboplatin.
According to the invention, the term "radiotherapy" refers to each radiation therapy that is commonly used to treat tumor cells. In a preferred embodiment, this therapy includes y-rays, X-rays, microwaves, UV radiation as well as the direct administration of radioisotopes to or near tumor cells (brachytherapy).
As mentioned above, the objective of this aspect of the invention is to sensitize tumor cells for treatment with a chemotherapeutic drug or with radiation therapy. Accordingly, in a preferred embodiment, after sensitization with the binding molecule of the invention, the patient is further treated with said chemotherapeutic drug or with said radiotherapy.
In the context of the present invention, it is envisioned to sensitize tumor cells of any cell type or to treat any tumoriological disease. Preferably, the tumor cells or the tumor-like disease are of a type selected from the group consisting of astrocytoma, oligodendroglioma, meningioma, neurofibroma, glioblastoma, ependymoma, Schwannoma, neurofibrosarcoma, medulloblastoma, melanoma, pancreatic cancer, prostate carcinoma, cancer of the head and neck, breast cancer, lung cancer, ovarian cancer, endometrial cancer, kidney cancer, neuroblastomas, squamous cell carcinomas, medulloblastomas, hepatoma, colon and mesothelioma cancer, and squamous cell carcinoma.
In addition, it is preferred that the tumor cells are from an epithelial tumor or the tumor-like disease is an epithelial tumor, preferably in which the epithelial tumor is pancreatic cancer, colon cancer, ovarian cancer or endometrial cancer.
In one description, the antibody does not induce neuronal side effects when administered in a therapeutically effective amount.
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
60
As mentioned above, the binding molecule is used for the preparation of a pharmaceutical composition.
In general, the pharmaceutical compositions of the present invention comprise a therapeutically effective amount of a therapeutic product and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a federal or state government regulatory agency or mentioned in the United States Pharmacopoeia or other pharmacopoeia generally recognized for use in animals, and more particularly, in beings. humans. The term "vehicle" refers to a diluent, adjuvant, excipient or vehicle with which the therapeutic product is administered. Such pharmaceutical vehicles may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, including, but not limited to, peanut oil, soybean oil, mineral oil, sesame oil. and the like Water is a preferred vehicle when the pharmaceutical composition is administered orally. Saline solution and aqueous dextrose solution are preferred vehicles when the pharmaceutical composition is administered intravenously. Preferably, saline solutions and aqueous solutions of dextrose and glycerol are used as liquid carriers for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, gypsum, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained release formulations and the like. The composition can be formulated as a suppository, with traditional binders and vehicles such as triglycerides. The oral formulation may include conventional vehicles such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic product, preferably in purified form, together with a suitable amount of the vehicle to provide the form for proper administration to the patient. The formulation must be suitable for the mode of administration.
In a preferred embodiment, the composition is formulated, according to routine procedures, as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. When necessary, the composition may also include a solubilizing agent and a local anesthetic, such as lidocaine, to relieve pain at the injection site. Generally, the components are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as a vial or envelope indicating the amount of active agent . When the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, a water vial or sterile saline solution for injection can be provided so that the components can be mixed before administration.
The therapeutic products of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with free carboxyl groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., those formed with free amine groups such as those derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine , procaine, etc., and those derived from sodium, potassium, ammonium, calcium and ferric hydroxides, etc.
The amount of the therapeutic product of the invention, which will be effective in the treatment of a particular disorder or condition, will depend on the nature of the disorder or condition, and can be determined by conventional clinical techniques. In addition, in vitro tests may optionally be used to help identify optimal dosage ranges. The precise dose to be used in the formulation will also depend on the route of administration, and the severity of the disease or disorder, and should be decided according to the doctor's criteria and the circumstances of each patient. However, suitable dosage ranges for intravenous administration are, in general, approximately 20-500 micrograms of active compound per kilogram of body weight. Dosage ranges suitable for intranasal administration are, in general, from about 0.01 pg / kg body weight to 1 mg / kg body weight. Effective doses can be extrapolated from dose-response curves derived from test systems in in vitro or animal models. In general, suppositories may contain the active substance in the range of 0.5% to 10% by weight; Oral formulations preferably contain from 10% to 95% active ingredient.
Various delivery systems are known and can be used to administer a therapeutic product of the invention, for example, encapsulation in liposomes, microparticles and microcapsules: use of recombinant cells that can express the therapeutic product, use of receptor-mediated endocytosis (e.g., Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432); construction of a therapeutic nucleic acid as part of a retroviral vector or other vector, etc. The methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural and oral routes. The compounds can be administered by any convenient route, for example by infusion, by bolus injection, by absorption through epithelial or mucocutaneous coatings (for example, oral, rectal and oral mucosa).
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
intestinal, etc.), and can be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration may also be employed, for example, by the use of an inhaler or nebulizer and formulation with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area that needs treatment. This can be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, for example, together with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an Implant, said implant being a porous, non-porous or gelatinous material, including membranes, such as sialastic membranes, or fibers. In one embodiment, administration may be by direct injection into the site (or anterior site) of a malignant tumor or neoplastic or preneoplastic tissue.
In another embodiment, the therapeutic product can be administered in a vesicle, in particular a liposome (Langer, 1990, Science 249: 1527-1533), more particularly a cationic liposome (WO 98/40052).
In yet another embodiment, the therapeutic product can be administered by a controlled release system. In one embodiment, a pump (Langer, cited above) can be used. In yet another embodiment, a controlled release system may be placed near the therapeutic target, thus requiring only a fraction of the systemic dose.
A method for sensitizing tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy is also disclosed, comprising administering to the patient an effective amount of an anti-L1 antibody or binding molecule. All the embodiments described above also apply to this method.
Throughout the invention, the term "effective amount" means that a given molecule or compound is administered in an amount sufficient to obtain a desired therapeutic effect. In the case in which, throughout the Invention, two compounds are administered in an effective therapeutic amount, this includes that one or each of the compounds is administered in an amount less than the therapeutic, that is to say that the amount of each compound by itself is not sufficient to provide a therapeutic effect, but that the combination of the compounds results in the desired therapeutic effect. However, it is also included within the present invention that each of the compounds itself be administered in a therapeutically effective amount.
In another aspect of the invention, the invention relates to the binding molecule of the invention for use in a method of treating tumor cells in a patient previously treated with a chemotherapeutic drug or with radiation therapy.
As mentioned earlier, the treatment of tumor cells with anti-L1 antibodies has already been described in WO 02/04952 and WO 06/013051.
In the context of the present invention, the term "treated above" may include patients who have already been treated with a chemotherapeutic drug or radiotherapy during a separate regimen that has taken place, for example, within the last term. Six or eight months.
In the course of anti-tumor treatment with chemotherapeutic drugs or radiotherapy, in most cases it is observed that, after an initial response of the tumor to such therapy (reduction of tumor mass or stabilization of the disease), the tumors begin to progress again. Usually, such progression begins weeks or months after such therapy. Normally these tumors are then resistant to additional treatments with the chemotherapeutic drug applied above and other treatment modalities are desired. As described above, it has been found that such resistant tumors express L1 and, therefore, become a target for anti-L1 antibodies.
Therefore, according to this embodiment of the invention, the expression "treated above" preferably means that the patient previously received such treatment, such treatment showed an initial effect and, at the time of therapy with the anti-L1 antibody or the drug molecule. union, the tumor is progressing again.
In addition, the expression "treated above" can also be observed in a context in which the L1 anti-L1 antibody or the binding molecule and the chemotherapeutic drug or radiotherapy are used within the same regimen, which means that the treatments are administered within a treatment calendar. In this context "in a treatment calendar" means that the treatments are applied at the same time, one after the other or intermittently, but, unlike the above, the distances in time between individual treatments are short (in the within one week or within 2-4 days) and, if successful treatment is observed, tumor progression is not expected before the next treatment is applied.
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
Preferably, in this context, the invention includes the case in which a patient is treated with a chemotherapeutic drug or with radiation therapy and subsequently, preferably within a week or less and more preferably within 2-4 days, a treatment is started with the binding molecule of the invention. In an additionally preferred embodiment, several cycles of chemotherapy or radiotherapy are carried out on the one hand and treatment with the anti-L1 antibody or binding molecule, with intervals preferably of a week or less and more preferably within 2- 4 days.
In a preferred embodiment, the patient is at least partially resistant to treatment with said chemotherapeutic drug or with radiation therapy, an effect often observed in the course of said types of treatment (see above).
In a further aspect, the invention relates to a binding molecule of the invention for use in a method of treating tumor cells in a patient at least partially resistant to a treatment with a given chemotherapeutic drug or radiotherapy.
In the context of the present invention, the term "treatment resistant" means that the respective tumor cell does not react to treatment with a chemotherapeutic drug or radiotherapy completely. Instead, with respect to these tumor cells, treatment with said chemotherapeutic drug or radiotherapy is rather ineffective or even shows no effects.
In a further aspect of the invention, the invention relates to the binding molecule of the invention for use in a method of treating a tumorgenic disease, in which the binding molecule is administered in combination with a chemotherapeutic drug or with radiotherapy, preferably wherein the chemotherapeutic drug or radiotherapy is administered before the binding molecule of the invention.
According to the invention, the expression "treatment of tumor-like disease" includes both the destruction of tumor cells, the reduction of tumor cell proliferation (for example by at least 30%, at least 50% or at least 90%) as well as the complete inhibition of tumor cell proliferation. In addition, this expression includes the prevention of a tumor-like disease, for example, by destroying cells that may or are likely to become tumor cells in the future as well as the formation of metastases.
According to the invention, the expression "in combination with" includes any combined administration of the binding molecule and the chemotherapeutic drug or radiotherapy. This may include the simultaneous application of drugs or radiotherapy or, preferably, a separate administration. In the case where a separate administration is envisaged, it will preferably be ensured that a significant period of time will not pass between the time of administration, so that the binding molecule and the chemotherapeutic drug or radiotherapy can still have an advantageously combined effect. over the cell In such cases, it is preferred that the cell be contacted with both agents within approximately one week, preferably within approximately 4 days, more preferably within approximately 12-36 hours with each other.
The rationale behind this aspect of the invention is that the administration of chemotherapeutic drugs or treatment with radiotherapy leads to an increase in the expression of L1 on the surface of the tumor cells which in turn makes the tumor cells a better target for the binding molecule.
Therefore, this aspect of the invention also encompasses treatment regimens in which the binding molecule is administered in combination with the chemotherapeutic drug or radiotherapy in various treatment cycles in which each cycle can be separated for a period of time without treatment that can last, for example, two weeks and in which each cycle may involve repeated administration of the binding molecule and / or the chemotherapeutic drug or radiotherapy. For example, such a treatment cycle may include treatment with a chemotherapeutic drug or with radiation therapy, followed, for example, by applying the binding molecule twice within 2 days.
Throughout the invention, the expert will understand that the individual therapy to be applied will depend, for example, on the physical condition of the patient or the severity of the disease and, therefore, will have to be adjusted in each case.
Especially in the course of such repeated treatment cycles, it is also provided within the present invention that the binding molecule be administered before the chemotherapeutic drug or radiotherapy.
A method of treating tumor cells is also disclosed in a patient previously treated with a chemotherapeutic drug or with radiation therapy, which comprises administering to the patient a therapeutically effective amount of the anti-L1 antibody or the binding molecule. In addition, the description refers to a method for treating tumor cells in a patient, at least partially resistant to treatment with a given chemotherapeutic drug or radiotherapy, which comprises administering to the patient a therapeutically effective amount of the anti-L1 antibody or molecule. Union. In addition, the description relates to a method for treating tumor cells in a patient, which comprises administering to the patient a therapeutically effective amount of the anti-L1 antibody or the binding molecule in combination with a chemotherapeutic drug or with radiation therapy. In addition, the description
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
refers to a method of treating tumor cells in a patient, which comprises administering to the patient a therapeutically effective amount of the anti-L1 antibody or the binding molecule.
The antibody can also be used in a method for a diagnostic method to determine the level of the L1 protein in body fluids or tissues.
With respect to these methods, it is disclosed that all the embodiments described above also apply to the other uses or methods.
The invention also relates to the binding molecule of the invention for use in a method of treating a tumorgenic disease or for sensitizing tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy.
In a preferred embodiment, said use also has the characteristics defined for the uses of the invention.
The invention also relates to pharmaceutical compositions comprising the binding molecule of the invention. With respect to said pharmaceutical composition, all the embodiments described above also apply.
The invention is further illustrated by the following figures and examples.
Legends for figures and tables
Figure 1
(A) FACS analysis of CHO, CHO-L1, SKOV3ip and OVMz cells. The cells were stained with the indicated mAbs (10 | jg / ml) for 30 min at 4 ° C. Followed by a mAb conjugated with secondary PE. (B) Western blot analysis. Cell lysates of CHO wt, CHO-L1, OVMz and SKOV3ip cells were transferred onto a PVDF membrane and then incubated with the mAb indicated against L1 (1 jg / ml), followed by a secondary mAb conjugated with POX.
Figure 2
(A) Effect of antibodies on phosphorylation of Erk in SKOV3ip cells. Cells were incubated for 24 h at 37 ° C with the purified antibodies indicated against L1 (10 jg / ml) or isotype control IgG1. The cells were also treated with dMsO (vehicle), or the specific MEK inhibitor, PD59098. Cell lysates were examined to determine Erk phosphorylation. (B) Effect of antibodies on phosphorylation of Erk in SKOV3ip cells. Fluorescent staining of antibody treated cells with a phospho-Erk specific antibody and a secondary mAb conjugated to Alexa488.
Figure 3
Matrigel cell invasion analysis. SKOV3ip cells treated with antibody (10 jg / ml) were seeded in a 4-well plate and allowed to invade the Matrigel for 20 h (5% CO2; 37 ° C).
Figure 4
Differential gene expression in SKOV3ip cells. (A) SKOV3ip cells were transfected with L1-specific or disorganized siRNA and 72 h later, mRNA was isolated, transcribed to give cDNA and used as a template for qPCR (SYBRgreen analysis). (B) SKOV3ip cells were treated with the mAb L1-9.3 (10 jg / ml) or the control mAb, IgG1 (10 jg / ml) and 96 h after which mRNA was isolated, transcribed to give cDNA and analyzed by qPCR to determine the expression of the indicated genes (SYBRgreen analysis). (C) Differential gene expression of residual tumor cells. Residual tumor mRNAs were isolated from animals treated with antibody, transcribed to cDNA and analyzed by qPCR to determine the expression of the indicated genes.
Figure 5
Tumor growth in nude mice. I.p. SKOV3ip cells labeled with LacZ in nude mice and, after tumor implantation, the animals were treated with the indicated mAbs against L1 or control mAbs, EpCAM (Hea125). After 30 days, the tumor volume was determined and provided as the ratio between the tumor mass stained with X-Gal and the total sites. 6 animals were analyzed per group.
Figure 6
(A) Western blot analysis of L1-V5 constructs. Supernatants of Sf9 insect cells transfected from Ricardo Gouveia were received and analyzed by Western blot using L1-9.3 mAb and re-analyzed with probe by anti-V5 mAb. (B) Western blot analysis of L1-FC constructs. L1-FC constructs were transfected into Cos-7 cells
5
10
fifteen
twenty
25
30
35
40
Four. Five
using Jet PEI® transfection reagent, as described. After 3 days, the supernatants were purified using SepharoseA and analyzed by Western blot using mAb L1-9.3.
Figure 7
Homophilic cell adhesion assay. (A) J558-L1 cell binding was analyzed by bright field microscopy. In this case, an example of each treatment is shown. In the red box the coating with L1-Fc (10 | jg / ml) stands out and in the black box both controls, fibronectin (10 jg / ml) and BSA are shown. (B) The graph shows the mean + SD of bound cells after treatment with antibody or control indicated.
Figure 8
In Figures 8a and 8b, respectively, the light chain and heavy chain antibody DNA sequences used to construct the humanized antibodies are provided.
Figure 9
Amino acid sequences of the murine scFv of L1_9.3 (a) and the humanized scFv of L1_9.3Hu (b) and L1_9.3Hu3 (c).
Figure 10
DNA and amino acid sequences of the expressed parts of scFv constructs of L1_9.3 (a), L1-9.3Hu (b) and L1_9.3Hu3 (c).
Figure 11
Binding of the scFv of L1_9.3, L1-9.3Hu and L1_9.3Hu3 to the human L1 cancer antigen. Rows A, B and C are coated with L1 and rows D, E and F are coated with streptavidin. The blue color in the wells indicates the binding of the individual scFv to the L1 on the plate. The absence of color in the streptavidin coated rows shows that single chain antibodies specifically bind to L1.
Figure 12
Genomic sequences of the variable domains of the monoclonal antibody 9.3.
a) Sequence of the variable region of the kappa chain (dotted lines: CDR1, dashed lines: CDR2, underlined: CDR3).
b) Sequence of the heavy chain variable region (dotted lines: CDR1, dashed lines: CDR2, underlined: CDR3).
Figure 13
A) PBMC and human L1-positive OVMZ tumor cells were incubated with mAb L1-9.3 for 24 h and the amount of bound antibody was determined by FACS analysis.
B) The dissociation constants Kd were estimated from the regression curves using the concentration at half of the maximum junction.
Figure 14
L1-9.3 has no effect on the release of cytokines by resting and activated human PBMCs. The resting PBMC cytokine levels and activated by OKT3 were determined from three different donors after incubation for 24 h in the presence or absence of L1-9.3 at 20 jg / ml. Ionomycin / PMA and LPS were used as stimulation controls. The results for IFN-y (A) and TNF-a (B) are shown.
Figure 15
L1-9.3 does not induce T cell proliferation and has no effect on OKT3 induced T cell proliferation. The proliferation of PBMC activated by OKT3 was determined from two different donors in the presence or absence of L1-9.3 at 20 jg / ml using a BrdU incorporation assay 48 h after stimulation. There was no difference in whether the antibody was added before, in parallel with or after stimulation with OKT3 at 75 ng / ml. L1-9.3 by itself did not result in the activation of T cells.
Figure 16
L1-9-3 was not affected by the deglycosylation of L1. Western blot staining of L1 in untreated and deglycosylated cell lysate using several different anti-L1 mAbs is shown. The antibodies tested can be divided into three classes with respect to their dependence on glycosylation: first class
5
10
fifteen
twenty
25
30
35
40
Four. Five
(not affected by glycosylation): L1-9.3. Second class (WB binding was negatively affected by deglycosylation): 11A, 14.10, OV52.24 and OV549.20. Third class (WB binding was positively affected by deglycosylation): 35.9 and 38.12.
Figure 17
The figure shows the in vivo binding of L1-9.3 applied intravenously to collecting tubules of the kidney. In vivo binding was only detectable using the CSA amplification system (Figure 17A), while using the conventional ABC method no signal could be seen (Figure 17B). Thus, L1-9.3 was detected in a range of 30-300 pmol in the tissue (the concentration of L1-9.3 is assumed to be greater than 5 ng / ml and less than 50 ng / ml). The negative control did not show staining, therefore, non-specific staining can be ruled out (Figure 17C). The staining pattern of L1-9.3 bound in vivo (Figure 17A) corresponds to the expression pattern of L1 in the kidney when tissue sections are stained directly with L1-9.3 (Figure 17D).
Figure 18
Humanized mAb L1-9.3 FACS analysis
Flow cytometry analysis of SKOV3ip cells with pcDNA3.1-luciferase. The cells were stained with the indicated humanized mAbs (10 pg / ml) for 30 min, 4 ° C, followed by a secondary PE conjugated mAb.
Figure 19
Mouse SKOV3ip xenograft model
7 * 106 SKOV3ip cells with pcDNA3.1-luciferase were injected intraperitoneally into 6-week-old female CD1 nu / nu mice. After 24 h the mice were randomized into groups of 10 mice. Each group of mice was injected intraperitoneally three times per week 300 pg of either mAb L1-chi9.3, either mAb L1-hu3 or PBS.
On day 33, images of the mice were obtained (Figure 2). Tumor volume was determined using the XENOGEN IVIS 200 system. In summary, mice were anesthetized and 100 pl of luciferin D (3 pg / mouse) were injected intraperitoneally. After this, the luciferase activity of the tumor cells was measured by detecting the emission of light. Tumor volume is shown as photons per second (total flow). Statistical analysis was performed using the Student's t-test.
Figure 20
Total tumor mass in vivo
After 36 days the mice were sacrificed and the tumor mass was determined. Tumor growth is facilitated as a reason for tumor mass with respect to body weight. (A individual mice, B average value). Statistical analysis was performed using the Student's t-test. Therefore, the treatment of mice immunodeficient with L1 9.3 antibody could be reproduced with chimerized and humanized forms of the mAb L1 9.3.
Figure 21
PT45-P1res cells were either left untreated (without) or treated with gemcitabine at 20 pg / ml (A) or etoposide (B) in the absence (without) or presence of either 9.3 anti-L1CAM antibody at 1 or 10 pg / ml or isotype control antibody matching 1 or 10 pg / ml. After 24 hours, the cells were analyzed by caspase-3 / -7 assay. The means ± SD of three independent experiments are shown. * indicates p <0.05.
Figure 22
Colo357 cells were either left untreated (without) or treated with gemcitabine at 20 pg / ml (A) or etoposide (B) in the absence (without) or presence of either 9.3 anti-L1CAM antibody at 1 or 10 pg / ml or isotype control antibody matching 1 or 10 pg / ml. After 24 hours, the cells were analyzed by caspase-3 / -7 assay. The means ± SD of three independent experiments are shown. * indicates p <0.05.
Table 1
The table shows a summary of the antibodies tested in the indicated assays.
EXAMPLES
1. Example 1
1.1 Summary of Example 1
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
55
The L1 adhesion molecule (L1-CAM) is a transmembrane cell adhesion molecule involved in cell migration and axon orientation in the developing nervous system. L1 is also overexpressed in ovarian and endometrial carcinomas. In this case the expression of L1 is associated with a poor prognosis. In carcinoma cell lines, overexpression of L1 increases cell motility, tumor growth in mice and induces the expression of Erk-dependent genes. In this case, it is shown that treatment with antibodies against L1 suppresses the activation of Erk, blocks the invasion of cells to Matrigel and decreases tumor growth in nude mice. In cells treated with antibodies against L1 the induction of Erk-dependent genes, such as HOX A9, p3-integrin and IER 3 is reversed in vitro and in vivo. In this report, it is shown that the L1-9.3 antibody is the best therapeutic antibody of all tested antibodies against L1. In all cases, L1-9.3 showed the best results regarding the invasive phenotype or the therapeutic effect on tumor growth. It can be shown that L1-9.3 binds to the first Ig-like domain of L1 and can block the homophilic junction L1-L1. Homophilic junction block was only observed with L1-9.3. It is concluded that L1-9.3 is superior in therapy as it combines two functions: it blocks the activation of erk and interferes with the binding function of L1.
1.2 Results of example 1
1.2.1 FACS analysis of the new antibodies against L1
Using immunization with a recombinant L1-Fc fusion protein, antibodies against novel L1-9.3, L1-14.10, L1-35.9 and L1-38.12 were generated. To clarify the specificity for L1, the new mAbs against L1 were tested for these antibodies in the ovarian carcinoma cell lines expressing endogenous LV OVMz and SKOV3ip and the Chinese hamster ovarian CHO cells and CHO- cells stably transduced L1 by fluorescent staining (Figure 1A) and Western blot analysis (Figure 1B). All antibodies tested showed a positive staining of L1 in CHO-L1 cells (Figure 1A). The staining pattern for the OVMz and SKOV3ip cells was different for the antibodies. Interestingly, the L1-9.3 antibody showed a bright staining of both OVMz and SKOV3ip ovarian carcinoma cell lines, while L1-14.10 showed a very weak staining (Figure 1A). Neither of the two antibodies against l1, L1-35.9 and L1-38.12, could bind to the endogenous L1 of these cells (Figure 1A). As expected, no staining for L1 could be observed in CHO cells that were used as a negative control. All new antibodies detected full-length L1 in lysates of CHO-L1, OVMz and SKOV3ip cells by Western blot analysis. CHO cells negative for L1 again served as a negative control.
1.2.2 Erk phosphorylation decreases after antibody treatment
A recent report has shown that L1 expression in collaboration with serum-derived growth factors led to sustained Erk activation and induction of Erk-dependent genes (Silletti et al, 2004). It was investigated whether the suppressive effect of antibodies against L1 could be due to interference with L1-mediated gene regulation. Therefore, the mode of action of antibodies against L1 was examined using SKOV3ip cells. The mAbs L1-11A, L1-9.3 and L1-14.10 effectively blocked Erk phosphorylation (Figure 2A) in vitro. There was no inhibition with matching isotype control mAb, DMSO as a vehicle or the antibody against L1, L1-38.12 (Figure 2A) that can only bind to the neuronal isoform of L1. Fluorescent analysis with the phospho-specific Erk antibody confirmed a clear reduction of activated Erk. Depletion from the nucleus could also be observed in cells treated with mAb against L1 (L1-11A, L1-9.3 and L1-14.10) (Figure 2B).
1.2.3 Antibody treatment against L1 reduced cell invasion
It was previously shown that treatment with an antibody against L1 (L1-11A) reduced haptotactic cell migration on fibronectin and Matrigel invasion of different cell lines (Arlt et al, 2006). The invasion capacity of SKOV3ip cells treated with the different antibodies against L1 was compared. The L1-11A, L1-14.10 and especially L1-9.3 antibodies reduced the invasion of SKOV3ip (Figure 3). In stark contrast, the cells treated with the L1-35.9 or L1-38.12 antibodies did not show a reduction in invasion (Figure 3).
1.2.4 Antibodies against L1 affect gene expression in vitro and in vivo
It was further examined whether antibodies against L1 affected the gene expression profile in SKOV3ip cells in vitro in a manner similar to that observed for depletion mediated by L1 siRNA (Figure 4A). In fact, analysis by qRT-PCR of cells treated with L1-9.3 or L1-11A against control antibody showed significant changes in the expression of genes regulated by L1 such as p 3-integrin, HOXA9 transcription factors and genes related to apoptosis IER 3 and STK 39 (Figure 4A). The same set of genes was regulated by decrease in SKOV3ip cells transduced with a specific siRNA of L1 (Figure 4B).
It was tested if the mAb L1-9.3 could also influence the gene expression profile of SKOV3ip cells in vivo in a manner similar to that observed in vitro. To do this, mRNA was isolated from residual tumors of mice treated with L1-9.3 or mice treated with IgG control and subjected to analysis by qRT-PCR. Treatment with L1-9.3 led to significant regulation of L1 dependent genes as demonstrated for HOXA9, p3-integrin and iEr 3 (Figure 4C).
1.2.5 Tumorigenicity analysis in nude mice
Next, it was investigated whether intraperitoneal growth of SKOV3ip in mice could be inhibited by treatment with mAbs L1-11A, L1-9.3 or L1-14.10. SKOV3ip-lacZ cells were injected into the peritoneal cavity of female nude mice 2 days before the start of therapy. Biweekly, 5 i.p. treatments were performed. using the antibody concentration of 10 mg / kg. Control mice were treated with PBS or HEA125 (anti-EpCAM antibody) as a control antibody (10 mg / kg b.weekly). In all the anti-L1 mAb treatment groups, a substantial decrease in the amount of tumor mass was observed compared to PBS or the HEA-125 control antibody (Figure 5). Compared to the control, all anti-L1 mAbs led to a dose-dependent reduction in tumor burden i.p. [L1-11A (10 mg / kg), -40%; L1-14.10 (10 mg / kg), - 10 30%; L1-9.3 (10 mg / kg), -60%; figure 5]. The tumor reduction in the group treated with L1-9.3 (10 mg / kg) was
Statistically significant (PL1-9.3 (10 mg / kg) = 0.004) compared to the PBS control. Mice treated with the HEA125 control antibody revealed no detectable reduction in tumor burden i.p. of SKOV3ip-lacZ compared to the group treated with PBS (Figure 5), although EpCAM is present in SKOV3ip and HEA125 cells can bind to tumor cells. There were no side effects or serious toxicity of treatment with mAb against L1, L1-11A, L1-9.3 or L1-14.10, during the entire course of treatment.
Therefore, treatment with antibodies against L1 reduced the tumor growth of SKOV3ip cells (Figure 5) suggesting that antibodies against L1 can regulate gene expression but also affect tumor growth in vivo.
1.2.6 Biacore study of the new antibodies against L1
20 This study was carried out by Avidex (Oxford) as described in example 6. Table 1 summarizes these results concerning the binding kinetics of the new antibodies against L1 (ka, kd and KD).
1.2.7 Mapping of epitopes of the binding site of L1-9.3
An important factor for the characterization of novel antibodies against L1 is to examine their binding sites in L1. Thus, a variety of L1-Fc fusion proteins that covered different parts of the molecule were constructed. The PCR products encoding different lengths of L1 ectodomain regions were amplified. These constructs were cloned into the plg vector, and expressed as Fe fusion proteins. After purification, the products were used for analysis by Western blot. To compare the results, other recombinant L1 protein fragments (obtained from Ricardo Gouveia, Oeiras, Portugal) were analyzed. It was found that L1-9.3 bound to the first Ig domain of L1 (Figure 6). L1-14.10 binds to the third domain 30 of Ig while L1-11A binds between the FN3-5 site (Figure 6).
1.2.8 mAB L1-9.3 blocks the homophilic junction L1-L1
The question was raised whether antibodies against L1 could interfere with the homophilic binding function of L1. To address this issue, a cell adhesion assay was used in which cells transfected with L1 were allowed to bind to immobilized L1. After an initial coating of glass slides with a recombinant L1-Fc 35 fusion protein, fibronectin for positive control (to which the cells bind in an integrin-dependent manner) or BSA as a negative control, J558-L1 cells were incubated with antibody L1-11A, L1-9.3 or L1-14.10. For the control, an IgG, PBS control or an antibody against CD24 (SWA11) was used. The mAb L1-9.3 could completely block the homophilic binding L1-L1, while none of the other antibodies tested could interfere with the homophilic binding capacity. None of the antibodies interfered with fibronectin binding (data not shown).
1.3 Materials and methods
1.3.1 Cell lines and cell culture
The human ovarian carcinoma cell lines SKOV3ip (kindly provided by Ellen Vitetta, University of Texas, Dallas, TX) and LMOV in DMEM (Biochrom, Berlin, Germany) with 10% FcS were grown in 45 cell culture conditions ( 5% CO2, relative humidity 95%, 37 ° C). For identification and quantification of the tumor mass, SKOV3ip cells were stably transduced with a retroviral vector encoding lacZ (GeneSuppressor retroviral system, Biocarta, Hamburg, Germany). The Chinese CHO hamster ovary cell line that stably expresses human L1 (-hL1) was established by transfection with Superfect (Stratagene, Heidelberg, Germany) and selection to determine L1 expression with mAb L1-11A and magnetic beads 50 (Miltenyi Biotec, Bergisch Gladbach, Germany) or classification with a FACS Calibur instrument. All cells were cultured in DMEM supplemented with 10% FCS at 37 ° C, 5% CO2 and 100% humidity. Plasmids encoding human L1 and J558-L1 cells were obtained from Dr. Vanee Lemmon (University of Miami, Miami, FL, USA).
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
1.3.2 Antibodies
HEA-125, a mouse IgG1 directed against EpCAM, was described above and binds to all human adenocarcinomas (Moldenhauer et al., 1987). Monoclonal antibodies L1-14.10 (Huszar et al., 2006), L1-9.3, L1-35.9 and L1-38.12 were obtained after immunization of mice with human L1-Fc protein comprising the ectodomain of L1 (Oleszewski et al. , 1999). Goat anti-mouse IgG lgG antibody was purified by affinity and absorbed into human serum proteins (Zymed Laboratories, Inc., San Francisco, CA).
1.3.3 Biochemical analysis
SDS-PAGE and transfer of separated proteins to Immobilon membranes using semi-dry transfer have been described previously (Gutwein et al., 2000). After blocking with 5% skim milk in TBS or 1% BSA in TBS / 0.1% Tween-20, transfers were revealed with the respective primary antibody followed by peroxidase-conjugated secondary antibody and ECL detection.
1.3.4 FACS analysis
Surface staining of cells with saturating amounts of mAb, either hybridoma supernatants or purified antibodies, and goat antibodies conjugated to PE against mouse Ig (Dianova, Hamburg, Germany) has been described elsewhere (Ebeling et al., 1996). Stained cells were analyzed with a FACScan instrument (Becton Dickinson).
1.3.5 Immunofluorescence
For immunofluorescent staining, cells were grown on coverslips, treated for 10 min with pervanadate and fixed for 20 min with 4% paraformaldehyde / PBS at room temperature. The cells were washed in PBS and permeabilized with 0.1% NP-40 in PBS containing 5% goat serum for 15 min at room temperature. The cells were then incubated for 1 hour with the first antibody (against phospho-specific Erk1 / 2). After 3 steps of washing with PBS the cells were incubated for 30 min in the dark with a second goat lgG antibody conjugated with Alexa488 anti-mouse. After washing the cells twice with PBS, the stained cells were mounted on glass slides and examined with an epifluorescence microscope (Axioplan-2; Zeiss, Oberkochem).
1.3.6 Invasion Test
In vitro tumor cell invasion was determined in a double filter assay as described above in Erkell et al. (1988). In summary, a Matrigel layer was placed between two filters, a lower nitrocellulose filter with 5 pm pores and an upper polycarbonate filter with 8 pm pores. After incubation of 105 cells with the interleaved filter structure for 20 h in 1 ml of medium, the intercalated structure was fixed and the filters were separated and stained with DAPI. The cells present in the gel in the lower filter were counted, and the cell invasion was expressed as the ratio of the number of cells in the Lower filter with respect to the total number of cells present in both filters.
1.3.7 Quantitative PCR
For the qPCR the cDNA was purified on Microspin G-50 columns (GE Healthcare, Munich, Germany) and quantified by NanoDrop spectrophotometer (ND-1000. Kisker-Biotechnology, Steinfurt, Germany). Primers were designed for qPCR with the DNA Star program and produced by MWG (Ebersberg, Germany). P-actin was used as internal standard. The PCR reaction was performed with the SYBRgreen master mix (Applied biosystems, Darmstadt, Germany).
1.3.8 Cell binding assay
Cell binding assays to L1-Fc or fibronectin are described in detail in Oleszewski et al (JCB 2000).
1.3.9 Tumor model and therapy
Female pathogen-free CD1 nu / nu mice (7-9 weeks old; 20 g average; Charles River) were inoculated with 5 x 106 human ovarian carcinoma cells labeled with lacZ (SKoV3ip-lacZ) in the peritoneal cavity on day 0, leading to an ip tumor formation within 5 weeks. Anti-L1 mAbs were diluted in sterile PBS to the concentration necessary for treatment. Mice carrying tumor i.p. twice a week with a solution of 300 pl of the respective dosage (10 mg / kg per application, respectively), vehicle (PBS) or Hea125 antibody control. Antibody treatments started from day 3 after the injection of tumor cells to give the tumor cells time to attach to the inner side of the abdominal wall and the surfaces of the organs i.p. At autopsy (day 38), ascites samples were taken from all mice and the volume was determined. All organs i.p. (including tumor mass), abdominal wall and diaphragm, were stained with p-galactosidase substrate (X-gal; Roche-Diagnostics, Penzberg, Germany), photographed and weighed. The indigo blue tumor mass was removed between the
5
10
fifteen
twenty
25
30
35
40
Four. Five
organs, in the diaphragm and on the inner side of the abdominal wall, and weighed alone. The relative tumor load in each mouse was calculated by dividing the weight of the tumor mass by the weight of the total sites.
2. Example 2
Humanization of the murine anti-L1 antibody L1_9.3
In order to humanize the murine anti-L1 L1_9.3 antibody, the human genes v-kappa 1 (huiml), and the variable heavy chain family III (humlII) were used as the acceptor sequences. The numbering system used herein for these genes is adopted from Wu and Kabat (Kabat, E. A, Wu, TT, Perry, HM, Gottesman, KS and Foeller, C (1992) Sequences of proteins of immunological interest, Diane Books Publishing company). The light and heavy chain amino acid sequences of the murine antibody L1_9.3 were aligned against the amino acid sequences of the huirnl light chain and the humlll heavy chain, respectively. Two humanized L1_9.3 antibodies (L1_9.3Hu and Ll_9.3Hu3) were generated by replacing the corresponding CDRs of the murine antibody L1_9.3 with the six CDRs of the human antibody.
Locations of the six complementarity determining regions (CDR)
Kabat numbering scheme loop
LCDR1 L24-L34
LCDR2 L50-L56
LCDR3 L89-L97
HCDR1 H31-H35B
HCDR2 H50-H65
HCDR3 H93-H101
Several residues from the framework region of the murine antibody L1_9.3 were transferred to the humanized L1_9.3 antibodies:
Version 1 (L1_9.3Hu) humanized antibody - the heavy chain residue numbers 6, 23, 27, 30, 43, 49, 71, 73, 76, 78 and 94, and the chain residue number were transferred light 100 of the murine antibody L1_9.3 and the residue number of the light chain 73 was replaced by the corresponding one (Phe) found in this position in the light chain of human REI antibody.
Version 2 (L1_9.3Hu3) humanized antibody - the heavy chain residue numbers 6, 23, 27, 30, 71, 73 and 94, and the light chain residue number 100 of the murine antibody L1_9.3 were transferred.
DNA sequences were then generated encoding single chain variable fragment analogs (scFv) of murine antibody L1_9.3 and the two humanized versions of this antibody (L1_9.3Hu and L1_9.3Hu3) for expression in E. coli. All these scFv contain the same linker (TSGPGDGGKGGPGKGPGGEGTKGTGPGG). ScFv genes were synthesized by GeneArt AG, Germany.
In Figures 8a and 8b, respectively, the light chain and heavy chain antibody DNA sequences used to construct the humanized antibodies are provided.
Figures 9a-9c provide the amino acid sequences of the scFv of murine L1_9.3 and the scFv of humanized L1_9.3Hu and L1_9.3Hu3, respectively.
3. Example 3
Cloning of DNA encoding the scFv of L1_9.3, L1-9.3Hu and L1-9.3Hu3 in vectors of periplasmic expression of E. coli and transformation of E. coli with these vectors.
The periplasmic expression of scFv is beneficial for several reasons. First, such scFv escape within the bacterial supernatant and from there they can be conveniently tested for binding to their related antigen (in this case, the L1 cancer antigen). Second, periplasmic expression allows the purification of soluble active scFv.
The DNA sequences encoding the scFv of L1_9.3, L1-9.3Hu and L1_9.3Hu3 synthesized by GeneArt AG, Germany, were not supplied in a periplasmic expression vector of E. coli. Therefore, these DNA sequences were cloned into an periplasmic expression vector of E. coli using the following methods.
DNAs encoding scFv synthesized with the following primer pairs were rescued by PCR using conventional PCR conditions and reagents:
5
10
fifteen
twenty
25
30
35
40
Four. Five
scFv Pair of primers
L1_9.3 Yol811 and Yol812
L1-9.3Hu Yol813 and Yol814
L1_9.3Hu3 Yol813 and Yol814
The primer sequences are shown below.
Yol811 AGCCGGCCATGGCCGATATTCAGATGACCCAGAC
Yol812 TCTATGCAGCGGCGGCACCGCCGCTGCTCACGGTAACGCTG
Yol813 AGCCGGCCATGGCCGATATTCAGATGACCCAGAG
Yol814 TCTATGCAGCGGCCGCACCGCCGCTGCTCACGGTAACCAGGGTG
The PCR products were run on a 1.6% agarose gel and the bands of correct size were cleaved and purified. The PCR products were subjected to double digestion with restriction enzymes Nco1 and Not1 under conventional conditions followed by further purification. The PCR products were ligated into an IPTG inducible periplasmic expression vector containing:
- a pelB leader sequence to direct the encoded polypeptides to the periplasm in which this leader sequence is then cleaved
- cloning sites Nco1 / Not1
- the constant region of the human antibody kappa chain.
Linked vectors were transformed into E. coli TG1 cells and plated on 2xTY agar (16 g / l tryptonic bacto, 10 g / l yeast extract, 15 g / l agar bacto and 5 g / l NaCl) supplemented with 100 pg / ml ampicillin and 2% glucose. Figures 10a, 10b and 10c, respectively, show the DNA and amino acid sequences of the expressed portions of scFv constructs of L1_9.3, L1-9.3Hu and L1_9.3Hu3.
4. Example 4
Expression of single chain antibodies L1_9.3, L1-9.3Hu and L1_9.3Hu3 in E. coli
Polypeptides expressed by these vectors include the c kappa constant region of human antibody fused with the C-terminal ends of scFv. These constructs containing c kappa constant chain are referred to herein as single chain antibodies.
Eight clones of E. coli were chosen for each single chain antibody construct, L1_9.3, L1_9.3Hu and L1_9Hu3, (24 clones in total) in separate wells of a 96-well plate containing 300 pl of 2xTY (Bacto Tryptone 16 g / l, yeast extract 10 g / l and NaCl 5 g / l) supplemented with 100 pg / ml ampicillin and 2% glucose. Each well had a volume of 1 ml. Cultures were grown with agitation (200 rpm) at 37 ° C until the cultures reached an OD600 of approximately 0.5. The 96-well plates were then centrifuged at 3200 rpm for 10 min and the supernatant was aspirated and discarded. Bacterial sediments were resuspended in 400 µl of new 2XTY supplemented with 100 pg / ml ampicillin and 1 mM IPTG to induce expression of single chain antibodies. The cultures were shaken at 200 rpm overnight at 25 ° C.
The next day, the 96-well plate was centrifuged at 3200 rpm for 10 min to pellet the cells. The supernatant containing the single chain antibodies against L1 expressed for analysis by ELISA was retained.
5. Example 5
ELISA assay of binding of scFv of L1_9.3, L1-9.3Hu and L1_9.3Hu3 to human L1 cancer antigen
This ELISA was carried out in order to confirm that the humanization procedure had not led to a loss of antibody binding to the L1 cancer antigen and to identify which of the chosen clones correctly expressed the single chain antibody constructs.
Three rows of a 96-well plate were coated with 100 µl of L1 antigen comprising the extracellular domain of the L1 protein fused with an Fc fragment (5 pg / ml) in PBS for 1 h at room temperature. Three additional rows were coated with streptavidin (5 pg / ml) in PBS as a control.
The wells were washed three times with 370 pl of PBS and blocked with 3% milk powder in PBS for 1 h at room temperature.
5
10
fifteen
twenty
25
30
35
40
Four. Five
fifty
50 µl of each bacterial supernatant was mixed overnight with 50 µl of 6% milk powder in PBS for 1 hour.
The blocked ELISA plate was washed twice with PBS, as described above, and the blocked supernatants containing the single chain antibody were added and incubated for 1 h at room temperature.
The 96-well plate was washed four times with PBS / 0.1% tween followed by the addition of 100 µl of a 1: 5000 dilution of HRP conjugate and free and bound antibody to anti-human kappa light chains (Sigma A7164) in PBS / 1% BSA. The conjugate was incubated for 1 h at room temperature followed by five washes with 0.1% PBS / tween.
The ELISA assay was revealed by the addition of TMB 2-component peroxidase substrate kit for microwells (Kirkegaard and Perry Laboratories Inc., USA) according to the manufacturer's protocol. An image of the ELISA plate is shown in Figure 4. At least four L1 binding clones were observed for each of the three versions of single chain antibody. These L1-binding single chain antibody clones do not bind streptavidin.
Figure 11 shows the binding of the scFv of L1_9.3, L1-9.3Hu and L1_9.3Hu3 to the human L1 cancer antigen. Rows A, B and C are coated with L1 and D, E and F are coated with streptavidin. The blue color in the wells indicates union of the individual scFv to the L1 on the plate. The absence of color in the streptavidin coated rows shows that single chain antibodies specifically bind to L1.
6. Example 6
Determination of binding affinity
Mouse antibody L1-9.3 and humanized antibody L1-hu3 were tested by Biacore analysis (Biacore AB, Uppsala, Sweden) to determine binding kinetics.
A BIAcore CM5 sensor chip with EDC / NHS was activated and extracellular fragment of purified recombinant L1-Fc (515 jg / ml in PBS) was coupled to the CM5 sensor chip at 200 to 3000 UR. The remaining active sites were blocked by ethanolamine / HCI. Antibody binding was measured by adding antibody at concentrations from 6 to 3333 nM at a flow rate of 10 ul / min using the Kinject function. The chip was regenerated with 10 mM glycine, pH 2.0 with 500 mM NaCl to remove bound antibodies.
Binding curves were adjusted to a Langmuir binding model using BIAevaluation software (Biacore AB, Uppsala, Sweden). Table 2 shows the determined KD values.
 Table 2
 Antibody  L1-9.3 L1-hu3
 Ka [1 / Ms]  2.6 x 105 8.0 x 105
 Kd [1 / s]  2.2 x 10'5 6.5 x 10'5
 KD [M]  8.5 x 10'11 8.1 x 10'11
Table 2: The humanized variant L1-hu3 has a high affinity for target similar to the original antibody L1-9.3.
7. Example 7
Binding of antibody to PBMC and cancer cells
PBMC were obtained by density gradient centrifugation from whole blood with EDTA from healthy human donors. OVMZ tumor cells cultured by trypsination were collected. 1 x 105 cells / well (75 ml) were seeded in FACS tubes. Dilutions of mAb L1-9.3 were prepared in culture medium with 10 mM EDTA and 75 jl / well of dilution of mAb against L1 were added to PBMC and OVMZ cells to result in final concentrations between 6.6x10 "13 and 6 , 6x10-8 M. Subsequently, the cells were incubated overnight (~ 24 h) at 37 ° C / 5% CO2 in an incubator.The cells were washed directly in FACS tubes using 2 ml of FACS buffer followed by centrifugation at 300 g / 5 min / 4 ° C. The supernatant was removed by pipetting.For staining, a secondary donkey antibody labeled with anti-mouse PE (Dako) was added at a volume of 150 ml / well followed by incubation for 30 min at 4 ° C. Washing steps were repeated as above and the cells were fixed in 200 µl of PBS / 1% formaldehyde, then the average fluorescence of the sample was measured by FACS analysis.
As shown in Figure 13, mAb L1-9.3 has a strongly reduced affinity for L1 in PBMC compared to tumor L1. L1-9.3 binding to PBMC was detected in the nanomolar range (dashed line),
while tumor cell binding could be observed at picomolar concentrations (solid line). B) The dissociation constants Kd were estimated from the regression curves using the concentration at half of the maximum junction. KD of L1-9.3 in CMSP was at least 400 times lower than that in tumor cells.
8. Example 8
5 Determination of cytokine release
PBMC were obtained by density gradient centrifugation from whole blood with citrate from healthy human donors. The cells were resuspended in RPMI 1640/5% human serum / 5 ml of NEAA / 5 ml of L-glutamine / 5 ml of sodium pyruvate. 1x105 cells were seeded per 100 pl in round bottom 96-well plates. In a second stage, 100 µl of medium containing LPS (10 ng / ml), mAb L1-9.3 (20 pg / ml), 10 mAb OKT3 (Ebioscience) (75 ng / ml) or ionomycin / pMA (1) were added pg / ml / 5 ng / ml) in triplicate followed by incubation for 24 h at 37 ° C, 5% CO2. As a negative control, untreated PBMC were used. After 24 h, the cytokine interferon-gamma levels and the tumor necrosis factor were measured by FACS analysis using the flexible CBA (BD) cytokine assemblies according to the manufacturer's information.
The resulting cytokine levels are shown in Figure 14. Unlike the OKT3 mAb, ionomycin / PMA and 15 LPS, L1-9.3 did not significantly increase the release of TNF or IFN-gamma by PBMC.
9. Example 9
T cell proliferation assay
PBMC were obtained by density gradient centrifugation from whole blood with citrate from two healthy human donors. 1x10 ° cells were seeded per well in flat-bottom 96-well plates. In a second stage, 100 pl of medium containing either mAb L1-9.3 (20 pg / ml) and OKT3 (Ebioscience, 75 ng / ml) or mAb L1-9.3 (20 pg / ml) or OKT3 were added (75 ng / ml) in triplicate. After 1 h, the last two were supplemented with OKT3 or L1-9.3, respectively. To exclude any activation related to the antibody, PBMC were incubated with or without L1-9.3 in the absence of OKT3. After incubation for 24 h at 37 ° C, 5% CO2, T cell proliferation was evaluated using a BrdU incorporation assay (Roche) according to the manufacturer's information.
From the results shown in Figure 15, it can be concluded that mAb L1-9.3 does not induce T cell proliferation or inhibit OKT3 induced T cell proliferation.
10. Example 10
Dependence of glycosylation of antibody binding
30 2x106 SKOV3ip cells were seeded in a 10 cm Petri dish and incubated for 24 h at 37 ° C, 5% CO2. After 24 h, the cells were washed with PBS and lysed with 500 μl of M-PER reagent (Pierce) according to the protocol described in the Seize classical mammalian immunoprecipitation kit (Pierce). Lysates of SkOv3ip cells were deglycosylated as described in the Enzymatic CarboRelease kit (QA_Bio). In summary, 2.5 μl of denaturation solution was added to 35 μl of cell lysate. The sample was incubated in a thermoblock at 100 ° C for 5 min and then cooled on ice. Finally, 2.5 pl of Triton-X and 1 pl of each glycosidase contained in the Enzymatic CarboRelease kit (QA_Bio) (PGNase F, O-glycosidase, sialidase, (p-galactosidase, glucoaminidase) were added according to the manufacturer's protocol followed by an incubation at 37 ° C for 3 h. Glycosylated and deglycosylated products were subjected to SDS PAGE and subsequent Western blotting. Western blots were incubated with different antibodies against L1 depending on their staining performance. 1 pg / ml (9.3, 11A and 14.10), 5 pg / ml (35.9) or 10 pg / ml (OV52.24, OV543.18, 38.12, OV549.20) Antibody binding against l1 to Western blotting with anti-mouse HRP-labeled antibody (Dianova).
As shown in Figure 16, the anti-L1 antibodies tested can be divided into three classes with respect to their dependence on glycosylation: First class (not affected by glycosylation): L1-9.3. Second class (WB binding was negatively affected by deglycosylation): 11 A, 14.10, OV52.24 and OV549.20. Third class (WB binding was positively affected by deglycosylation): 35.9 and 38.12.
11. Example 11
Biodistribution of L1-9.3 in rabbit
A female rabbit (Himalayan white) was injected twice with L1-9.3 (0 h, 24 h) by intravenous route 50 at a dose of 10 mg / kg. 1 control animal received a comparable volume of PBS. Autopsy of the animals was performed 72 h after the first application. The organs were fixed in 4% buffered formalin and embedded in paraffin. Histological sections were prepared and immunohistochemistry was performed. Tissue sections of the animal treated with L1-9.3 and the control were stained with an anti-mouse antibody to detect the binding of L1-9.3 after intravenous application. Signals were visualized by DAB (Sigma). Two detection systems were used
5
10
fifteen
twenty
25
30
35
40
different, conventional avidin / biotin complex method or CSA II (Dako) tyramide signal amplification system method, which allowed a sufficient estimate of the amount of L1-9.3 bound in vivo. The conventional avidin / biotin complex method (Vector Laboratories) can detect L1-9.3 concentrations of 50 ng / ml or higher, while the CSA II biotin-free tyramide signal amplification system (Dako) has a limit of 5 ng / ml detection. To determine the expression pattern of L1, tissues of the control animal were incubated with primary L1-9.3 antibody and with the detection antibody. For the ABC method a biotinylated anti-mouse antibody (Dianova, 1: 3000 dilution) was used as the detection antibody, the CSA method was performed according to the manufacturer's protocol.
Figure 17 shows the in vivo binding of L1-9.3 applied intravenously to kidney collecting tubules. Binding could only be detected in vivo using the CSA amplification system (Figure 17A), while using the conventional ABC method no signal could be seen (Figure 17B). Thus, L1-9.3 was detected in a range of 30300 pmol in the tissue (the concentration of L1-9.3 is assumed to be greater than 5 ng / ml and less than 50 ng / ml). The negative control did not show any staining, therefore, non-specific staining can be ruled out (Figure 17C). The staining pattern of L1-9.3 bound in vivo (Figure 17A) corresponds to the expression pattern of L1 in the kidney when tissue sections are stained directly with L1-9.3 (Figure 17D). It can be concluded that the L1-9.3 antibody administered intravenously can be extravagated to peripheral tissue.
12. Example 12
Function of humanized forms of mAb L1 9.3 in nude mice
It was investigated whether the humanized form of mAb L1 9.3 could also inhibit tumor growth of ovarian carcinoma in vivo. First, the binding of the two humanized forms of L1 9.3 to the selected cell line was analyzed. Therefore, flow cytometry was performed with SKOV3ip cells with pcDNA3.1-luciferase (Figure 18). Both mAbs showed strong binding to the tumor cell line, and gave similar binding results to the native L1 9.3 mAb.
SKOV3ip cells were injected with pcDNA3.1-luciferase in immunodeficient mice 24 h before starting therapy. Humanized antibodies (300 | jg) or PBS were injected three times per week intraperitoneally. To detect tumor growth in vivo, images of the mice were obtained once a week using the Xenogen IVIS 200 system. The mice were anesthetized and injected with luciferin D, followed by detection of the light emission that occurs during activity. of luciferase from tumor cells. Over the course of time a slower tumor growth was detected in the group of mice treated with humanized mAb compared to the control. On day 33, the latest imaging data was taken. The imaging results gave a decreased tumor volume of approximately 80% using the hu3 mAb and approximately 50% for chiL1 9.3. Both results were strongly significant (figure 19). After 36 days the mice were sacrificed and the tumor mass was determined. In both groups treated with humanized anti-L1 mAbs, a substantially decreased tumor mass was measured in comparison to the PBS group (Figure 20 (A, B)).
13. Example 13
Chemistance suppression was tested by treatment with 9.3 anti-L1CAM monoclonal antibody as described in WO 2008/046529, example 3 (see also Figure 17e of WO 2008/046529). The results are shown in Figures 21 and 22. It could be shown that monoclonal antibody 9.3 suppresses chemoresistance. Its effect appears to be stronger than those of the 11A antibody tested in WO 2008/046529.
Table 1
 mAb  FACS Immuno- Western-type transfer IP L1-Fc Phosphorus invasion- Erk ka (1 / Ms) kd (1 / s) KD (M) Tumor growth
 L1-9.3  + + + + + + + + + + + + -60% -50% 2.6E + 05 2.2E-05 8.5E-11 -60%
 L1-11A  + + + + + + + + + + + + -50% -40% 1.0E + 05 4.0E-06 4.0E-11 -40%
 L1-14.10  + + + + + + + -40% -40% 1.4E + 04 1.0E-06 7.1E-11 -30%
 L1-38.12  + + + + + + + + 0 0 3.7E + 04 2.0E-06 5.4E-11
5
10
fifteen
twenty
25
30
 mAb  FACS Immuno- Western-type transfer IP L1-Fc Phosphorus invasion- Erk ka (1 / Ms) kd (1 / s) KD (M) Tumor growth
 L1-35.9  + + + + + + + + 0 0 4.0E + 04 1.2E-05 3.0E-10
 L1- N15.17  + + + + + + 0 0 5.3E + 04 1.0E-03 1.9E-08
 L1- 1D12.22      + + + 0 -20% 2,3E + 04 1,0E-04 4,3E-09
 L1- 1D17.3      + + + 0 0 2.3E + 04 1.0E-04 4.3E-09
 L1- 1D64.8    + + + + + + + 0 0 8.5E + 04 1.5E-04 1.8E-09
 L1- 1D74.8    + + + + + + + -10% 0 3.0E + 04 2.0E-03 6.7E-08
The following is described:
1. An anti-L1 monoclonal antibody that can bind to the same L1 epitope recognized by monoclonal antibody 9.3, produced by the hybridoma cell deposited as DSMZ ACC2841.
2. The anti-L1 monoclonal antibody according to item 1, in which the epitope is within the first immunoglobulin-like domain of L1.
3. An anti-L1 monoclonal antibody, which has the same ability to inhibit tumor growth as monoclonal antibody 9.3, produced by the hybridoma cell deposited under DSMZ ACC2841.
4. An anti-L1 monoclonal antibody, characterized in that at least one of its complementarity determining regions (CDR):
a) has one of the following sequences RASQDISNYLN, YTSRLHS, QQGNTLPWT, RYWML, EINPRNDRTNYNEKFKT or GGGYAMDY or
b) has a sequence that, in comparison to the sequences mentioned in a) has at least one conservative amino acid exchange.
5. A monoclonal antibody, produced by the hybridoma cell deposited under DSMZ ACC2841.
6. A humanized antibody based on the monoclonal antibody of any of items 1 to 5.
7. The humanized antibody of item 6, which has at least one non-human CDR residue and human frame region (FR).
8. The humanized antibody according to any of items 6 or 7, comprising the sequence of L1_9.3hu or L1_9.3hu3, as shown in Figure 8 a) and b).
9. A binding molecule comprising
a) at least one of the following sequences RASQDISNYLN, YTSRLHS, QQGNTLPWT, RYWML, EINPRNDRTNYNEKFKT or GGGYAMDY or
b) at least one sequence that has, in comparison to the sequences given in a), at least one conservative amino acid exchange.
10. The binding molecule of point 9, which is selected from the group consisting of single chain antibodies (for example scFv, multimers of scFv such as diabodies, triabodies or tetrabodies, antibody fragments (eg, Fab), Tandab, Flexibodies, antibodies bispecific and chimeric antibodies.
11. The antibody of any of items 1 to 8 or the binding molecule of any of items 9 or 10, bound to an active substance, preferably a toxin, a cytokine, a nanoparticle or a radionuclide.
5
10
fifteen
twenty
25
30
35
40
Four. Five
12. A hybridoma cell that produces the monoclonal antibody of any of items 1 to 5.
13. The hybridoma cell deposited under DSMZ ACC2841.
14. The use of the antibody or binding molecule of any of items 1 to 11 for the preparation of a medicament for the treatment of a tumoriological disease.
15. The use of the antibody or binding molecule of any of items 1 to 11 to sensitize tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy.
16. The use of item 15, wherein the cells are at least partially resistant to treatment with said chemotherapeutic drug or radiotherapy.
17. The use of any of items 15 or 16, wherein, after sensitization with the anti-L1 antibody, the patient is further treated with said chemotherapeutic drug or with radiation therapy.
18. The use of the antibody or binding molecule of any of items 1 to 11 for the preparation of a medicament for the treatment of a tumoriological disease in a patient previously treated with a chemotherapeutic drug or with radiation therapy.
19. The use of item 18, in which the patient is at least partially resistant to treatment with said chemotherapeutic drug or with radiation therapy.
20. The use of the antibody or the binding molecule of any of items 1 to 11 for the preparation of a medicament for the treatment of a tumoriological disease in a patient, at least partially resistant to treatment with a given chemotherapeutic drug or with radiotherapy.
21. The use of the antibody or the binding molecule of any of items 1 to 11 for the preparation of a medicament for the treatment of a tumoriological disease, in which the L1 binding molecule is administered in combination with a chemotherapeutic drug. or with radiotherapy.
22. The use of item 21, wherein the chemotherapeutic drug or radiotherapy is administered before the anti-L1 antibody.
23. The use of any of items 14 to 22, in which the tumor cells or tumoriological disease are of a type selected from the group consisting of astrocytoma, oligodendroglioma, meningioma, neurofibroma, glioblastoma, ependymoma, Schwannoma, neurofibrosarcoma, medulloblastoma , melanoma, pancreatic cancer, prostate carcinoma, head and neck cancer, breast cancer, lung cancer, ovarian cancer, endometrial cancer, renal cancer, neuroblastomas, squamous carcinomas, medulloblastomas, hepatoma, colon cancer and mesothelioma and squamous cell carcinoma.
24. The use of any of items 14 to 22, in which the tumor cells are from an epithelial tumor or the tumor is an epithelial tumor, preferably in which the epithelial tumor is pancreatic cancer, colon cancer, cancer of ovarian or endometrial cancer.
25. The use of any of items 15 to 24, wherein the chemotherapeutic drug is a DNA damaging agent, preferably selected from the group consisting of actinomycin-D, mitomycin C, cisplatin, doxorubicin, etoposide, verapamil, podophyllotoxin , 5-FU, taxanes, preferably paclitaxel and carboplatin.
26. The use of any of items 15 to 24, wherein radiotherapy is selected from the group consisting of X-ray radiation, UV radiation, irradiation with gamma, alpha or beta radiation and microwaves.
27. The antibody or binding molecule of any of items 1 to 11 for use as a medicine.
28. The antibody or binding molecule of any of items 1 to 11 for use as a medicament for the treatment of a tumor-like disease or to sensitize tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy.
29. The antibody or binding molecule of any of items 1 to 11 for use as a medicament in the treatment of tumor cells, with the characteristics defined in any of items 16 to 26.
30. A pharmaceutical composition, comprising the antibody or the binding molecule of any of items 1 to 11.

权利要求:
Claims (14)
[1]
5
10
fifteen
twenty
25
30
35
40
Four. Five
1. A binding molecule capable of binding to L1,
(a) being selected from the group consisting of single chain antibodies, scFv, scFv multimers such as diabodies, triabodies or tetrabodies, antibody fragments, Fab, Tandabs, Flexibodies, bispecific antibodies and chimeric antibodies,
I
(b) comprising at least one lg domain,
and in which the binding molecule capable of binding to L1:
(i) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: RASQDISNYLN (SEQ ID No .: 24), LCDR2: YTSRLHS (SEQ ID No .: 25), LCDR3: QQGNTLPWT (SEQ ID No .: 26), HCDR1: RYWML (SEQ ID No .: 27), HCDR2: EINPRNDRTNYNEKFKT (SEQ ID No .: 28) and HCDR3: GGGYAMDY (SEQ ID No .: 29),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M, or
(ii) is characterized in that its complementarity determining regions (CDR) have the following sequences: LCDR1: QDISNY (SEQ ID No .: 30), LCDR2: YTS, LCDR3: QQGNTLPWT (SEQ ID No .: 31), HCDR1: GYTFTRYW (SEQ ID No .: 32), HCDR2: INPRNDRT (SEQ ID No .: 33), and HCDR3: ALGGGYAMDY (SEQ ID No .: 34),
and whose binding molecule binds to L1 with an affinity (KD) of at least 10-10 M.
[2]
2. The binding molecule capable of binding to L1 of claim 1, wherein the binding molecule is binding to L1 with an affinity (KD) of at least 10-11 M.
[3]
3. The binding molecule capable of binding to L1 of claim 1 or 2 bound to an active substance, preferably a toxin, a cytokine, a nanoparticle or a radionuclide.
[4]
4. A binding molecule capable of binding to L1 of any one of claims 1 to 3, for use in a method of treating a tumoriological disease.
[5]
5. A binding molecule capable of binding to L1 of any one of claims 1 to 3, for use in a method of sensitizing tumor cells in a patient for treatment with a chemotherapeutic drug or with radiation therapy.
[6]
6. The binding molecule capable of binding to L1 for use according to claim 5, wherein the cells are at least partially resistant to treatment with said chemotherapeutic drug or radiotherapy.
[7]
7. The binding molecule capable of binding to L1 for use according to claim 5 or 6, wherein, by altering sensitization with the binding molecule, the patient is further treated with said chemotherapeutic drug or with radiation therapy.
[8]
8. The binding molecule capable of binding to L1 for use according to claim 4, in a patient previously treated with a chemotherapeutic drug or with radiation therapy.
[9]
9. The binding molecule capable of binding to L1 for use according to claim 8, wherein the patient is at least partially resistant to treatment with said chemotherapeutic drug or with radiation therapy.
[10]
10. The binding molecule capable of binding to L1,
(i) for use according to claim 4, in a patient at least partially resistant to treatment with a given chemotherapeutic drug or with radiation therapy, or
(ii) for use according to claim 4, wherein the binding molecule is administered in combination with a chemotherapeutic drug or with radiation therapy.
[11]
11. The binding molecule capable of binding to L1 for use according to claim 10, item (ii), wherein the chemotherapeutic drug or radiotherapy is administered before the binding molecule.
[12]
12. The binding molecule capable of binding to L1 for use according to any of claims 4 to 11, wherein the tumor cells or the tumor-like disease are of a type selected from the group consisting of astrocytoma, oligodendroglioma, meningioma , neurofibroma, glioblastoma, ependymoma, Schwannoma, neurofibrosarcoma, medulloblastoma, melanoma, pancreatic cancer, prostate carcinoma, head cancer and
neck, breast cancer, lung cancer, ovarian cancer, endometrial cancer, kidney cancer, neuroblastomas, squamous carcinomas, hepatoma, colon and mesothelioma cancer and squamous cell carcinoma, or
in which the tumor cells come from an epithelial tumor or the tumor is an epithelial tumor.
13. The binding molecule capable of binding to L1 for use according to claim 12, wherein the tumor
Epithelial is pancreatic cancer, colon cancer, ovarian cancer or endometrial cancer.
[14]
14. The binding molecule capable of binding to L1 for use in any of claims 5 to 13, wherein the chemotherapeutic drug is a DNA damaging agent, preferably selected from the group consisting of actinomycin-D, mitomycin C, cisplatin, doxorubicin, etoposide, verapamil, podophyllotoxin, 5-FU, taxanes,
10 preferably paclitaxel and carboplatin, or
wherein the radiotherapy is selected from the group consisting of x-ray radiation, UV radiation, and irradiation, or microwave and p irradiation.
[15]
15. A pharmaceutical composition comprising the binding molecule capable of binding to L1 of any of claims 1 to 3.
16. The use of a binding molecule capable of binding to L1 of any of claims 1 to 3 for
determine the level of L1 protein in body tissues or fluids in vitro.

类似技术:

---

公开号 | 公开日 | 专利标题

---

ES2664809T3|2018-04-23|Human anti-TROP-2 antibody that has antitumor activity in vivo

---

ES2645272T3|2017-12-04|DLL3 modulators and usage procedures

---

ES2750358T3|2020-03-25|Anti-human TROP-2 antibody showing anti-tumor activity in vivo

---

US7067131B2|2006-06-27|Methods for using anti-MUC18 antibodies

---

US6924360B2|2005-08-02|Antibodies against the MUC18 antigen

---

JP6042395B2|2016-12-14|Treatment of tumors with specific anti-L1 antibodies

---

US7090844B2|2006-08-15|Use of antibodies against the MUC18 antigen

---

US8715662B2|2014-05-06|Anti-trop-2 monoclonal antibodies and uses thereof in the treatment and diagnosis of tumors

---

CN104093743B|2018-04-24|It is specific to binding molecule of HER3 and application thereof

---

ES2469369T3|2014-06-18|Humanized anti-CXCR4 antibodies for cancer treatment

---

KR20180105642A|2018-09-28|Compositions and methods for the detection and treatment of gastric cancer

---

ES2737649T3|2020-01-15|Anti-Notch3 antibodies

---

BR112020006999A2|2020-10-06|multispecific antibody, pharmaceutical composition and production method

---

BR112019019650A2|2020-06-30|binding of antibodies specifically to muc1 and using them

---

KR20220034823A|2022-03-18|Anti-GRP78 antibodies and methods of use thereof

---

AU2002361885B2|2008-04-24|Methods for using anti-MUC18 antibodies

同族专利:

---

公开号 | 公开日

---

US20090162355A1|2009-06-25|

---

CY1119890T1|2018-06-27|

---

NO2631248T3|2018-04-14|

---

CA2691075A1|2008-12-18|

---

EP2170956A2|2010-04-07|

---

LT2631248T|2018-04-25|

---

EP2631248B1|2017-11-15|

---

US20140120117A1|2014-05-01|

---

ES2528167T3|2015-02-04|

---

US9260521B2|2016-02-16|

---

WO2008151819A2|2008-12-18|

---

HRP20150007T1|2015-03-13|

---

WO2008151819A3|2009-04-09|

---

US8138313B2|2012-03-20|

---

JP2010529970A|2010-09-02|

---

HUE036490T2|2018-07-30|

---

PL2170956T3|2015-04-30|

---

DK2170956T3|2015-02-02|

---

JP2015042651A|2015-03-05|

---

EP2631248A2|2013-08-28|

---

JP5921066B2|2016-05-24|

---

TW200918556A|2009-05-01|

---

PT2631248T|2018-02-15|

---

JP6042395B2|2016-12-14|

---

TWI478939B|2015-04-01|

---

CA2958672A1|2008-12-18|

---

US20120258039A1|2012-10-11|

---

CA2691075C|2017-04-11|

---

US8580258B2|2013-11-12|

---

HRP20150007T8|2015-08-14|

---

EP2631248B9|2018-05-23|

---

SI2170956T1|2015-02-27|

---

CY1115960T1|2017-01-25|

---

SI2631248T1|2018-04-30|

---

DK2631248T3|2018-02-12|

---

EP2170956B1|2014-10-22|

---

PT2170956E|2015-02-05|

---

EP2631248A3|2013-10-23|

---

PL2631248T3|2018-06-29|

---

HRP20180192T1|2018-04-06|

---

ES2658342T3|2018-03-09|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

GB8308235D0|1983-03-25|1983-05-05|Celltech Ltd|Polypeptides|

---

US4816567A|1983-04-08|1989-03-28|Genentech, Inc.|Recombinant immunoglobin preparations|

---

US5225539A|1986-03-27|1993-07-06|Medical Research Council|Recombinant altered antibodies and methods of making altered antibodies|

---

AT87659T|1986-09-02|1993-04-15|Enzon Lab Inc|BINDING MOLECULE WITH SINGLE POLYPEPTIDE CHAIN.|

---

AU600575B2|1987-03-18|1990-08-16|Sb2, Inc.|Altered antibodies|

---

US5223409A|1988-09-02|1993-06-29|Protein Engineering Corp.|Directed evolution of novel binding proteins|

---

DE69233697T2|1991-03-01|2008-01-24|Dyax Corp., Cambridge|Process for the development of binding microproteins|

---

EP1026240A3|1988-09-02|2004-04-07|Dyax Corp.|Generation and selection of recombinant varied binding proteins|

---

GB8823869D0|1988-10-12|1988-11-16|Medical Res Council|Production of antibodies|

---

ES2052027T5|1988-11-11|2005-04-16|Medical Research Council|IMMUNOGLOBULINE VARIABLE DOMAIN SEQUENCE CLONING.|

---

US5175384A|1988-12-05|1992-12-29|Genpharm International|Transgenic mice depleted in mature t-cells and methods for making transgenic mice|

---

US5530101A|1988-12-28|1996-06-25|Protein Design Labs, Inc.|Humanized immunoglobulins|

---

ES2091824T3|1989-04-21|1996-11-16|Us Health|RECOMBINANT FUSION PROTEIN ANTIBODY TOXIN.|

---

US5859205A|1989-12-21|1999-01-12|Celltech Limited|Humanised antibodies|

---

US5427908A|1990-05-01|1995-06-27|Affymax Technologies N.V.|Recombinant library screening methods|

---

IE911922A1|1990-06-07|1991-12-18|Scripps Clinic Res|Apo ai polypeptides, diagnostic methods and systems for¹quantifying apo ai, and therapeutic methods|

---

GB9015198D0|1990-07-10|1990-08-29|Brien Caroline J O|Binding substance|

---

AT181571T|1991-09-23|1999-07-15|Medical Res Council|METHODS FOR PRODUCING HUMANIZED ANTIBODIES|

---

AT185601T|1990-07-10|1999-10-15|Cambridge Antibody Tech|METHOD FOR PRODUCING SPECIFIC BINDING PAIRS|

---

US5545806A|1990-08-29|1996-08-13|Genpharm International, Inc.|Ransgenic non-human animals for producing heterologous antibodies|

---

US5625126A|1990-08-29|1997-04-29|Genpharm International, Inc.|Transgenic non-human animals for producing heterologous antibodies|

---

US5661016A|1990-08-29|1997-08-26|Genpharm International Inc.|Transgenic non-human animals capable of producing heterologous antibodies of various isotypes|

---

US6300129B1|1990-08-29|2001-10-09|Genpharm International|Transgenic non-human animals for producing heterologous antibodies|

---

CA2089661C|1990-08-29|2007-04-03|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

US5633425A|1990-08-29|1997-05-27|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

WO1992009690A2|1990-12-03|1992-06-11|Genentech, Inc.|Enrichment method for variant proteins with altered binding properties|

---

ES2315612T3|1991-04-10|2009-04-01|The Scripps Research Institute|GENOTECAS OF HETERODYMERIC RECEPTORS USING PHAGEMIDS.|

---

DE69233254T2|1991-06-14|2004-09-16|Genentech, Inc., South San Francisco|Humanized Heregulin antibody|

---

DE4122599C2|1991-07-08|1993-11-11|Deutsches Krebsforsch|Phagemid for screening antibodies|

---

EP0617706B1|1991-11-25|2001-10-17|Enzon, Inc.|Multivalent antigen-binding proteins|

---

DE69333082T2|1992-02-11|2004-05-06|Cell Genesys, Inc., Foster City|OBTAINING HOMOZYGOTEM BY TARGETED GENETIC EVENTS|

---

AU4953693A|1992-08-25|1994-03-15|Medac Gesellschaft Fur Klinische Spezialpraparate Mbh|Antibody/radioisotope conjugate for tumor diagnosis and/or therapy|

---

US6811779B2|1994-02-10|2004-11-02|Imclone Systems Incorporated|Methods for reducing tumor growth with VEGF receptor antibody combined with radiation and chemotherapy|

---

US6114507A|1995-06-30|2000-09-05|Mochida Pharmaceutical Co., Ltd.|Anti-Fas ligand antibody and assay method using the anti-Fas ligand antibody|

---

US5837283A|1997-03-12|1998-11-17|The Regents Of The University Of California|Cationic lipid compositions targeting angiogenic endothelial cells|

---

DE19819846B4|1998-05-05|2016-11-24|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Multivalent antibody constructs|

---

GB9809951D0|1998-05-08|1998-07-08|Univ Cambridge Tech|Binding molecules|

---

NZ573838A|1998-08-11|2011-01-28|Biogen Idec Inc|Combination therapies for b-cell lymphomas comprising administration of anti-cd20 antibody|

---

US6737056B1|1999-01-15|2004-05-18|Genentech, Inc.|Polypeptide variants with altered effector function|

---

EP1172654B1|2000-07-10|2007-10-31|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Diagnostic method based on the detection of the L1 adhesion molecule for ovarian and endometrial tumors|

---

ES2276735T3|2001-09-14|2007-07-01|Affimed Therapeutics Ag|SINGLE CHAIN MULTIMERIC FV ANTIBODIES IN TANDEM.|

---

GB0209893D0|2002-04-30|2002-06-05|Molmed Spa|Conjugate|

---

KR100470535B1|2002-06-27|2005-02-22|재단법인서울대학교산학협력재단|Immunoliposome conjugated with upa antibody|

---

AU2003286645A1|2002-10-24|2004-05-13|The Board Of Trustees Of The University Of Illinois|Antibody-mediated induction of tumor cell death|

---

US20040202666A1|2003-01-24|2004-10-14|Immunomedics, Inc.|Anti-cancer anthracycline drug-antibody conjugates|

---

GB0306618D0|2003-03-22|2003-04-30|Univ Newcastle|Antibody|

---

EP1623995A1|2004-08-06|2006-02-08|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Inhibitors of L1 and ADAM10 for the treatment of carcinomas|

---

CA2621502A1|2005-09-07|2007-03-15|Medimmune, Inc.|Toxin conjugated eph receptor antibodies|

---

WO2007114550A1|2006-04-03|2007-10-11|Korea Research Institute Of Bioscience And Biotechnology|A novel monoclonal antibody specific to the l1cam, a hybridoma producing the same and a method producing the same|

---

MX2009002064A|2006-08-23|2009-06-30|Korea Res Inst Of Bioscience|A pharmaceutical composition for treating cholangiocarcinoma, a method for inhibiting growth or invasion of cholangiocarcinoma and a method for treating cholangiocarcinoma.|

---

WO2008046529A1|2006-10-16|2008-04-24|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Treatment of chemotherapy- or radiotherapy-resistant tumors using an l1 interfering molecule|AU2008201871A1|2008-04-16|2009-11-26|Deutsches Krebsforschungszentrum Stiftung Des Oeffentlichen Rechts|Inhibition of angiogenesis and tumor metastasis|

---

KR20100060351A|2008-11-27|2010-06-07|한국생명공학연구원|A composition for treating l1cam-expressing cancer comprising an inhibitor of activity or expression of l1cam and anticancer agent|

---

WO2012058627A2|2010-10-29|2012-05-03|Miqin Zhang|Pre-targeted nanoparticle system and method for labeling biological particles|

---

WO2014077648A1|2012-11-16|2014-05-22|강원대학교산학협력단|Antibody binding specifically to human and mouse l1cam protein, and use therefor|

---

WO2016050702A1|2014-09-30|2016-04-07|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Binding molecules, especially antibodies, binding to l1cam |

---

CA3029653A1|2016-08-02|2018-02-08|Memorial Sloan-Kettering Cancer Center|Treating metastatic cancer and model systems for metastatic disease|

---

WO2020243616A1|2019-05-31|2020-12-03|Seattle Children's Hospital D/B/A Seattle Children's Research Institute|E-cadherin activating antibodies and uses thereof|

法律状态:

优先权:

---

申请号 | 申请日 | 专利标题

---

US94435907P| true| 2007-06-15|2007-06-15|

---

US944359P|2007-06-15|

---