• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    CELL TRANSFECTION METHOD. The present invention relates to methods for transfecting cells. In particular, the present invention relates to methods of transfecting primordial germ cells in birds, and methods of rearing birds, with modified characteristics.
    公开号:BR112014026186B1
    申请号:R112014026186-5
    申请日:2013-04-19
    公开日:2022-02-01
    发明作者:Scott Geoffrey Tyack
    申请人:Commonwealth Scientific And Industrial Research Organisation；Mat Malta Advanced Technologies Limited；
    IPC主号:
    专利说明:

    FIELD OF THE INVENTION
    [001] The present invention relates to cell transfection methods. In particular, the present invention relates to methods of transfecting primordial germ cells into birds, and methods of rearing birds with modified traits. BACKGROUND OF THE INVENTION
    [002] The development of an efficient technique to develop transgenic or genetically modified birds is of great importance for the agricultural and biopharmaceutical industries, as well as for increasing our understanding of avian biology through functional genomic studies. Poultry production will play an important role in ensuring food security for the planet in the face of population growth, and modern advances in biotechnology, such as the development of transgenic poultry, will help the industry to meet the demand for greater production.
    [003] More specifically, the application of transgenic technology to modify traits in birds that are not possible through conventional breeding, such as disease resistance and modulation of sex determination, will now be possible and will provide great benefits to the poultry industry. The demand for biopharmaceutical proteins is growing rapidly and, until recently, in vitro cell-based manufacturing systems to produce new recombinant proteins for the treatment of disease have been used. The use of transgenic livestock as bioreactors for the production of recombinant proteins is now being developed as an important alternative to expensive and labor-intensive cell-based systems. The development of transgenic technology for chickens has allowed the egg to be developed as a bioreactor for high levels of production and purification of biopharmaceutical proteins.
    [004] Attempts have also been made to introduce selected foreign genes by cloning them into a retroviral vector (e.g. reticuloendothelial virus or avian leukosis virus), injecting the recombinant virus into fertile eggs, allowing the virus to infect the developing embryo (eg, primordial germ cells), thus creating a chimeric gonad or ovum, and using the resulting recombinant to attempt to introduce a foreign gene into the progeny. However, the poultry industry has been reluctant to commercially use this technology, as the virus (in its natural state) is a pathogen, and even variant replication-competent virus vectors can sometimes induce tumors. , and replication-incompetent variants require high or repeated dosages. Likewise, even replication-defective virus constructs may pose some degree of risk of recombining with endogenous virus envelopes and becoming replication competent. Furthermore, these vectors are currently limited to relatively small-sized DNA inserts (eg, two kilobases or less).
    [005] There have also been attempts to inject foreign DNA into an undeveloped fertilized egg after it has been surgically removed from the hen. However, this approach required incubating the developing embryo in a series of surrogate vessels. In addition, it took flocks of chickens and a lot of practice to gain the necessary surgical and technical skills.
    [006] An alternative approach involves injecting genetically modified embryonic cells, or primordial germ cells (PGCs) into a recipient embryo shortly after laying. In this approach, PCG cultures were created that maintained their ability to differentiate into functional eggs or sperm that produced cells when incorporated into the developing embryo. PGC cultures of this type can be genetically modified and then injected into recipient embryos. Recipient embryos could have typically been modified by gamma irradiation to weaken endogenous primordial germ cells so as to give the injected cells a selection advantage in terms of hosting the gonadal ridge. The modified cells could then mature and produce sperm or eggs capable of transmitting the transgene to at least the next generation. However, this technique is time consuming as it requires the removal of PGCs from a donor embryo and their subsequent culture and reintroduction into a recipient embryo. Furthermore, the efficiency at which birds comprising genetically modified PGCs can be obtained using this technique is low.
    [007] In this sense, there is still a need for methods of genetic modification of primordial germ cells of birds. SUMMARY OF THE INVENTION
    [008] The present inventors have found that direct injection of transfection reagents mixed with DNA into the blood of developing avian embryos results in the introduction of the DNA into primordial germ cells (PGCs) and the insertion of the DNA into the avian genome.
    [009] Accordingly, the present invention provides a method for producing a bird comprising genetically modified germ cells, which comprises: (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of an avian embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the bird.
    [0010] In one embodiment, the method further comprises (ii) incubating the embryo at a temperature sufficient for the embryo to become a chicken.
    [0011] The transfection mixture is preferably injected into the bird embryo at the time of PGC migration at approximately stages 12 to 17. In a preferred embodiment, the transfection mixture is injected into the bird embryo at stages 13 to 14.
    [0012] While any suitable transfection reagent can be used in the methods of the invention, preferably the transfection reagent comprises a cationic lipid.
    [0013] In one embodiment, the transfection reagent comprises a monovalent cationic lipid selected from one or more of DOTMA (N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride) , DOTAP (1,2-(bis)oleoyloxy-3-3-(trimethylammonium)propane), DMRIE (1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide) and DDAB (dimethyldioctadecylammonium bromide). In another embodiment, the transfection reagent comprises a polyvalent cationic lipid selected from one or more deDOSPA (2,3-dioleoyloxy-N-[2(sperminocarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate) and DOSPER (1,3-dioleoyloxy-2-(6-carboxyspermyl)-propylamide),TMTPS (tetramethyltetrapalmitoylspermine), TMTOS (tetramethyltetraoleylspermine), TMTLS (tetramethyltetralaurylspermine), TMTMS (tetramethyltetramyristylspermine) and TMDOS (tetramethyldioleylspermine).
    [0014] In yet another embodiment, the transfection reagent comprises DOSPA (2,3-dioleyloxy-N-[2(sperminocarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate).
    [0015] In another embodiment, the transfection reagent further comprises a neutral lipid. The neutral lipid may comprise, for example, DOPE (dioleoylphosphatidylethanolamine, DPhPE (diphthanoylphosphatidylethanolamine) or cholesterol.
    [0016] In a particular embodiment, the transfection reagent comprises a 3:1 (w/w) mixture of DOSPA and DOPE prior to mixing the transfection reagent with the polynucleotide.
    [0017] Advantageously, the methods of the present invention are suitable for the use of non-retroviral methods of introducing a polynucleotide into the genome of a germ cell. Thus, in one embodiment, the polynucleotide further comprises a nucleotide sequence that encodes a transposon or a zinc finger nuclease.
    [0018] In a particular embodiment, the transfection mixture comprises a polynucleotide encoding a transposase. The transposase may be encoded by DNA, such as in a plasmid, or alternatively, the polynucleotide encoding the transposase is RNA.
    [0019] In a specific modality, the transposon is selected from Tol2, mini-Tol2, Sleeping Beauty and PiggyBac.
    [0020] In another embodiment, the polynucleotide comprises a sequence encoding a zinc finger nuclease.
    [0021] Although the germ cells that are genetically modified in birds may be embryonic germ cells, preferably the cells are primordial germ cells.
    [0022] In one embodiment, the injection mixture is injected into the embryo in the eggshell in which the embryo has developed.
    [0023] The polynucleotide in the transfection mixture can be an RNA molecule or DNA molecule that encodes a polypeptide, or a DNA molecule that encodes an RNA that comprises a double-stranded region. In a particular embodiment, the polynucleotide encodes an RNA molecule that comprises a double-stranded region. The RNA molecule can, for example, be a siRNA, shRNA or mock RNA (RNA decoy).
    [0024] In another embodiment, the polynucleotide encodes a polypeptide.
    [0025] In one embodiment, the RNA molecule or polypeptide reduces virus replication in a cell, compared to a cell without the RNA molecule or polypeptide.
    [0026] The methods of the invention can be used to target any viral pathogen in a bird. In one embodiment, the virus is the influenza virus.
    [0027] The present invention further provides a bird, having genetically modified germ cells, wherein the bird is produced by the method of the invention.
    [0028] The present invention further provides a genetically modified germ cell of the bird of the invention, wherein the germ cell comprises the polynucleotide inserted into the genome.
    [0029] The present invention further provides sperm produced by birds, which comprise the genetically modified cells of the invention.
    [0030] The present invention further provides an egg produced by birds, which comprises the genetically modified cells of the invention.
    [0031] The present invention further provides a method for genetically modifying germ cells in a bird, which comprises: (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of a contained avian embryo in an egg; and (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a chicken; wherein the polynucleotide is inserted into the genome of one or more germ cells in the bird.
    [0032] In additional embodiments, the method comprises one or more of the features of the invention, as described therein.
    [0033] The present invention further provides a method for producing a genetically modified bird, which comprises: (i) obtaining the bird comprising the genetically modified germ cells of the invention; (ii) breeding from the bird comprising genetically modified germ cells to produce offspring; and (iii) selecting the progeny that comprise the polynucleotide inserted into the genome.
    [0034] The present invention further provides an avegenetically modified produced by the method of the invention.
    [0035] The present invention further provides a method of food production, which comprises: (i) obtaining the bird comprising the genetically modified germ cells of the invention, or the avegenetically modified one of the invention; and (ii) producing food from the bird.
    [0036] In one embodiment, the method collects meat and/or eggs from the bird.
    [0037] The present invention further provides a method of rearing genetically modified birds, which comprises: (i) carrying out the method of the invention to produce a hen or progeny; (ii) allowing the chick or progeny to develop into a sexually mature bird; and (iii) rearing from a sexually mature bird to produce a genetically modified bird.
    [0038] In one embodiment, the invention provides a genetically modified bird produced in accordance with the method of the invention.
    [0039] The present invention further provides a method of modulating a trait in an avian, the method comprising: (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of an avian embryo, whereby polynucleotide is inserted into the genome of one or more germ cells in the bird; and (ii) incubating the embryo at a temperature sufficient to allow the embryo to develop into a chicken; wherein the polynucleotide encodes a polypeptide or RNA molecule comprising a double-stranded region that modulates a trait in the bird.
    [0040] In one embodiment, the RNA molecule comprises a siRNA, shRNA, or mock RNA.
    [0041] In one embodiment, the trait is selected from muscle mass, sex, nutritional content and/or disease resistance.
    [0042] The present invention further provides a method of increasing the resistance of a bird to a virus, the method comprising carrying out the method of the invention, wherein the polynucleotide is a siRNA, shRNA or mock RNA that reduces the replication of the virus in a cell, or the polynucleotide encodes an antiviral peptide that reduces virus replication in a cell.
    [0043] In a particular embodiment, the virus is the influenza virus.
    [0044] The present invention further provides a bird produced in accordance with the method of the invention.
    [0045] In some embodiments of the invention, the bird is selected from a chicken, duck, turkey, goose, bantam hen or quail.
    [0046] In another embodiment of the methods of the invention, the transfection mixture further comprises a targeting nuclease, or a polynucleotide encoding a targeting nuclease, to facilitate integration of the polynucleotide into the germ cell genome. For example, the targeting nuclease can be selected from a zinc finger nuclease, TALEN and CRISPR.
    [0047] The present invention further provides a method for producing a bird comprising genetically modified germ cells, which comprises: (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of a bird embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the bird; and (ii) incubating the embryo at a temperature sufficient for the embryo to develop into a chicken; wherein the transfection reagent comprises a cationic lipid, the polynucleotide further comprises a sequence encoding a transposon, and the transfection mixture is injected in the blood vessel of the bird embryo at stages 13 and 14.
    [0048] In one embodiment, the transfection reagent comprises lipofectamine 2000 or a 3:1 (w/w) mixture of DOSPA and DOPE prior to mixing the transfection reagent with the polynucleotide, the transposon is Tol2 or mini-Tol2 and the The transfection mixture comprises a polynucleotide encoding Tol2 transposase.
    [0049] The present invention further provides a method for producing a bird comprising genetically modified germ cells, which comprises: (i) injecting a transfection mixture comprising a polynucleotide mixed with a transfection reagent into a blood vessel of a bird embryo, whereby the polynucleotide is inserted into the genome of one or more germ cells in the bird; and (ii) incubating the embryo at a temperature sufficient for the embryo to develop into a chicken; wherein the transfection reagent comprises a cationic lipid and a neutral lipid, the polynucleotide further comprises a sequence encoding a zinc finger nuclease , and the transfection mixture is injected into the blood vessel of the bird embryo at stages 13 and 14.
    [0050] In one embodiment, the transfection reagent comprises lipofectamine 2000 or a 3:1 (w/w) mixture of DOSPA and DOPE prior to mixing the transfection reagent with the polynucleotide.
    [0051] As will be apparent, preferred features and features of one aspect of the invention are applicable to many other aspects of the invention.
    [0052] Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising" shall be interpreted as implying the inclusion of an element, integer or established step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
    [0053] The invention is described below by means of the following non-limiting examples and with reference to the associated figures. BRIEF DESCRIPTION OF THE DRAWINGS
    [0054] Figure 1. Direct injection of DNA encoding EGFP complexed with lipofectamine 2000 into avian embryos. Fluorescent images (left side) and corresponding brightfield images (right side) of the gonads taken from the embryos on day 7.
    [0055] Figure 2. Direct injection of DNA encoding EGFP complexed with lipofectamine 2000 into avian embryos, day 14 images. Fluorescent images (right side) and corresponding brightfield images (left side) of the gonads taken from the embryos on day 14. The last fluorescent image is a magnification of the left set of green cells in an embryo. This region was removed by dissection of the remainder of the gonad to stain with the homologous chicken vasa (cvh). A small part of the remainder of the gonad was used as a negative control.
    [0056] Figure 3. Direct injection of DNA encoding EGFP complexed with lipofectamine 2000 into avian embryos. Staining cells for the cvh PGC marker. DAPI staining showing nuclear material and staining of all cells, cvh, a PGC-specific marker marked a subpopulation of cells (lighter gray cells). Transformed cells that received the transposon by direct injection and turned green are indicated by arrows.
    [0057] Figure 4. Confirmation of in vitro optimization by direct injection in avian embryos. EGFP expression in embryo gonads on day 14.
    [0058] Figure 5. Direct injection of DNA encoding EGFP and a multi-warhead construct comprising several sequences encoding shRNAs complexed with lipofectamine 2000 into broiler embryos. Fluorescent images of gonads on day 12.
    [0059] Figure 6. Direct injection of DNA encoding EGFP, and a multi-headed, extended hairpin construct complexed with lipofectamine 2000 into laying hen embryos. Fluorescent images of the gonads of day 14 embryos after direct injection.
    [0060] Figure 7. Direct injection of the Tol2-EGFP construct with each of the two multiple shRNA expression cassettes (pMAT084 and pMAT085). Images of 10 gonads taken on day 14, showing EGFP expression.
    [0061] Figure 8. Scanning gel electrophoresis of PCR products indicating the integration of PB shRNA in direct injected embryos. DNA was extracted from an enriched PGC sample from ZFN-treated embryos as well as from control embryos at 5 days after direct injection with ZFN and a repair plasmid (containing the PB shRNA). A PCR scan was then performed to detect the integration of the PB shRNA into the genome. Lane 1 shows PB-injected embryos, control embryos in lane 2, ZFN-treated cells in lane 3 (positive control), and lane 4 is a water control.KEY TO SEQUENCE LISTINGSEQ ID NO: 1 - polynucleotide sequence EGFP construct Tol2;SEQ ID NO: 2 - transposase Tol2 amino acid sequence;SEQ ID NO: 3 - scan oligonucleotide primer 7;SEQ ID NO: 4 - scan oligonucleotide primer 6;SEQ ID NO: 5 - oligonucleotide primer normal deminiTol2;SEQ ID NO: 6 - miniTol2 reverse oligonucleotide primer;SEQ ID NO: 7 - miniTol2 detection probe; SEQ ID NO: 8 - genomic control region normal primer;SEQ ID NO: 9 - genomic control region reverse primer;SEQ ID NO: 10 - genomic control region probe. DETAILED DESCRIPTION General definitions and techniques
    [0062] Unless otherwise defined, all technical and scientific terms used in this document shall be considered to have the same meaning as is commonly understood by a person skilled in the ordinary art (e.g. in protein chemistry, biochemistry , cell culture, molecular genetics, microbiology and immunology).
    [0063] Unless otherwise indicated, the DNA and recombinant protein, cell culture and immunological techniques used in the present invention are standard procedures well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press (2001), R. Scopes, Protein Purification - Principals and Practice, 3rd ed. Springer (1994), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates to date), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).
    [0064] The term "avian", as used in the present invention, refers to any species, subspecies or race of organism of the taxonomic class Aves, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites, including ostrich, emu and cassowary. The term includes the various known varieties of Gallus gallus (chickens), e.g. White Leghorn, Brown Leghorn, Rock Barrada, Sussex, New Hampshire, Rhode Island, Australorp, Cornish, Minorca, Amrox, California Gray and Italian Partidge-coloured, as well as types of turkeys, pheasants, quail, duck, ostriches and other domestic birds commonly raised in commercial quantities.
    [0065] The term "poultry" includes all birds kept, bred or domesticated for the production of meat or eggs, e.g. chicken, turkey, ostrich, quail, pigeon, guinea fowl, pheasant, duck, goose and emu.
    [0066] As used in the present invention, a "genetically modified bird" or "transgenic bird" refers to any bird in which one or more of the bird's cells contains heterologous nucleic acid introduced through human intervention. direct injection technique
    [0067] The germ line in chickens is initiated as the epiblast cells of a stage X embryo ingress into the nascent hypoblast (Kagami et al., 1997; and Petitte, 2002). As the hypoblast develops anteriorly, the primordial germ cells are pushed forward into the germinal crescent, where they can be identified as the large cells loaded with glycogen. The first identification of germline cells by these morphological criteria occurs about 8 hours after the start of incubation (phase 4 using the staging system established by Hamburger and Hamilton, (1951)). The primordial germ cells reside in the stage 4 germinal crescent, until they migrate through the vasculature during stages 12 to 17. At this time, the primordial germ cells are a small population of about 200 cells. From the vasculature, primordial germ cells migrate into the genital crest and are incorporated into the ovaries or testes as the gonad differentiates.
    [0068] Chimeric germline chickens were previously generated by transplanting the donor PGCs and gonad germ cells from various developmental stages (blastoderm to 20 day embryo) into recipient embryos. Methods for obtaining transgenic chickens from long-term cultures of avian primordial germ cells (PGCs) have also been described, for example, in US patent application 20060206952. When combined with a host bird embryo by known procedures, those modified PGCs are transmitted through the germ line to produce genetically modified offspring.
    [0069] Unlike the commonly used methods of the prior art, which are based on collecting donor embryos, the methods of the present invention involve the direct injection of a transfection mixture into an avian embryo. Thus, the methods of the invention can be used to transfect avian germ cells, including PGCs and embryonic germ cells. transfection mix
    [0070] In the methods of the present invention, a polynucleotide is complexed or mixed with an appropriate transfection reagent. The term "transfection reagent", as used in the present invention, refers to a composition added to the polynucleotide to enhance uptake of the polynucleotide in a eukaryotic cell including, but not limited to, an avian cell, such as a primordial germ cell. . While any transfection reagent known in the art to be suitable for transfecting eukaryotic cells can be used, the present inventors have found that transfection reagents comprising a cationic lipid are particularly useful in the methods of the present invention. Thus, in a preferred embodiment, monovalent cationic lipids are selected from one or more of DOTMA (N-[1-(2,3-dioleoyloxy)-propyl]-N,N,N-trimethylammonium chloride), DOTAP ( 1,2-bis(oleoyloxy)-3-3-(trimethylammonium)propane), DMRIE (1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide) or DDAB (dimethyldioctadecylammonium bromide). Preferred selected polyvalent cationic lipids are lipospermines, specifically DOSPA (2,3-dioleyloxy-N-[2(sperminocarboxamido)ethyl]-N,N-dimethyl-1,1-propanaminium trifluoracetate) and DOSPER (1,3-dioleoyloxy- 2-(6-carboxyspermyl)-propylamide), and the di- and tetra-alkyltetramethylspermines, including but not limited to TMTPS(tetramethyltetrapalmitoylspermine), TMTOS(tetramethyltetraoleylspermine), TMTLS(tetramethyltetralaurylspermine), TMTMS(tetramethyltetramyristylspermine) and TMDOS(tetramethyldioleylspermine) ). Cationic lipids are optionally combined with non-cationic lipids, particularly neutral lipids, eg lipids such as DOPE (dioleoylphosphatidylethanolamine), DPhPE(diphthanoylphosphatidylethanolamine) or cholesterol. A cationic lipid composition composed of a 3:1 (w/w) mixture of DOSPA and DOPE, or a 1:1 (w/w) mixture of DOTMA and DOPE are generally useful in the methods of the invention. Non-limiting examples of suitable commercially available transfection reagents comprising cationic lipids include lipofectamine (Life Technologies) and lipofectamine 2000 (Life Technologies).
    [0071] In general, any dendrimer that can be employed to introduce nucleic acid into any cell, particularly a eukaryotic cell, is useful in the methods of this invention. Generation 5 or higher (G5 or higher) dendrimers are preferred, with those of the generation between G5-G10 being of particular interest. Dendrimers that may be useful in the invention include those with NH3 or ethylenediamine nuclei, GX(NHs) or GX(EDA), where X= the generation number. With dendrimers where X = 5 to 10 being preferred. Dendrimers that may be useful in the invention include those in which the repeating unit of the inner layers is an amidoamine (to form polyamidoamines, i.e. PAMAMs). Useful dendrimers include those in which the terminal functional groups on the outer surface of the dendrimer provide a positive charge density, for example, as do terminal amine functional groups. The surface charge and chemical nature of the outer surface of dendrimers can vary by altering the functional groups on the surface, for example, by reacting some or all of the surface amine groups. Of particular interest are dendrimers that are functionalized by reaction with cationic amino acids such as lysine or arginine. Grafted dendrimers as described, for example, in PCT applications WO 9622321 and WO 9631549 cited in U.S. Patent No. 5,266,106 can be used in the methods of this invention. Activated dendrimers (Haensler and Szoka, 1993; and Tang et al., 1996) can also be used in the methods of the invention.
    [0072] The transfection reagent may further comprise peptide sequences from viral, bacterial or animal proteins and other sources, including peptides, proteins or fragments or parts thereof which may improve the efficiency of transfection of eukaryotic cells mediated by the transfection agents, including cationic lipids and dendrimers. Such peptides are described in US 20030069173 and include, for example, viral peptides or proteins from influenza virus, adenovirus, Semliki forest virus, HIV, hepatitis, herpes simplex virus, vesicular stomatitis virus or simian virus 40, and more specifically, an RGD peptide sequence, an NLS peptide sequence and/or a VSVG peptide sequence, and the viral peptides or proteins of each of the foregoing.
    [0073] The polynucleotide may be mixed (or "complexed") with the transfection reagent according to manufacturers' instructions or known protocols. By way of example, when transfecting plasmid DNA with the lipofectamine 2000 transfection reagent (Invitrogen, Life Technologies), DNA can be diluted in 50 µL of Opit-MEM medium and mixed gently. Lipofectamine 2000 reagent is mixed gently and an appropriate amount is diluted in 50 μL of Opti-MEM medium. After a 5 minute incubation period, the diluted DNA and transfection reagent are combined and mixed gently at room temperature for 20 minutes.
    [0074] A suitable volume of the transfection mixture can then be injected directly into an avian embryo in accordance with the method of the invention. Typically, a suitable volume for injection into an avian embryo is from about 1 μL to about 3 μL, although adequate volumes can be determined by factors such as the stage of the embryo and the bird species being injected. The person skilled in the art will appreciate that the protocols for mixing the transfection reagent and DNA, as well as the volume to be injected into the avian embryo, can be optimized in light of the teachings of the present specification. Injection into the embryo
    [0075] Prior to injection, eggs are incubated at a temperature suitable for embryonic development, e.g. about 37.5 to 38°C, with the pointed end (taglion) facing up for about 2.5 days (stages 12 to 17), or until such time as the blood vessels in the embryo are large enough to allow injection. The ideal time for injection of the transfection mixture is the time of PGC migration which normally occurs approximately at stages 12 to 17, but more preferably at stages 13 to 14. As one skilled in the art will note, broiler hens Broiler strains typically have faster growing embryos and therefore injection should preferably take place at stages 13 to 14 in order to introduce the transfection mixture into the blood stream at the time of PGC migration.
    [0076] To access a blood vessel from the bird embryo, a hole is made in the eggshell. For example, a hole of about 10 mm can be made in the pointed end of the egg using an appropriate utensil such as a forceps. The shell section and associated membranes are carefully removed, avoiding damage to the embryo and its membranes.
    [0077] Siliconized glass capillary tube micropipettes can be used to inject the transfection mixture into the blood vessels of the bird embryo. Typically, the micropipettes are removed or “pulled out” with a micropipette puller and the tips are beveled with the aid of a pipette sharpener to a diameter (internal aperture) of about 10 μm to about 50 μm in diameter, more preferably from about 25 μm to about 30 μm in diameter. Micropipettes are typically tapered to a diameter of about 25 μm to about 30 μm, to facilitate injection of the PGCs into an avian embryo. The person skilled in the art will appreciate that a narrower diameter can be used in the methods of the present invention, as the transfection mixture does not comprise the cells. A micropipette produced in this way is also referred to as a "pulled glass capillary".
    [0078] A pulled glass capillary is loaded with about 1 to 3 μL of the transfection complex. The injection is made into any blood vessel large enough to accommodate the capillary, such as the marginal vein or dorsal aorta, or any other blood vessel large enough to accommodate the capillary. Air pressure can be used to expel the transfection complex from the capillary into the blood vessel.
    [0079] After injection of the transfection mixture into the blood vessel of the avian embryo, the egg is sealed using a sufficient amount of parafilm, or other suitable sealing film, as is known in the art. For example, where a 10mm hole has been drilled in the shell, an approximately 20mm square piece of parafilm can be used to cover the hole. A scalpel blade can then be used to affix the parafilm to the outer surface of the egg. The eggs are then inverted into position with the pointed end down and incubated at a temperature sufficient for the embryo to develop, such as until after analysis or hatching of the egg.
    [0080] As used in the present invention, the phrases "sufficient temperature for the embryo to develop" and "sufficient temperature for the embryo to develop into a chicken" refer to the incubation temperatures that are necessary for an avian embryo to continue to develop in the egg and preferably develop into a chick that is ready to hatch. Suitable incubation temperatures can be determined by those skilled in the art. For example, a chicken egg is normally incubated at about 35.8 to about 38°C. Incubators are commercially available which control the incubation temperature to desirable levels, for example from 37.9°C on days 1 to 6 after egg placement, to about 37.6°C on days 9 and 10, about 37.5°C on days 11 and 12, about 37.4°C on day 13, about 37.3°C on days 14 and 15, about 37.2°C on day 16 and about 37, 1°C on day 17, and which may decrease to about 35.8°C by day 22.Genomic integration of polynucleotides
    [0081] To facilitate the integration of the polynucleotide into the genome of avian germ cells, preferably from a transposon, zinc finger nuclease, or another non-viral construct or vector, is used in the method of the invention.
    [0082] Examples of suitable transposons include Tol2 (Kawakami et al., 2002), mini-Tol2, Sleeping Beauty (Ivies et al., 1997), PiggyBac (Ding et al., 2005), Mariner and Galluhop. The Tol2 transposon which was first isolated from the rice field goldfish Oryzias latipes and belongs to the hAT family of transposon is described in Kawakami et al. (2000). Mini-Tol2 is a variant of Tol2 and is described in Balciunas et al. (2006). The Tol2 and Mini-Tol2 transposons facilitate the integration of a transgene into an organism's genome by acting in conjunction with the Tol2 transposase. When delivering the Tol2 transposase on a separate non-replicating plasmid, only the Tol2 or Mini-Tol2 transposon and the transgene are integrated into the genome, and the plasmid containing the Tol2 transposase is lost in a limited number of cell divisions. Thus, an integrated Tol2 or Mini-Tol2 transposon will no longer have the ability to undergo a subsequent transposition event. Furthermore, as Tol2 is not known to be a naturally occurring avian transposon, there is no endogenous transposase activity in an avian cell, eg a chicken cell, to cause further transposition events. As would be understood in the art, an RNA encoding the Tol2 transposase can be included in the transfection mixture as an alternative to a plasmid DNA encoding the transposase. Thus, the Tol2 transposon and the transposase are particularly suitable for use in the methods of the present invention.
    [0083] Any other suitable transposon system may be used in the methods of the present invention. For example, the transposon system may be a Sleeping Beauty, Frog Prince, or Mosl transposon system, or any transposon belonging to the tel/mariner or hAT family of transposons may be used.
    [0084] The person skilled in the art will understand that it may be desirable to include additional genetic elements in the constructs to be injected into the avian embryo. Examples of an additional genetic element that can be included in the nucleic acid construct include a reporter gene, such as one or more genes for a fluorescent marker protein such as GFP or RFP; an easily analyzed enzyme, such as beta-galactosidase, luciferase, beta-glucuronidase, chloramphenic acetyltransferase, or embryonic secreted alkaline phosphatase; or proteins for which immunoassays are readily available, such as hormones or cytokines. Other genetic elements that may find use in embodiments of the present invention include those that encode proteins that confer a selective growth advantage on cells, such as adenosine deaminase, aminoglycoid phosphotransferase, dihydrofolate reductase, hygromycin-B-phosphotransferase, or drug resistance. .
    [0085] Genome editing technologies can also be used in the methods of the invention. By way of example, genome editing technology may be a targeting nuclease. As used in the present invention, the term "targeting nuclease" includes reference to a naturally occurring protein, or a modified protein. In one embodiment, the targeting endonuclease may be a meganuclease. Meganucleases are endodeoxyribonucleases characterized by long recognition sequences, that is, the recognition sequence generally ranges from about 12 base pairs to about 40 base pairs. As a consequence of this requirement, the recognition sequence usually occurs only once in any given genome. Among meganucleases, the family of resident endonucleases called LAGLIDADG has become a valuable tool for the study of genomes and genomic engineering. A meganuclease can be targeted to a specific chromosomal sequence by modifying its recognition sequence using techniques well known to those skilled in the art.
    [0086] In another embodiment, the "targeting nuclease" is a zinc finger nuclease. Zinc finger nucleases (ZFNs) are artificial nucleases generated by fusing a zinc finger DNA binding domain to a DNA cleavage domain. Zinc finger domains can be manipulated to target desired DNA sequences, and this allows zinc finger nucleases to be targeted to unique sequences within complex genomes. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms. Zinc finger nucleases are known in the art and described, for example, in U.S. Patent No. 7,241,574 and reviewed in Durai et al. (2005) and in Davis and Stokoe (2010).
    [0087] Prior to the present invention, it was expected that to modify PGCs using zinc finger nuclease technology, zinc finger constructs could be introduced into cultured PGCs. Transfected cells comprising the desired insertions/modifications could then be selected and cloned. The cloned and selected cells could be injected into a PGC-depleted recipient embryo.
    [0088] The present inventors surprisingly found that direct injection of a zinc finger nuclease construct into an avian embryo resulted in a specific genomic modification that could be detected in the gonad of the transfected embryo on day 14. This verification was This is surprising because it was expected that the combined transfection efficiency and zinc finger nuclease activity levels could be too low to detect a specific modification in a directly injected embryo. In view of the targeting specificity of the desired DNA sequences and the fact that the present inventors have found that the combination of a zinc finger nuclease and transfection reagent injected directly into an embryo achieved higher efficiency levels than the As expected, zinc finger nucleases are particularly useful for introducing a polynucleotide into the genome of an avian germ cell in the methods of the present invention.
    [0089] In yet another embodiment, the targeting endonuclease may be a transcriptional activator-type effector nuclease (TALE) (see, for example, Zhang et al., 2011). TALEs are transcription factors from the plant pathogen Xanthomonas that can be readily manipulated to bind to novel DNA targets. TALEs, or their truncated versions, can be linked to the catalytic domain of endonucleases, such as Fokl, to create the targeting endonuclease called TALE nucleases or TALENs.
    [0090] In yet another embodiment, the “targeting nuclease” is a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease (Barrangou, 2012). CRISPR is a microbial nuclease system involved in defense against invading phages and plasmids.
    [0091] CRISPR loci in microbial hosts contain a combination of CRISPR-associated genes (Cas) as well as non-coding RNA elements capable of programming the specificity of CRISPR-mediated nucleic acid cleavage. Three types (I-III) of CRISPR systems have been identified in a wide range of bacterial hosts. A key feature of each CRISPR locus is the presence of a matrix of repetitive sequences (direct repetitions), interspersed with short stretches of non-repetitive sequences (spacers). The non-coding CRISPR template is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct the Cas nucleases to the target site (protospacer).
    [0092] CRISPR type II is one of the most well-characterized systems (eg, see Cong et al., 2013) and performs oriented double-stranded DNA breakage in four sequential steps. First, two non-coding RNAs, the pre-crRNA template and tracrRNA, are transcribed from the CRISPR locus. Subsequently, the tracrRNA hybridizes to the repeat regions of the pre-crRNA and mediates the processing of the pre-crRNA into the mature crRNAs containing the individual spacer sequences. Third, the mature crRNA:tracrRNA complex directs Cas9 to the target DNA through Wastson-Crick base pairing between the spacer on the crRNA and the protospacer on the target DNA near the adjacent portion of the protospacer (PAM), an additional requirement for target recognition. Finally, Cas9 mediates the cleavage of the target DNA to create a double-stranded break within the protospacer. The CRISPR system can also be used to generate single-strand breaks in the genome. Thus, the CRISPR system can be used for RNA-guided site-specific editing. polynucleotides
    [0093] The methods of the present invention can be used to incorporate the polynucleotides into the genome of avian primordial germ cells that can be transmitted to genetically modified offspring. Polynucleotides integrated into the genome can confer a desirable function or activity on the genetically modified cells, the polynucleotide comprising such as, for example, modifying a production trait or increasing disease resistance. Thus, polynucleotides that can be integrated into the germ cell genome include those that encode short interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), extended short hairpin RNAs (ehRNAs), catalytic RNAs such as ribozymes, sham RNAs, as well as such as those encoding endogenous or exogenous polypeptides, such as those that can be used to modulate a production trait or increase disease resistance in a bird.
    [0094] Thus, in some embodiments, the methods of the invention can be used to modify any trait of an avian species. Preferred traits that can be modified include production and disease resistance traits. As used in the present invention, the term "production trait" refers to any phenotype of a bird that has commercial value, such as muscle mass, sex, disease resistance or nutritional content. Preferred characteristics that can be modified in accordance with the methods of the present invention include sex, muscle mass and disease resistance. Examples of genes that can be targeted to modify sex as a production trait in a bird include DMRT1, WPKCI (ASW), R-spondin, FOX9, aromatase, AMH and β-catenin.
    [0095] As used in the present invention, the term "muscle mass" refers to the weight of muscle tissue. An increase in muscle mass can be determined by weighing the total muscle tissue of a bird, which is hatched from an egg treated as described herein, compared to a bird of the same bird species, more preferably of a bird type or breed. , and even more preferably the same bird to which a nucleic acid has not been administered, as defined herein. Alternatively, specific muscles, such as the chest and/or thigh muscles, can be used to identify an increase in muscle mass. Genes that can be targeted to modulate muscle mass include, for example, the myostatin gene. RNA interference
    [0096] In certain embodiments, the methods of the present invention utilize nucleic acid molecules encoding double-stranded regions for RNA interference in order to modulate traits in a bird. The terms "RNA interference", "RNAi" or "gene silencing" generally refer to a process in which a double-stranded RNA molecule reduces the expression of a nucleic acid sequence with which the RNA molecule strands share substantial or full homology. However, it has been shown that RNA interference can be achieved using double-stranded molecules other than RNA (see eg US 20070004667).
    [0097] Double-stranded regions must be at least 19 nucleotides contiguous, e.g. about 19 to 23 nucleotides, or may be longer, e.g. 30 or 50 nucleotides, or 100 nucleotides or more . The complete sequence corresponding to the entire gene transcript can be used. Preferably, they are from about 19 to about 23 nucleotides in length.
    [0098] The degree of identity of a double-stranded region of a nucleic acid molecule to the target transcript should be at least 90% and more preferably 95 to 100%. The nucleic acid molecule may, of course, comprise unrelated sequences which may function to stabilize the molecule.
    [0099] The term "short interfering RNA" or "siRNA", as used in the present invention, refers to a nucleic acid molecule comprising ribonucleotides capable of inhibiting or down-regulating gene expression, for example, mediating the RNAi of sequence-specific manner, wherein the double-stranded portion is less than 50 nucleotides in length, preferably from about 19 to about 23 nucleotides in length. For example, the siRNA can be a nucleic acid molecule that comprises self-complementary sense and antisense regions, where the antisense region comprises the nucleotide sequence that is complementary to the nucleotide sequence in a target nucleic acid molecule, or a portion of it. same, and the sense region has a nucleotide sequence corresponding to the target nucleic acid sequence, or a portion thereof. The siRNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, where the sense and antisense strands are self-complementary.
    [00100] As used in the present invention, the term siRNA is intended to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence-specific RNAi, e.g., micro-RNA (miRNA), short hairpin (shRNA), short interfering oligonucleotide, short interfering nucleic acid (siNA), short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA) and others. Furthermore, as used in the present invention, the term RNAi is intended to be equivalent to other terms used to describe sequence-specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetics. For example, siRNA molecules, as described in this document, can be used to epigenetically silence genes at both the post-transcriptional and pre-transcriptional levels. In a non-limiting example, epigenetic regulation of gene expression by siRNA molecules, as described in this paper, may result from siRNA-mediated modification of chromatin structure to alter gene expression.
    [00101] By "shRNA" or "short hairpin RNA" is meant an RNA molecule where less than about 50 nucleotides, preferably about 19 to about 23 nucleotides, are base-paired with a localized complementary sequence. in the same RNA molecule, and wherein said sequence and complementary sequence are separated by an unpaired region of at least about 4 to about 15 nucleotides, which forms a single-stranded loop above the stem structure created by the two regions of basic complementarity.
    [00102] The shRNAs included are double or two- or multi-finger hairpin dsRNAs, wherein the RNA molecule comprises two or more such stem-loop structures, separated by single-stranded spacer regions.
    [00103] MicroRNA regulation is a specialized branch of the RNA silencing pathway that has evolved towards gene regulation, diverging from conventional RNAi/PTGS. MicroRNAs are a specific class of small RNAs that are encoded in gene-like elements arranged in a characteristic inverted repeat. When transcribed, microRNA genes give rise to stem-loop precursor RNAs, from which microRNAs are further processed. MicroRNAs are typically about 21 nucleotides in length. The released miRNAs are incorporated into RISC-like complexes containing a particular subset of agronaut proteins that exert sequence-specific gene repression. disease resistance
    [00104] The methods of the present invention can be used to integrate a polynucleotide that confers disease-resistance through the cell into the genome of primordial germ cells in an avian embryo. For example, the polynucleotide may encode a nucleic acid molecule, such as a siRNA, shRNA, or miRNA, that reduces the expression of a host or pathogen gene, resulting in decreased viral replication in cells in which the polynucleotide is present. "Viral replication", as used in the present invention, refers to the amplification of the viral genome in a host cell, the packaging of the viral genome into a cell, and/or the release of infectious viral particles from a cell.
    [00105] Alternatively, the polynucleotide may encode a mock RNA. Mock RNAs are known in the art and contain particular nucleotide base sequences, which bind to viral proteins that are essential for pathogenic virus replication. Mock RNAs targeting HIV proteins were first described by Sullenger et al. (nineteen ninety). The person skilled in the art will understand, however, that dummy RNAs can be engineered to target proteins that play a role in the replication of avian viral pathogens, such as dummy RNAs targeting the proteins of the influenza virus polymerase complex.
    [00106] Preferably, by reducing virus replication in avian cells, the genetically modified birds comprising the polynucleotide will have increased resistance to a viral pathogen. As used in the present invention, a bird that is "resistant" or that has "higher resistance" to a pathogen or viral pathogen exhibits fewer symptoms, or no symptoms of disease compared to a susceptible bird, when exposed to the pathogen. Using the methods of the invention, birds can be made resistant to pathogens such as, but not limited to, influenza virus, Marek's disease virus, Newcastle disease virus, and infectious bursal disease virus.Protein production recombinants in the egg
    [00107] Petitte and Modziak (2007) describe the domestic chicken as a "very efficient protein bioreactor". Recognizing that bird eggs contain large amounts of protein, and that more than half of the protein in egg whites or albumin comprises a single species, there is great potential in producing recombinant or heterologous proteins in eggs. The difficulties encountered in prior art methods of producing transgenic poultry for producing therapeutic proteins in eggs are well described in the art. Although achieved using an undesirable lentivirus system, the production of transgenic birds that deposit high levels of commercially relevant proteins in an egg has been achieved. In this regard, the methods of the present invention can be used to produce genetically modified birds that express a heterologous or recombinant polypeptide in eggs. Commercially important proteins that could be produced in eggs include therapeutic proteins such as antibodies and vaccine antigens. Production and breeding of genetically modified birds
    [00108] The methods of the present invention include methods of breeding genetically modified birds and methods of producing food from genetically modified birds. The person skilled in the art will understand that a bird of the invention, comprising genetically modified germ cells, may have a chimeric germline, in which only some of the germ cells that have migrated to the gonads are genetically modified. Thus, the bird comprising the genetically modified germ cells can be bred to produce offspring, in which all the cells are genetically modified. Thus, in one embodiment, the invention provides a method of producing a genetically modified bird, the method comprising: (i) obtaining the bird comprising the genetically modified germ cells according to the invention (ii) breeding from the birds that comprise the germ cells genetically modified to produce the offspring and (iii) select the offspring comprising the polynucleotide inserted into the genome.
    [00109] The birds comprising the genetically modified germ cells of the invention, and the genetically modified birds according to the invention can be used in food production. Thus, the methods of the invention are applicable to the production of poultry products for human and animal consumption. Methods of producing food derived from poultry are well known in the art and may comprise collecting meat and/or eggs from poultry, such as, but not limited to, a chicken. In certain embodiments, the bird has been genetically modified to include a polynucleotide that modulates a production trait. EXAMPLES Example 1. Direct injection of the EGFP expression construct into embryos
    [00110] 5.1 µg of a nucleic acid construct encoding enhanced GFP (EGFP) flanked by the Tol2 sequences and 1.0 µg of a plasmid encoding the Tol2 transposase were complexed with 3 µl of lipofectamine 2000. Acid complexation nucleic acid and transfection reagent were performed in a total volume of 90 μL of OptiMEM or OptiPRO medium using incubation times recommended by the manufacturer (Life Technologies).
    [00111] After the last 20 minutes of incubation, 1 to 3 μL of the complex was injected into a blood vessel of 2.5 day old chicken embryos (stages 13 to 17; Hamburger and Hamilton, 1951). No blood removal was necessary. Access to the embryo was achieved by removing a small section (10 mm) of the shell. After injection, the hole was sealed with a square of 20 mm square of parafilm.
    [00112] EGFP expression was observed on day 7 and day 14 in most gonads at different levels. Dissociated gonad cells and green cells were also shown to be PGCs (Figures 1, 2 and 3). Example 2. In Vitro DNA Optimization for Transfection Reagent Ratios
    [00113] Experiments were performed to test the optimal ratio of DNA:Lipofectamine 2000 and the volume of media to compose the transfection complex. A DNA construct encoding EGFP and a single hairpin (shRNA) with Tol2 franchising sequences was complexed with lipofectamine 2000 in volumes of OptiMEM of 50, 40, 30 or 20 μL. The ratios of DNA (μg) to lipofectamine 2000 (μL) used were as follows: 1:2, 2:4 and 4:8.
    [00114] The complexes were transfected into chicken fibroblast cells (DF-1) and analyzed for EGFP expression. The results indicated (not shown) that a 1:2 ratio of DNA (μg):lipofectamine 2000 in 30 μL of medium worked slightly better than a 2:4 ratio in 50 μL.
    [00115] The in vitro data were later confirmed in the embryos. 0.33 μg of DNA construct, comprising the Tol2 transposon, 0.66 μg of plasmid transposase and 2 μL of lipofectamine 2000 were complexed in OptiMEM and injected directly into chicken embryos. All live embryos showed good levels of EGFP expression on day 14 (Figure 4).Example 3. FuGene Transfection Reagent Test
    [00116] FuGene (Promega) was tested as a transfection reagent using a DNA:Fugene ratio similar to that recommended by the manufacturer for cell culture transfection. The FuGene-complexed DNA construct comprised an EGFP expression cassette with Tol2 flanking sequences. The complex (0.66 μg of the EGFP-Tol2 construct, 1.33 μg of the transposase plasmid, 6 μL of FuGene) was injected directly into 15 embryos. One of the embryos showed very small amounts of EGFP expression in the gonads on day 14. This experiment was repeated, and on day 12, all 10 embryos that were injected were still alive. Two of the embryos had a pair of green cells in the gonads.Example 4. Direct injection transformation of broiler lines
    [00117] As with previous direct injection experiments performed on laying hen lines, the purpose of this experiment was to test whether the direct injection method could be used to successfully transform broiler lines. An EGFP expression construct comprising a single hairpin flanking the Tol2 sequences was complexed with lipofectamine 2000 (0.33 μg transposon construct, 0.66 μg transposase, 2 μL lipofectamine 2000) and injected directly into the aorta. backbone of chicken embryos. Twelve of the 13 injected embryos were alive at day 10 and good amounts of EGFP expression were detected in most gonads.
    [00118] This experiment was repeated with an EGFP expression construct comprising several hairpins (shRNAs) (0.33 μg transposon, 0.66 μg transposase and 2 μL lipofectamine 2000). Good amounts of EGFP expression were found in the embryos at day 12 (Figure 5).Example 5. Comparison of OptiMEM with OptiPRO as a transfection reagent medium
    [00119] A comparison was made between OptiMEM (containing animal products), OptiPRO (without animal products) and PBSA as the transfection reagent medium. An EGFP expression construct comprising the Tol2 flanking sequences was complexed with the transfection reagent (0.33 µg transposon, 0.66 µg transposase, 2 µL Lipofectamine 2000) and injected directly into chicken embryos. All embryos were slightly green in the gonads at day 12, and the medium used did not affect mortality. OptiMEM and OptiPRO produced equivalent results, whereas PBSA resulted in significantly reduced expression of EGFP in the gonads.Example 6. Laying hen lines injected with the “multi-warhead” construct.
    [00120] Two DNA constructs were complexed with the transfection reagent and injected directly into chicken embryos. The first DNA construct comprised an EGFP expression cassette and multiple shRNA hairpins flanked by a Tol2 sequence, and the second construct comprised an EGFP expression construct and a single extended hairpin cassette encoding three double-stranded regions. . The constructs were complexed with the transfection reagent in the following amounts: 0.33 μg transposon, 0.66 μg transposase, 2 μL lipofectamine 2000. On day 14, EGFP expression was found in the gonads of most embryos for both constructs.Example 7. Tol2-EGFP persistence test
    [00121] A DNA construct comprising an EGFP expression cassette, multiple hairpins and flanked by Tol2 were complexed with the transfection reagent. (0.33 μg transposon, 2 μL lipofectamine 2000). The transposase-free transfection complex was injected directly into chicken embryos.
    [00122] Embryos where the transposase was omitted still had green cells in some embryos, but fewer cells than what was observed when the transposase is included. This suggests that the plasmid can remain in the gonadal cells for at least 2 weeks after direct injection, and that not all of the green staining observed is due to the integration of Tol2 into the genome.Example 8. Lipofectamine not of animal origin
    [00123] An EGFP expression cassette with Tol2 and several shRNA expression cassettes was complexed with the animal product-free transfection reagent (lipofectamine 2000 CD) (0.33 μg transposon, 0.66 μg transposase, 2 μL of lipofectamine 2000 CD). On day 14, all 10 embryos examined showed good amounts of EGFP expression in the gonads (figure 7).Example 9. Direct injection on day 3.5
    [00124] In all previous experiments, injections of transfection complexes were performed on day 2.5. The purpose of this experiment was to test an alternative time (day 3.5) for direct injection of embryos. A DNA construct, composed of an EGFP and Tol2 expression construct, was complexed with lipofectamine 2000CD (0.33 µg transposon, 0.66 µg transposase, 2 µL lipofectamine 2000 CD).
    [00125] On day 14, 8 of 21 embryos had small amounts of EGFP expression in the gonads. Thus, the timing of direct injection at day 2.5 is important, and by day 3.5, efficient transfection of PGCs is not observed.Example 10. Changing transposon to transposase ratios
    [00126] Keeping the ratios of DNA:lipofectamine 2000 CD:medium, we increase the transposon ratio in the DNA mixture, while slightly decreasing the ratio of plasmid transposase. Slightly different volumes were used due to the need to inject more eggs in future experiments. The inventors also tested the removal of blood from the embryo prior to injection of the transfection mixture to determine whether this allowed a greater volume of the mixture to be injected.
    [00127] A DNA construct comprising an EGFP and Tol2 expression cassette was complexed with the transfection reagent. (0.66 µg transposon, 1.0 µg transposase, 3 µl lipofectamine 2000 CD). At day 14, prebleed embryos had similar levels of EGFP expression in the gonads compared to non-prebled embryos. The new DNA ratios worked well, with good levels of EGFP expression being observed.Example 11. JetPEI Transfection Reagent
    [00128] For JetPEI, the DNA construct comprising an EGFP and Tol2 expression cassette was complexed with the transfection reagent (4 µg transposon, 6 µg transposase, 1.6 µL JetPEI (Polyplus transfection) in 50 μL of OptiPRO (with 5% glucose). JetPEI caused blood to clot after injection, but this did not affect embryo survival. Green cells were found in these embryos and in the gonads, but most were morphologically different from the transformed PGCs observed when Lipofectamine2000 was used.
    [00129] A second experiment was performed to test the JetPEI transfection reagent. Two reaction mixtures were used: i) 0.66 μg transposon, 1.0 μg transposase, 0.5 μL JetPEI in 100 μL OptiPRO (with 5% glucose); and ii) 1.32 µg transposon, 2.0 µg transposase, 0.5 µl JetPEI in 100 µl OptiPRO (with 5% glucose).
    [00130] JetPEI caused blood to clot after injection, and reaction mixing (ii) resulted in improved embryo survivability. Again, some degree of EGFP expression was seen in the gonads, but again the cell type did not appear to be similar to PGC. The gonads were removed and the cells dissociated and stained for PGC markers. There were no green cells staining for the PGC markers, confirming that the PGCs were not being transfected by the JetPEI complex.Example 12. Zinc finger nuclease
    [00131] The aim of the experiment was to determine whether zinc finger nuclease plasmids can be used to transform PGCs by the direct injection technique. The DNA used in the experiment comprised two zinc finger nuclease plasmids and the overlapping fragment, which was complexed with the transfection reagent comprising 0.5 μg of each plasmid, 3 μL of lipofectamine 2000 CD in 90 μL of OptiPRO.
    [00132] As there was no EGFP present in the plasmids, the inventors relied on a PCR test that could amplify only one fragment if the overlapping fragment had been incorporated into the chicken genome. After 14 days of incubation, gonads were removed, PGCs enriched using an antibody selection method, and genomic DNA was prepared. PCR revealed that the overlapping fragment had been incorporated into the chicken genome. These results demonstrate that zinc finger nucleases are suitable for integrating DNA into the genome of avian PGCs using the direct injection method of the present invention.Example 13. Results
    [00133] In accordance with the protocols described above, the inventors have observed significant transformation of PGCs in the gonads of recipient embryos, and to a much greater degree than that described in prior art methods of transfection of PGCs. By staining cells with PGC-specific markers, the inventors demonstrated that the majority of transformed cells in the gonad were PGCs. The inventors reared recipient embryos to sexual maturity and were able to detect Tol2 transposon sequences in the semen of >90% of adult males.
    [00134] Other transfection reagents were used, however, lipid-based reagents provided better transfection of PGCs. JetPEI transfected cells by this method, but it could not be shown that any of the transfected cells were PGCs. FuGene cells transfected at a very low rate.Example 14. Direct injection modification of the genome using zinc finger nucleases
    [00135] A zinc finger nuclease (ZFN) targeted to a region of intron 5 of the PANK1 gene was injected together with a plasmid containing the anti-influenza shRNA PB 1-2257 and the regions necessary for homologous repair in embryos that were further analyzed for shRNA integration.
    [00136] A total of 1.5 µg of DNA (500 µg of each ZFN plasmid and 500 µg of the repair plasmid) was added to 45 µl of OptiPRO and then complexed with 3 µl of lipofectamine 2000 CD in 45 µl of OptiPRO before being injected into 30 eggs 2.5 days. The eggs were incubated until day 7, when the gonads were removed, disassociated and the PGCs enriched by using a type of MACS with an SSEA-1 antibody (Santa Cruz Biotech). DNA was extracted from the PGC-enriched sample from the ZFN-treated embryos and control embryos using a Qiagen DNAeasy kit.
    [00137] A PCR to scan for successful shRNA integration was performed using a primer that binds to the genome outside the region used for homologous repair (scan 7, 5' GTGACTCAGACTCCTGTTAG(SEQ ID NO:3)) and one that binds to shRNA (scan 6, 5'TCTGCTGCTTCACAGTCTTC (SEQ ID NO:4)). PCR was performed using the green master mix (Promega) according to the manufacturer's instructions, using cyclic conditions of 94°C for 2 min, followed by 36 cycles of 94°C for 45 observations, 55°C for 45 observations and 72°C for 1 min 10 s. This was followed by a final extension at 72°C for 10 min.
    [00138] PCR was performed on the PGC DNA-enriched sample from ZFN-treated embryos, as well as control embryos, DNA from positive control cells, which had previously been shown to have shRNA integrated into them, and a water control. Figure 8 shows the gel electrophoresis of these PCR reactions. The first lane, which contains the PCR of embryos directly injected with ZFN, clearly shows a band indicating genomic integration in the embryos that were injected.Example 15. Results of genome modification by direct injection of chickens
    [00139] After a series of cycles of direct injections, a total of 277 roosters were bred to sexual maturity, and their semen was tested for the presence of the Tol2 transgene. Of the 277 samples tested, 98 were found to contain the Tol2 transgene with varying levels of percent positive semen. A number of these G(0) positive roosters were mated and a total of 7393 G(1) chicks were tested. Sixty-five chicks were found to be transgenic. Later matings using these G(1) chicks demonstrated Mendelian inheritance of the transgenes to the G(2) generation.
    [00140] The hatched chicks were reared to sexual maturity, and quantitative real-time PCR (qPCR) was used to detect the presence of miniTol-EGFP in the semen. Semen samples were collected and DNA was extracted from 20 μL of semen diluted in 180 μL of PBS using the Qiagen DNeasy blood and tissue kit, according to the manufacturer's instructions. The semen genomic DNA was then diluted to 1/100 in ddH2O for use in the PCR reaction. qPCR was performed on a Mastercycler® ep realplex (Eppendorf, Hamburg, Germany), according to the manufacturer's instructions. Briefly, 20 µL of reactions were set up, containing 10 µL of 2x Taqman Universal Master Mix (Applied Biosystems), 1 µL of 20x FAM-labeled Assay Mix (Applied Biosystems), and 9 µL of diluted DNA. Each sample was set up in duplicate with minTol2 specific primers and probe: 5' reverse primer GGGCATCAGCGCAATTCAATT 3' (SEQ ID NO:6); 5' detection probe ATAGCAAGGGAAAATAG 3' (SEQ ID NO:7); and specific primers and probe for a genomic control region of the chicken genome, which acts as a control template: 5' normal primer GATGGGAAAACCCTGAACCTC 3' (SEQ ID NO: 8); 5' reverse primer CAACCTGCTAGAGAAGATGAGAAGAG 3' (SEQ ID NO: 9); probe detection 5' CTGCACTGAATGGAC 3' (SEQ ID NO: 10).
    [00141] The PCR cycle parameters were an initial denaturation step at 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 60°C for 1 minute. Each rooster was tested at least twice and was classified as being positive if a CT value less than 36 was obtained for minTol2. A CT less than 32 for the genomic control region was used to indicate that there was enough DNA in the sample tested.
    [00142] It will be appreciated by those skilled in the art that numerous variations and/or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present arrangements are therefore to be considered in all respects as illustrative and not restrictive.
    [00143] All publications discussed and/or referenced in this document are incorporated herein in their entirety.
    [00144] The present application claims priority from US 61/636,331, filed April 20, 2012, US 61/783,823, filed March 14, 2013 and AU 2013204327, filed April 12, 2013, all contents of each of which is incorporated herein by reference.
    [00145] Any discussion of documents, acts, materials, devices, articles or the like, which has been included in the present specification, is for the sole purpose of providing a context for the present invention. It is not to be considered an admission that any or all of these matters form part of the prior art basis or were common general knowledge in the field relevant to the present invention, as it existed prior to the priority date of each claim in that application. et al. (2006) PLoS Genet. 10:169. Barrangou (2012) Nature Biotechnology, 30:836-838. Cong et al. (2013) Science, 339:819-823.Davis and Stokoe (2010) BMC Med, 8:42.Ding et al. (2005) Cell, 122:473-483. Durai et al. (2005) Nucleic Acids Res, 33:5978-5990.Hamburger and Hamilton (1951) J Morphol, 88:49-92.Haensler and Szoka, (1993) Bioconjugate Chem, 4:372-379.Ivies et al. (1997) Cell, 91:501-510. Kagami et al. (1997) Mol Reprod Dev, 48:501-510. Kawakami et al. (2000) Proc Natl Acad Sci USA, 97: 11403-11408.Petitte (2002) J Poultry Sci, 39:205-228.Pettite and Modziak (2007) PIOC Natl Acad Sci USA, 104:1739-1740.Sullenger et al . (1990) Cell, 63:601-608. Tang et al. (1996) Bioconjugate Chem, 7:703-714. Zhang et al. (2011) Nature Biotechnology, 29:149-153.
    权利要求:
    Claims (14)
    [0001]
    1. Method for producing an avian comprising genetically modified germ cells, CHARACTERIZING in that it comprises: (1) obtaining an avian embryo that has been injected into its blood vessel with a transfection mixture comprising a polynucleotide mixed with a transfection reagent, in that (a) the polynucleotide comprises a transposon and the transfection mixture comprises a transposase or a polynucleotide encoding a transposase; or (b) the transfection mixture comprises a targeting nuclease or a polynucleotide encoding a targeting nuclease; and whereby the polynucleotide is inserted into the genome of one or more primordial germ cells in the bird; and (ii) incubating the embryo at a temperature sufficient for the embryo to develop into a chicken.
    [0002]
    2. Method according to claim 1, CHARACTERIZED by the fact that the transfection mixture is injected into the bird embryo at stages 13 and 14.
    [0003]
    3. Method according to claim 1 or 2, CHARACTERIZED in that the transfection reagent comprises a cationic lipid.
    [0004]
    4. Method according to claim 3, CHARACTERIZED in that i) the transfection reagent comprises a monovalent cationic lipid selected from one or more of DOTMA (N-[1-(2,3-dioleoyloxy chloride) propyl]-N,N,N-trimethylammonium), DOTAP (1,2-(bis)oleoyloxy-3-3-(trimethylammonium)propane), DMRIE (1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide) and DDAB (dimethyldioctadecylammonium bromide), and/orii) the transfection reagent comprises a polyvalent cationic lipid selected from one or more of DOSPA (2,3-dioleyloxy-N-[2(sperminocarboxamido)ethyl]-N,N- dimethyl-1-propanaminium) and DOSPER (1,3-dioleoyloxy-2-(6-carboxyspermyl)-propylamide), TMTPS (tetramethyltetrapalmitoyl spermine), TMTOS (tetramethyltetraoleyl spermine), TMTLS (tetramethyltetralauryl spermine), TMTMS (tetramethyltetramyryl spermine) and TMDOS (tetramethyldioleyl spermine).
    [0005]
    5. Method, according to claim 3 or 4, CHARACTERIZED in that the transfection reagent further comprises a neutral lipid.
    [0006]
    A method according to any one of claims 1 to 5, CHARACTERIZED in that the transfection mixture comprises a polynucleotide sequence encoding a transposase or a targeting nucleotide selected from the group consisting of a zinc finger nuclease, a TALEN or CRISPR targeting nuclease.
    [0007]
    7. Method according to any one of claims 1 to 6, CHARACTERIZED in that the injection mixture was injected into the embryo in the eggshell, in which the embryo developed.
    [0008]
    8. Method according to any one of claims 1 to 7, CHARACTERIZED in that the polynucleotide encodes an RNA molecule comprising a double-stranded region, or the polynucleotide encodes a polypeptide.
    [0009]
    9. Method, according to any one of claims 1 to 8, CHARACTERIZED by the fact that when present in the genome of the bird or its progeny, the polynucleotide modifies a characteristic of the bird.
    [0010]
    10. Method for increasing the resistance of a bird to a virus, CHARACTERIZING that it comprises carrying out the method, as defined in any one of claims 1 to 9, wherein the polynucleotide encodes a siRNA, shRNA or mock RNA that reduces the replication of the virus in a cell, or the polynucleotide encodes an antiviral peptide that reduces virus replication in a cell.
    [0011]
    11. Method according to any one of claims 1 to 10, CHARACTERIZED in that the bird is selected from a chicken, duck, turkey, goose, bantam hen or quail.
    [0012]
    12. Method according to any one of claims 1 to 11, CHARACTERIZED in that the polynucleotide comprises a transposon and the transfection mixture comprises a transposase or a polynucleotide encoding a transposase.
    [0013]
    13. Method according to any one of claims 1 to 12, CHARACTERIZED in that the transfection mixture comprises a targeting nuclease or a polynucleotide encoding a targeting nuclease.
    [0014]
    14. Method according to claim 13, CHARACTERIZED in that the targeting nuclease is a CRISPR targeting nuclease.
    类似技术:
    公开号 | 公开日 | 专利标题
    US20210112789A1|2021-04-22|Cell transfection method
    CN111448318A|2020-07-24|Methods of modifying specificity of non-coding RNA molecules for silencing gene expression in eukaryotic cells
    JP2010526542A|2010-08-05|Influenza treatment and prevention
    CN101175858A|2008-05-07|In-vitro method for producing oocytes or eggs having targeted genomic modification
    AU2009328633B2|2013-03-28|Methods of modulating the sex of avians
    CN107683336A|2018-02-09|Reagent for treating hepatitis type B virus | infection and application thereof
    JP2018534948A|2018-11-29|Virus production in avian eggs
    CN105018523B|2019-05-07|A kind of ZB Transposon System and its gene transfer method of mediation
    WO2018013759A1|2018-01-18|Poultry and offspring sex selection
    US20200149063A1|2020-05-14|Methods for gender determination and selection of avian embryos in unhatched eggs
    US20140289881A1|2014-09-25|Double-stranded rna
    CN104906125B|2018-03-02|Application of microRNA 326 inhibitor in the medicine for preparing treatment cataract
    Craveiro2017|Development of cloning-free protocols for generation of gene knockouts using CRISPR-Cas9 technology in the model organisms Danio rerio Drosophila melanogaster and Mus Musculus
    BR112021010753A2|2021-09-21|GENE EDITING SYSTEMS TO EDIT A CYSTIC FIBROSIS TRANS MEMBRANE REGULATORY GENE |
    CN102618581A|2012-08-01|Preparation of recombinant slow virus of shRNA | of target GPMV NP and M genes
    Zhu2017|Construction of a Conditional Knockout Platform in Zebrafish for Evaluating the Role of Dgcr8 in Embryonic Development
    Challagulla2016|Precision engineering of the chicken genome for disease control
    Jordan2012|Utilizing the piggyBac transposon in transgenic chicken strategies
    AU2013200109A1|2013-02-07|Treatment and prevention of influenza
    同族专利:
    公开号 | 公开日
    EP2839016A1|2015-02-25|
    KR102076784B1|2020-02-12|
    US20150072064A1|2015-03-12|
    AU2013204327A1|2013-11-07|
    KR20150014446A|2015-02-06|
    US10897881B2|2021-01-26|
    CN112626128A|2021-04-09|
    US20190261609A1|2019-08-29|
    CN104619848B|2020-12-15|
    BR112014026186A2|2017-07-18|
    EP2839016B1|2018-10-03|
    JP6531239B2|2019-06-19|
    ES2704155T3|2019-03-14|
    AU2013248945A1|2014-10-30|
    JP2015514404A|2015-05-21|
    WO2013155572A1|2013-10-24|
    US20210112789A1|2021-04-22|
    AU2013204327B2|2016-09-01|
    EP3460065A1|2019-03-27|
    CN104619848A|2015-05-13|
    EP2839016A4|2015-11-25|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US5162215A|1988-09-22|1992-11-10|Amgen Inc.|Method of gene transfer into chickens and other avian species|
    GB8906214D0|1989-03-17|1989-05-04|Nat Res Dev|Introducing an exogenous gene into birds|
    US5631329A|1990-08-27|1997-05-20|Dendritech, Inc.|Process for producing hyper-comb-branched polymers|
    US5453357A|1992-10-08|1995-09-26|Vanderbilt University|Pluripotential embryonic stem cells and methods of making same|
    US5266106A|1992-10-22|1993-11-30|Xerox Corporation|Ink compositions with dendrimer grafts|
    WO1996031549A1|1995-04-07|1996-10-10|Mueller Egbert|Dendrimeric graft polymers|
    CA2264012C|1996-08-13|2011-04-26|Chiron Corporation|Compositions and methods for polynucleotide delivery|
    US20030069173A1|1998-03-16|2003-04-10|Life Technologies, Inc.|Peptide-enhanced transfections|
    GB9710809D0|1997-05-23|1997-07-23|Medical Res Council|Nucleic acid binding proteins|
    ES2252851T3|1997-08-04|2006-05-16|University Of Massachusetts, A Public Institution Of Higher Education Of Commonwealth Massachusetts|CELLULAR LINE OF PRIMARY GERMINAL CELLS OF BIRDS AND METHOD FOR LONG-TERM CULTURE OF THE SAME.|
    WO1999006534A1|1997-08-04|1999-02-11|University Of Massachusetts, A Public Institution Of Higher Education Of The Commonwealth Of Massachusetts, Represented By Its Amherst Campus|Production of avian embryonic germ cell lines by prolonged culturing of pgcs, use thereof for cloning and chimerization|
    CA2307840C|1997-10-16|2014-07-15|University Of Georgia Research Foundation, Inc.|Protein production in transgenic avians|
    WO2000047717A1|1999-02-11|2000-08-17|Hanmi Pharm. Co., Ltd.|Avian pluripotent embryonic germ cell line|
    US6140118A|1999-08-11|2000-10-31|Wisconsin Alumni Research Foundation|Avian blastodermal cell lines|
    JP4609869B2|1999-12-03|2011-01-12|独立行政法人科学技術振興機構|Transposon transferase and gene modification method|
    US8202979B2|2002-02-20|2012-06-19|Sirna Therapeutics, Inc.|RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid|
    JP4300287B2|2002-02-14|2009-07-22|国立大学法人東京海洋大学|Induction of germ line differentiation by transplantation of isolated primordial germ cells|
    JP4364474B2|2002-02-15|2009-11-18|大学共同利用機関法人情報・システム研究機構|Functional transposons in mammals|
    US7527966B2|2002-06-26|2009-05-05|Transgenrx, Inc.|Gene regulation in transgenic animals using a transposon-based vector|
    US20040172667A1|2002-06-26|2004-09-02|Cooper Richard K.|Administration of transposon-based vectors to reproductive organs|
    KR100502889B1|2003-04-21|2005-07-20|한미약품|Method for Enhancing Germline Transmission Efficiency of Avian Primordial Germ Cells|
    AU2006210645A1|2005-02-01|2006-08-10|Symphogen A/S|Transgenic chickens|
    EP2366710A3|2005-03-31|2011-10-19|Ronen Kahana|Creating poultry and other animals resistant to viral disease|
    US20070293449A1|2006-06-20|2007-12-20|Nastech Pharmaceutical Company Inc.|Compositions and methods for delivery of double-stranded rna|
    WO2008060510A2|2006-11-13|2008-05-22|Sangamo Biosciences, Inc.|Zinc finger nuclease for targeting the human glucocorticoid receptor locus|
    MY149171A|2007-05-16|2013-07-31|Mat Malta Advanced Technologies Ltd|Treatment and prevention of influenza|
    CA2706224A1|2007-08-14|2009-02-19|Origen Therapeutics, Inc.|Transgenic chickens comprising an inactivated endogenous immunoglobulin light chain gene and methods to produce such chickens using genetically modified primordial germ cells|
    CN102612565B|2009-08-11|2016-04-06|桑格摩生物科学股份有限公司|The homozygous organism of targeting modification|
    CN107090470B|2011-02-25|2021-09-07|重组股份有限公司|Genetically modified animals and methods of making the same|
    CN105518146A|2013-04-04|2016-04-20|哈佛学院校长同事会|Therapeutic uses of genome editing with CRISPR/CAS systems|GB201122458D0|2011-12-30|2012-02-08|Univ Wageningen|Modified cascade ribonucleoproteins and uses thereof|
    KR20170134766A|2012-05-25|2017-12-06|더 리젠츠 오브 더 유니버시티 오브 캘리포니아|Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription|
    US10100331B2|2012-10-29|2018-10-16|Agency For Science, Technology And Research|Reagent for gene-drug therapeutics|
    ES2757325T3|2012-12-06|2020-04-28|Sigma Aldrich Co Llc|Modification and regulation of the genome based on CRISPR|
    KR20150105956A|2012-12-12|2015-09-18|더 브로드 인스티튜트, 인코퍼레이티드|Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications|
    EP3597755A1|2013-06-17|2020-01-22|The Broad Institute, Inc.|Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using viral components|
    WO2014093709A1|2012-12-12|2014-06-19|The Broad Institute, Inc.|Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof|
    EP3825406A1|2013-06-17|2021-05-26|The Broad Institute Inc.|Delivery and use of the crispr-cas systems, vectors and compositions for hepatic targeting and therapy|
    WO2014204727A1|2013-06-17|2014-12-24|The Broad Institute Inc.|Functional genomics using crispr-cas systems, compositions methods, screens and applications thereof|
    KR20170108172A|2013-03-14|2017-09-26|카리부 바이오사이언시스 인코포레이티드|Compositions and methods of nucleic acid-targeting nucleic acids|
    EP3674411A1|2013-06-17|2020-07-01|The Broad Institute, Inc.|Delivery, engineering and optimization of tandem guide systems, methods and compositions for sequence manipulation|
    WO2015089364A1|2013-12-12|2015-06-18|The Broad Institute Inc.|Crystal structure of a crispr-cas system, and uses thereof|
    EP3470089A1|2013-12-12|2019-04-17|The Broad Institute Inc.|Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components|
    SG10201804974RA|2013-12-12|2018-07-30|Broad Inst Inc|Compositions and Methods of Use of Crispr-Cas Systems in Nucleotide Repeat Disorders|
    CN103782953A|2014-01-23|2014-05-14|固镇县玉鹏蔬菜开发有限责任公司|Gosling plague prevention method|
    CN105265383A|2014-10-18|2016-01-27|颍上县永祥旱粮研究所|Under forest chicken cultivation method|
    WO2016094867A1|2014-12-12|2016-06-16|The Broad Institute Inc.|Protected guide rnas |
    CN104789599A|2015-04-13|2015-07-22|浙江省农业科学院|Method for improving transgenic poultry preparation efficiency through lentivirus subgerminal cavity injection|
    EP3129393B1|2015-06-18|2021-08-04|The Broad Institute Inc.|Crispr enzyme mutations reducing off-target effects|
    WO2017024343A1|2015-08-07|2017-02-16|Commonwealth Scientific And Industrial Research Organisation|Method for producing an animal comprising a germline genetic modification|
    AU2016361455A1|2015-11-24|2018-06-21|Commonwealth Scientific And Industrial Research Organisation|Production of viruses in cell culture|
    BR112018010503A2|2015-11-24|2018-11-13|Commw Scient Ind Res Org|bird egg, method for replicating a virus, virus, method for producing a vaccine composition, vaccine composition, transgenic bird, and method for producing a bird|
    WO2017111144A1|2015-12-25|2017-06-29|国立研究開発法人産業技術総合研究所|Genetically-modified poultry egg|
    AU2018274769A1|2017-05-25|2019-12-19|Eggxyt Ltd|Methods for gender determination of avian embryos in unhatched eggs and means thereof|
    CN109275622A|2017-07-20|2019-01-29|龚海华|A kind of cyclic culture method of laying hen|
    CN107723313A|2017-10-30|2018-02-23|扬州大学|A kind of method that allogenic material imports chicken embryo|
    EP3710013A4|2017-11-15|2021-06-16|Weird Science LLC|Methods and compositions for non-myeloablative bone marrow reconstitution|
    法律状态:
    2018-03-27| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2019-09-03| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|
    2021-06-22| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|
    2021-10-05| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2022-01-18| B09W| Correction of the decision to grant [chapter 9.1.4 patent gazette]|Free format text: RETIFICACAO INCORRECAO NO QUADRO 1 DO PARECER DE DEFERIMENTO E NO TITULO |
    2022-02-01| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 19/04/2013, OBSERVADAS AS CONDICOES LEGAIS. |
    优先权:
    申请号 | 申请日 | 专利标题
    US201261636331P| true| 2012-04-20|2012-04-20|
    US61/636,331|2012-04-20|
    US201361783823P| true| 2013-03-14|2013-03-14|
    US61/783,823|2013-03-14|
    AU2013204327|2013-04-12|
    AU2013204327A|AU2013204327B2|2012-04-20|2013-04-12|Cell transfection method|
    PCT/AU2013/000414|WO2013155572A1|2012-04-20|2013-04-19|Cell transfection method|
    [返回顶部]