• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Ghrelin-O-acyl transferase (GOAT) and its uses. The present invention relates to the use of levels obtained ex vivo from a biological sample isolated from a subject of the amount or concentration of the enzyme ghrelin-O-acyl transferase (GOAT) or RNAm which codes for this protein, as an effective tool for obtaining useful data in the clinical diagnosis of prostate cancer. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2620262A1
    申请号:ES201531731
    申请日:2015-11-27
    公开日:2017-06-28
    发明作者:Justo P. CASTAÑO FUENTES；Raúl M. LUQUE HUERTAS；Manuel D. GAHETE ORTIZ；Daniel HORMAECHEA AGULLA；María José REQUENA TAPIA；Enrique GÓMEZ GÓMEZ；Julia CARRASCO VALIENTE；Alejandro IBÁNEZ COSTA；María Del Mar MORENO；José VALERO ROSA
    申请人:Universidad de Cordoba；Servicio Andaluz de Salud；
    IPC主号:
    专利说明:

    Ghrelin-O-acyl transferase (GOAT) and its uses FIELD OF THE TECHNIQUE
    The present invention is within molecular biology and medicine, and refers to an enzyme called ghrelin-O-acyl transferase (GOAT) and its uses. Specifically, it refers to the use of this enzyme to obtain useful data in the diagnosis and / or detection of patients with prostate cancer. STATE OF THE PREVIOUS TECHNIQUE
    Ghrelin is a hormone synthesized primarily by the stomach [1], although it is also expressed in a wide range of tissues where it acts as a paracrine or autocrine factor [2-5]. Ghrelin is the main endogenous ligand of growth hormone secretagogue receptor (GHS-R) type 1a (GHS-R1a). It is currently known that the ghrelin / GHS-R1a system exerts actions in multiple tissues, many of them related to the regulation of metabolic functions [6-8]. In order for ghrelin to bind to the GHS-R1a receptor and, therefore, exert its actions, it is necessary that it be previously acylated (through an n-octanoacylation) in its serine 3 residue (Ser3). The enzyme responsible for this post-transduction modification is the enzyme ghrelin-O-acyl transferase or GOAT [9, 10]. This enzyme belongs to the membrane-anchored Oacil-transferase superfamily (MBOATs) [11] and, therefore, is also called MBOAT4 [12].
    The human GOAT gene (MBOAT4) is located on chromosome 12 and its sequence has a high degree of conservation among vertebrates [13]. GOAT is an integral membrane protein that octanolates the Ser3 residue of ghrelin in the endoplasmic reticulum after signal peptide removal [14]. The GOAT enzyme is expressed, at the level of mRNA, in a large number of tissues such as the stomach, pancreas, skeletal muscle, heart, intestine or bones [15]; an expression pattern that partially overlaps with that exhibited by ghrelin [15]. In fact, the presence of GOAT (at the level of mRNA and protein) has been observed in individual ghrelin-producing cells [16]. However, some studies have shown that GOAT expression levels do not correlate perfectly with ghrelin expression levels, but are more similar to those shown by a splicing variant of the ghrelin gene, called In1-ghrelin [17], suggesting the possible existence of additional targets for GOAT.


    It is important to note that the system composed of ghrelin, its variant of In1ghrelin splicing, the associated receptors (GHS-R1a and a truncated receptor called GHS-R1b) and the GOAT enzyme could play a relevant regulatory role in several types of tumor pathologies. In fact, all components of this regulatory system have been found expressed in gastric [18-20] and / or intestinal tumors [21] and / or pancreatic carcinoids [20, 22], as well as in breast cancer [23] and of prostate [24], although their expression levels depend on the detection method used [18-21].
    However, the authors of the present invention are the first to suggest and provide experimental data that support the determination of one of the specific components of the system, in particular the GOAT enzyme, as a clinically useful tool in the clinical diagnosis of cancer. of prostate. BRIEF DESCRIPTION OF THE INVENTION
    The authors of the present invention face the problem of providing diagnostic tools for prostate cancer. In particular, they face the problem of providing a diagnostic tool that serves as a clinically effective alternative to the use of prostate specific antigen (PSA).
    In addressing this problem, the authors have found that the use of levels obtained ex vivo or in vitro from a human biological sample isolated from the amount or concentration of the enzyme ghrelin-O-acyl transferase (GOAT) or mRNA that It codes for this protein, it is an effective tool as a biomarker or indicator for obtaining useful data in the clinical diagnosis of prostate cancer. In particular, the authors of the present invention have observed how GOAT plasma levels can distinguish between prostate cancer patients and controls (healthy individuals) with high specificity and sensitivity, 66% and 81%, respectively; levels that guarantee its condition as a useful diagnostic tool in the clinic. BRIEF DESCRIPTION OF THE FIGURES
    Figure 1. GOAT expression levels in biopsy samples of prostate cancer patients and controls (healthy individuals). The number of copies adjusted by a normalization factor of n = 37 tumor cases and n = 10 controls is represented. ROC curve that shows that GOAT expression levels in biopsy samples can distinguish between prostate cancer patients and controls (healthy individuals).


    Figure 2. GOAT levels in plasma samples of prostate cancer patients and controls (healthy individuals). The GOAT concentration (ng / mL) of n = 85 tumor cases and n = 29 controls is represented. ROC curve that shows that GOAT plasma levels can distinguish between prostate cancer patients and controls (healthy individuals) with high specificity and sensitivity.
    Figure 3. Correlations of GOAT plasma levels with the levels of other tumor markers such as total PSA (TPSA), free PSA (FPSA), ca153 and figure_211 in patients with prostate cancer.
    Figure 4. Correlation of GOAT plasma levels with glycosylated hemoglobin plasma levels in patients with prostate cancer.
    Figure 5. Correlations of GOAT plasma levels with glucose levels and the HOMA-IR index in patients with prostate cancer who present with metabolic syndrome. DETAILED DESCRIPTION OF THE INVENTION
    The results shown in the present invention demonstrate that GOAT expression levels, measured by real-time quantitative PCR (qPCR), are significantly increased in biopsy samples (isolated samples of prostate tissue) of patients with prostate cancer in comparison with samples from biopsies of healthy patients (in which the biopsy was negative for the presence of prostate cancer) (Figure 1, left panel). Moreover, as shown in the ROC curve shown in Figure 1 (right panel), GOAT expression levels in these biopsied samples can significantly distinguish between prostate cancer patients from healthy individuals with high sensitivity. and specificity.
    On the other hand, the results shown here also indicate that although the levels of GOAT protein in urine do not appear to be high enough to be useful for the diagnosis of prostate cancer, measuring levels of GOAT protein in plasma allows us to discern between Prostate cancer patients and controls (healthy individuals) with high specificity and sensitivity (Figure 2, left panel). Moreover, the data shown support that the measurement of this marker in blood samples, particularly in plasma, results in a diagnostic tool that is especially effective in clinical settings. Thus, as shown in the ROC curve of Figure 2 (right panel), a plasma GOAT value of 1,212 ng / mL shows a sensitivity of 81% and a specificity of 67% to distinguish between patients with and without cancer of prostate.


    In addition, the GOAT plasma levels detected in prostate cancer patients correlated positively with the levels of total PSA (TPSA) and negatively with those of free PSA (FPSA) (Figure 3). Similarly, the GOAT plasma levels detected in prostate cancer patients also positively correlated with two other tumor markers such as ca1 5.3 and cyfra_211 (Figure 3).
    Finally, it is intended that the GOAT plasma levels detected in prostate cancer patients correlate with several markers related to glucose homeostasis, diabetes and metabolic syndrome. Specifically, GOAT levels were positively correlated with glycosylated hemoglobin levels in patients with prostate cancer (Figure 4). In addition, they were correlated with glucose levels and with the HOMA-IR index in prostate cancer patients with metabolic syndrome (Figure 5).
    Therefore, a first aspect of the present invention relates to the use of levels obtained in vitro (outside the human or animal body) from an isolated biological sample of a subject, preferably a human, of the expression products of the gene encoding the enzyme ghrelin-O-acyl transferase (GOAT) as a biomarker or indicator for obtaining useful data in the diagnosis or detection of prostate cancer.
    A preferred embodiment of the first aspect of the present invention relates to the in vitro use of the levels (expressed in terms of quantity or concentration) obtained from an isolated biological sample of a subject, preferably a human, of the enzyme ghrelin -O-acyl transferase (GOAT) or mRNA encoding said enzyme, as a biomarker or indicator for obtaining useful data in the diagnosis or detection of prostate cancer.
    In another preferred embodiment of the invention, the levels of the enzyme ghrelin-O-acyl transferase (GOAT) are determined from an isolated sample of blood, serum, an isolated sample of prostate or plasma tissue and the determination of mRNA levels are determined from an isolated sample of prostate tissue.
    The term "gene expression products ...", as used herein, refers to the transcription and / or translation products (RNA and / or protein) of said gene,
    or to any form resulting from the processing of said transcription or translation products.
    An "isolated biological sample" includes, but is not limited to, cells, tissues and / or biological fluids of an organism, obtained by any method known to a person skilled in the art. The biological sample may be a tissue, for example, a biopsy or a fine needle aspirate, or it may be a fluid sample, such as blood, plasma or serum. Preferably, the samples


    Biological isolates are selected from the list consisting of blood, plasma, serum or a biopsy or sample of prostate tissue.
    The term "cancer" or "cancerous" as used herein, refers to any malignant tumor, in particular a malignant prostate tumor.
    The determination of the levels of the quantity or concentration, preferably semiquantitatively or quantitatively, can be carried out directly or indirectly. Direct measurement refers to the measure of the quantity or concentration of the expression products, based on a signal that is obtained directly from the expression products, and that is correlated with the number of molecules of said expression products. Said signal - which we can also refer to as an intensity signal - can be obtained, for example, by measuring an intensity value of a chemical or physical property of said expression products. The indirect measurement includes the measurement obtained from a secondary component or a biological measurement system (for example the measurement of cellular responses, ligands, "tags" or enzymatic reaction products).
    The term "quantity", as used in the description, refers to, but is not limited to, the absolute or relative quantity of the expression products, as well as any other value or parameter related thereto or that may be derived of these. Said values or parameters comprise values of signal intensity obtained from any of the physical or chemical properties of the expression products obtained by direct measurement. Additionally, said values or parameters include all those obtained by indirect measurement, for example, any of the measurement systems described elsewhere in this document. Thus, the "determination of the level of expression" of the genes can be carried out by any method of determining the amount of the product of the expression of the genes known in the state of the art.
    In a preferred embodiment, the detection of the gene expression product is performed by determining the level of mRNA derived from its transcription, where the analysis of the level of GOAT mRNA can be performed, by way of illustration and without limiting the scope of the invention, by amplification by polymerase chain reaction (PCR), back transcription in combination with polymerase chain reaction (RT-PCR), back transcription in combination with ligase chain reaction (RT-LCR ), or any other nucleic acid amplification method; DNA chips made with oligonucleotides deposited by any mechanism; DNA microarrays made with oligonucleotides synthesized in situ by photolithography or by any other mechanism; in situ hybridization using specific probes labeled with any labeling method; by electrophoresis gels; by transfer to


    membrane and hybridization with a specific probe; by nuclear magnetic resonance or any other diagnostic imaging technique using paramagnetic nanoparticles or any other type of detectable nanoparticles functionalized with antibodies or by any other means.
    The mRNA can be analyzed, for example, but not limited, in samples of fresh tissue, frozen tissue, fixed tissue or tissue fixed and embedded in paraffin. The use of samples of tissue fixed and embedded in paraffin has important advantages over fresh or frozen tissue samples: they are stable at room temperature, easy to store and there is a large archive of clinical samples available along with their clinical information and disease monitoring. Thus, in a preferred embodiment, the assay is extracted from samples of tissue fixed and embedded in paraffin.
    However, RNA obtained from tissue samples fixed and embedded in paraffin is often very degraded. While studies using microarrays are very sensitive to RNA degradation, the use of RT-PCR, and in particular, quantitative RT-PCR (qRT-PCR) has proven to be a technique that offers better results in the face of degradation of the RNA In addition, expression analysis using microarrays is a complex technique that requires sophisticated equipment that is not available in many laboratories. Therefore, in another preferred embodiment, the mRNA detection of the genes is performed by the RT-PCR technique; and in a more preferred embodiment, the detection is performed by the qRT-PCR technique.
    In another preferred embodiment, the detection of the gene expression product is performed by determining the level of protein derived from its transcription and translation, where the analysis of the level of GOAT peptide products can be performed, by way of illustration and without limiting the scope of the invention, by incubation with a specific antibody in an immunoassay. The term "immunoassay", as used herein, refers to any analytical technique that is based on the reaction of conjugation of an antibody with the sample obtained. Examples of immunoassays known in the state of the art are, for example, but not limited to: immunoblot, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunohistochemistry or protein microarrays.
    A second aspect of the invention relates to a method of obtaining useful data for the diagnosis and / or detection of prostate cancer in a subject, preferably human, comprising:


    to. detect and quantify in vitro in an isolated biological sample of said subject, the amount
    or concentration of the ghrelin-O-acyl transferase enzyme (GOAT) or of the mRNA encoding said protein.
    In a preferred embodiment of the second aspect of the invention, the isolated biological sample is selected from the list consisting of blood, plasma, serum or a biopsy or prostate tissue sample.
    In another preferred embodiment of the second aspect of the invention, the method further comprises:
    b. compare the levels obtained in step (a) with a reference level or with the levels obtained in a control sample obtained from a healthy human subject.
    A third aspect of the invention relates to a method of diagnosis and / or detection of prostate cancer that comprises steps (a) - (b) of the second aspect of the invention, and which further comprises:
    C. assign the subjects that have increased levels with respect to a reference level, to the group of individuals suffering from prostate cancer.
    As used in the present invention, the term "diagnosis" refers to the ability to discriminate between individuals suffering from prostate cancer or not. It also refers, but not limited to, the ability to discriminate between samples from patients and healthy individuals. This discrimination, as understood by one skilled in the art, is not intended to be correct in 100% of the samples analyzed. However, it requires that a statistically significant amount of the analyzed samples be classified correctly. The amount that is significantly statistical can be established by one skilled in the art by using different statistical tools, for example, but not limited, by determining confidence intervals, determining the p-value, Student's test or discriminant functions of Fisher Preferably, the confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99%. Preferably, the value of p is less than 0.1, 0.05, 0.01, 0.005 or 0.0001. Preferably, the present invention makes it possible to correctly detect the disease differentially by at least 60%, at least 70%, at least 80%, or at least 90% of the subjects of a certain group or population analyzed.
    The detection of GOAT (both mRNA and the protein itself) in a biological sample isolated from a subject in a proportion greater than the reference amount is indicative that said individual suffers from prostate cancer. In particular, levels increased by at least 1.5


    Sometimes, preferably twice, the levels obtained in a control sample obtained from a healthy human subject is indicative that said individual suffers from prostate cancer.
    Thus, a third alternative aspect of the invention relates to a method of diagnosis and / or detection of prostate cancer that comprises steps (a) - (b) of the second aspect of the invention, and which further comprises:
    C. assign the subjects that have increased levels by at least 1.5 times, preferably 2 times, the levels obtained in a control sample obtained from a healthy human subject, to the group of individuals suffering from prostate cancer.
    The term "subject" is not intended to be limiting in any aspect, and may be of any age and physical condition.
    Another aspect of the invention, fourth aspect, relates to a kit comprising the means suitable for carrying out the methods of the invention. In a preferred embodiment, said kit comprises means for detecting expression products (in particular mRNA and protein) derived from the gene that generates the GOAT.
    A particular embodiment of this aspect of the invention relates to a kit or device suitable for carrying out a PCR reaction, preferably RT-PCR, qRT-PCR or qPCR, comprising primers consisting essentially of the sequences SEQ ID NO 1 and SEQ ID NO 2. Said kit may further comprise all those reagents necessary to carry out said PCR reactions. Thus, the kit can also include, without any limitation, the use of buffers, enzymes, polymerase enzymes, cofactors to obtain optimal activity of these, agents to prevent contamination, etc. On the other hand, the kit can include all the supports and containers necessary for commissioning and optimization. The kit may also contain other molecules, genes, proteins or probes of interest, which serve as positive and negative controls. Preferably, the kit further comprises instructions for carrying out the fourth aspect of the invention. Preferably, the kit further comprises the primers indicated at least one or any combination of the following reagents: DNA polymerase, dNTPs, MgCl2, markers, stabilizers, DNAsas and the enzyme reverse transcriptase (RT).
    A fifth aspect of the invention relates to the in vitro use of a kit or device comprising specific primers for the determination of GOAT expression levels by PCR, to obtain useful data for the diagnosis and / or detection of cancer. of prostate in a human subject from an isolated biological sample of said subject. Preferably, said kit is defined according to the fourth aspect of the invention. Preferably, said biological sample is


    Select from the list consisting of blood, plasma, serum and isolated samples of prostate tissue.
    A sixth aspect of the invention relates to the in vitro use of a kit or device comprising antibodies or fragments thereof specific to the GOAT protein, for obtaining useful data for the diagnosis and / or detection of prostate cancer. in a human subject from a biological sample isolated from said subject. Preferably, said biological sample is a biopsy of prostate tissue. Preferably the use of the sixth aspect of the invention is carried out by an immunoassay, preferably by an ELISA, more preferably by the in vitro use of a commercial ELISA (Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit; MBS2019923, MyBioSource, San Diego, CA), following the manufacturer's instructions. In another preferred embodiment, the immunoassay is an immunoblot or Western blot. To carry out an immunoblot or Western blot, a protein extract is obtained from an isolated biological sample of a subject and the proteins are separated in a support medium capable of retaining them by electrophoresis. Once the proteins are separated, they are transferred to a different support where they can be detected through the use of specific antibodies that recognize the GOAT peptide products, ln1-ghrelin and / or the truncated ghrelin receptor (GHS-R1b).
    In another preferred embodiment, the immunoassay is an immunohistochemistry (IHQ). Immunohistochemical techniques allow the identification, on tissue or cytological samples of characteristic antigenic determinants. Immunohistochemical analysis is performed on tissue sections, either frozen or included in paraffin, from an isolated biological sample of a subject. These sections hybridize with a monoclonal or polyclonal antibody that recognizes the GOAT peptide products, ln1-ghrelin and / or the truncated ghrelin receptor (GHS-R1b).
    Among the immunohistochemical techniques that can be used to obtain expression profiles is the tissue microarray. Tissue microarray (TMA) is today considered a powerful tool for the massive analysis of the molecular profile of cancer from multiple tissue samples simultaneously, providing the possibility of studying new markers,
    or those already existing in bulk. In turn, the TMA preserves the original tissue samples that with traditional methods decrease in amount and deteriorate due to frequent use.
    The term "antibody" as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, that is, molecules that contain an antigen binding site that specifically binds (immunoreacts) with any of GOAT peptide products. Examples of immunologically active immunoglobulin molecule fragments, include F (ab) and F (ab ’) 2 fragments


    which can be generated by treating the antibody with an enzyme such as pepsin. The antibodies can be polyclonal (typically include different antibodies directed against different determinants or epitopes) or monoclonal (directed against a single determinant in the antigen). The monoclonal antibody may be biochemically altered, by genetic manipulation, or it may be synthetic, possibly lacking the antibody in whole or in part, from portions that are not necessary for the recognition of GOAT peptide products and being replaced by others that give the antibody additional advantageous properties. The antibody can also be recombinant, chimeric, humanized, synthetic or a combination of any of the foregoing. A "recombinant antibody or polypeptide" (rAC) is an antibody that has been produced in a host cell that has been transformed or transfected with the nucleic acid encoding the polypeptide, or produces the polypeptide as a result of homologous recombination.
    Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention.
    The following examples and drawings are provided by way of illustration, and are not intended to be limiting of the present invention.
    EXAMPLES
    Example 1. Marials and methods. 1.1. Patients and samples.
    Samples of prostate biopsies [both tumor (n = 37) and normal (n = 10)] were obtained at the Reina Sofía University Hospital (Córdoba), after the appropriate evaluation of an expert pathologist and under the approval of the Ethics Committees from the University of Córdoba and the Reina Sofía Hospital (Córdoba). This is a cohort of patients with suspected prostate cancer who were biopsied between 2012 and 2014 to confirm this suspicion. At the time of the biopsy, blood and urine samples were also collected from these patients. Before entering the study, each patient signed an informed consent. 1.2. RNA isolation and reverse transcription (RT).


    Nucleic acids from biopsied tissues were isolated by using a commercial kit (AllPrep DNA / RNA Mini Kit, Qiagen; Barcelona, Spain) according to the manufacturer's instructions and treated with DNase. The amount of total RNA recovered was determined by using the Nanodrop 2000 spectrophotometer (Thermo Scientific, Wilmington, NC, USA). Reverse transcription was carried out with 1 µg of total RNA, using the First-Strand Synthesis cDNA kit (Fermentas, Hanover, MD, USA). 1.3. Determination of gene expression by quantitative real-time PCR (qPCR)
    GOAT expression levels were determined using qPCR using primers specific for this transcript (Sn: TTGCTCTTTTTCCCTGCTCTC and As: ACTGCCACGTTTAGGCATTCT). The selection of primers, as well as verification of their specificity, and confirmation of their efficiency has been performed in a manner similar to that previously described for other genes [17, 25]. The final volume of the PCR reaction was 20 µl including 100ng of sample and 10 µl of IQ ™ SYBR Green Supermix (Biorad). The PCR program consisted of 40 cycles at 95º C for 20s, 60º C for 20s, and 55º C for 30s. In addition, a control without DNA was run on each plate to monitor possible exogenous contamination. In all cases, the amplification was carried out with the qPCR Mx3000 system (Agilent, Madrid). To confirm that a single band of the expected size was amplified, the products were run on an agarose gel stained with ethidium bromide. This band was purified and subsequently sequenced to confirm that it corresponded with the expected sequence. 1.4. Determination of GOAT protein levels.
    The plasma or urine concentration of GOAT was determined by using a commercial ELISA (Human Ghrelin-O-Acyltransferase (GOAT) ELISA Kit; MBS2019923, MyBioSource, San Diego, CA), following the manufacturer's instructions. Information regarding the specificity, detectability and reproducibility of the assay is available on the company's website.
    Example 2. RESULTS 2.1. GOAT mRNA expression in prostate biopsy samples.
    GOAT expression levels, measured by real-time quantitative PCR (qPCR), are significantly increased in samples from biopsies of prostate cancer patients compared to samples from biopsies of healthy patients (in which the biopsy resulted negative for the presence of prostate cancer) (Figure 1, left panel). In fact, GOAT expression levels in biopsies can significantly discern


    among prostate cancer patients and healthy individuals with high sensitivity and specificity (ROC curve; Figure 1, right panel). 2.2. GOAT levels in biofluids of patients with suspected prostate cancer.
    In addition, the levels of GOAT protein in biofluids (plasma and urine) of these were determined.
    5 patients These analyzes revealed that GOAT is not found in urine at detectable levels; while it is at considerable (detectable) levels in plasma samples. Specifically, the GOAT enzyme is also found in higher plasma levels of patients with prostate cancer compared to plasma of healthy control patients (Figure 2, left panel). Similarly, GOAT plasma levels can discern among cancer patients with
    10 prostate and healthy individuals with high sensitivity and specificity (ROC curve; Figure 2, right panel). Thus, a serum GOAT value of 1,212 ng / mL shows a sensitivity of 81% and a specificity of 66% to distinguish between patients with and without prostate cancer.
    In addition, GOAT plasma levels detected in prostate cancer patients correlated positively with total PSA levels (TPSA) and negatively with PSA levels.
    15 free (FPSA) (Figure 3). Similarly, the GOAT plasma levels detected in prostate cancer patients also positively correlated with two other tumor markers, such as ca153 and figure_211 (Figure 3).
    Finally, it is intended that the GOAT plasma levels detected in prostate cancer patients correlate with several markers related to the deregulation of the
    20 glucose homeostasis, diabetes and metabolic syndrome. Specifically, GOAT levels were positively correlated with glycosylated hemoglobin levels in patients with prostate cancer (Figure 4). In addition, they were correlated with glucose levels and with the HOMA-IR index in prostate cancer patients with metabolic syndrome (Figure 5).

    BIBLIOGRAPHY
    one. Kojima, M., et al., Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature, 1999. 402 (6762): p. 656-60.
    2. Lago, F., et al., Ghrelin, the same peptide for different functions: player or bystander Vitam Horm, 2005. 71: p. 405-32.
    3. Leite-Moreira, A.F., A. Rocha-Sousa, and T. Henriques-Coelho, Cardiac, skeletal, and smooth muscle regulation by ghrelin. Vitam Horm, 2008. 77: p. 207-38.
    Four. Leite-Moreira, A.F. and J.B. Soares, Physiological, pathological and potential therapeutic roles of ghrelin. Drug Discov Today, 2007. 12 (7-8): p. 276-88.
    5. Leontiou, C.A., G. Franchi, and M. Korbonits, Ghrelin in neuroendocrine organs and tumors. Pituitary, 2007. 10 (3): p. 213-25.
    6. Horvath, T.L., et al., Minireview: ghrelin and the regulation of energy balance - a hypothalamic perspective. Endocrinology, 2001. 142 (10): p. 4163-9.
    7. Tschop, M., D.L. Smiley, and M.L. Heiman, Ghrelin induces adiposity in rodents. Nature, 2000. 407 (6806): p. 908-13.
    8. van der Lely, A.J., et al., Biological, physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocr Rev, 2004. 25 (3): p. 426-57.
    9. Gutierrez, J.A., et al., Ghrelin octanoylation mediated by an orphan lipid transferase. Proc Natl Acad Sci U S A, 2008. 105 (17): p. 6320-5.
    10. Yang, J., et al., Identification of the acyltransferase that octanoylates ghrelin, an appetitestimulating peptide hormone. Cell, 2008. 132 (3): p. 387-96.
    eleven. Chang, S.C. and A.I. Magee, Acyltransferases for secreted signalling proteins (Review). Mol Membr Biol, 2009. 26 (1): p. 104-13.
    12. Lim, C.T., B. Kola, and M. Korbonits, The ghrelin / GOAT / GHS-R system and energy metabolism. Rev Endocr Metab Disord, 2011. 12 (3): p. 173-86.
    13. Muller, T.D., et al., Genetic variation of the ghrelin activator gene ghrelin O-acyltransferase (GOAT) is associated with anorexia nervosa. J Psychiatr Res, 2011. 45 (5): p. 706-11.
    14. Taylor, M.S., et al., Architectural Organization of the Metabolic Regulatory Enzyme GhrelinO-Acyltransferase. J Biol Chem, 2013.
    fifteen. Lim, C.T., et al., The expression of ghrelin O-acyltransferase (GOAT) in human tissues. Endocr J, 2011. 58 (8): p. 707-10.
    16. Sakata, I., et al., Co-Localization of Ghrelin O-Acyltransferase (GOAT) and Ghrelin in Gastric Mucosal Cells. Am J Physiol Endocrinol Metab, 2009. 297 (1): E134-41.


    17. Gahete, M.D., et al., A novel human ghrelin variant (In1-ghrelin) and ghrelin-Oacyltransferase are overexpressed in breast cancer: potential pathophysiological relevance.
    PLoS One, 2011. 6 (8): p. e23302.
    18. Papotti, M., et al., Ghrelin-producing endocrine tumors of the stomach and intestine. J Clin 5 Endocrinol Metab, 2001. 86 (10): p. 5052-9.
    19. Rindi, G., et al., Ghrelin expression in gut endocrine growths. Histochem Cell Biol, 2002. 117 (6): p. 521-5.
    twenty. Volante, M., et al., Expression of ghrelin and of the GH secretagogue receptor by pancreatic islet cells and related endocrine tumors. J Clin Endocrinol Metab, 2002. 87 (3): p. 1300-8.
    10 21. Inhoff, T., et al., Desacyl ghrelin inhibits the orexigenic effect of peripherally injected ghrelin in rats. Peptides, 2008. 29 (12): p. 2159-68.
    22. Ekeblad, S., et al., Co-expression of ghrelin and its receptor in pancreatic endocrine tumors. Clin Endocrinol (Oxf), 2007. 66 (1): p. 115-22.
    2. 3. Chopin, L.K., et al., The ghrelin axis - does it have an appetite for cancer progression 15 Endocr Rev, 2012. 33 (6): p. 849-91.
    24. Seim, I., et al., Ghrelin O-acyltransferase (GOAT) is expressed in prostate cancer tissues and cell lines and expression is differentially regulated in vitro by ghrelin. Reprod Biol Endocrinol, 2013. 11: p. 70.
    25. Ibanez-Costa, A., et al., In1-ghrelin splicing variant is overexpressed in pituitary adenomas 20 and increases their aggressive features. Sci Rep, 2015. 5: p. 8714.

    权利要求:
    Claims (17)
    [1]
    one. In vitro use of the levels, expressed in terms of concentration or quantity, obtained from an isolated biological sample of a subject, of the gene expression products encoding the enzyme ghrelin-O-acyl transferase (GOAT), for Obtaining useful data in the diagnosis or detection of prostate cancer.
    [2]
    2. In vitro use according to claim 1, wherein said levels of the expression products are selected from the list consisting of the amount or concentration of the ghrelin-O-acyl transferase enzyme (GOAT) or the mRNA encoding said enzyme .
    [3]
    3.  The use according to claim 1 or 2, wherein the isolated biological sample is selected from the list consisting of blood, plasma, serum or a biopsy or sample of prostate tissue.
    [4]
    Four. The use according to any of the preceding claims, wherein the levels of the gene expression products refer to the amount or concentration of the enzyme ghrelin-O-acyl transferase (GOAT) obtained from an isolated sample of blood, serum, of an isolated sample of prostate tissue or plasma and / or where the levels of gene expression products refer to the amount or concentration of mRNA obtained from an isolated sample of prostate tissue.
    [5]
    5.  Method of obtaining useful data for the diagnosis and / or detection of prostate cancer in a human subject, comprising:
    to. detect and quantify in vitro the levels, expressed in terms of concentration or quantity, obtained from an isolated biological sample of said subject, of the gene expression products encoding the enzyme ghrelin-O-acyl transferase (GOAT).
    [6]
    6.  Method of obtaining useful data for the diagnosis and / or detection of prostate cancer in a human subject, where said levels of expression products are selected from the list consisting of the amount or concentration of the ghrelin-O-acyl enzyme transferase (GOAT) or the mRNA encoding said enzyme.
    [7]
    7. The method of obtaining useful data according to any of claims 5 or 6, wherein the isolated biological sample is selected from the list consisting of blood, plasma, serum or a biopsy or sample of prostate tissue.
    [8]
    8.  Method of obtaining useful data according to any of claims 5 to 7, further comprising:

    b. compare the levels obtained in step (a) with a reference level or with the levels obtained in a control sample obtained from a healthy human subject.
    [9]
    9. Method of diagnosis and / or detection of prostate cancer comprising steps (a) - (b) according to claim 8, and further comprising:
    C. assign the subjects that have increased levels with respect to a reference level, to the group of individuals suffering from prostate cancer.
    [10]
    10. Method of diagnosis and / or detection of prostate cancer comprising steps (a) - (b) according to claim 8, and further comprising:
    C. assign the subjects that have increased levels by at least 2 times the levels obtained in a control sample obtained from a healthy human subject, to the group of individuals suffering from prostate cancer.
    [11]
    eleven.  Kit or device suitable for carrying out a PCR reaction, preferably RT-PCR, qRT-PCR or qPCR, comprising primers consisting essentially of the sequences SEQ ID NO 1 and SEQ ID NO 2.
    [12]
    12.  The kit or device according to claim 11, further comprising at least one or any combination of the following reagents: DNA polymerase, dNTPs, MgCl2, markers, stabilizers, DNAsas and the enzyme reverse transcriptase (RT).
    [13]
    13. In vitro use of a kit or device comprising specific primers for the determination of GOAT expression levels by PCR, to obtain useful data for the diagnosis and / or detection of prostate cancer in a human subject from a biological sample isolated from said subject.
    [14]
    14.  Use according to claim 13, wherein the kit is defined according to any of claims 11 or 12.
    [15]
    fifteen. Use according to any of claims 13 or 14, wherein said biological sample is selected from the list consisting of blood, plasma, serum and isolated samples of prostate tissue.
    [16]
    16. In vitro use of a kit or device comprising specific antibodies or fragments thereof against the GOAT protein, for obtaining useful data for the diagnosis and / or detection of prostate cancer in a human subject from a biological sample isolated from said subject.

    [17]
    17. Use according to claim 16, wherein said biological sample is a biopsy of prostate tissue.

    Fig. 1
     MI (n = 30) CP (n = 85) 0 20 40 60 80 100
    Fig 2

    3 50 10
    40 8
    2 30 6
    TPSA
    20 4
    20 10
    20
    000 GOAT ng / ml GOAT ng / ml GOAT ng / ml GOAT ng / ml
    Fig. 3.
     0 5 10152025 GOAT ng / ml
    Fig. 4.

    Glucose level (mg / dL)
    100 10
    0 GOAT ng / ml GOAT ng / ml
    Fig. 5.

    Sequence listing ._ST25 to be filed. SEQUENCE LISTING
    <110> UNIVERSITY OF CORDOBA
    <120> Ghrelin-O-acyl transferase (GOAT) and its uses
    <130> 901049
    <160> 2
    <170> PatentIn version 3.5
    <210> <211> <212> <213> 1 21 Artificial DNA Sequence
    <220> <223> Specific primer
    <220> <221> <222> misc_feature (1) .. (21)
    <400> 1 ttgctctttt tccctgctct c twenty-one
    <210> <211> <212> <213> 2 21 Artificial DNA Sequence
    <220> <223> Specific primer
    <220> <221> <222> misc_feature (1) .. (21)
    <400> 2 actgccacgt ttaggcattc t twenty-one
     one
    类似技术:
    公开号 | 公开日 | 专利标题
    Song et al.2006|Proteomic analysis on metastasis-associated proteins of human hepatocellular carcinoma tissues
    BRPI0720371A2|2013-12-31|CANCER BIOMARKERS.
    WO2004055519A2|2004-07-01|Specific markers for pancreatic cancer
    KR102047502B1|2019-11-22|Composition for diagnosing cancer using potassium channel protein
    JPWO2009142257A1|2011-09-29|Esophageal cancer determination composition and method
    Carr et al.2013|Overexpression of membrane proteins in primary and metastatic gastrointestinal neuroendocrine tumors
    ES2620262B1|2018-06-25|Ghrelin-O-acyl transferase | and its uses
    KR20200099108A|2020-08-21|Composition for diagnosing cancer
    EP3217175B1|2020-12-23|Arteriosclerosis detection method using deoxyhypusine synthase gene as indicator
    ES2403781B1|2014-06-06|METHOD OF OBTAINING USEFUL DATA FOR THE DIAGNOSIS OF CANCER CANCER, AND TO EVALUATE THE RESPONSE TO TREATMENT.
    ES2372337B1|2013-01-18|VARIANTE OF THE GHRELINA AND ITS USES.
    ES2874803T3|2021-11-05|Use of In1-ghrelin for the diagnosis of prostate cancer and colon cancer
    ES2363669B1|2012-08-09|METHOD FOR DETERMINING THE RISK OF DEVELOPING BRAIN METASTASIS AND A KIT TO CARRY OUT THIS PROCEDURE
    WO2013096852A1|2013-06-27|Biomarkers of cancer
    KR102216386B1|2021-02-17|A Composition for Diagnosing Cancer
    KR102280672B1|2021-07-23|A Composition for Diagnosing Cancer
    KR20210109724A|2021-09-07|A Composition for Diagnosing Cancer
    CN107385098B|2020-03-13|Gastric adenocarcinoma metastasis diagnosis and treatment tool
    KR102280360B1|2021-07-23|A Composition for Diagnosing Cancer
    KR102325742B1|2021-11-15|A Composition for Diagnosing Cancer
    US11180814B2|2021-11-23|Biomarker for diagnosis and prognosis prediction of liver cancer, and use thereof
    CN107385096B|2020-03-13|LRRTM1 gene and application of expression product thereof in preparation of gastric adenocarcinoma metastasis diagnosis and treatment tool
    KR20210109725A|2021-09-07|A Composition for Diagnosing Cancer
    KR20210109727A|2021-09-07|A Composition for Diagnosing Cancer
    Shaker et al.2021|Tenascin-C As A New Marker For The Diagnosis And Treatment Monitoring Of Breast Cancer
    同族专利:
    公开号 | 公开日
    ES2620262B1|2018-06-25|
    BR112018010848A2|2018-11-27|
    WO2017089642A1|2017-06-01|
    US20200158732A1|2020-05-21|
    EP3381936A4|2019-06-19|
    ES2877094T3|2021-11-16|
    EP3381936B1|2021-03-24|
    EP3381936A1|2018-10-03|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    EP1847620A3|2000-10-13|2008-10-22|Cedars-Sinai Medical Center|Methods of diagnosis of prostate cancer, compositions and methods of screening for modulators of prostate cancer|
    AU2002254800B2|2001-05-10|2006-09-28|Queensland University Of Technology|Reproductive cancer diagnosis and therapy|
    ES2372337B1|2010-06-10|2013-01-18|Servicio Andaluz De Salud|VARIANTE OF THE GHRELINA AND ITS USES.|
    WO2013155633A1|2012-04-19|2013-10-24|Leong Hon Sing|Method for detecting or monitoring prostate cancer|
    法律状态:
    2018-06-25| FG2A| Definitive protection|Ref document number: 2620262 Country of ref document: ES Kind code of ref document: B1 Effective date: 20180625 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201531731A|ES2620262B1|2015-11-27|2015-11-27|Ghrelin-O-acyl transferaseand its uses|ES201531731A| ES2620262B1|2015-11-27|2015-11-27|Ghrelin-O-acyl transferaseand its uses|
    BR112018010848-0A| BR112018010848A2|2015-11-27|2016-11-28|grelin-o-acilotransferaseand uses thereof|
    ES16868079T| ES2877094T3|2015-11-27|2016-11-28|Diagnosis of prostate cancer using ghrelin-O-acyl transferase |
    PCT/ES2016/070844| WO2017089642A1|2015-11-27|2016-11-28|Ghrelin o-acyltransferaseand uses thereof|
    US15/779,776| US20200158732A1|2015-11-27|2016-11-28|Ghrelin o-acyltransferaseand uses thereof|
    EP16868079.1A| EP3381936B1|2015-11-27|2016-11-28|Diagnosis of prostate cancer using ghrelin o-acyltransferase |
    [返回顶部]