methods to produce genetically modified mice, use of said mice and use of a nucleic acid sequence pr

专利摘要:
  METHODS TO PRODUCE GENETICALLY MODIFIED MICE UNDERSTANDING ECTOPIC NUCLEIC ACID SEQUENCE THAT CODES ADAM6 PROTEIN AND USE OF GENETICALLY MODIFIED MICE IN THE PRODUCTION OF ANTIBODIES, PROTEINS, HYBRIDOMES AND TREATMENT OF TREATMENTS.The present invention relates to methods for producing genetically modified mice comprising an ectopic nucleic acid sequence that encodes a mouse ADAM6 protein. In addition, the present invention provides uses of genetically modified mice for the production of antibodies, proteins, cell lines, hybridoma, and drugs for the treatment of human disease or disorder.
公开号:BR112014002713A2
申请号:R112014002713-7
申请日:2012-08-03
公开日:2020-10-27
发明作者:John McWhirter；Lynn MacDonald；Sean Stevens；Samuel Davis；David R. Buckler；Karolina A. Hosiawa；Andrew J. Murphy
申请人:Regeneron Pharmaceuticals, Inc.；
IPC主号:

专利说明:

[001] [001] Mice, cells, embryos, genetically modified tissues and isolated nucleic acids for the production of antibodies and sequences encoding variable domains of the human immunoglobulin heavy chain, including bispecific antibodies, and including bispecific antibodies that comprise universal light chains. Compositions and methods include genetically modified mice with germline substitutions at the endogenous variable locus of the mouse heavy chain, which comprise modified light chain loci that express light chains derived from no more than one or two gene segments V of the different light chain, in which the mice are still genetically modified in their germ line such that male mice carrying these modifications are fertile. Genetically modified mice are provided that express variable domains of the universal light chain and the humanized heavy chain, in which the mice comprise an ADAM6 activity that is functional in a male mouse. BACKGROUND
[002] [002] The development of antibodies for use as human therapy has a long and complex history. A significant advance has been the ability to produce essentially entirely human antibody sequences for use in designing effective human therapy with reduced potential for immunogenicity. The mice that now exist are modified in their germ line to
[003] [003] Human variable domains made in humanized mice can be used to project fully human bispecific antibodies, that is, binding proteins that are the heterodimers of heavy chains, where the identity and binding specificities of the variable domains of the chain heavy differ. But the selection of light chains that can be effectively associated and expressed with the heterodimers of the heavy chain is not an easy solution. The development of variable domains of the human light chain for use in human therapy is certainly possible in humanized mice, but there is no easy solution for the selection of which light chains will effectively associate and express with heavy chains having the desired characteristics of binding, where light chains are not detrimental to the expression or binding behavior of both heavy chains.
[004] [004] Thus, there remains a need in the art for compositions and methods for developing variable regions of human immunoglobulin for use in human therapy, including variable regions of human immunoglobulin generated from nucleic acid sequences in endogenous mouse immunoglobulin loci. SUMMARY
[005] [005] Mice are described expressing human immunoglobulin variable domains that are suitable for use in bispecific binding proteins, including bispecific antibodies, in which the mice comprise a humanization of an endogenous variable location of the mouse heavy chain , in which male mice comprising humanization are fertile, and in which mice further comprise a humanization of an endogenous locus of the immunoglobulin light chain that results in the mouse expressing a repertoire of the immunoglobulin light chain that is derived from no more than one, or not more than two, gene segments V À and / or K.
[006] [006] Genetically engineered mice are provided such that variable domains of the human immunoglobulin heavy chain matured by selected appropriate affinity derived from a repertoire of segments V, D, and J of the human heavy chain not rearranged, in which variable domains of the heavy chain affinity-matured humans associate and express a humanized universal light chain. The humanized universal light chain is expressed as a locus comprising no more than one or no more than two V segments of the human light chain and a human J segment operably linked to a constant light chain gene, or no more than that one or no more than two rearranged human nucleic acid sequences (VMNJA, VK / JK, VAW / JK or VK / JA) encoding a light chain variable domain operably linked to a light chain constant gene. In various modalities, the universal humanized light chain domain pairs with a plurality of affinity-matured human heavy chain variable domains, where the plurality of heavy chain variable domains specifically bind to different epitopes or antigenic.
[007] [007] In one aspect, the nucleic acid constructs, cells, embryos, mice and methods are provided to produce mice comprising a variable humanized immunoglobulin heavy chain locus and a variable immune locus. —Humanized light chain globulin, in which the mouse expresses one of no more than two universal light chains, and male mice exhibit wild fertility.
[008] [008] In one aspect, a modified mouse is provided in such a way that it comprises in its germ line a humanized heavy chain immunoglobulin variable locus in an endogenous mouse heavy chain locus and a variable chain immunoglobulin locus humanized light, in which the mouse expresses a universal light chain, and in which the mouse comprises a nucleic acid sequence encoding a mouse or ortholog or homologous ADAM6 or functional fragment thereof. In several modalities, the variable humanized light chain immunoglobulin locus is at an endogenous mouse light chain locus.
[009] [009] In one embodiment, the humanized heavy chain immunoglobulin variable locus comprises a substitution in the endogenous variable mouse heavy chain locus of all or substantially all of the mouse immunoglobulin heavy chain gene segments V, D and J functional with one or more gene segments human V, human D and human J, where one or more human V, D and J segments are operationally linked and capable of rearrangement to form a rearranged V / D / J gene that is operationally connected to a heavy chain constant sequence.
[0010] [0010] In one embodiment, the mouse comprises a light chain locus that has been engineered to produce a single light chain
[0011] [0011] In one embodiment, segment V of the single human light chain is operationally linked to a segment J of the human light chain selected from JK1, JK2, JK3, JK4 and JK5, where segment V of single human light chain is capable of rearrangement to form a sequence that encodes a variable region gene of the light chain with any one or more J segments of the human light chain.
[0012] [0012] In one embodiment, the mouse comprises an endogenous light chain locus that comprises a replacement for all or substantially all of the mouse gene segments V and J with no more than one, or no more than two, acid sequences rearranged nucleic acids (V / J)) In one embodiment, no more than one or no more than two rearranged nucleic acid (V / J) sequences are selected from a human VK1-39JK5, a
[0013] [0013] In one embodiment, the mouse without an endogenous functional light chain locus that is capable of expressing a variable domain of the mouse light chain. In one embodiment, the mouse comprises a nucleic acid sequence that encodes a variable domain of a universal light chain at a K locus. In one embodiment, the mouse comprises a nucleic acid sequence that encodes a variable domain of a universal light chain at an À locus.
[0014] [0014] In one embodiment, the human V segment (or rearranged V / J sequence) is operationally linked to a human or mouse leader sequence. In one embodiment, the leader sequence is a mouse leader sequence. In a specific modality, the mouse leader sequence is a VK3-7 mouse leader sequence.
[0015] [0015] In one embodiment, the human V segment (or rearranged V / J sequence) is operationally linked to an immunoglobulin promoter sequence. In one embodiment, the promoter sequence is a human promoter sequence. In a specific embodiment, the human immunoglobulin promoter is a human VK3-15 promoter.
[0016] [0016] In one embodiment, segments V and J not rearranged or the rearranged sequence (V / J) are operationally linked to a light chain immunoglobulin constant region gene. In a specific fashion, the constant region gene is a CK mouse gene.
[0017] [0017] In one embodiment, segments V and J not rearranged or the rearranged sequence (V / J) are present in a locus of the light chain K, and the locus of the light chain K comprises an intronic enhancer of mouse k «, a K 3 'mouse enhancer, or both an intronic and a 3 enhancer. In a specific modality, the locus «is an endogenous locus».
[0018] [0018] In one embodiment, the mouse comprises a K locus comprising a sequence encoding a variable domain of a universal light chain, and the mouse comprises a non-functional immunoglobulin (A) lambda locus of the light chain. In a specific embodiment, the light chain A locus comprises a deletion of one or more sequences of the locus, in which one or more deletions render the A light chain locus unable to rearrange to form a chain gene Light. In another modality, all or substantially all of the V segments of the light chain A locus are deleted. In another embodiment, the mouse comprises a deletion of all, or substantially all, of the variable locus of the endogenous light chain.
[0019] [0019] In one embodiment, the mouse also comprises in its germ line a sequence selected from an intronic 5 'mouse enhancer relative to the sequence of the rearranged immunoglobulin light chain or non-rearranged gene segments, an enhancer of mouse 3 'K and a combination of these.
[0020] [0020] In one embodiment, the variable domain sequence of the universal light chain of the mouse comprises one or more somatic hyper-permutations; in one embodiment, the variable domain sequence comprises a plurality of somatic hypermutations.
[0021] [0021] In one embodiment, the mouse produces a universal light chain that comprises a somatively mutated human variable domain. In one embodiment, the light chain comprises a somatically mutated human variable domain derived from a human V segment, a human J segment and a mouse CK gene. In one embodiment, the mouse does not express a light chain.
[0022] [0022] In one embodiment, the human variable sequence is a rearranged human VK1-39JK5 sequence, and the mouse expresses a reverse chimeric light chain comprising (i) a variable domain derived from VK1-39JK5 and (ii) a C, mouse; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse Ch and (ii) a somatically mutated human heavy chain variable domain. In one mode, the mouse expresses a light chain that is somatically mutated. In one embodiment, the C, is a mouse CK
[0023] [0023] In one embodiment, the human variable sequence is a rearranged human VK3-20JK1 sequence, and the mouse expresses a reverse chimeric light chain comprising (i) a variable domain derived from VK3-20JK1, and (ii) a C , from mouse; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse Ch, and (ii) a somatically mutated human heavy chain variable domain.
[0024] [0024] In one embodiment, the mouse comprises both a rearranged human VK1-39JK5 sequence and a rearranged human VK3-20JK1 sequence, and the mouse expresses a reverse chimeric light chain comprising (i) a light chain comprising a variable domain derived from the VK1-39JK5 sequence or the VK3-20JK1 sequence, and (ii) a mouse C; wherein the light chain is associated with a reverse chimeric heavy chain comprising (i) a mouse Ch, and (ii) a somatically mutated human heavy chain variable domain. In one mode, the mouse expresses a light chain that is somatically mutated. In one embodiment, the C, is a mouse CK
[0025] [0025] In one embodiment, the mouse expresses a reverse chimeric antibody comprising a light chain that comprises a mouse CK and a somatized human variable domain.
[0026] [0026] In one aspect, a genetically modified mouse is provided in a way that expresses a single K light chain derived from no more than one, or no more than two, rearranged K light chain sequences in that the mouse, through immunization with the antigen, exhibits a serum titer that is comparable to a wild mouse immunized with the same antigen. In a specific embodiment, the mouse expresses a unique K light chain sequence, where the unique K light chain sequence is derived from no more than a rearranged K light chain. In one embodiment, the serum titer is characterized as total immunoglobulin. In a specific modality, the serum titer is characterized as a specific IIM titer. In a specific embodiment, the serum titer is characterized as a specific IG titer. In a more specific embodiment, the sequence of the rearranged k «light chain is selected from a sequence VK1-39JK5 and VK3-20JK1. In one embodiment, the sequence of the rearranged K 'light chain is a
[0027] [0027] In one aspect, a genetically modified mouse is provided in a way that expresses a plurality of heavy immunoglobulin chains associated with a single light chain sequence. In one embodiment, the heavy chain comprises a human sequence. In various modalities, the human sequence is selected from a variable sequence, a CH1, a hinge, a CH2, a CH3 and a combination of these. In a modality, the single light chain comprises a human sequence. In various modalities, the human sequence is selected from a variable sequence, a constant sequence and a combination thereof. In one embodiment, the mouse comprises a deactivated endogenous immunoglobulin locus and expresses the heavy chain and / or the light chain of an extrachromosomal transgene or episome. In one embodiment, the mouse comprises a replacement in an endogenous mouse locus of some or all of the endogenous gene segments of the mouse heavy chain (i.e., V, D, J), and / or some or all of the constant sequences of the heavy chain of endogenous mouse (for example, CH1, hinge, CH2, CH3, or a combination of these), and / or some or all of the endogenous mouse light chain sequences (for example, V, J, constant, or a combination of these) , with one or more sequences of human immunoglobulin.
[0028] [0028] In one embodiment, the mouse, after rearrangement of one or more gene segments V, D and J, or one or more gene segments V and J, the mouse comprises in its genome at least one sequence of nucleic acids that encodes a mouse or homologous or orthologous ADAM6 gene or functional fragment thereof.
[0029] [0029] In one embodiment, male mice comprise a single unmodified endogenous ADAM6 allele or the homologous ortholog or functional fragment thereof at an ADAM6 endogenous locus.
[0030] [0030] In one embodiment, male mice comprise an ADAM6 or homologous or orthologous sequence or functional fragment thereof at a position in the mouse genome that approximates the position of the endogenous mouse ADAM6 allele, for example, 3 'from a sequence of the final V gene segment and 5 'of an initial D gene segment.
[0031] [0031] In one embodiment, male mice comprise an ADAM6 sequence or homologous or orthologous or functional fragment of it flanked upstream, downstream, or upstream and downstream (relative to the direction of transcription of the ADAM6 sequence) of a sequence nucleic acids encoding a genetic segment of the immunoglobulin variable region. In a specific modality, the gene segment of the variable region of immunoglobulin is a human gene segment. In one embodiment, the gene segment of the immunoglobulin variable region is a human gene segment and the sequence encoding mouse ADAM6 or the ortholog or the homologous or fragment of this functional in a mouse are among the human V gene segments; in one modality, the
[0032] [0032] In one embodiment, the humanized heavy chain immunoglobulin variable locus without an endogenous mouse ADAM6 gene. In one embodiment, the variable humanized heavy chain immunoglobulin locus comprises an ADAMG6 gene that is functional in a male mouse. In a specific embodiment, the ADAM6 gene that is functional in the male mouse is a mouse ADAMG6 gene and the mouse ADAM6 gene is placed inside or immediately adjacent to the variable humanized heavy chain immunoglobulin locus.
[0033] [0033] In one embodiment, the humanized heavy chain immunoglobulin variable locus without an endogenous mouse ADAMG6 gene, and the mouse comprises an ectopic ADAM6 sequence that is functional in a male mouse. In one embodiment, the ectopic ADAMG6 gene that is functional in the male mouse is a mouse ADAM6 gene. In one embodiment, the mouse A-DAMG6 gene is on the same chromosome as the humanized heavy chain immunoglobulin variable locus. In one fashion, the mouse ADAM6 gene is on a different chromosome than the humanized heavy chain immunoglobulin variable locus. In one embodiment, the mouse ADAM6 gene is in an episome.
[0034] [0034] In one embodiment, the mouse comprises a first allele of the endogenous heavy chain and a second allele of the endogenous heavy chain, and the first allele of the endogenous heavy chain comprises a deletion of a mouse ADAM6 locus, and the first allele of the endogenous heavy chain comprises a substitution
[0035] [0035] In one embodiment, the nucleic acid sequence comprises a sequence encoding mouse ADAM6a or functional fragment thereof and / or a sequence encoding mouse ADAM6b or functional fragment thereof, wherein ADAM6a and / or ADAMG6b or fragment ( s) functional of these are operationally linked to a promoter. In one embodiment, the promoter is a human promoter. In one embodiment, the promoter is the mouse ADAM6 promoter. In a specific modality, the ADAM6 promoter comprises the sequence located between the first codon of the first ADAM6 gene very close to most of the 5 'mouse DW gene segment and the recombination signal sequence of most of the DW 5 gene segment, in that 5 'is indicated with respect to the direction of transcription of the mouse immunoglobulin genes. In one embodiment, the promoter is a viral promoter. In a specific embodiment, the viral promoter is a cytomegalovirus (CMV) promoter. In one embodiment, the promoter is a ubiquitin promoter.
[0036] [0036] In one embodiment, ADAM6a and / or ADAM6b of mice are selected from ADAM6a of SEQ ID NO: 1 and / or ADAMG6b of the sequence SEQ ID NO: 2. In one embodiment, the mouse ADAM6 promoter is the promoter of SEQ ID NO: 3. In a specific embodiment, the mouse ADAM6 promoter comprises the nucleic acid sequence of SEQ ID NO: 3 directly upstream (relative to the direction of ADAM6a transcription) from the first ADAM6a codon and extending to the end of SEQ ID
[0037] [0037] In one embodiment, the nucleic acid sequence comprises SEQ ID NO: 3 or a fragment thereof which when placed in a mouse that is sterile or has low fertility due to a lack of ADAM6, improves fertility or restores fertility to approximately wild fertility. In one embodiment, SEQ ID NO: 3 or a fragment thereof gives a male mouse the ability to produce a sperm cell that is able to pass through a female mouse oviduct in order to fertilize a mouse egg .
[0038] [0038] In one embodiment, the mice comprise a nucleic acid sequence that encodes an ADAMG6 protein, or ortholog or homolog or fragment thereof, which is functional in a male mouse. In a specific embodiment, the nucleic acid sequence is within or adjacent to a human nucleic acid sequence that comprises one or more gene segments of immunoglobulin variable region. In one embodiment, one or more gene segments of variable immunoglobulin region are at a variable locus of the modified endogenous mouse immunoglobulin heavy chain. In one embodiment, the modification comprises a replacement of all or substantially all of the functional variable gene segments of mouse heavy chain immunoglobulin with a plurality of non-rearranged human heavy chain gene segments that are operationally linked to a gene. constant region of endogenous mice. In a specific embodiment, the nucleic acid sequence is between two human V segments. In a specific embodiment, the nucleic acid sequence is between a human V segment and a human D segment. In a specific embodiment, the nucleic acid sequence is between a human D segment and a human J segment. In a specific embodiment, the nucleic acid sequence is upstream of most of the 5 'segment (relative to the transcription direction of the segment V) human V. In a specific embodiment, the nucleic acid sequence is between one human J segment and a gene sequence of constant region of the endogenous mouse heavy chain.
[0039] [0039] In one modality, male mice are able to breed offspring by mating, with a frequency that is approximately the same as that of a wild mouse. In one embodiment, male mice produce sperm that can pass through a mouse uterus through a mouse oviduct to fertilize a mouse egg; in a specific modality, the sperm of the mice travels through the oviduct almost as efficiently as the sperm of a wild mouse. In one embodiment, approximately 50% or more of the sperm produced in the mouse exhibits the ability to enter and / or transit an egg to fertilize a mouse egg.
[0040] [0040] In one embodiment, the mouse without a functional endogenous ADAM6 locus, in which the mouse comprises an ectopic nucleotide sequence that completes the loss of mouse A-DAMG6 function in a male mouse. In one embodiment, the ectopic nucleotide sequence gives the male mouse an ability to produce offspring that is comparable to a corresponding wild male mouse that contains a functional endogenous ADAM6 gene. In one embodiment, does the sequence give the mouse an ability to form an ADAM complex and / or ADAM3 and / or ADAMG6 on the surface of the mouse sperm cell. In one embodiment, the sequence gives the mouse an ability to travel in a mouse uterus through a mouse oviduct to a mouse egg to fertilize the egg.
[0041] [0041] In one embodiment, the mouse without a functional endogenous ADAM6 locus and comprises an ectopic nucleotide sequence that encodes an ADAMG6 or orthologist or homolog or fragment thereof that is functional in a male mouse and in which the male mouse produces at least approximately 50%, 60%, 70%, 80% or 90% of the number of litters that a wild mouse of the same age and strain produces in a period of six months.
[0042] [0042] In one embodiment, the mouse without the endogenous functional ADAM6 gene and comprising the ectopic nucleotide sequence at least produces approximately 1.5 times, approximately 2 times, approximately 2.5 times, approximately 3 times, approximately 4 times, approximately 6 times, approximately 7 times, approximately 8 times, or approximately 10 times or more progeny when reproduced over a six-month period of time than a mouse of the same age and the same strain or similar without the endogenous functional ADAM6 gene and without the ectopic nucleotide sequence that is produced substantially in the same period of time and substantially under the same conditions.
[0043] [0043] In one embodiment, the mouse without the endogenous functional ADAM6 gene and comprising the ectopic nucleotide sequence produces an average of at least approximately an average of 2 times, 3 times, or 4 times of pups per litter in a breeding period 4 or 6 months than a mouse without the functional endogenous ADAM6 gene and which does not have the ectopic nucleotide sequence, and which is produced for the same period of time.
[0044] [0044] In one embodiment, the mouse without the endogenous functional ADAM6 gene and comprising the ectopic nucleotide sequence is a male mouse, and the male mouse produces the sperm that when recovered from post-copulation oviducts in approximately 5 -6 hours reflects an oviduct migration that is at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, 100 times, 110 times, or 120 times or more than the sperm of a mouse without the functional endogenous ADAM6 gene and which does not have the ectopic nucleotide sequence .
[0045] [0045] In one embodiment, the mouse without the endogenous functional ADAM6 gene and comprising the ectopic nucleotide sequence when copulating with a female mouse generates sperm that is able to pass through the uterus and enter and pass through the oviduct in approximately 6 hours with an efficiency that is roughly equal to the sperm of a wild mouse.
[0046] [0046] In one embodiment, the mouse lacking the endogenous functional ADAM6 gene and comprising the ectopic nucleotide sequence produces approximately 1.5 times, approximately 2 times, approximately 3 times, or approximately 4 times or more hatched in a period of comparable time than a mouse lacking the functional ADAMSGS gene and lacking the ectopic nucleotide sequence.
[0047] [0047] In one aspect, a mouse is provided in a manner that comprises a humanized endogenous mouse heavy chain variable immunoglobulin locus and a modification of a mouse light chain immunoglobulin locus, in which the mouse expresses a cell B comprising a human heavy chain immunoglobulin sequence rearranged operatively linked to a gene sequence of constant region of the human or mouse heavy chain, and the B cell comprises in its genome (for example, in a cell chromosome B) a gene encoding an ADAMG6 or orthologist or homolog or a fragment thereof that is functional in a male mouse (for example, a mouse A-DAMG6 gene, for example, mouse ADAM6a and / or —ADAMG6b of mouse), in that the variable domains of the light chains À or 'of the immunoglobulin of mice are derived from no more than one or no more than two gene segments V of the light chain.
[0048] [0048] In one embodiment, the immunoglobulin sequence rearranged operably linked to the gene sequence of the constant region of the heavy chain comprises a V, D and / or J sequence of the human heavy chain; a V, D and / or J sequence of the mouse heavy chain; a V and / or J sequence of the human or mouse light chain. In one embodiment, the heavy chain constant region gene sequence comprises a human or mouse heavy chain sequence selected from the group consisting of a Cy, a hinge, a Ch2, a Cy3 and a combination of these.
[0049] [0049] In one aspect, a mouse suitable for producing antibodies that have the same light chain is provided, in which all or substantially all of the antibodies produced in the mouse are expressed with the same light chain, in which the light chain comprises a human variable domain, and wherein the antibodies comprise a heavy chain comprising a human variable domain.
[0050] [0050] In one aspect, a mouse is provided in a manner that is characterized by an inability of the mouse to produce a B cell that expresses an immunoglobulin light chain variable domain that is derived from a rearranged light chain sequence which is not a human VK1-39JK5 sequence or a human VK3- 20JK1.
[0051] [0051] In one embodiment, the mouse exhibits a proportion of the K: A light chain that is approximately the same as a mouse that comprises a wild complement of VeyJ gene segments of the immunoglobulin light chain.
[0052] [0052] In one aspect, a mouse, as described in this order, is provided in a way that expresses an immunoglobulin light chain derived from a human VK1-39JK5 sequence or a human VK3- 20JK1, in which the mouse comprises a replacement of all or substantially all gene segments of the endogenous mouse heavy chain variable region with one or more gene segments of the human heavy chain variable region and the mouse exhibits a proportion of (a) CD19 * B cells that express an immunoglobulin having a light chain A, for (b) CD19 ”* B cells expressing an immunoglobulin having a light chain, from approximately 1 to approximately 20.
[0053] [0053] In one embodiment, the mouse expresses a single K light chain, where the single K light chain is derived from a human VK1-39JK5 sequence and the proportion of CD19 * B cells that express an immunoglobulin having a light chain A for CD19 * B cells expressing an immunoglobulin having a light chain K is approximately 1 to approximately 20; in one embodiment, the ratio is approximately 1 to at least approximately 66; in a specific modality, the proportion is approximately 1 to 66.
[0054] [0054] In one embodiment, the mouse expresses a single K light chain, in which the 'single light chain is derived from a human VKx3-20JK5 sequence and the proportion of CD19 * B cells that express an immunoglobulin having a A light chain for CD19 * B cells expressing an immunoglobulin having a 'light chain' is approximately 1 to approximately 20; in a modality, the proportion is from approximately 1 to approximately 21. In specific modalities, the proportion is from 1 to 20, or from 1 to 21.
[0055] [0055] In one embodiment, the percentage of B Igk * / Igh * cells in the mouse is approximately the same as in a wild mouse. In a specific modality, the percentage of B IgK * / IgA * cells in the mouse is approximately 2 to approximately 6 percent. In a specific embodiment, the percentage of IgkK * / IgA * B cells in a mouse in which the single rearranged 'light chain is derived from a VK1-39JK5 sequence is approximately 2 to approximately 3; in a specific modality, approximately 2.6. In a specific embodiment, the percentage of IgkK * / IgA * B cells in a mouse in which the single rearranged K 'light chain is derived from a VK3-20JK1 sequence is approximately 4 to approximately 8; in a specific modality, approximately 6.
[0056] [0056] In one embodiment, the mouse does not include a modification that reduces or eliminates a mouse's ability to summatically mutate any locus in the mouse's functional light chain. In one embodiment, the only functional light chain locus in the mouse expresses a light chain comprising a human variable domain derived from a rearranged sequence selected from a human VK1-39JK5 sequence, a Vx3-20JK1 sequence and a combination of these.
[0057] [0057] In one aspect, a genetically modified mouse
[0058] [0058] In one aspect, a genetically modified mouse
[0059] [0059] In one embodiment, the level of expression of the light chain, for the purpose of comparing the expression of the light chain with expression in a mouse comprising a variable locus of the substantially completely humanized light chain, is characterized by quantifying the MRNA of the sequence of the transcribed light chain (of one or two rearranged sequences) and comparing it with the transcribed light chain sequence of a mouse carrying a complete or substantially complete light chain locus.
[0060] [0060] In one aspect, a method for producing an antibody is provided, comprising expressing in a cell (a) a first sequence of nucleic acids from the human heavy chain of an immunized mouse as described in this fused application. to a human Ch gene sequence; (b) a human light chain variable domain nucleic acid sequence from an immunized mouse as described in this application fused to a human, Cy gene sequence; and, (c) maintaining the cell under conditions sufficient to express a fully human antibody and isolating the antibody. In one embodiment, the cell comprises a second human heavy chain variable domain nucleic acid sequence from a second immunized mouse as described in this application fused to a human Cy gene sequence, the first heavy chain nucleic acid sequence encodes a first domain heavy chain variable that recognizes a first epitope, and the second nucleic acid sequence of the heavy chain encodes a second heavy chain variable domain that recognizes a second epitope, where the first epitope and the second epitope do not are identical.
[0061] [0061] In one aspect, a method for producing an epitope-binding protein is provided, comprising exposing a mouse as described in this application to an antigen that comprises an epitope of interest, keeping the mouse under control. - sufficient conditions for the mouse to generate an immunoglobulin molecule that specifically binds to the epitope of interest and isolation of the immunoglobulin molecule that specifically binds to the epitope of interest; wherein the epitope-binding protein comprises a heavy chain comprising a somatically mutated human variable domain and a mouse Ch associated with a light chain comprising a mouse and a human variable domain derived from a VK1 -39JK5 human rearranged or a human VK3-20JK1 rearranged.
[0062] [0062] In one aspect, a method for producing a protection
[0063] [0063] In one embodiment, the first antigen and the second antigen are not identical.
[0064] [0064] In one embodiment, the first antigen and the second antigen are identical, and the first epitope and the second epitope are not identical. In one embodiment, the binding of the first variable region of the heavy chain to the first epitope does not block the connection of the second variable region of the heavy chain to the second epitope.
[0065] [0065] In one embodiment, the first antigen is selected from a soluble antigen and a cell surface antigen (for example, a tumor antigen), and the second antigen comprises a cell surface receptor. In a specific embodiment, the cell surface receptor is an immunoglobulin receptor. In a specific embodiment, the immunoglobulin receptor is an Fc receptor. In one embodiment, the first antigen and the second antigen are the same cell surface receptor, and binding of the first heavy chain to the first epitope does not block the binding of the second heavy chain to the second epitope.
[0066] [0066] In one embodiment, the light chain variable domain of the light chain comprises 2 to 5 somatic mutations. In one mode, the variable domain of the light chain is a somatic mutated cognate light chain expressed in a B cell of the first or second mouse immunized with the first or second variable domain of the heavy chain.
[0067] [0067] In one aspect, a cell expressing an epitope-binding protein is provided, wherein the cell comprises: (a) a human nucleotide sequence that encodes a variable domain of the human light chain that is derived from a VK1-39JK5 rearranged human or a rearranged human VK3-20JK1, in which the human nucleic acid sequence is fused (directly or by a linker) to a sequence of nucleic acids in the constant domain of the human immunoglobulin light chain (for example, a sequence of human K constant domain DNA); and, (b) a first human heavy chain variable domain nucleic acid sequence encoding a human heavy chain variable domain derived from a first human heavy chain variable domain nucleotide sequence, wherein the first variable domain nucleotide sequence the human heavy chain is fused (directly or by a linker) to a nucleic acid sequence of human immunoglobulin heavy chain constant domain (for example, a human I9G1, IgG2, I9gG3, IgG4 or IgE sequence); wherein the epitope-binding protein recognizes a first epitope. In one embodiment, the epitope-binding protein binds to the first epitope with a dissociation constant lower than 10º M, lower than 10º M, lower than 10º M, lower than 10º M , lower than 10º M, or lower than 10º M. In one mode, the cell comprises a second human nucleotide sequence that encodes a second variable domain of the human heavy chain, in which the second human sequence is fused (directly or by a linker) to a sequence of domain nucleic acids human immunoglobulin heavy chain constant, and the second variable domain of the human heavy chain does not specifically recognize the first epitope (for example, exhibits a dissociation constant of, for example, 10º M, 10º M, 10º M, or higher ), and where the epitope-binding protein binds to both the first epitope and the second epitope, and where the first and second immunoglobulin heavy chains each associate with a light chain according to ( The). In one embodiment, the second VH domain binds to the second epitope with a dissociation constant that is lower than 10º M, lower than 10 ”M, lower than 10º M, lower than 10º M, lower than 10º M, lower than 10 M or lower than 10 M.
[0068] [0068] In one embodiment, the epitope-binding protein comprises a first immunoglobulin heavy chain and a second immunoglobulin heavy chain, each associated with a universal light chain (e.g., a light chain derived from a variable chain sequence rearranged human light selected from a human VK1-39JK5 or a human VK3-20JK1), in which the first immunoglobulin heavy chain binds to a first
[0069] [0069] In one embodiment, the first immunoglobulin heavy chain comprises a wild protein A binding determinant, and the second heavy chain without a wild protein A binding determinant. In one embodiment, the first immunoglobulin heavy chain binds protein A under isolation conditions, and the second immunoglobulin heavy chain does not bind protein A or bind protein A at least 10 times, a hundred times, or a thousand times weaker than the first heavy immunoglobulin chain binds to protein A under isolation conditions. In a specific fashion, the first and second heavy chains are IgG1 isotypes, in which the second heavy chain comprises a modification selected from 95R (EU 435R), 96F (EU 436F), and a combination of these, and where the first heavy chain has no such modification.
[0070] [0070] In aspect, a mouse, embryo or cell as described in this application comprises a locus of the K light chain that conserves endogenous regulatory or control elements, for example, an intronic K enhancer, a 3 'mouse enhancer. «, Either an intronic enhancer or a 3 'potentializer, in which the regulatory elements or the control elements facilitate the somatic mutation and affinity maturation of an expressed sequence of the K light chain locus.
[0071] [0071] In one aspect, a mouse cell is provided so that it is isolated from a mouse as described in this application. In one embodiment, the cell is an ES cell. In a modality, the cell is a lymphocyte. In one embodiment, the lymphocyte is a B cell. In one embodiment, the B cell expresses a chimeric heavy chain that comprises a variable domain derived from a human V gene segment; and a light chain derived from (a) a rearranged human VK1-39 / J sequence, (b) a rearranged human VK3-20 / J sequence or (c) a combination thereof; where the heavy chain variable domain is fused to a mouse constant region and the light chain variable domain is fused to a mouse or human constant region. In one embodiment, the mouse cell comprises at least one gene that encodes a mouse ADAM6 or ortholog or homologous or functional fragment thereof. In one embodiment, the cell is a B cell and the B cell comprises a sequence that encodes a rearranged human heavy chain immunoglobulin variable domain and a sequence that encodes a universal light chain variable domain, in which cellB comprises on a chromosome a nucleic acid sequence that encodes an ADAMG6 protein or ortholog or homolog or a fragment thereof that is functional in a male mouse; in one embodiment, the mouse B cell comprises two alleles of the nucleic acid sequence.
[0072] [0072] In one aspect, a mouse cell is provided, comprising a first chromosome comprising a humanized immunoglobulin that the heavy chain locus comprising human segments V, D and J not rearranged; a second chromosome comprising a humanized immunoglobulin light chain locus that encodes or is capable of rearrangement to encode a light chain, wherein the light chain locus comprises no more than one V segment (or no more than two V segments) and no more than one J segment (or no more than two J segments) operationally linked to a light chain constant region gene, or no more than one or no more than two V / J sequences from the rearranged light chain operationally linked to a light chain constant gene; and a third chromosome comprising the nucleic acid sequence encoding a mouse or ortholog or homologous ADAM6 or homolog or fragment thereof that is functional in a male mouse. In one embodiment, the first and third chromosomes are the same. In one embodiment, the second and third chromosomes are the same. In one embodiment, the first, second and third chromosomes are each different. In one embodiment, the nucleic acid sequence encoding mouse A-DAM6 or the orthologist or homologous or functional fragment thereof is present in two copies. In one embodiment, the cell is a somatic cell. In a specific embodiment, the somatic cell is a B cell. In one embodiment, the cell is a germ cell.
[0073] [0073] In one aspect, a hybridoma is provided, in which the hybrid
[0074] [0074] In one aspect, a cell is provided in a way that comprises a fully human heavy chain gene that comprises a nucleic acid sequence that encodes a first mouse heavy chain variable domain as described in this application and a fully human light chain gene that comprises a nucleic acid sequence that encodes a universal light chain sequence as described in this application. In one embodiment, the cell further comprises a nucleic acid sequence that encodes a second variable domain of a mouse heavy chain as described in this application, in which the first and second variable domains of the heavy chain are different. In one embodiment, the cell is selected from CHO, COS, 293, HeLa, and a retinal cell that expresses a viral nucleic acid sequence (for example, a PERC.67Y cell).
[0075] [0075] In one aspect, a mouse embryo is provided, wherein the embryo comprises an ES cell donor that is derived from a mouse as described in this application.
[0076] [0076] In one aspect, the use of a mouse embryo that comprises a genetic modification as described in this application is provided, wherein the use comprises the creation of a genetically modified mouse as described in this application.
[0077] [0077] In one aspect, a human heavy chain variable domain and a human light chain variable domain amino acid sequence of an antibody produced in a mouse as described in this application are provided.
[0078] [0078] In one aspect, a human heavy chain variable domain nucleotide sequence and a human light chain variable domain nucleotide sequence of an antibody made in a mouse as described in this application is provided.
[0079] [0079] In one aspect, an antibody or antigen-binding protein or antigen-binding fragment thereof (e.g., Fab, F (ab) ', scFv) produced in a mouse as described in this application is provided.
[0080] [0080] In one aspect, a mouse produced using a targeting vector, nucleotide construct, or cell as described in this application is provided.
[0081] [0081] In one aspect, a progeny of a first mouse coupling as described in this application with a second mouse that is a wild or genetically modified mouse is provided.
[0082] [0082] In one aspect, the use of a mouse as described in this application to produce a fully human antibody or fully human antigen-binding protein and comprises a variable domain of immunoglobulin or functional fragment thereof, is provided .
[0083] [0083] In one aspect, the use of a mouse or tissue or cell as described in this application to produce a fully human bispecific antibody is provided.
[0084] [0084] In one aspect, the use of a mouse nucleic acid sequence as described in this application is provided,
[0085] [0085] In one aspect, the use of a mouse as described in this application to produce an immortalized cell line is provided.
[0086] [0086] In one aspect, the use of a mouse as described in this application to produce a hybridoma or quadroma is provided.
[0087] [0087] In one aspect, the use of a mouse as described in this application to produce a nucleic acid sequence that encodes an immunoglobulin variable region or fragment thereof is provided. In one embodiment, the nucleic acid sequence is used to produce a human antibody or antigen-binding fragment thereof. In one embodiment, the mouse is used to produce an antigen-binding protein selected from an antibody, a multispecific antibody (for example, a bispecific antibody), a scFv, a bis-scFV, a body, a tribody, a tetrabody, a V-NAR, a VHH, a VL, an F (ab), an F (ab) ,, a DVD (ie, dual variable domain antigen binding protein), an SVD (ie, protein binding to the single variable domain antigen), or a bispecific T cell ligand (BiTE).
[0088] [0088] In one aspect, the use of the mouse as described in this application for the production of a drug (for example, an antigen-binding protein), or for the production of a sequence that encodes a variable sequence of a drug (eg, antigen-binding protein), for the treatment of a human disease or disorder is provided.
[0089] [0089] Any of the modalities and aspects described in this application may be used in conjunction with one another, unless otherwise indicated or evident from the context. Other modalities will become evident to those skilled in the technique of a review of the
[0090] [0090] FIG. 1A shows a general, not to scale, illustration for the direct genomic substitution of approximately three megabases - (Mb) of the mouse immunoglobulin heavy gene variable locus (closed symbols) with approximately one mega-base (Mb) of the gene locus human immunoglobulin heavy chain variable (open symbols).
[0091] [0091] FIG. 1B shows a general, not to scale, illustration for the direct genomic substitution of approximately three megabases (Mb) of the variable gene locus of the mouse K immunoglobulin light chain (closed symbols) with approximately 0.5 mega-bases (Mb) the first, or proximal, of two almost identical repetitions of variable gene locus of the human immunoglobulin K light chain (open symbols).
[0092] [0092] FIG. 2A shows a detailed, non-scaled illustration for three initial steps (AC) of direct genomic substitution of the variable gene locus of the mouse immunoglobulin heavy chain that results in the deletion of all mouse segments Vu, Dy and J'4 and replacement by three gene segments V, human, all human Di and Ju. A targeting vector for the first insertion of gene segments from the human immunoglobulin heavy chain is shown (3hV, BACvec) with a 67 kb 5 'mouse homology arm, a selection cassette (open rectangle), a site site-specific recombination (open triangle), a 145 kb human genomic fragment and an 8 kb 3 'mouse homology arm. Human gene segments (open symbols) and mouse (closed symbols) of immunoglobulin, additional selection cases (open rectangles) and specific recombination sites for the inserted site (open triangles) of subsequent targeting vectors are shown.
[0093] [0093] FIG. 2B shows a detailed, non-scaled illustration for six additional steps (Dl) for direct genomic substitution of the mouse immunoglobulin heavy chain variable gene locus that results in the insertion of 77 additional human V gene segments and removal of the cassette final selection. A vector for directing the insertion of additional human V gene segments (18hV4 BACvec) for the initial insertion of human heavy chain gene segments (3hV4-CRE Hybrid Allele) is shown with a 5 'mouse homology arm 20 kb, a selection cassette (open rectangle), a 196 kb human genomic fragment and a 62 kb human homology arm that is superimposed with the 5 'end of the initial insertion of gene segments of the heavy chain that is shown with a recombination site specific to the site (open triangle) located 5 'to the human gene segments. Human gene segments (open symbols) and mouse mice (closed symbols) of immunoglobulin and additional selection cassettes (open rectangles) inserted by subsequent targeting vectors are shown.
[0094] [0094] FIG. 2C shows a detailed, non-scaled illustration for three initial steps (AC) for direct genomic substitution of the mouse K immunoglobulin light chain variable gene locus that results in the deletion of all mouse VK and JK gene segments ( Hybrid IgKk-CRE allele). Selection cassettes (open rectangles) and site-specific recombination sites (open triangles) inserted from the targeting vectors are shown.
[0095] [0095] FIG. 2D shows a detailed illustration, not to scale, for 5 additional steps (D-H) for direct genomic substitution of the mouse immunoglobulin light chain variable gene locus.
[0096] [0096] FIG. 3A shows a general illustration of the positions of quantitative PCR (PCR) primer / probe sets to screen ES cells for insertion of human heavy chain gene sequences and loss of mouse heavy chain gene sequences. The tracking strategy in ES cells and mice for the first human heavy gene insertion is shown with qPCR primer / probe sets for the deleted region ("loss" probes C and D), the inserted region (hlgH probes) "G and H) and flanking regions (" retention "probes A, B, E and F) on an unmodified mouse chromosome (top) and a correctly targeted chromosome (bottom).
[0097] [0097] FIG. 3B shows a representative calculation of the number of probe copies observed in parental and modified ES cells for the first insertion of gene segments of the human immunoglobulin heavy chain. The number of probe copies observed from probes A to F was calculated as 2 / 2AACt. The AACt is calculated as bird [ACt (sample) - medACt (control)] where ACt is the difference in Ct between test and reference probes (between 4 and 6 reference probes depending on the test). The term medACt (control) is the average ACt number of multiple (> 60) non-target DNA samples from parental ES cells. Each modified ES cell clone was analyzed in six-replicate. To calculate copy numbers of IgH G and H probes in parental ES cells, these probes were assumed to have the number of copies of 1 modified ES cells and a maximum Ct of 35 was used.
[0098] [0098] FIG. 3C shows that a representative calculation of copy numbers for four mice of each genotype was calculated in a similar way using only D and H probes. Wild mice: WT mice; Heterozygous mice for the first insertion of human immunoglobulin gene segments: HET mice; Homozygous mice for the first insertion of human immunoglobulin gene segments: Homo mice.
[0099] [0099] FIG. 4A shows an illustration of the three steps used for the construction of 3hV, BACvec by homologous bacterial recombination (BHR). Human gene segments (open symbols) and mouse (closed symbols) of immunoglobulin, selection cassettes (open rectangles) and recombination sites specific for parasite (open triangles) inserted for targeting vectors are shown.
[00100] [00100] FIG.4B shows pulsed field gel electrophoresis (PFGE) of three BAC clones (B1, B2 and B3) after Notl digestion. The M1, M2 and M3 markers are low range, medium range and lambda ladder PFG markers, respectively (New England BioLabs, Ipswich, MA).
[00101] [00101] AFIG.5A shows a schematic illustration, not in scale, of sequential modifications of the mouse immunoglobulin heavy chain locus with increasing amounts of human immunoglobulin heavy chain gene segments. Homozygous mice were made from each of the three different stages of humanization of the heavy chain. The open symbols reflect the human sequence; the closed symbols reflect the mouse sequence.
[00102] [00102] AFIG.5B shows a schematic illustration, not in
[00103] [00103] AFIG.6 shows FACS point plots of B cell populations in wild and humanized Veloclmmu- neêO mice. Spleen cells (upper line, third line from the top and bottom line) or inguinal lymph nodes (second line from the top) of wild mice (wt) or VelocIimmuneO 1 (V1), VeloclMmune 2 (V2) or VeloclmmuneO 3 (V3) have been labeled for B cells that express IgM on the surface (top line and second line from the top), superficial immunoglobulin containing K or À light chains (third line from the top) or superficial IgM of specific haplotypes (bottom row) and populations separated by FACS.
[00104] [00104] FIG. 7A shows heavy chain CDR3 sequences representative of VeloclmmuneO antibodies randomly selected around the V4-Dy-Jn (CDR3) junction, demonstrating junctional additions and nucleotide diversity. The heavy chain CDR3 sequences are grouped according to the use of the genetic segment Du, the germline of which is provided above each group in bold. The Vy gene segments for each heavy chain CDR3 sequence are observed within parentheses at the 5 'end of each sequence (for example, 3-72 is human V43-72). The J gene segments of each heavy chain CDR3 are observed within parentheses at the 3 'end of each sequence (for example, 3 is J; 3 human). The SEQ ID NOs for each sequence shown are proceeding as follows from top to bottom: SEQ ID
[00105] [00105] AFIG.7B shows sequences of light chain CDR3 representative of Velocimmune8 antibodies randomly selected around the VK-JK (CDR3) link, demonstrating junctional additions and diversity of nucleotides. The VK gene segments of each light chain in the CDR3 sequence are observed within the parenthesis at the 5 'end of each sequence (for example, 1-6 is human VKk1-6). The JK gene segments for each CDR3 of the light chain are observed within parentheses at the 3 'end of each sequence (for example, 1 is human J «K1). The SEQ ID NOs for each sequence shown are proceeding as follows from top to bottom: SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 42; SEQ ID NO: 43; SEQ ID NO: 44; SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 47; SEQ ID NO: 48; SEQ ID NO: 49; SEQ ID NO: 50; SEQ ID NO: 51; SEQ ID NO: 52; SEQ ID NO: 53; SEQ ID NO: 54; SEQ ID NO: 55; SEQ ID NO: 56; SEQID NO: 57; SEQ ID NO: 58.
[00106] [00106] AFIG.8 shows frequencies of somatic hypermutation of heavy and light chains of labeled VeloclmmuneO antibodies (after alignment with corresponding germline sequences) as a percentage of modified sequences at each nucleotide position (NT; left column) or amino acid (AA; right column) between sets of 38 sequences (non-immunized IgM), 28 (non-immunized IgG), 32 (non-immunized IgG), 36 (immunized IgG) or 36 (non-immunized IgG IgG) ). The shaded bars indicate the positions of CDRs.
[00107] [00107] AFIG.9A shows isotonic serum immunoglobulin levels
[00108] [00108] AFIG.9B shows serum immunoglobulin levels of the IgA isotype in wild mice (open bars) or VelocIlmmuneO (closed bars).
[00109] [00109] AFIG.9C shows levels of serum immunoglobulin of the IgE isotype in wild mice (open bars) or VelocIlmmuneO (closed bars).
[00110] [00110] FIG.10A shows antigen-specific IgG titers against interleukin-6 receptor from the serum of seven VE- LOCIMMUNEPO (VI) and five wild (WT) mice after two (bleeding 1) or three (bleeding 2) cycles immunization with interleukin-6 receptor ectodomain.
[00111] [00111] FIG. 10B shows specific IgG for specific titers for the anti-interleukin-6 receptor type of seven VeloclmmuneãO (VI) and five wild (WT) mice.
[00112] [00112] AFIG.11A shows the affinity distribution of the anti-interleukin-6 monoclonal antibodies generated in Veloclmmune € mice.
[00113] [00113] AFIG. 11B shows the specific blockade for the anti-interleukin-6 receptor monoclonal antibody antigen generated in Veloclmmuneã & (VI) and wild (WT) mice.
[00114] [00114] AFIG. 12 shows a schematic illustration, not in scale, of mouse ADAM6a and ADAM6b genes in the mouse immunoglobulin heavy chain locus. A targeting vector (Targeting Vector mADAMG6) used for the insertion of mouse ADAM6a and ADAM6b into a humanized endogenous heavy chain locus is shown with a selection cassette (HYG: hygromycin) flanked by specific recombination sites. to the site (Frt) including restriction sites engineered at the ends
[00115] [00115] AFIG.13 shows a schematic illustration, not in scale, of a human ADAM6 pseudogene (hADAM6Y) located between the variable gene segments of the human heavy chain 1-2 (V4W1-2) and 6-1 ( V46-1). A targeting vector of the homologous bacterial recombination (Targeting Vector hADAM6Y) to delete a human ADAMG6 pseudogene and insert unique restriction sites into a human heavy chain locus is shown with a selection cassette (NEO: neomycin) flanked by sites site-specific recombination (loxP) including restriction sites engineered at the 5 'and 3' ends. A non-scale illustration of the resulting targeted humanized heavy chain locus containing a genomic fragment encoding ADAM6a and ADAM6b genes from mouse including a selection cassette flanked by site-specific recombination sites is shown.
[00116] [00116] AFIG.14A shows FACS contour graphs of lymphocytes controlled in singlets for superficial expression of I9M and B220 in the bone marrow of mice homozygous for variable gene loci of the human heavy and human K light chain (H / k ) and homozygous mice for variable human heavy and human K light chain loci having an inserted mouse genomic fragment comprising mouse ADAM6 genes (H / K-A6). The percentage of immature (B220 "IlgM *) and mature (B220" "| gM *) B cells is observed in each contour graph.
[00117] [00117] FIG. 14B shows the total number of immature (B220 "" gM *) and mature (B220 "" IgM *) B cells in the bone marrow isolated from femurs of homozygous mice for variable human loci and human heavy chain (H / K) ) and homozygous mice for variable human heavy chain and human K light chain loci that have an ectopic mouse genomic fragment encoding mouse ADAM6 genes (H / K-A6).
[00118] [00118] AFIG.15A shows FACS contour graphics of B cells controlled by CD19 + for superficial expression of c-kit and CD43 in the bone marrow of homozygous mice for variable human and light heavy chain human K loci ( H / K) and homozygous mice for variable human heavy chain and human K light loci having an ectopic mouse genomic fragment that encodes the mouse ADAM6 (H / x-A6) genes. The percentage of pro-B (CD19 + CD43 + ckit *) and pre-B (CD1I9 + CD43-ckit-) cells is observed in the upper right and lower left quadrants, respectively, of each contour graph.
[00119] [00119] FIG. 15B shows the total number of pro-B cells (CD19 * CD43'ckit ”) and pre-B cells (CD19" CD43 ckit) in the bone marrow isolated from femurs of homozygous mice for variable human heavy chain loci and light human K (H / K) and homozygous mice for variable human heavy chain and human light k loci having an ectopic mouse genomic fragment comprising mouse ADAM6 (H / K-A6) genes.
[00120] [00120] AFIG. 16A shows FACS contour plots of singlet-controlled lymphocytes for superficial expression of CD19 and CD43 in bone marrow of homozygous mice for variable human K and H light heavy chain (H / K) and mouse genic loci. homozygous for variable human heavy chain gene loci raise human kK that have an ectopic mouse genomic fragment that encodes the mouse ADAM6 genes (H / K-A6). The percentage of immature B (CD19 * CD43), pre-B (CD19 * CD43 "") and pro-B (CD19 "CD43 *) cells is observed in each contour plot.
[00121] [00121] FIG. 16B shows histograms of immature B cells
[00122] [00122] AFIG.17A shows FACS contour plots of lymphocytes controlled by singlets for the superficial expression of CD19 and CD3 in splenocytes of homozygous mice for human genic and human K light chain (H / Kk) variable loci and homozygous mice for variable human heavy and human K light chain loci that have an ectopic mouse genomic fragment that encodes the mouse ADAM6 (H / K-A6) genes. The percentage of B (CD19 * CD3 ') and T (CD19'CD3 ”) cells is observed in each contour graph.
[00123] [00123] AFIG.17B shows contour graphics of FACs for B cells controlled by CD19 ”for superficial expression of IgA and IgK light chains in the spleen of homozygous mice for variable human and human K heavy chain light loci ( H / K) and homozygous mice for variable human heavy and human K light chain gene loci having an ectopic mouse genomic fragment comprising mouse ADAM6 (H / xK-A6) genes. The percentage of B cells of IgA ”(upper left quadrant) and lgK (lower right quadrant) is observed in each contour graph.
[00124] [00124] FIG. 17C shows the total number of CD19 * B cells in the spleen of homozygous mice for variable human heavy chain K and human K (H / K) and homozygous mice for variable human heavy chain K and loci human having an ectopic mouse genomic fragment comprising mouse ADAM6 genes (H / K-A6).
[00125] [00125] AFIG.18A shows contour plots of CD19-controlled B-cell FACs for superficial expression of ID and IgM in the spleen of homozygous mice for variable human heavy chain and human K light chain (H / K) and homozygous mice for variable human heavy chain and human K light chain loci having an ectopic mouse genomic fragment comprising mouse ADAM6 genes (H / K-A6). The percentage of mature B cells (CD19 * IgD "" IgM "") is observed for each contour plot. The arrow in the right contour graph illustrates the maturation process of B cells in relation to the expression of IgD and IgM surface.
[00126] [00126] AFIG.18B shows the total number of B cells in the spleen of homozygous mice for variable human and human light chain (H / K) loci and mice homozygous for variable human heavy chain loci. and light human K having an ectopic mouse genomic fragment that encodes the mouse ADAM6 genes (H / Kk-A6) during the maturation of CD19 * IgM "" IgD "'to CD19 * IgM"! gD "e",
[00127] [00127] FIG. 19 illustrates a targeting strategy to replace gene segments from the variable region of the endogenous mouse immunoglobulin light chain with a human VK1- 39JK5 gene region.
[00128] [00128] FIG. 20 illustrates a targeting strategy to replace gene segments from the variable region of the endogenous mouse immunoglobulin light chain with a human VK3- 20JK1 gene region.
[00129] [00129] FIG. 21 illustrates a targeting strategy to replace gene segments from the variable region of the endogenous mouse i- —munoglobulin light chain with a V-
[00130] [00130] AFIG.22 shows the percentage of CD19 * B cells (Y axis) of peripheral blood from wild mice (WT), mice homozygous for a region of the rearranged human light chain rearranged VK1-39JK5 (VK1-39JK5 HO) and homozygous mice for a rearranged human light chain region rearranged VK3-20JK1 (VK3-20JK1 HO).
[00131] [00131] AFIG.23A shows the expression of relative mMRNA (Y-axis) of a light chain derived from Vk1-39 in a quantitative PCR assay using specific probes to bind a region of the rearranged human light chain generated of VK1-39JK5 (Binding Probe VK1-39JK5) and the human VKx1-39 gene segment (Probe VK1-39) in a homozygous mouse to replace the VK and JK gene segments with the VK and JK (Hx) gene segments, a wild mouse (WT), and a heterozygous mouse for a rearranged engineered human light chain region VK1- 39JK5 (VK1-39JK5 HET). The signals are normalized to the expression of mouse CK. N.D .: not detected.
[00132] [00132] AFIG.23B shows the expression of relative mMRNA (Y-axis) of a light chain derived from Vx1-39 in a quantitative PCR assay using specific probes for the binding of a region of the rearranged human light chain rearranged VK1-39JK5 (VK1-39JK5 binding probe) and the human VK1-39 gene segment (VK1-39 probe) in a homozygous mouse to replace the VK and JK gene segments with the VK and JK gene segments (Hx ), a wild mouse (WT), and a mouse homozygous for a rearranged human light chain region rearranged VK1- 39JK5 (VK1-39JK5 HO). The signals are normalized to the expression of mouse CK.
[00133] [00133] AFIG.23C shows the relative mMRNA expression (Y axis)
[00134] [00134] AFIG.24A shows titer of I9M (left) and IgG (right) in wild mice (WT; N = 2) and homozygous for a region of the rearranged human light chain rearranged VK1-39JK5 (VK1- 39JK5 HO; N = 2) immunized with B-galatosidase.
[00135] [00135] FIG. 24B shows the total immunoglobulin titer (IM, IgG, IgA) in wild mice (WT; N = 5) and homozygous for a rearranged engineered human light chain region VK3-20JK1 (VK3-20JK1 HO; N = 5) immunized with B-galatosidase. DETAILED DESCRIPTION
[00136] [00136] The term "antibody", as used in this application, includes immunoglobulin molecules comprising four polypeptide chains, two heavy chains (H) and two light chains (L) interconnected by disulfide bonds. Each heavy chain comprises a variable region of the heavy chain (VH) and a constant region of the heavy chain (Cy). The heavy chain constant region comprises three domains, Cy1, Ch2 and Ch3. Each light chain comprises a variable region of the light chain (VL) and a constant region of the light chain (C1). The Vy and V regions can be further subdivided into regions of hypervariability, called regions of complementarity determination (CDR), interspersed with regions that are more conservative.
[00137] [00137] The phrase "bispecific antibody" includes an antibody capable of selectively binding to two or more epitopes. Bispecific antibodies generally comprise two non-identical heavy chains, with each heavy chain that specifically binds to a different epitope - or on two different molecules (for example, different epitopes on two different immunogens) or on the same molecule (for example, different epitopes on the same immunogen). If a bispecific antibody is able to selectively bind to two different epitopes (a first epitope and a second epitope), the affinity of the first heavy chain of the first epitope will generally be at least one for two or three or four or more orders of magnitude lower than the affinity of the first heavy chain of the second epitope, and vice versa. Epitopes specifically linked by the bispecific antibody can be on the same target or on a different one (for example, on the same or a different protein). Bispecific antibodies can be produced, for example, by combining heavy chains that recognize different epitopes of the same immunogen. For example, nucleic acid sequences that encode sequences
[00138] [00138] The term "cell" includes any cell that is suitable for expressing a recombinant nucleic acid sequence. Cells include those of prokaryotes and eukaryotes (single cell or multiple cell), bacterial cells (eg E. coli strains, Bacillus spp. Streptomyces spp., Etc.), mycobacterial cells, fungal cells, yeast cells (for example, S. cerevisiae, S. pombe, P. pastoris, P. methanolica, etc.), plant cells, insect cells (for example, SF-9, SF-21, insect cells infected with baculovirus, Trichoplusia ni, etc.) Non-human animal cells, human cells or cell fusions such as, for example, hybridomas or frames. In some modalities, the cell is a human, monkey, great ape, hamster, rat or mouse cell. In some embodiments, the cell is eukaryotic and is selected from the following cells: CHO (for example, CHO K1, DXB-11 CHO, Veggie-CHO), COS (for example, COS-7), retinal cell, Vero, CV1 , renal (e.g.,
[00139] [00139] The phrase "complementarity determining region," "or the term" CDR ", includes an amino acid sequence encoded by a nucleic acid sequence of an organism's immunoglobulin genes that normally (that is, in a wild animal ) appears between two framework regions in a variable region of a light chain or a heavy chain of an immunoglobulin molecule (for example, an antibody or a T cell receptor). A CDR can be encoded, for example, by a germline sequence or a rearranged or non-rearranged sequence, and, for example, by a naive or mature B cell or a T cell. A CDR can be somatically mutated ( for example, vary from a sequence encoded in an animal's germline), humanized and / or modified with amino acid substitutions, additions or deletions. In some circumstances (for example, for a CDR3), CDRs can be encoded by two or more sequences (for example, germline sequences) that are not contiguous (for example, in a non-rearranged nucleic acid sequence) but they are contiguous in a B cell nucleic acid sequence, for example, as the result of splicing or joining the sequences (for example, VDJ recombination to form a heavy chain CDR3).
[00140] [00140] The term "conserved", when used to describe a conservative amino acid substitution, includes the replacement of an amino acid residue with another amino acid residue having a side chain R group with similar chemical properties (for example , charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially modify the functional properties of interest for a protein, for example, the ability of a variable region to specifically bind to a target epitope with a desired affinity.
[00141] [00141] In some embodiments, the residue positions in an immunoglobulin light chain or heavy chain differ by one or more conservative amino acid substitutions. In some embodiments, the residue positions in an immunoglobulin light chain or functional fragment thereof (for example, a fragment that allows expression and secretion, for example, of a B cell) are not identical to a light chain whose amino acid sequence is listed in this application, but differs by one or more conservative amino acid substitutions.
[00142] [00142] The phrase "epitope-binding protein" includes a protein having at least one CDR and is able to selectively recognize an epitope, for example, is able to bind to an epitope with a Kp that is approximately one micromolar or lower (for example, a Kp that is approximately 1 x 10º M, 1 x 107 M, 1 x 10º M, 1 x 10º M, 1x10ººM, 1x10 * M or approximately 1 x 10º M). Therapeutic epitope-binding proteins (for example, therapeutic antibodies) often require a Kp that is in the nanomolar or picomolar range.
[00143] [00143] The phrase "functional fragment" includes fragments of proteins linked to the epitope that can be expressed, secreted, and specifically bind to an epitope with a Kp in the micromolar, nanomolar or picomolar range. Specific recognition includes having a Kp that is at least in the micromolar range, in the nanomolar range or in the picomolar range.
[00144] [00144] The term "germline" includes reference to an immunoglobulin nucleic acid sequence in a non-somatically mutated cell, for example, a non-somatically mutated B cell or hematopoietic cell or pre-B cell.
[00145] [00145] The phrase "heavy chain," or "immunoglobulin heavy chain" includes an immunoglobulin heavy chain constant region sequence from any organism. The heavy chain variable domains include three heavy chain CDRs and four FR regions, unless otherwise specified. Heavy chain fragments include CDRs, CDRs and FRs and combinations thereof. A typical heavy chain has, after the variable domain (from N-terminal to C-terminal), a C41 domain, a hinge, a Chy2 domain and a Ch43 domain. A functional fragment of a heavy chain includes a fragment that is capable of specifically recognizing an epitope (for example, recognizing the epitope with a Kp in the micro-molar, nanomolar, or picomolar range), which is capable of expression and secretion of a cell, and which comprises at least one CDR.
[00146] [00146] The term "identity", when used with respect to sequence, includes identity as determined by several different algorithms known in the art that can be used to measure the identity of amino acid and / or nucleotide sequence. In some embodiments described in this application, identity is determined using ClustalW v. 1.83 (slow) employing an open gap penalty of 10.0, a gap gap penalty of 0.1, and using a Gonnet similarity matrix (MacVector '"10.0.2, MacVector Inc., 2008). length of the sequences compared with respect to sequence identity will depend on the particular sequences, but in the case of a light chain constant domain, the length must contain the sequence of sufficient length to bind to a light chain constant domain that is capable of self-association for form a constant domain of the canonical light chain, for example, capable of forming two beta leaves that comprise beta strips and capable of interacting with at least one Cnh1 domain of a human or mouse. - In C41, the length of the sequence must contain a sequence of sufficient length to bind to a Cy1 domain that is capable of forming two beta sheets comprising beta strips and capable of interacting with at least one domain the light chain of a mouse or a human.
[00147] [00147] The phrase "immunoglobulin molecule" includes two immunoglobulin heavy chains and two immunoglobulin light chains. Heavy chains can be identical or different, and light chains can be identical or different.
[00148] [00148] The phrase "light chain" includes an immunoglobulin light chain sequence from any organism, and unless otherwise specified includes «and À and a VpreB light chains, as well as substitute light chains. Light chain variable domains (V,) typically include three light chain CDRs and four arboretum (FR) regions, unless otherwise specified. Generally, an entire light chain includes, from the amino to the carboxyl terminal, a V domain, which includes FRI-CDR1I-FR2-CDR2-FR3-CDR3-FR4 and a constant domain of the light chain. Light chains include those, for example, that do not selectively bind to a first or second epitope selectively linked by the epitope-binding protein in which they appear. Light chains also include those that bind and recognize or assist the heavy chain by binding and recognizing one or more epitopes selectively linked by the epitope-binding protein in which they appear.
[00149] [00149] Universal light chains or common light chains refer to light chains produced in mice as described in this application, in which mice are highly restricted in the selection of gene segments available to produce a variable domain of the light chain. As a result, such mice make a light chain derived, in one embodiment, from no more than one or two V segments of the non-rearranged light chain and no more than one or two J segments of the non-rearranged light chain (for example, one V and a J, two V and a J, a V and two J, two V and two J).
[00150] [00150] The phrase "somatically mutated" includes reference to a nucleic acid sequence of a B cell that has undergone a class change, in which the nucleic acid sequence of an immunoglobulin variable region (for example, a variable domain of heavy chain or including a heavy chain CDR or FR sequence) in the class-switched B cell is not identical to the nucleic acid sequence in the B-cell before the class change, such as, for example, a difference in an acid sequence CDR nuclei or framework between a B cell that has not undergone a class change and a B cell that has undergone a class change. "Summatically mutated" includes reference to affinity-matured B-cell nucleic acid sequences that are not identical to corresponding immunoglobulin variable region sequences in B-cells that are not affinity-matured (ie, sequences in the germ cell genome). The phrase "somatically mutated" also includes reference to a nucleic acid sequence of a B cell immunoglobulin variable region after exposure of the B cell to an epitope of interest, in which the nucleic acid sequence differs from the acid sequence corresponding nucleic acids before exposure of the B cell to the epitope of interest. The phrase "somatically mutated" refers to antibody sequences that have been generated in an animal, for example, a mouse having sequences of nucleic acid - variable region of human immunoglobulin, in response to an immunogen challenge and that result from the processes inherently operational selection criteria on such an animal.
[00151] [00151] The term "not rearranged", with reference to a nucleic acid sequence, includes nucleic acid sequences that exist in the germ line of an animal cell.
[00152] [00152] The phrase "variable domain" includes an amino acid sequence of an immunoglobulin light or heavy chain (modified as desired) comprising the following amino acid regions, in the sequence from N-terminal to C-terminal (unless than otherwise indicated): FR1, CDR1, FR2, CDR2, FR3, CDR3, FRA4. Mice with Humanized Immunoglobulin Loci
[00153] [00153] The mouse as a genetic model was greatly enhanced by transgenic and knockout technologies, which allowed the study of the effects of targeted overexpression or deletion of specific genes. Despite all its advantages, the mouse still presents genetic obstacles that make it an imperfect model of human diseases and an imperfect platform for testing human therapeutic products or producing them. First, although approximately 99% of human genes have a mouse homolog (Waterston, R.H., et al. (2002). Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520-562). Potential therapeutic products often fail to cross-react, or cross-react improperly with mouse orthologists of the desired human targets. To avoid this problem, the selected target genes can be "humanized", that is, the mouse gene can be deleted and replaced with the corresponding human ortholog gene sequence (for example, US
[00154] [00154] Exogenously introduced human immunoglobulin transgenes rearrange themselves in precursor B cells in mice (Alt, F.W ,, Blackwell, T.K., and Yancopoulos, G.D. (1985).
[00155] [00155] A method of a large genetic in situ substitution of the variable human germline immunoglobulin genes for variable human germline immunoglobulin genes while maintaining the ability of mice to generate offspring is described. Specifically, the exact replacement of six megabases of immunoglobulin variable gene loci in both the mouse heavy chain and the K light chain by their
[00156] [00156] “Humanized VELCOIMMUNEGO mice exhibit a fully functional humoral immune system that is essentially indistinguishable from that of wild mice. They exhibit normal cell populations at all stages of B cell development. They exhibit normal lymphoid organ morphology. Antibody sequences of humanized VELCOIMMUNEGO mice exhibit normal variable segment rearrangement and normal somatic hypermutation. The antibody populations in these mice reflect isotype distributions that result from normal class switching (for example, cis switching from the normal isotype). Immunizing humanized VELCOIMMUNEP mice results in robust humoral responses that generate a great diversity of antibodies having variable domains of human immunoglobulin suitable as therapeutic candidates. This platform provides an abundant source of affinity-matured human immunoglobulin variable region sequences to produce pharmaceutically acceptable antibodies and other antigen-binding proteins.
[00157] [00157] It is the exact replacement of variable sequences of mouse immunoglobulin with variable sequences of human immunoglobulin that allows the creation of humanized mice VE-LOCIMMUNEGO. Even an exact replacement of endogenous mouse immunoglobulin sequences at heavy and light chain loci with equivalent human immunoglobulin sequences, by sequential recombination engineering of very large ranges of human immunoglobulin sequences, can present certain challenges due to evolution diverging immunoglobulin loci between mouse and man. For example, intergenic sequences interspersed within immunoglobulin loci are not identical between mice and humans and, in some circumstances, may not be functionally equivalent. Differences between mice and humans in their immunoglobulin loci can still result in abnormalities in humanized mice, particularly when humanizing or manipulating certain portions of the endogenous mouse immunoglobulin heavy chain loci. Some changes in the mouse immunoglobulin heavy chain loci are deleterious. Deleterious changes can include, for example, loss of the ability of modified mice to mate and produce offspring.
[00158] [00158] “An exact, large-scale, in situ replacement of six mezzases of the variable regions of the immunoglobulin loci of the mouse heavy and light chain (V4-Duy-Jy and VK-JK) with the 1.4 mega- bases of corresponding human genomic sequences were performed by leaving the flanking mouse sequences intact and functional within the hybrid loci, including all mouse constant chain genes and transcriptional control regions of the locus (Figure 1). Specifically, the human gene sequences Vu, Du, Jun, VK and JK were introduced through the gradual insertion of 13 chimeric BAC targeting vectors carrying overlapping fragments of human germline variable loci in mouse ES cells using genetic engineering technology. netic VELOCIGENEO (see, for example, US Pat. No. 6,586,251 and Valenzuela, DM, et al. (2003). High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nat Biotechnol 21, 652- 659).
[00159] [00159] The humanization of mouse immunoglobulin genes represents the greatest genetic modification to the mouse genome so far. Although previous efforts with randomly integrated human immunoglobulin transgenes have met with some success (discussed above), the direct replacement of mouse immunoglobulin genes by their human counterparts dramatically increases the efficiency with which fully human antibodies can be efficiently generated in normal mice otherwise. In addition, such mice exhibit a dramatically increased diversity of fully human antibodies that can be obtained after immunization with virtually any antigen, when compared to mice carrying inactivated endogenous loci and fully human antibody transgenes. Multiple versions of substituted, humanized loci exhibit completely normal levels of mature and immature B cells, in contrast to mice with randomly integrated human transgenes, which exhibit significantly reduced populations of B cells at various stages of differentiation . Although efforts to increase the number of human gene segments in human transgenic mice have reduced such defects, the expanded immunoglobulin repertoires have not completely corrected the reductions in B cell populations when compared to wild mice.
[00160] [00160] However, the close wild humoral immune function observed in mice with substituted immunoglobulin loci, there are other challenges encountered when employing a direct immunoglobulin replacement that is not found in some approaches that employ randomly integrated transgenes. Differences in the genetic composition of immunoglobulin loci between mice and humans have led to the discovery of beneficial sequences for the propagation of mice with substituted immunoglobulin gene segments. Specifically, mouse ADAM genes located within the endogenous immunoglobulin locus are present optimally in mice with substituted immunoglobulin loci, due to their role in fertility. Genomic Position and Function of ADAM6 in Mouse
[00161] [00161] Male mice lacking the ability to express any functional ADAMG6 protein exhibit a severe defect in the mice's ability to mate and breed offspring. Mice lacking the ability to express a functional ADAM6 protein due to a replacement of all or substantially all of the gene segments of the mouse immunoglobulin variable region by gene segments of the human variable region. Loss of ADAMB6 function occurs because the ADAMG6 locus is located within a gene locus region of the variable region of the endogenous mouse immunoglobulin heavy chain, proximal to the 3 'end of the V segment locus, which is upstream of the Dy gene segments. In order to create mice that are homozygous for the replacement of all or substantially all of the variable gene segments of the endogenous mouse heavy chain by variable gene segments of the human heavy chain
[00162] [00162] The ADAM6 protein is a member of the ADAM family of proteins, where ADAM is an acronym for Disintegrin A and Metalloprotease. The ADAM family of proteins is large and diverse, with diverse functions. Some members of the ADAM family are involved in spermatogenesis and fertilization. For example, ADAM encodes a subunit of the fertilin protein, which is involved in sperm-egg interactions. ADAM3 or ciritestin, seems necessary for the connection of sperm to the pellucid zone. The absence of ADAM2 or ADAMB3 results in infertility. It has been postulated that ADAM2, ADAM3 and ADAMG6 form a complex on the surface of mouse sperm cells.
[00163] [00163] The human ADAM6 gene, normally found between the V, human V1h1-2 and V46-1 gene segments, appears to be a pseudo-dogene (Figure 12). In mice, there are two genes - ADAM6 and ADAM6a - that are found in an intergenic region between the gene segments V, and Di, of mouse, and in the mouse, genes a and b are oriented in a transcriptional orientation as opposed to that of the orientation of transcription of the surrounding immunoglobulin gene segments (Figure 11). In mice, a functional ADAM6 locus is apparently required for normal fertilization. A functional ADAMG6 locus or sequence, then, refers to an ADAM6 locus or sequence that can complement, or rescue, the drastically reduced fertiization exhibited in male mice with the absence of endogenous or damaged ADAM6 loci.
[00164] [00164] The position of the intergenic sequence in mice encoding ADAM6a and ADAMG6b makes the intergenic sequence susceptible to modification by modifying an endogenous mouse heavy chain. When gene segments V are deleted or replaced, or when gene segments D ,, are deleted or replaced, there is a high probability that a resulting mouse will exhibit a severe deficit in fertility. In order to compensate for the deficit, the mouse is modified to include a nucleotide sequence that encodes a protein that will complete the loss in ADAM6 activity due to a modification of the endogenous mouse ADAM6 locus. In several modalities, the nucleotide sequence that completes is that encoding a mouse ADAM6a, a mouse ADAM6b, or a homologous or orthologous or functional fragment thereof that rescues the deficit in fertility.
[00165] [00165] The nucleotide sequence that rescues fertility can be placed in any suitable position. It can be placed in the intergenic region, or in any suitable position in the genome (that is, ectopically). In one embodiment, the nucleotide sequence can be introduced into a transgene that randomly integrates into the mouse genome. In one embodiment, the sequence can be maintained episomally, that is, in a separate nucleic acid instead of in a mouse chromosome. Suitable positions include positions that are transcriptionally permissive or active, for example, a ROSAZ6 locus.
[00166] [00166] The term "ectopic" is intended to include a displacement or placement in a position that is not normally found in nature (for example, placing a sequence of nucleic acids in a position that is not the same position as the nucleic acid sequence that is found in a wild mouse). The term in various modalities is used with respect to its object that is outside its normal or appropriate position. For example, the phrase "an ectopic nucleotide sequence that encodes ..." refers to a nucleotide sequence that appears in a position where it is not normally found in the mouse. For example, in the case of an ectopic nucleotide sequence that encodes a mouse A-DAMG6 protein (or an orthologist or homolog or fragment thereof that provides the same or similar fertility benefit in male mice), the sequence can be placed in a different position in the mouse genome than is normally found in a wild mouse. A functional ADAM6 or mouse homologue is a sequence that confers a rescue from the loss of fertility (for example, the loss of the ability of a male mouse to generate offspring by mating) that is observed in an ADAM6 mouse ”. Homologues or functional orthologs include proteins that have at least approximately 89% or more identity, for example, up to 99% identity, to the amino acid sequence of ADAM6a and / or the amino acid sequence of ADAM6b, and that can complement or rescue the ability to successfully mate a mouse that has a genotype that includes an ADAM6a and / or ADAMG6b deletion or knockout.
[00167] [00167] The ectopic position can be anywhere (for example, as with the random insertion of a transgene containing a mouse ADAM6 sequence), or it can be, for example, in an approaching position (but it is not precisely the same as) its position in a wild mouse (for example, in a modified endogenous mouse immunoglobulin locus, but upstream or downstream of its natural position, for example, within a modified immunoglobulin locus but between different gene segments, or in a different position in a mouse RV RV intergenic sequence). An example of an ectopic placement is placement within a humanized immunoglobulin heavy chain locus. For example, a mouse comprising a replacement of one or more V gene segments, endogenous by human V gene segments, where the replacement removes an endogenous ADAM6 sequence, can be engineered to have a mouse ADAM6 sequence located within the sequence containing the human Vy gene segments. The resulting modification would generate a mouse ADAMG6 (ectopic) sequence within a human gene sequence, and the placement (ectopic) of the mouse ADAMG6 sequence within the human gene sequence can approximate the position of the human ADAM6 pseudogene (that is, between two V segments) or can approach the position of the mouse ADAMG6 sequence (ie, within the RV intergenic region).
[00168] [00168] In several respects, mice that comprise deletions or substitutions of the endogenous heavy chain variable region locus or portions thereof can be produced containing an ectopic nucleotide sequence that encodes a protein that confers fertility benefits similar to mouse ADAM6 (for example, an orthologist or a homolog or a fragment of it that is functional in a male mouse). The ectopic nucleotide sequence may include a nucleotide sequence that encodes a protein that is an ADAMG6 homolog or ortholog (or a fragment thereof) from a different mouse strain or a different species, for example, a different rodent species, and which confers a benefit on fertility, for example, increased number of litters over a given period of time and / or increased number of pups per litter and / or the ability of a male mouse's sperm cell to cross an oviduct mouse to fertilize a mouse egg.
[00169] [00169] In one embodiment, ADAM6 is a homolog or orthologist that is at least 89% to 99% identical to a mouse ADAMG6 protein (for example, at least 89% to 99% identical to mouse ADAM6a or ADAM6b of mice). In one embodiment, the ectopic nucleotide sequence encodes one or more proteins independently selected from a protein at least 89% identical to mouse ADAM6a, a protein at least 89% identical to mouse ADAM6b and a combination of these. In one embodiment, the homologue or ortholog is a rat, hamster, mouse, or guinea pig protein that is or is modified to be approximately 89% or more identical to mouse ADAM6a and / or mouse ADAM6b. In one embodiment, the homologue or orthologist is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a mouse ADAM6a and / or mouse ADAM6b .
[00170] [00170] Mice that produce human antibodies have been available for some time. Although they represent an important advance in the development of human therapeutic antibodies, these mice exhibit several significant abnormalities that limit their usefulness. For example, they exhibit compromised B cell development. The compromised development may be due to a variety of differences between transgenic mice and wild mice.
[00171] [00171] Human antibodies could not optimally interact with the mouse pre-B cell or B cell receptors on the surface of mouse cells that signal for maturation, proliferation or survival during clonal selection. Fully human antibodies could not optimally interact with a mouse Fc receptor system; mice express Fc receptors that do not exhibit individual correspondence with human Fc receptors. Finally, several mice that produce fully human antibodies do not include all genuine mouse sequences, for example, downstream enhancer elements and other locus control elements that may be required for the development of wild B cell .
[00172] [00172] Mice that produce fully human antibodies generally comprise endogenous immunoglobulin loci that are in some way deactivated and human transgenes that comprise constant and variable immunoglobulin gene segments are introduced into a random position in the mouse genome. While the endogenous locus is sufficiently inactivated to not rearrange gene segments to form a functional immunoglobulin gene, the goal of producing fully human antibodies in such a mouse can be achieved - albeit with compromised B cell development.
[00173] [00173] Although compelled to produce fully human antibodies from the human transgene locus, the generation of human antibodies in a mouse is apparently an unfavorable process. In some mice, the process is not favored so as to result in the formation of heavy mouse constant chains / chimeric human variables (but not light chains) by the trans-exchange mechanism. By this mechanism, transcripts encoding fully human antibodies undergo an isotype exchange in a human trans-type to a mouse isotype. The process is in trans, because the fully human transgene is located apart from the endogenous locus that preserves an undamaged copy of a gene from the constant region of the mouse heavy chain. Although in such a trans-exchange of mice it is readily apparent the phenomenon is still insufficient to rescue the development of B cell, which remains severely impaired. In any case, the trans-exchanged antibodies produced in such mice retain fully human light chains, since the trans-exchange phenomenon apparently does not occur relatively in light chains; the exchange presumably depends on exchange sequences at endogenous loci used (albeit differently) in exchange for the normal cis isotype. Thus, even when mice engineered to produce fully human antibodies select a trans-exchange mechanism to produce antibodies with constant mouse regions, the strategy is still insufficient to rescue normal B-cell development.
[00174] [00174] A primary concern in creating human antibody-based therapeutic products is making a sufficiently large diversity of human immunoglobulin variable region sequences to identify useful variable domains that specifically recognize and bind to particular epitopes with a desirable affinity, usually - but not always - with high affinity. Prior to the development of humanized VE-LOCIMMUNEOÔ mice, there was no indication that mice expressing human variable regions with constant mouse regions would exhibit any significant difference from mice that produced human antibodies to a transgene. That assumption, however, was incorrect.
[00175] [00175] VELOCIMMUNEGO humanized mice, which contain an exact substitution of variable regions of mouse immunoglobulin with variable regions of human immunoglobulin in endogenous mouse loci, exhibit a striking and remarkable similarity with wild mice in relation to B cell development. In a surprising and stunning development, humanized VELOCIMMUNEG mice exhibited an essentially normal, wild response to immunization that only differed in a significant circumstance from wild mice - the variable regions generated in response to the immunization are entirely human.
[00176] [00176] Humanized VELOCIMMUNEG mice contain an exact, large-scale replacement of variable regions of germ line from the mouse immunoglobulin (IgH) heavy chain and immunoglobulin light chain (eg, K light chain, IgKk) with corresponding variable regions of human immunoglobulin, in endogenous loci. In total, approximately six megabases of mouse loci are replaced by approximately 1.4 mega-bases of the human genomic sequence. This exact substitution results in a mouse with hybrid immunoglobulin loci that produce heavy and light chains that have human variable regions and a constant mouse region. The exact replacement of Vy4-Du-Jy and VK-JK mouse segments leaves flanked mouse sequences intact and functional in the hybrid immunoglobulin loci. The mouse's humoral immune system functions like that of a wild mouse. B-cell development is unimpeded in any significant circumstance and a rich diversity of human variable regions is generated in the mouse in the antigen challenge.
[00177] [00177] —VELOCIMMUNEO humanized mice are possible because the immunoglobulin gene segments of heavy and light chains «rearrange themselves similarly in humans and individuals
[00178] [00178] In some embodiments, additional replacement of certain gene sequences from the mouse constant region with human gene sequences (for example, replacement of the mouse Cy1 sequence by the human Cy1 sequence and replacement of the mouse C sequence by the C sequence, human) result in mice with hybrid immunoglobulin loci that produce antibodies that have human variable regions and partially human constant regions, suitable, for example, for producing fully human antibody fragments, for example, fully human Fab. Mice with hybrid immunoglobulin loci exhibit normal variable gene segment rearrangement, normal somatic hypermutation and normal class change. These mice exhibit a humoral immune system that is indistinguishable from wild mice, and require normal cell populations at all stages of B-cell development and normal lymphoid organ structures - even where mice lack a complete repertoire of genetic segments of human variable region. The immunization of these mice results in robust humoral responses that exhibit a wide range of uses for the variable gene segment.
[00179] [00179] The exact replacement of gene segments in the variable region of mouse germline allows the creation of
[00180] [00180] Large-scale humanization by recombination engineering methods has been used to modify mouse embryonic stem cells (ES) to replace precisely up to 3 dolocus megabases of mouse heavy chain immunoglobulin that essentially included all mouse Vu, Dy and J'4 gene segments with equivalent human gene segments with up to a 1 megabase human genomic sequence containing some or essentially all human Vu, Dy and Ja gene segments. Even a 0.5 megabase segment of the human genome comprising one of two repeats that encode essentially all of the VK and JK gene segments was used to replace a 3 megabase segment of the mouse immunoglobulin light chain locus containing essentially all genomic segments camkongVkKe dJk.
[00181] [00181] Mice with such substituted immunoglobulin loci may comprise a disturbance or deletion of the mouse endogenous A-DAMG6 locus, which is normally found between most of the V, 3 'gene segment and most of the 5 'Di gene segment at the mouse immunoglobulin heavy chain locus. The disturbance in this region can lead to a reduction or elimination of the functionality of the endogenous mouse ADAM6 locus. If most of the 3 'V gene segments in the human heavy chain repertoire are used in a substitution, an intergenic region that contains a pseudogene that appears to be a human ADAM6 pseudo-gene is present between these Vau gene segments, this is, between V, 1-2 and human V41-6. However, male mice that comprise this human intergenic sequence require little or no fertility.
[00182] [00182] Mice are described comprising the substituted loci as described above, and which also comprise an ectopic nucleic acid sequence that encodes a mouse ADAM6, where the mice exhibit essentially normal fertility. In one embodiment, the ectotropic nucleic acid sequence SEQID NO: 3, placed between Vy1-2 and human V41-6 at the modified endogenous mouse heavy chain locus. The direction of transcription of the ADAM6 genes of SEQ ID NO: 3 is opposite to the direction of transcription of the surrounding human V gene segments. Although the examples in this application show the rescue of fertility by placing the ectopic sequence between the V gene segments, well-versed humans will recognize that the placement of the ectopic sequence in any transitionally suitable permissive locus in the mouse genome (or even extra-chromosomally) similarly rescues fertility in a male mouse.
[00183] [00183] The phenomenon of complementing a mouse without a functional ADAMG6 locus with an ectopic sequence that comprises a mouse ADAM6 gene or ortholog or homologous or functional fragment thereof is a general method that is applicable to the rescue of any mouse with non-functioning endogenous ADAM6 loci
[00184] [00184] In one aspect, a mouse is provided in a way that comprises an ectopic ADAMG6 sequence that encodes a functional ADAMG6 protein (or ortholog or homologous or functional fragment thereof), a replacement for all or substantially all of the gene segments V, mouse by one or more human V4 gene segments, a replacement of all or substantially all of the gene segments Di, mouse and gene segments dJ1, by gene segments D, human and J, human; where the mouse does not have a Ch1 and / or hinge region. In one fashion, the mouse produces a unique variable domain binding protein that is a dimer of immunoglobulin chains selected from: (a) V, human - mouse Cy1 - mouse Ch2 - mouse C0Ê3; (b) Human V4 - mouse hinge - mouse Ch2 - mouse Ch3; and, (c) Human V. - mouse C1h2 - mouse C43.
[00185] [00185] In one aspect, the nucleotide sequence that rescues fertility is placed within a variable region sequence of the human immunoglobulin heavy chain (for example, between the human Vy1-2 and V41-6 gene segments) in a mouse that has a replacement of all or substantially all of the variable gene segments of the mouse immunoglobulin heavy chain (mVy's, MDy's and mJ4y's) with one or more variable gene segments of the human immunoglobulin heavy chain (hVy's, hDy's and hJ4's) , and the mouse further comprises replacing all or substantially all of the variable gene segments of the mouse immunoglobulin K 'light chain (mVK's, mJK's) with one or more variable gene segments of the human immunoglobulin light chain' (hVkK's and hJK's) . In one embodiment, the nucleotide sequence is placed between a human V41-2 gene segment and a human V41-6 gene segment in a humanized VELO-CIMMUNEO mouse (US 6,596,541 and US 7,105,348, incorporated in this application by reference). In one embodiment, such a modified VELOCIMMUNEO humanized mouse comprises a replacement for all or substantially all of the variable gene segments of the human immunoglobulin heavy chain (all hVy's, hDy's and hJy's) and all or substantially all of the variable gene segments of the K light chain human immunoglobulin (hVkK's and hJK's).
[00186] [00186] In one aspect, a functional mouse ADAM6 locus (or ortholog or homologous or functional fragment thereof) can be placed in the middle of human V gene segments that replace endogenous mouse V gene segments. In one embodiment, all or substantially all of the mouse Vy gene segments are removed and replaced with one or more human V gene segments, and the mouse ADAM6 locus is placed immediately adjacent to the 3 'end of the human V gene segments, or between two human V gene segments. In a specific embodiment, the mouse ADAM6 locus is placed between two V gene segments, close to the 3 'end of the inserted human V gene segments. In a specific modality, the replacement includes gene segments V, human Vy1-2 and Vi6-1 and the mouse ADAM6 locus is placed downstream of the genetic segment V41-2 and upstream of the gene segment V46-1. In a specific modality, the arrangement of human V4y gene segments is then as follows (from upstream to the direction of transcription of human Vy gene segments): human V41-2 - mouse A-DAMG6 locus - V46 -1 human. In a specific embodiment, the ADAM6 pseudogene between human V, 1-2 and human V46-1 is replaced by the mouse ADAM6 locus. In one embodiment, the orientation of one or more of mouse ADAM6a and mouse A-DAMG6b from the mouse ADAM6 locus is opposite with respect to the direction of transcription when compared to the orientation of human Vy gene segments. Alternatively, the mouse ADAM6 locus can be placed in the intergenic region between most of the 3 'human Vy gene segment and most of the 5'D gene segment. This may be the case if most of the segment D ,, 5 'is mouse or human.
[00187] [00187] Similarly, a mouse modified with one or more human V gene segments (e.g., VK or VA segments) replacing all or substantially all of the endogenous mouse Vu gene segments can be modified to maintain the endogenous mouse ADAM6 locus, as described above, for example, employing a targeting vector that has a downstream homology arm that includes a mouse ADAM6 locus or functional fragment thereof, or replacing a damaged mouse ADAM6 locus with an ectopic sequence positioned between two V gene segments , humans or between gene segments V, humans and a gene segment Di (or human or mouse, for example, VA + m / hDy), or gene segment J (or human or mouse, for example, VK + Ja) . In one embodiment, the substitution includes two or more human V gene segments, and the mouse A-DAMG6 locus or functional fragment thereof is placed between the majority of two 3 'V gene segments. specific, the arrangement of human V gene segments is then as follows (upstream and downstream with respect to the transcription direction of human gene segments): human V, 3'-1 - mouse ADAM6 locus - human V, 3 ' . In one embodiment, the orientation of one or more of mouse ADAM6a and mouse ADAM6b —dong of the mouse ADAM6 locus is opposite with respect to the direction of transcription when compared to the orientation of the human V gene segments. Alternatively, the mouse ADAM6 locus can be placed in the intergenic region between most of the human V, 3 'gene segment and most of the D, 5 gene segment. This may be the case if most of the D, 5 'is mouse or human.
[00188] [00188] In one aspect, a mouse is provided with a replacement of one or more endogenous mouse V gene segments, and which comprises at least one endogenous mouse gene segment. In such a mouse, the modification of the gene segments V, of endogenous mice may comprise a modification of one or more of most of the gene segments V, 3 ', but not the majority of the gene segment 5' Du, where care is taken. taken so that the modification of one or more of most of the V, 3 'gene segments does not disturb or produce the non-functional mouse endogenous ADAMG6 locus. For example, in one embodiment, the mouse comprises a replacement of all or substantially all gene segments V, of endogenous mouse by one or more human Vy gene segments, and the mouse comprises one or more gene segments D ,, endogenous-
[00189] [00189] In another embodiment, the mouse comprises the modification of most of the endogenous mouse V, 3 'gene segments and a modification of one or more endogenous mouse Du "gene segments, and the modification is performed for man - have the integrity of the mouse endogenous ADAM6 locus to the extent that the endogenous ADAM6 locus remains functional.In one example, such modification is done in two steps: (1) replacement of most V, 3 'gene segments of endogenous mice by one or more V gene segments, humans employing a targeting vector with an upstream homology arm and a downstream homology arm in which the downstream homology arm includes all or a portion of a functional mouse ADAM6 locus; (2) then replacement and the endogenous mouse D, gene segment by a targeting vector having an upstream homology arm that includes all or a functional portion of an ADAM6 locus from camundon go.
[00190] [00190] In several respects, employing mice that contain an ectopic sequence encoding a mouse ADAM6 protein or an ortholog or homologous or functional homologue of this are useful where the modifications disrupt the endogenous mouse ADAM6 function. The likelihood of disrupting the function of endogenous mouse A-DAMG6 is high by making modifications to the mouse immunoglobulin loci, in particular by modifying variable regions of the mouse immunoglobulin heavy chain and surrounding sequences. Therefore, such mice provide particular benefit in producing mice with heavy immunoglobulin chain loci that are totally or partially deleted, are totally or partially humanized or are replaced (for example, with VK or VA sequences). or partially. The methods for producing the genetic modifications described for the mice described below are known to those skilled in the art.
[00191] [00191] Mice containing an ectopic sequence that encodes a mouse ADAM6 protein or substantially identical or similar protein that confers the fertility benefits of a mouse ADAM6 protein, is particularly useful in conjunction with modifications to a gene locus of variable regions of the mouse immunoglobulin heavy chain that disrupt or delete the endogenous mouse ADAM6 sequence. Although primarily described with respect to mice expressing antibodies with human variable regions and mouse constant regions, such mice are useful with respect to any genetic modification that disturbs the endogenous mouse ADAM6 gene. Those skilled in the art will recognize that this encompasses a wide variety of genetically modified mice that contain modifications of the variable locus of the mouse immunoglobulin heavy chain. These include, for example, mice with a deletion or replacement of all or a portion of the gene segments of the mouse immunoglobulin heavy chain, despite other modifications. Non-limiting examples are described below.
[00192] [00192] In some respects, genetically modified mice are provided that comprise an ectopic mouse, rodent, or other ADAMG6 gene (or orthologous or homologous or fragment) functional in a mouse, and one or more segments gene treatments of the variable and / or human immunoglobulin constant region.
[00193] [00193] In one aspect, a mouse is provided in a manner that comprises an ectopic ADAMG6 sequence that encodes a functional ADAMGS protein, a replacement of all or substantially all of the mouse V gene segments by one or more gene segments Human V "y; a replacement of all or substantially all of the mouse D gene segments by one or more human D1 gene segments; and a replacement of all or - substantially all of the mouse J gene segments by one or more more J gene segments, human.
[00194] [00194] In one embodiment, the mouse further comprises a replacement of a mouse Cy1 nucleotide sequence with a human Cy1 nucleotide sequence. In one embodiment, the mouse further comprises a replacement of a mouse hinge nucleotide sequence by a human hinge nucleotide sequence. In one embodiment, the mouse further comprises replacing a variable locus of the immunoglobulin light chain (V, and J,) with a variable locus of the human immunoglobulin light chain. In one embodiment, the mouse further comprises replacing a nucleotide sequence of the mouse immunoglobulin light chain constant region with a nucleotide sequence of the human immunoglobulin light chain constant region. In a specific embodiment, V., Je Cr are light chain sequences of immunoglobulin. In a specific embodiment, the mouse comprises a mouse Ch2 immunoglobulin constant region and mouse C3 sequences fused with a human hinge and a human Ch41 sequence, such that the mouse immunoglobulin loci are re-arrange to form a gene encoding a binding protein comprising (a) a heavy chain that has a human variable region, a human Cy1 region, a human hinge region and a mouse Cy2 region and a mouse C1h3; and (b) a gene that encodes an immunoglobulin light chain comprising a human variable domain and a human constant region.
[00195] [00195] In one aspect, a mouse is provided in a manner that comprises an ectopic ADAMG6 sequence that encodes a functional ADAMG6 protein, a replacement of all or substantially all of the mouse V gene segments by one or more gene segments V, humans, and optionally a replacement of all or substantially all of the gene segments Dy, and / or gene segments J4y with one or more gene segments D, human and / or gene segments J, human, or optionally a substitution of all or substantially all of the gene segments Dy and gene segments J, by one or more gene segments J, human.
[00196] [00196] In one embodiment, the mouse comprises a replacement of all or substantially all of the mouse Vu, Du and Ja gene segments by one or more WV gene segments, one or more Dye one or more J (for example, JK or JA), in which the gene segments are operationally linked to an endogenous mouse hinge region, in which the mouse forms a rearranged immunoglobulin chain gene that contains, from 5 'to 3' in the direction of transcription, V, human - Human or mouse dy - human or mouse vJ - mouse hinge - mouse Ch2 - mouse C43. In one embodiment, the J region is a human JK region. In one embodiment, the J region is a human J region. In one embodiment, the J region is a human JA region. In one embodiment, the human V region is selected from a human VA region and a human VK region.
[00197] [00197] In specific embodiments, the mouse expresses a single variable domain antibody that has a mouse or human constant region and a variable region derived from a human VK, a human D and a human JK; a human VK, a D "human and an HJ, human; a human VA, a human Di and a human JA
[00198] [00198] In one aspect, a mouse is provided in a manner that comprises an ectopic ADAMG6 sequence that encodes a functional ADAMG6 protein (or ortholog or homologous or functional fragment thereof), a replacement for all or substantially all of the gene segments V, mouse by one or more gene segments V, human, a replacement of all or substantially all gene segments Dy, and gene segments J, mouse by gene segments J, human; where the mouse does not have a Cy1 region and / or hinge region.
[00199] [00199] In one embodiment, the mouse does not have a sequence that encodes a Cy1 domain. In one embodiment, the mouse does not have a sequence that encodes a hinge region. In one embodiment, the mouse does not have a sequence that encodes a Cy domain and a hinge region.
[00200] [00200] In a specific embodiment, the mouse expresses a binding protein that comprises a variable domain of the human immunoglobulin light chain (A or ') fused to a mouse C1h2 domain that is linked to a mouse Chy3 domain.
[00201] [00201] In one aspect, a mouse is provided in a manner that comprises an ectopic ADAMG6 sequence that encodes a functional ADAMG6 protein (or ortholog or homologous or functional fragment thereof), a replacement for all or substantially all of the gene segments V, mouse by one or more gene segments WV, human, a replacement of all or substantially all gene segments D., and mouse J4 by gene segments J, human.
[00202] [00202] In one embodiment, the mouse comprises a deletion of a gene sequence from an immunoglobulin heavy chain constant region that encodes a Ch1 region, a hinge region, a Cy1 region and a hinge region, or a region Ch1 and a hinge region and a Cy2 region.
[00203] [00203] In one embodiment, the mouse produces a single variable domain binding protein comprising a homodimer selected from the following: (a) V, human - mouse Cy1 - mouse Cyh2 - mouse C1h3; (b) V, human - mouse hinge - mouse Ch2 - mouse Cy3; (c) V, human - mouse Chy2 - mouse Ch3.
[00204] [00204] In one aspect, a mouse is provided with a deactivated endogenous heavy chain immunoglobulin locus, comprising an invalid or deleted endogenous mouse ADAMG6 locus, in which the mouse comprises a nucleic acid sequence that expresses a human or mouse or human / mouse or other chimeric antibody. In one embodiment, the nucleic acid sequence is present in an integrated transgene that is randomly integrated into the mouse genome. In one embodiment, the nucleic acid sequence is in an episome (for example, a chromosome) not found in a wild mouse. Chain Light, Common, or Universal
[00205] [00205] - Previous efforts to produce useful multispecific epitope binding proteins, for example, bispecific antibodies, have been prevented by the variety of problems that often share a common paradigm: in vitro selection or manipulation of sequences to rationally engineer, or engender by trying
[00206] [00206] Generally, native mouse sequences are often not a good source for human therapeutic sequences. For this reason at least, generation of variable regions of mouse heavy chain immunoglobulin that resemble a common human light chain is of limited practical utility. More in vitro engineering efforts would be spent in a trial and error process to try to humanize variable sequences of the mouse heavy chain while hoping to preserve epitope specificity and affinity while maintaining the ability to couple with the human light chain. common, with uncertain result. At the end of such a process, the final product may maintain some specificity and affinity, and be associated with the common light chain, but in short the immunogenicity in a human being would probably remain a very great risk.
[00207] [00207] —Therefore, a mouse suitable for producing human therapeutic products would include an appropriately large repertoire of gene segments of the human heavy chain variable region in the gene segments of the variable region of the endogenous mouse heavy chain. The gene segments of the variable region of the human heavy chain must be able to rearrange and re-combine with a constant domain of the endogenous mouse heavy chain to form a reverse chimeric heavy chain (that is, a heavy chain comprising a domain human variable and a constant mouse region). The heavy chain must be capable of class change and somatic hypermutation so that an appropriately large repertoire of variable domains of the heavy chain is available for the mouse to select the one that can associate with the limited repertoire of variable regions of the human light chain.
[00208] [00208] “A mouse that selects a common light chain from a plurality of heavy chains has practical use. In various modalities, antibodies that express in a mouse that can only express a common light chain will have heavy chains that can associate and express an identical or substantially identical light chain. This is particularly useful in creating bispecific antibodies. For example, such a mouse can be immunized with a first immunogen to generate a B cell that expresses an antibody that specifically binds to a first epitope. The mouse (or genetically the same mouse) can be immunized with a second immunogen to generate a B cell that expresses an antibody that specifically binds to the second epitope. Variable heavy regions can be cloned from B cells expressed with the same heavy chain constant region and the same light chain, and expressed in a cell to produce a bispecific antibody, in which the bispecific antibody light chain component was selected by a mouse to associate and express the light chain component.
[00209] [00209] The inventors have engendered a mouse to generate immunoglobulin light chains that will suitably join with a very diverse family of heavy chains, including heavy chains whose variable regions start from germinated lineage sequences, for example, mature variable regions affinity or somatically mutated. In several modalities, the
[00210] [00210] The genetically engineered mouse, through the long and complex process of antibody selection within an organism, makes biologically appropriate choices in matching a diverse collection of variable domains of the human heavy chain with a limited number of options. human light chain. In order to achieve this, the mouse is engineered to present a limited number of human light chain variable domain options together with a wide variety of human heavy chain variable domain options. In the challenge with an antigen, the mouse maximizes the number of solutions in its repertoire to develop an antibody to the antigen, limited basically or alone by the number or options of the light chain in its repertoire. In various ways, this includes allowing the mouse to perform suitable and compatible somatic mutations of the variable domain of the light chain that will nevertheless be compatible with a relatively wide variety of variable domains of the human heavy chain, including in particular variable domains of the heavy chain human somatically mutated.
[00211] [00211] To achieve a limited repertoire of light chain options, the mouse is engineered to originate non-functional or substantially non-functional its ability to produce, or rearrange, a variable domain of the native mouse light chain. This can be achieved, for example, by deleting the variable region gene segments of the mouse light chain. The endogenous mouse locus can then be modified by a variable region gene segment of the appropriate exogenous human light chain of choice, operationally linked to the constant domain of the endogenous mouse light chain, in such a way that the gene segments of exogenous human variable region can combine with the endogenous mouse light chain constant region gene and form a rearranged reverse chimeric light chain gene (human variable, mouse constant). In various modalities, the variable region of the light chain is capable of being somatically mutated. In various modalities, to maximize the ability of the variable region of the light chain to acquire somatic mutations, the appropriate enhancer (s) is conserved in the mouse. For example, in the modification of a mouse K light chain locus to replace endogenous mouse k light chain gene segments with human K light chain gene segments, the K intronic mouse enhancer and enhancer of mouse 3 '«are functionally maintained or undisturbed.
[00212] [00212] “A genetically engineered mouse is provided in a way that expresses a limited repertoire of chimeric reverse light chains (human variable, mouse constant) associated with a diversity of chimeric reverse heavy chains (human variable, mouse constant). In several modalities, gene segments of the endogenous mouse k light chain are delet- ed and replaced by a rearranged single (or two) human light chain region, operationally linked to the endogenous mouse CK gene. In modalities to maximize the somatic hypermutation of the rearranged human light chain region, the intronic K mouse enhancer and the 3 'K mouse enhancer are maintained. In various modalities, the mouse also comprises a non-functional À light chain locus or deletion thereof or a deletion that gives rise to the locus incapable of producing an À light chain.
[00213] [00213] A genetically engineered mouse is provided in a way that, in various modalities, comprises a variable region locus of the light chain without gene segments V, and J, of the endogenous mouse light chain and comprises a variable region of the light chain rearranged human, in a modality, a rearranged human VW / JL sequence, operationally linked to a constant mouse region, in which the locus is capable of undergoing somatic hypermutation, and in which the locus expresses a light chain that comprises the human V // J sequence linked to a mouse constant region. Thus, in various modalities, the locus comprises a 3 '«mouse enhancer, which is correlated with normal, or wild, somatic hypermutation level.
[00214] [00214] The mouse genetically engineered in several modalities when immunized with an antigen of interest generates B cells that exhibit a diversity of rearrangements of variable regions of the human immunoglobulin heavy chain that express and function with one or two rearranged light chains, including modalities where one or two light chains comprise variable regions of the human light chain that comprise, for example, 1 to 5 somatic mutations. In various modalities, such expressed human light chains are capable of associating and expressing any variable region of the human immunoglobulin heavy chain expressed in the mouse. Epitope-Binding Proteins That Bind to More Than One Epitope
[00215] [00215] The compositions and methods of that described in this application can be used to produce binding proteins that bind to more than one epitope with high affinity, for example, bispecific antibodies. The advantages of the invention include the ability to select
[00216] [00216] The synthesis and expression of bispecific binding proteins were problematic, partly due to issues associated with the identification of an appropriate light chain that can associate and express two different heavy chains, and partly due to isolation issues. The methods and compositions described in this application allow a genetically modified mouse to select, by means of natural processes otherwise, an appropriate light chain that can associate and express more than one heavy chain, including heavy chains that are somatic. mutated (for example, matured by affinity). Suitable B cell human V, and Vu sequences from immunized mice as described in this application that express affinity-matured antibodies having reverse chimeric heavy chains (i.e., human and mouse constant variable) can be identified and cloned into the structure in one expression vector with a suitable human constant region gene sequence (for example, a human IgG1). Two such constructs can be prepared, in which each construct encodes a variable domain of the human heavy chain that binds to a different epitope. One of the human Vs (for example, human VK1-39JK5 or human VK3-20JK1), following a | germline or a B cell in which the sequence has been mutated, can be fused to the structure a a suitable human constant region gene (for example, a human K constant gene). These three heavy and light, fully human constructs can be placed in a cell suitable for expression. The cell will express two main species: a homodimeric heavy chain with identical light chain and a heterodimeric heavy chain with the identical light chain. To allow easy separation of these main species, one of the heavy chains is modified to omit a Protein A binding determinant, resulting in a differential affinity of a homodimeric binding protein from a heterodimeric binding protein. The compositions and methods that address this issue are described in USSN 12 / 832,838, deposited on June 25, 2010, entitled "Readily Isolated Bispecific Antibodies with Native Immunoglobulin Format," published as US 2010 / 0331527A1, hereby incorporated by reference.
[00217] [00217] In one aspect, an epitope-binding protein as described in this application is provided, wherein the human sequences V, and V, are derived from mice described in this application that have been immunized with an antigen comprising an epitope of interest. if.
[00218] [00218] In one embodiment, an epitope-binding protein is provided so that it comprises a first and a second polypeptide, the first polypeptide comprising, from the N-terminal to the C-terminal, a first region that binds to the epitope that selectively binds to a first epitope, followed by a constant region comprising a first human IgG C, 3 region selected from I9gG1, IgG2, IgG4 and a combination of these; and, a second polypeptide comprising, from the N-terminal to the C-terminal, a second region that binds to the epitope that selectively binds to a second epitope, followed by a constant region that comprises a second selected human IgG Cy3 region from I9G1, I9G2, IgG4 and a combination thereof, in which the second Ch3 region comprises a modification that reduces or eliminates the binding of the second Cy3 domain to protein A.
[00219] [00219] In one embodiment, the second Cy3 region comprises an H95R modification (by exon numbering IMGT; H435R by EU numbering). In another modality, the second Cy3 region also includes a Y96F modification (IMGT; Y436F by EU).
[00220] [00220] In one embodiment, the second Ch3 region is from a modified human IgG1, and further comprises a modification selected from the group consisting of D16E, L18M, N44S, K52N, V57M and V821 (IMGT; D356E, L358M, N384S, K392N , V397M and V422] by EU).
[00221] [00221] In one embodiment, the second Ch3 region is from a modified human IgG2, and further comprises a modification selected from the group consisting of N44S, K52N and V821 (IMGT; N384S, K392N and V422 | by EU).
[00222] [00222] In one embodiment, the second Cy3 region is a modified human IgG4, and further comprises a modification selected from the group consisting of Q15R, N448S, K52N, V57M, R69K, E79Q and V82! (IMGT; O355R, N384S, K392N, V397M, R409K, E419Q eV422 | by the EU).
[00223] [00223] A method for producing an epitope-binding protein that binds to more than one epitope is to immunize a first mouse according to the invention with an antigen comprising a first epitope of interest, in which the mouse comprises a region locus variable of the endogenous immunoglobulin light chain that does not contain a V, of endogenous mouse that is capable of rearrangement and formation of a light chain, where in the locus of the variable region of the endogenous mouse immunoglobulin light chain is a V region, single rearranged human operably linked to the mouse endogenous light chain constant region gene, and the rearranged human V region is selected from a human VK1-39JK5 and a human VK3-20JK1 and endogenous mouse V gene segments have been replaced totally or partially with human V gene segments, such that mouse heavy chains of immunoglobulin are heavy chains solely or substantially that co comprise human variable domains and constant mouse domains. When immunized, such a mouse will produce a reverse chimeric antibody, comprising only one of two variable domains of the human light chain (for example, one of human VK1-39JK5 or human VK3-20JK1). Once a B cell is identified encoding a Vy that binds to the epitope of interest, the nucleotide sequence of V, (and, optionally, the V,) can be recovered (for example, by PCR) and cloned into a expression construct in the structure with a constant domain of adequate human i- —munoglobulin. This process can be repeated to identify a second domain V, which binds to a second epitope, and a second gene sequence V, can be retrieved and cloned into an expression vector in the structure for a second constant domain adequate immunoglobulin. The first and second immunoglobulin constant domains can be the same or different isotopes and one of the immunoglobulin constant domains (but not the other) can be modified as described in this application or in US 2010 / 0331527A1, and the binding protein the epitope can be expressed in a suitable and isolated cell based on its differential affinity for Protein A when compared to a homodimeric protein that binds to the epitope, for example, as described in US 2010 / 0331527A1.
[00224] [00224] In one embodiment, a method for producing a bispecific protein that binds to the epitope is provided, comprising the identification of a first human Vy nucleotide sequence (Vy41) matured by affinity (for example, comprising one or plus somatic hypermutations) of a mouse as described in this application, identifying a second human, V (nucleotide V) nucleotide sequence matured by affinity (for example, comprising one or more somatic hypermutations) of a mouse.
[00225] [00225] A variety of human variable regions of affinity-matured antibodies originating against four different antigens have been expressed with their cognate light chain or with at least one of a human light chain selected from human V <k1-39JK5, VK3 Human -20JK1 or human VpreBJA5 (see Example 10). For antibodies to each of the antigens, heavy chains of different somatically mutated high affinity gene families successfully matched regions of rearranged human germline VK1-39JK5 and VK3-20JK1 and were secreted from cells that express heavy and light chains. For VK1-39JK5 and VK3-20JK1, the V domains, derived from the following V, human gene families expressed favorably: 1-2, 1-8, 1-24, 2-5, 3-7, 3-9, 3 -11, 3-13, 3-15, 3-20, 3-23, 3-30, 3-33, 3-48, 4-31, 4-39, 4-59, 5-51, and 6- 1. Thus, a mouse that is engineered to express a limited repertoire of V domains, human from one or both of VK1-39JK5 and VK3-20JK1 will generate a diverse population of V domains, human somatically mutated from a modified V4 locus to replace the gene segments V, from mouse by gene segments V, "human.
[00226] [00226] Mice genetically engineered to express chimeric reverse heavy chains (human variable, mouse constant) of immunoglobulin associated with a single rearranged light chain (for example, a VK1-39 / J or a VK3-20 / J), when immunized with an antigen of interest, generated B cells that comprised a diversity of V, human rearrangements and expressed a diversity of specific antibodies of high affinity for the antigen with diverse properties regarding its ability to block binding antigen to its ligand, and relative to its ability to bind to variants of the antigen (see Examples 14 through 15).
[00227] [00227] Thus, the mice and the methods described in this application are useful in creating and selecting variable domains of the human immunoglobulin heavy chain, including somatically mutated human heavy chain variable domains, which result from a diversity of rearrangements, which exhibit a wide variety of affinities (including exposure of a Kp of approximately one nanomolar or less), a wide variety of specificities (including
[00228] [00228] In one aspect, a first mouse comprising a variable region locus of the humanized heavy chain is reproduced with a second mouse comprising a nucleic acid sequence encoding a common, or universal, light chain locus as described in this application. In one embodiment, the first or second mouse comprises an ectopic nucleic acid sequence that encodes a mouse or ortholog or homologous ADAM6 or functional fragment thereof. The progeny are produced to obtain mice homozygous for a humanized heavy chain locus and homozygous for the universal light chain locus. In one embodiment, the first mouse or second mouse comprises a modification of an endogenous mouse light chain locus to provide the non-functional mouse light chain endogenous locus (eg, a deletion or a mouse, for example). example, of an endogenous locus À and / or x). In one embodiment, the first mouse comprises a replacement of all or substantially all of the endogenous functional mouse gene segments V, D and J by one or more non-rearranged human gene segments V, D and J (for example, all or substantially all functional human V, D and J gene segments); and the mouse comprises a replacement for all or substantially all functional V and J light chain gene segments with no more than one or no more than two rearranged V / J light chain sequences. In one embodiment, the first mouse further comprises an ectopic nucleic acid sequence that encodes a mouse ADAMG6 or ortholog or homologous or functional fragment thereof. In one embodiment, the nucleic acid sequence
[00229] [00229] In one embodiment, mice that comprise the ectopic sequence and that are homozygous for the universal chain light locus for the humanized heavy chain locus are immunized with an antigen of interest in generating antibodies that comprise a plurality of somatically mutated human variable domains that associate and express a universal light chain. In one embodiment, the human heavy chain variable domain nucleic acid sequences identified in the mouse are employed in an expression system to produce a fully human antibody comprising the human heavy chain variable domain and a light chain comprising a sequence of the universal light chain of the mouse.
[00230] [00230] The following examples are provided to describe those of ordinary skill in the art how to make and use the methods and compositions of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to the numbers used (eg quantities, temperature, etc.) but some experimental errors and deviations must be accounted for. Unless otherwise stated, the parts are parts by weight, the molecular weight is the average molecular weight, the temperature is indicated in Centigrade, and the pressure is atmospheric or close.
[00231] [00231] —Human and mouse bacterial artificial chromosomes (BACs) have been used to engineer 13 different BAC targeting vectors (BACvecs) for humanizing the human chain.
[00232] [00232] Mouse BACs that span the 5 'and 3' ends of the immunoglobulin heavy chain and light chain loci 'have been identified by hybridizing filters tagged with the BAC library or by clusters of DNA from the BAC library of mice PCR tracking dongle. The filters were hybridized under standard conditions using probes that corresponded to the regions of interest. The library clusters were screened by PCR using pairs of unique primers that flank the target region of interest. Additional PCR using the same primers was performed to deconvolve a given well and isolate the corresponding BAC of interest. Both BAC filters and library clusters were generated from 129 SvJ mouse ES cells (Incyte Genomics / Invitrogen). Human BACs that cover the heavy immunoglobulin heavy chain and light chain loci «have been identified by hybridizing filters tagged with the BAC library (Caltec tech B, C libraries, or D & RPCI-11 library, Research Genetics / Invitrogen) by tracking human BAC library clusters (Caltech library, Invitrogen) by a PCR-based method or using a BAC end sequence database (Caltech D library, TIGR). Construction of BACvecs (tables 1 and 2).
[00233] [00233] Homologous bacterial recombination (BHR) was performed as described (Valenzuela et a /., 2003; Zhang, Y., et al. (1998). A new logic for DNA engineering using recombination in Escherichia coli. Nat
[00234] [00234] A 3, V "and BACvec was constructed using three sequential BHR steps for the initial stage of humanization of the immunoglobulin heavy chain locus (FIG. 4A and Table 1). In the first stage (Step 1), a cassette was introduced into a human parental BAC upstream of human V, 1-3 gene segment that contains a region of homology to the mouse immunoglobulin heavy chain (HB1) locus, a gene that confers resistance to kanamycin in bacteria and the resistance to G418 in animal cells (kanR) and a site-specific recombination site (eg loxP). In the second step (Step 2), a second cassette was introduced only downstream of the last J segment, which contains a second region of homology for the mouse immunoglobulin heavy chain locus (HB2) and a gene that confers resistance in bacteria to spectinomycin (specR). This second step included the elimination of human immunoglobulin heavy chain locus sequences downstream of J1 6 and the chloramphenicol resistance gene of the BAC vector (cmR). In the third step (Step 3), the doubly modified human BAC (B1) was then linearized using | -Ceul sites that had been added during the first two steps and integrated into one
[00235] [00235] In a similar way, 12 additional BACvecs were targeted for the humanization of heavy chain and levex chain loci. In some instances, BAC binding was performed instead of BHR to unite two large BACs by introducing rare restriction sites in both parental BACvecs by BHR along with careful placement of selectable markers. This allowed survival of the desired binding product after selection with combinations of specific drug markers. Recombinant BACs obtained by binding after digestion with rare restriction enzymes were identified and screened in a similar manner to those obtained by BHR (as described above). Table 1 BACvec Stage Description Proximal human BAC upstream process in BAC CTD-257202 | 3hV "sante in proximal human CTD-257202 BAC Insert 3hV./27hDy./9hJ, in 3 mouse proximal BAC CT7-302a07 to create 3hV, BAC- | BHR female | Insert cassette into the distal end of the 1 IgH DC locus of mouse using | BHR BAC CT7-253i20 e) 3hV insertion gems, using BAC CTD-257202 ss at the upstream end of the 3hV insertion, Rel2-408p02 BAC (= 10 kb downstream of V, 2-5) Insert the site | -Ceu1 at the upstream end 4 of BAC Rel2408p02 (= 23 kb upstream from Vy1- | BHR 18) E fiseaas “Ee | Link 153kb from step 2 Trim human homology from the BAC deletion CTD-257202 = 85kb and leaving 65kb homology | BHR for 3hV, Insert cassette and Not site at the distal end 7 of the mouse IgH locus in CT7-253i20 | BHR
[00236] [00236] Targeting the ES cell (F1H4) was performed using the genetic engineering method VelociGene & as described (Valenzu- elaetal, 2003). Derivation of mice from ES cells modified by any blastocyte (Valenzuela et a /., 2003) or injection of 8 cells (Poueymirou et al., 2007) was as described. Different ES cells
[00237] [00237] Karyotype analysis was performed by Coriell Cellular Repositories (Coriell Institute for Medical Research, Camden, NJ). FISH was performed on targeted ES cells as described (Valenzuela et al., 2003). Probes corresponding to mouse BAC DNA or human BAC DNA were labeled by nick translation (Invitogen) with dUTP nucleotides fluorescently labeled in the orange or green spectrum (Vysis).
[00238] [00238] The humanization of the variable region of the heavy chain locus was achieved in nine sequential stages by the direct replacement of approximately three million base pairs (Mb) of the contiguous mouse genomic sequence that contains all the segments genes Vu, Dy and Ja with approximately one Mb of the contiguous human genomic sequence containing the equivalent human gene segments (FIG. 1A and Table 1) using VELOCIGENEPO genetic engineering technology (see, for example, Pat. US No 6,586,251 and Valenzuela et a /., 2003).
[00239] [00239] The intron between J gene segments, and constant region genes (the JC intron) contains a transcriptional enhancer (Neuberger, MS (1983) Expression and regulation of immunoglobulin heavy chain gene transfected into Iymphoid cells. EMBO J 2, 1373- 1378) followed by a region of simple repetitions required for recombination during isotype exchange (Kataoka, T. et al. (1980) Re-
[00240] [00240] A first insertion of the human immunoglobulin DNA sequence into the mouse was achieved using 144 kb of the proximal end of the human heavy chain locus that contains 3 human Vu, 27 Di and 9 J4 gene segments inserted at the end. of proximal to the mouse IgH locus, with a concomitant deletion of 16.6 kb from the mouse genomic sequence, using approximately 75 kb of mouse homology arms (Eta-
[00241] [00241] Targeted ES cells from Step A were re-targeted with a BACvec that produced a 19 kb deletion at the distal end of the heavy chain locus (Step B, FIG. 2A). The BACvec of Step B contained a hygromycin resistance gene (hyg) in contrast to the neomycin resistance gene (neo) contained in the BACvec of Step A The resistance genes of the two BACvecs were designed such that, after successful targeting same chromosome, approximately three Mb of the mouse heavy chain variable gene locus containing all gene segments V, mouse besides Vy1-86 and all gene segments D, in addition to DQS5 2, as well as the two resistance genes, were flanked by loxP sites; DQ52 and all of the mouse J chain gene segments were deleted in Step A cell clones. Double cell ES clones on the same chromosome were identified by conduction of the 3hV proximal cassette to homozygosity in G418 high-grade (Mortensen, RM et a /. (1992) Production of homo-
[00242] [00242] The remainder of the variable region of the human heavy chain was added to the 3hVy allele in a series of 5 steps using the genetic engineering method Velocigene & (Steps EH, FIG. 2B), with each step involving exact insertion of up to 210 kb of sequences human genes. For each step, the proximal end of each new BACvec was designed to overlap with most of the distal human sequences from the previous step and the distal end of each new BACvec contained the same distal region of the mouse homology as used in Step A. The BACvecs from steps D, F and H contained neo selection cassettes, while those from steps E and G contained hyg selection cassettes, so the selections were switched between G418 and hygromycin. Targeting in Step D was analyzed for the loss of the single pcr product through the distal loxP site of the
[00243] [00243] The variable region of the K «light chain was humanized in eight sequential steps by directly replacing approximately three Mb of the mouse sequence containing all the VKe JK gene segments with approximately 0.5 Mb of the human sequence containing the gene segments VK and JK in a manner similar to that of the heavy chain (FIG. 1B; Tables 2 and 4).
[00244] [00244] The variable region of the human K light chain locus contains two nearly identical 400 kb repeats separated by an 800 kb spacer (Weichhold, GM et a /. (1993) The human immunoglobulin kappa locus consists of two copies that are organized in oppo-site polarity, Genomics 16: 503-511). Since the repetitions are so similar, almost all the diversity of loci can be reproduced in mice using proximal repetition. In addition, a natural human allele of the light chain locus «that has no distal repetition has been reported (Schaible, G. et a /. (1993) The immunoglobulin kappa locus: polymorphism and haplotypes of Caucasoid and non-Caucasoid individuals , Hum Genet 91: 261-267). Approximately three Mb of the mouse 'light chain variable gene sequence has been replaced by approximately 0.5 Mb of the human K light chain variable gene sequence to effectively replace all mouse VK and JK gene segments with all VK gene segments. and human JK (FIG. 2C and 2D; Tables 2 and 4). In contrast to the method described in Example 1 for the heavy chain locus, the entire mouse VK gene region, containing all the VK and JK gene segments, was deleted in a three-step process before any human sequence was added. First, the neo cassette was introduced at the proximal end of the variable region (Step A,
[00245] [00245] A human genomic fragment of approximately 480 kb in size containing the variable region of the entire immunoglobulin K «light chain was inserted in four sequential steps (FIG. 2D; Tables 2 and 4), with up to 150 kb of sequence of the human immunoglobulin K 'light chain inserted in a single step, using methods similar to those employed for the heavy chain (see Example 1). The final hygromycin resistance gene was removed by transient FLPe expression. As with the heavy chain, the target ES cell clones were evaluated for the integrity of the entire human insert, normal karyotype and germline potential after each step.
[00246] [00246] At various points, ES cells carrying a portion of the human immunoglobulin heavy chain or variable K light chain repertoires as described in Example 1 were microinjected and the resulting mice created to create multiple versions of VeloclmmuneO humanized mice with fractions progressively larger than human germline immunoglobulin repertoires (Table 5; FIG. 5A and 5B). VelocimmuneêO 1 (V1) humanized mice have 18 human Vy gene segments and all human Di and J4 gene segments combined with 16 human VK gene segments and all human JK gene segments. VeloclmmuneO 2 (V2) humanized mice and Veloclmmune & (V3) humanized mice increased the variable repertoires that carry a total of 39 V, and 30 VK and 80 V, and 40 VK respectively. Since the genomic regions encoding the V, mouse, Di and Ju gene segments, and the VK and JK gene segments, have been completely replaced, the antibodies produced by any version of humanized Velo-clomuneêO mice contain regions human variables linked to constant mouse regions. The mouse A light chain loci remain intact in all versions of the humanized VelocIimmuneO mice and serve as a comparator of the expression efficiency of various humanized Veloclmmunnel K light chain loci.
[00247] [00247] The double homozygous mice for both immunoglobulin heavy chain and K light chain humanizations were generated from a subset of the alleles described in Example 1. All genotypes observed during the improvement course to generate the doubly homozygous mice occurred
[00248] [00248] The populations of mature B cells in three different versions of Veloclmmuneã € 6 mice were evaluated by flow cytometry.
[00249] [00249] "Briefly, cell suspensions of bone marrow, spleen and thymus were made using standard methods. The cells were resuspended in 5x10º cells / mL in BD Pharmingen FACS labeling buffer, blocked with anti-CD16 / 32 mouse cells (BD Pharmingen), marked with the appropriate antibody cocktail and fixed with BD CYTOFIX'Y all according to the manufacturer's instructions.The final cell precipitates were resuspended in 0.5 mL of labeling buffer and analyzed using BD FACSCALI | - BUR'Y and the CELLQUEST BD Pro'Y program All antibodies (BD Pharmingen) were prepared in a mass / cocktail dilution and added to a final concentration of 0.5 mg / 10º of cells. antibodies for bone marrow (AD) labeling were as follows: A: anti-mouse IgMb-FITC, anti-mouse IgMa-PE, anti-mouse CD45R (B220) -APC; BB: anticCD43 (S7) -Mouse PE, anti-CD45R (B220) -Mouse APC; C: anti-CD24 (HSA) -Mouse PE; ant mouse i-CD45R (B220) -APC; D: mouse anti-BP-1-PE, mouse anti-CDA45R (B220) -APC. The antibody cocktails for spleen and inguinal lymph node (E-H) labeling were as follows: E: mouse anti-lgMb-FITC, mouse anti-lgMa-PE, mouse anti-CDA45R (B220) -APC; F: anti-mouse Ig, light chain M, A2, A3-FITC, anti-mouse IgK light chain-PE, anti-CD45R (B220) -APC mouse; G: mouse anti-Ly8G / C-FITC, mouse anti-CD49b (DX5) -PE, mouse anti-CD11b-APC; H: mouse anti-CD4 (L3T4) -FITC, mouse anti-CDA45R (B220) -PE, mouse anti-CD8a-APC.
[00250] [00250] Lymphocytes isolated from spleen or lymph node from homozygous VeloclmmuneO human mice were marked for the superficial expression of B220 and IgM markers and analyzed using
[00251] [00251] The ability to maintain allelic exclusion was examined in heterozygous mice for different versions of the humanized immunoglobulin heavy chain locus.
[00252] [00252] The humanization of the immunoglobulin locide was performed in an F1 ES lineage (F1H4 (Valenzuela et al., 2003)), derived from 129S6 / SvEvTac and C57BL / 6NTac heterozygous embryos. The germline variable gene sequences of the human heavy chain are directed to the 12986 allele, which carries the IgMa haplotype, whereas the C576BL / 6N unmodified mouse allele supports the IgMb haplotype. These allele forms of IgM can be distinguished by flow cytometry using antibodies specific for the polymorphisms found in the IgMb or IgMa alleles. As shown in FIG. 6 (lower row), B cells identified in heterozygous mice for each version of the humanized heavy chain locus only express a single allele, IgM (humanized allele) or IgM "(wild allele). This demonstrates that the mechanisms involved in allelic exclusion are intact in humanized mice Veloclmmune € O. In addition, the relative number of B cells positive for the humanized allele (IQM ) is approximately proportional to the number of gene segments V present.The humanized immunoglobulin locus is expressed in approximately 30% of the B cells in humanized heterozygous mice Ve- loclmmuneO 1, which has 18 human V gene segments, and in 50% of the B cells in VelocIimmuneGO 2 and 3 (not shown) humanized heterozygous mice, with 39 and 80 human V gene segments, respectively. Notably, the proportion of cells expressing the humanized allele against that of the wild mouse (0.5 to VeloclmmuneO 1 and 0.9 humanized mice for VeloclmmuneO 2) humanized mice is greater than the
[00253] [00253] The polymorphisms of the CK regions are not available in 129S6 or C57BL / 6N to examine the allelic exclusion of humanized versus non-humanized K light chain loci. However, VELOCIMMUNEO humanized mice all have the wild mouse
[00254] [00254] Since populations of mature B cells in humanized VeloclmmuneO mice resemble those of wild mice (described above), it is possible that defects in the first B cell differentiation are compensated by the expansion of cell populations Ripe B. Various stages of B cell differentiation have been examined by analyzing B cell populations using flow cytometry. Table 6 shows the proportion of cell fractions in each B cell lineage defined by FACs, using specific cell surface markers, in human VeloclmmuneO mice compared to elements from the same wild nest.
[00255] [00255] Early B cell development occurs in the bone marrow, and different stages of B cell differentiation are characterized by changes in types and amounts of cell surface marker expression. These differences in surface expression are correlated with the molecular changes that occur in the immunoglobulin loci within the cell. The transition from pro-B to pre-B cells requires successful rearrangement and expression of the functional heavy chain protein, while the transition from pre-B to mature B stage is governed by correct rearrangement and expression of a K or A light chain. Thus, the inefficient transition between stages of B cell differentiation can be detected by changes in the relative populations of B cells at a given stage. Table 6 Spleen Bone Marrow Version DO É and mouse pro-B pre-B Immature Emerging Mature Mature Velocimmu- - cpa43 "cD24" B220º B220 "B220" B220hi neO B220º B220º IgM Ign * in IgM + 1gD THE
[00256] [00256] No major defect was observed in B cell differentiation in any of the humanized VeloclMmune € 8 mice. The introduction of human heavy chain gene segments does not appear to affect the transition from pro-B to pre-B, and the introduction of human k light chain gene segments does not affect the transition from pre-B to B in humanized mice VeloclmMmune € . This demonstrates that "chimeric reverse" immunoglobulin molecules that have human variable and constant mouse regions function normally in the context of B cell signaling and co-receptor molecules that lead to appropriate B cell differentiation in a mouse environment. In contrast, the balance between different populations during B cell differentiation is disturbed to varying lengths in mice that contain randomly integrated immunoglobulin transgenes and inactivated endogenous heavy chain or K light chain loci (Green and Jakobovits (1998) ). Example IV Variable Gene Repertory in Humanized Immunoglobulin Mice
[00257] [00257] The use of human variable gene segments in the humanized antibody repertoire of humanized Velo-clmmuneêO mice was analyzed by the polymerase chain reaction with reverse transcriptase (RT-PCR) of human variable regions from multiple sources including cells hybridoma and splenocytes. The sequence of the variable region, the use of the gene segment, the somatic hypermutation and the junctional diversity of gene segments from the variegated region were arranged.
[00258] [00258] Briefly, total RNA was extracted from 1 x 10 / -2 x 10 splenocytes or approximately 10 * -10º hybridoma cells using TRIizol "" (Invitrogen) or Qiagen RNeasy'Y Mini Kit (Qiagen) and in- vestigated with specific primers from the mouse constant region using Superscript'Y “Ill ONe-Step RT-PCR (Invitogen) system. Reactions were performed with 2-5 μl of RNA from each sample using specific 3 'primers listed above paired with leader primers grouped from each family of human variable regions of both the heavy and light chain K' separately. The volumes of reagents and primers and RT-PCR / PCR conditions were performed according to the manufacturer's instructions. The primer sequences were based on multiple sources (Wang, X and Stollar, BD (2000) Human immunoglobulin variable region gene analysis by single cell RT-PCR, J Immunol Methods 244: 217-225; 1g- primer sets , Novagen). Where appropriate, nested secondary PCR reactions were performed with family-specific framework primers grouped together and the same specific 3 'mouse immunoglobulin constant primer used in the primary reaction. The aliquots (5 uL) of each reaction were analyzed by agarose electrophoresis and the reaction products were purified on agarose using a MONTAGEY Gel Extraction Kit (Millipore). The purified products were cloned using the TOPOTY TA Cloning System (Invitrogen) and transformed into E.coli DH10R cells by electroporation. Individual clones were selected from each transformation reaction and cultured in 2 mL of LB broth cultures with antibiotic selection overnight at 37ºC. Plasmid DNA was purified from bacterial cultures by a kit-based approach (Qiagen). Use of Variable Immunoglobulin Gene.
[00259] [00259] Plasmid DNA from both heavy and light chain K 'clones was sequenced with T7 or M13 antisense primers on the ABI 3100 Genetic Analyzer (Applied Biosystems). The raw sequence data was imported into Sequencher'Y (v4.5, Gene Codes). Each sequence was assembled in contiguous and aligned to human immunoglobulin sequences using the IMGT V-Quest search function (Brochet, X. et a /. (2008) IMGT / V-QUEST: the highly customized and integrated system for IG and TR standardized VJ and VDJ sequence analysis (Nucleic Acids Res 36: W503-508) to identify use of human Vu, Du, Ja and VK, JK segments. The sequences were compared with somatic hypermutation germline sequences and recombination link analysis.
[00260] [00260] The mice were generated from ES cells that contain the modification of the initial heavy chain (Allele Hybrid 3hV, -CRE, background of FIG. 2A) by RAG complementation (Chen, J. et al. (1993) RAG-2- deficient blastocyst complementation: an assay of gene function in Iymphocyte development, Proc Natl Acad Sci USA 90: 4528-4532), and CDNA was prepared from splenocyte RNA. The cDNA was amplified using sets of primers (described above) specific for the predicted chimeric heavy chain MRNA that would arise alongside the V (D) J recombination within the inserted human gene segments and subsequent replication to the IgM or IgG constant domains. mouse. The sequences derived from these cDNA clones (not shown) demonstrated that the appropriate V (D) J recombination had occurred within the human variable gene sequences, that the rearranged human V (D) J gene segments were appropriately stranded in the structure for domains mouse constants and that class exchange recombination had taken place. Additional sequence analysis of subsequent hybrid immunoglobulin mMRNA products was performed.
[00261] [00261] In a similar experiment, unimmunized wild B cells and humanized VeloclmmuneO mice were separated by flow cytometry based on the superficial expression of B220 and IgM or IgG. B220 * IgM * or superficial “IgG (sIgG”) cells were pooled and V, and VK sequences were obtained after amplification by RT-PCR and cloning (described above). The use of the representative gene in a set of RT-PCR amplified cCDNAs from unimmunized VeloclmmuneO 1 humanized mice (Table 7) and Veloclmmune € 6 3 humanized mice (Table 8) was recorded (“defective RSS; + does not have or pseudogene).
[00262] [00262] “As shown in Tables 7 and 8, almost all of the functional human gene segments Vu, Du, Ju, VK and JK are used. Of the functional variable gene segments described but not detected in humanized VELOCIMMUNEPO mice in this experiment, several have been reported to have incorrect recombination signal sequences (RSS) and thus would not be expected to be expressed (Feeney, AJ (2000) Factors that influence formation of B cell repertoire, Immunol Res 21: 195-202). The analysis of several other sets of immunoglobulin sequences from several humanized VELOCIMMUNEG mice, isolated from both naive and immunized repertoires, showed the use of these gene segments, albeit at lower frequencies (data not shown). The aggregated genetic use data showed that all functional human gene segments Vu, Du, Jun, VK and JK contained in humanized VeloclMmmuneO mice were observed in several naïve and immunized repertoires (data not shown). Although the human V17-81 gene segment has been identified in the analysis of human heavy chain locus sequences (Matsuda, F. et a /. (1998) The complete nucle-
[00263] [00263] It is known that the sequences of the heavy and light chains of antibodies show exceptional variability, especially in short polypeptide segments within the rearranged variable domain. These regions, known as hypervariable regions or complementary determination regions (CDRs) create the antigen binding site in the structure of the antibody molecule. The intervening polypeptide sequences are called framework regions (FRs). There are three CDRs (CDR1, CDR2, CDR3) and 4 FRs (FR1, FR2, FR3, FRA4) in both heavy and light chains. A CDR, CDR3, is unique in that this CDR is created by the recombination of both Vu, Dy and J4 and VK and JK gene segments and generates a significant amount of repertoire diversity before the antigen is found. This junction is inaccurate both due to nucleotide deletions through exonuclease activity and due to template-encoded additions through terminal deoxynucleotidyl transferase (TdT) and thus allows new sequences to result from the recombination process. Although FRs may show substantial somatic mutation due to the high mutability of the variable region as a whole, the variability is not, however, distributed equally across the variable region. The CDRs are concentrated and the localized regions of high variability on the surface of the antibody molecule that allow | antigen binding. Heavy chain and light chain sequences of antibodies selected from humanized Velo-clMmuneO mice around the CDR3 binding that manifests junctional diversity are shown in FIG. 7A and 7B, respectively.
[00264] [00264] As shown in FIG. 7A, nucleotide additions complicated without mold (N-additions) are observed in both Vn.Dy and Dy-J4 coupling in humanized mouse antibodies VeloclmmuneGO, indicating the appropriate TdT function with the segments humans. The parameters of segments Vu, Dy and J4 in relation to their germline counterparts indicate that exonuclease activity also occurred. Unlike the heavy chain locus, the rearrangements of the human K light chain exhibit little or no addition of TdT to CDR3, which is formed by the recombination of VK and JK segments (FIG. 7B). This is expected due to the lack of TdT expression in mice during light chain rearrangements in the transition from pre-B to B cell. The diversity observed in CDR3 of rearranged human VK regions is introduced predominantly through exonuclease activity. during the recombination event. Somatic Hypermutation.
[00265] [00265] “Additional diversity is added to the variable regions of immunoglobulin genes rearranged during the germinal reaction by a process called somatic hypermutation. B cells expressing somatically mutated variable regions compete with other B cells for access to the antigen presented by follicular dendritic cells. Those B cells with the highest affinity for the antigen will expand further and undergo a class change before leaving the periphery. Thus, B cells that express switched isotypes typically found the antigen and underwent germinal reactions and will have increased numbers of mutations compared to naive B cells. In addition, the predominantly naive B cell variable region sequences would be expected to have relatively fewer mutations than the variable sIgG * cell sequences that underwent antigen selection.
[00266] [00266] The sequences from random clones of V, or VK of slgM * or sIgG * B cells of unimmunized Veloclmunee humanized mice or sIgG * B cells of immunized mice were compared with their variable gene segments from | germination line and changes in the observed germ line sequence. The resulting nucleotide sequences were translated in silico and mutations that lead to amino acid modifications also observed. The data were compared from all variable regions and the percentage variation in a given position was calculated (FIG.8).
[00267] [00267] “As shown in FIG. 8, the variable regions of the human heavy chain derived from unimmunized VelocimmuneO B mouse cells sIgG * exhibit many other nucleotides as regards sIgM * cells from the same clusters of spleens and variable regions of the heavy chain derived from immunized mice exhibit even more modifications. The number of modifications is increased in the complementarity determination regions (CDRs) as for the framework regions, indicating the selection of antigen. The corresponding amino acid sequences of the variable regions of the human heavy chain also exhibit significantly higher numbers of mutations in IgG against IgM and even more in immunized IgG. These mutations again appear to be more frequent in CDRs compared to framework sequences, suggesting that antibodies were selected from the antigen in vivo. A similar increase in the number of nucleotide and amino acid mutations is seen in the VK sequences derived from IgG * B cells of immunized mice.
[00268] [00268] The gene use and somatic hypermutation observed in humanized mice Veloclmmune & demonstrate that essentially all the gene segments present are capable of rearranging
[00269] [00269] The visible structures of the spleen, inguinal lymph nodes, Peyer's plaques and thymus tissue samples from wild or humanized Veloclmmune & H&E-labeled mice were examined by optical microscopy. The levels of immunoglobulin isotypes in serum collected from wild and humanized Veloclmmune & G mice were analyzed using the Luminex '"Y, Lymphoid Organ Structure technology.
[00270] [00270] The structure and function of lymphoid tissues are partly dependent upon the appropriate development of hematopoietic cells. A defect in the development or function of B cells can be seen as a change in the structure of lymphoid tissues. After analysis of marked tissue sections, no significant difference in the appearance of secondary lymphoid organs between wild and humanized mice VeloclMmuneP € was identified (data not shown).
[00271] [00271] The expression level of each isotype is similar in wild and humanized VeloclmmuneO mice (FIG. 9A, 9B and 9C).
[00272] [00272] Different versions of humanized Velo-clmmuneê6 mice were immunized with the antigen to examine the humoral response to the foreign antigen challenge. Immunization and Hybridoma Development.
[00273] [00273] “VeloclmmuneO humanized and wild mice can be immunized with an antigen in the form of protein, DNA, a combination of DNA and protein or cells that express the antigen. Animals are typically stimulated every three weeks for a total of two to three times. After each antigen stimulus, serum samples from each animal are collected and analyzed for antibody responses specific to the antigen by determining the serum titer. Before fusion, the mice received a final pre-fusion stimulus of 5 µg of protein or DNA, as desired, through intraperitoneal and / or intravenous injections. Splenocytes are collected and fused to Ag8.653 myeloma cells in an electrofusion chamber according to the manufacturer's suggested protocol (Cyto Pulse Sciences Inc., Glen Burnie, MD). Ten days after culture, hybridomas are screened for antigen specificity using an ELISA assay (Harlow, E. and Lane, D. (1988) Antibodies: À Laboratory Manual. Cold Spring Harbor Press, New York). Alternatively, antigen-specific B cells are isolated directly from immunized VeloclmmuneO humanized mice and screened using standard techniques, including those described here, to obtain specific human antibodies to an antigen of interest. Determination of Serum Titer.
[00274] [00274] To monitor the antigen antigen response of animals, serum samples are collected approximately 10 days after each stimulus and titers are determined using the specific ELISA antigen. Briefly, 96-well Nunc Max-Sorp'Y plates are coated with 2 µg / mL antigen overnight at 4 ° C and blocked with bovine serum albumin (Sigma, St. Louis, MO). Serum samples in serial dilutions of 3 times are allowed to bind to the plates for one hour at room temperature. Plates are then washed with PBS containing 0.05% Tween-20 and bound IgG is detected using HRP-conjugated goat anti-Fc mouse (Jackson Immuno Research Laboratories, Inc., West Grove, PA) for the title of total IgG, or for polyclonal antibodies specific for biotin-labeled isotype or specific for light chain (SouthernBiotech Inc.) for specific isotype titers, respectively. For biotin-labeled antibodies, after washing the plate, HRP-conjugated streptavidin (Pierce, Rockford, IL) is added. All plates are developed using colorimetric substrates like BD OptEIA '"“ (BD Biosciences Pharmingen, San Diego, CA). After the reaction is stopped with 1 M phosphoric acid, the optical absorption at 450 nm is recorded and the data are analyzed using the Graph Pad's Prism “program. Dilutions required to obtain a double background signal are defined as the title.
[00275] [00275] In one experiment, humanized Velo-clMmuneGO mice were immunized with human interleukin-6 receptor (hIL-6R). A representative set of Veloclmuneune serum titers and wild mice immunized with hlL-6R is shown in FL.10.10 and 10B.
[00276] [00276] “VeloclmmuneO and wild humanized mice mounted strong responses towards IL-6R with similar title ranges (FIG. 10A). Several cohorts of humanized VeloclmMmuneê and wild mice achieved maximum response after a single antigen stimulus. These results indicate that the strength of the immune response and the kinetics to this antigen were similar in humanized VeloclmmuneO and wild mice. These antigen-specific antibody responses were further analyzed to examine the particular isotypes of the antigen-specific antibodies found in sera. Both groups of humanized VeloclmmuneOse and wild ones predominantly elicited an IgG1 response (FIG. 10B), suggesting that the class change during the humoral response is similar in mice of each type. Determination of Antibody Binding Affinity to Antigen in Solution.
[00277] [00277] A solution competition assay based on ELISA is typically designed to determine the binding affinity of the antibody to the antigen.
[00278] [00278] “Briefly, the antibodies in the conditioned medium are mixed well before use with serial dilutions of the antigen protein ranging from 0 to 10 mg / mL. The antibody and antigen mixing solutions are then incubated for two to four hours at room temperature until the equilibrium of binding is achieved. The amounts of the free antibody in the mixtures are then measured using a quantitative sandwich ELISA. Ninety-six Maxisorb 'Y plates (VWR, West Chester, PA) are coated with 1 vg / mL antigen protein in PBS solution overnight at 4 ° C followed by non-specific BSA block. The antibody-antigen mixing solutions are then transferred to these plates followed by incubation for one hour. The plates are then washed with washing buffer and the
[00279] [00279] In one experiment, humanized Velo-clmmune8O mice were immunized with hlL-6R (as described above). FIG. 11A and 11B show a representative set of affinity measures of anti-hiL6R antibodies from humanized and wild-type mice.
[00280] [00280] After the immunized mice receive a third antigen stimulus, serum titers are determined by ELISA. Splenocytes are isolated from selected cohorts of wild and humanized Veloclmmune8 mouse and fused with Ag8.653 myeloma cells to form hybridomas and cultured under selection (as described above). Of a total of 671 anti-IL-6R hybridomas produced, 236 were found to express specific antibodies to the antigen. Means collected from positive antigen wells were used to determine the affinity of antibody binding to the antigen using a competition ELISA solution. Antibodies derived from humanized VeloclmmuneO mice exhibit a wide range of affinity in binding to the antigen in solution (FIG. 11A). In addition, 49 of 236 anti-IL-6R hybridomas were found to block IL-6 from binding to the receptor in an in vitro bioassay (data not shown). In addition, these 49 anti-IL-6R blocking antibodies exhibited a range of high solution affinities similar to that of blocking antibodies derived from the parallel immunization of wild mice (FIG. 11B). Example VIl Construction of a Mouse ADAM6 Targeting Vector
[00281] [00281] A targeting vector for insertion of mouse A-DAM6a and ADAM6b genes into a humanized heavy chain locus was constructed using VELOCIGENEPGO genetic engineering technology (supra) to modify the Artificial Bacillus chromosome (BAC) 929d24 obtained from Dr. Fred Alt (Harvard University). BAC 929d24 DNA was engineered to contain genomic fragments containing mouse ADAM6a and ADAM6b genes and a hygromycin cassette for targeted deletion of a human ADAMG6 pseudogene (hADAM6Y) located between the human VyH1-2 and V46-1 gene segments of the chain locus humanized heavy weight (FIG. 12).
[00282] [00282] First, a genomic fragment containing the mouse ADAM6b gene, sequence of -800 bp upstream (5 ') and sequence of -4800 bp downstream (3') was subcloned from the BAC clone 929d24. A second genomic fragment containing the mouse A-DAM6a gene, sequence of -300 bp upstream (5 ') and sequence of -3400 bp downstream (3'), was separately subcloned from clone BAC 929d24. Two genomic fragments containing mouse ADAMG6b and ADAM6a genes were linked to a hygromycin cassette flanked by Frt recombination sites to create the targeting vector (Mouse ADAM6 Targeting Vector, Figure 20; SEQ ID NO: 3 ). Different restriction enzyme sites have been engineered for the 5 'end of the targeting vector
[00283] [00283] A separate modification was made to a BAC clone containing a replacement of the mouse heavy chain locus with the human heavy chain locus, including the human A-DAMG6 pseudogene located between the human gene segments Vh1-2 and V46- 1 of the humanized locus of the subsequent binding of the mouse ADAMG6 targeting vector (FIG. 13).
[00284] [00284] Briefly, a neomycin cassette flanked by recombination / loxP sites was engineered to contain homology arms containing the human genomic sequence at the 3 'positions of the human Vy1-2 gene segment (5' relative to DADAM6Y) and 5 'from gene segment V, 6-1 human (3 'relative to DADAM6Y; see my day FIG. 13). The position of the insertion site of this targeting construct was approximately 1.3 kb 5 'and -350 bp 3' of the human ADAM6 pseudo-dogene. The targeting construct also included the same restriction sites as the mouse ADAMG6 targeting vector to allow subsequent BAC binding between the modified BAC clone containing the deletion of the human ADAMG6 pseudogene and the mouse ADAM6 targeting vector.
[00285] [00285] Following the digestion of BAC DNA derived from both constructs, the genomic fragments were ligated together to construct a engineered BAC clone containing a humanized heavy chain locus containing an ectopically placed genomic sequence comprising ADAM6a and nucleotide sequences A- Mouse DAMG6b. The final targeting construct for the deletion of a human ADAM6 gene within a humanized heavy chain locus and the insertion of the mouse ADAM6a and ADAM6b sequences into contained ES cells, from 5 'to 3', a genetic fragment
[00286] [00286] The engineered BAC clone (described above) was used to electroporate mouse ES cells that contained a humanized heavy chain locus to modified ES cells created comprising an ectopically placed mouse genomic sequence comprising the ADAM6a and ADAMG6b sequences of mouse inside a humanized heavy chain locus. Positive ES cells containing the ectopic mouse genomic fragment within the humanized heavy chain locus were identified by a quantitative PCR assay using TAQMANTY probes (Lie, YS and Petropoulos, CJ (1998) Advances in quantitative PCR techno logy : 5'nuclease assays, Curr Opin Biotechnol 9 (1): 43-48). The regions upstream and downstream outside the modified portion of the humanized heavy chain locus were confirmed by PCR using primers and probes located within the modified region to confirm the presence of the ectopic mouse genomic sequence within the heavy chain location. humanized as well as the hygromycin cassette. The nucleotide sequence through the upstream insertion point included the following, which indicates the genomic sequence of the human heavy chain upstream of the insertion point and a | -Ceu restriction site
[00287] [00287] The target ES cells described above were used as donor ES cells and introduced into an 8 cell stage mouse embryo by the VELOCIMOUSEGO mouse engineering method (see, for example, US Pat. No. 7,6598,442,
[00288] [00288] Mice carrying a humanized heavy chain locus containing the mouse ADAM6a and ADAM6b genes are reproduced for a deleting FLPe mouse strain (see, for example, Rodríguez, Cl et al. (2000) High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nature Genetics 25: 139-140) in order to remove any FRTed hygromycin cassette introduced by the targeting vector that is not removed, for example, in the ES cell stage or in the embryo . Optionally, the hygromycin cassette is preserved in the mice.
[00289] [00289] The pups are genotyped and a puppy heterozygous for a humanized heavy chain locus that contains an ectopic mouse genomic fragment that comprises the mouse ADAM6a and ADAM6b sequences are selected to characterize the gene expression of mouse ADAM6 and fertility. Example VIII Characterization of ADAM6 rescue mice Flow cytometry.
[00290] [00290] Three mice with 25 weeks of age homozygous variable human heavy chain K and human K light (H / k) and three mice with 18-20 weeks of age homozygous for the human Kk light chain and human heavy ge - ectopic mouse nomic encoding the ADAM6a and A-DAMG6b mouse genes within both alleles of the human heavy chain locus (H / K-A6) were sacrificed for identification and analysis of lymphocyte cell populations by FACs on the BD LSR 1 System! (BD Bioscience). Lymphocytes were monitored for specific cell lines and analyzed for progression through various stages of B cell development. The tissues collected from the animals included blood, spleen and bone marrow. The blood was collected
[00291] [00291] To mark cell populations, 1 x 10 th cells from various tissue sources were incubated with mouse anti-CD16 / CD32 (2.4G2, BD Biosciences) on ice for 10 minutes, followed by one or one combination of the following antibody cocktails for 30 min on ice.
[00292] [00292] “Bone marrow: mouse anti-FITOC-CD43 (1B11, BiLegend), PE-ckit (2B8, BioLegend), PeCy7-IgM (11/41, eBioscience), PerCP-Cy5.5-lgD ( 11-26c.2a, BioLegend), APC-eFluor780-B220 (RA3- 6B2, eBioscience), A700-CD19 (1D3, BD Biosciences).
[00293] [00293] Peripheral blood and spleen: mouse anti- PHYTO- (187.1, BD Biosciences), PeA (RML-42, BioLegend), PeCy7-IgM (11/41, eBioscience), PerCP-Cy5.5-l9D ( 11-26c.2a, BioLegend), APC-CD3 (145-2C11, BD), A700-CD19 (1D3, BD), APC-eFluor780-B220 (RA3- 6B2, eBioscience). Following incubation with the labeled antibodies, the cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on an LSRII flow cytometer and analyzed with FlowJo. Results from a representative H / k and H / Kk-A6 mouse are shown in FIGS. 14-18.
[00294] [00294] The results demonstrate that B cells progress through H / K-A6 mice through the stages of B cell development in a similar way to H / K mice in bone marrow and peripheral compartments, and show normal models of maturation once they enter the periphery. H / K-A6 mice demonstrated an increased population of CD43intcD19 * cells when compared to H / K mice (FIG. 16B). This can indicate an accelerated IgM expression of the humanized heavy chain locus that contains an ectopic mouse genomic fragment comprising mouse ADAM6a and ADAM6b sequences in H / K-A6 mice. In the periphery, populations of Be T cells from H / K-A6 mice appear normal and similar to H / K mice.
[00295] [00295] To determine whether infertility in mice having humanized immunoglobulin heavy chain variable loci is due to defects in the testis and / or sperm production, testis morphology and sperm content of the epididymis was examined.
[00296] [00296] Briefly, testicles of two groups of five mice per group (Group 1: homozygous mice for variable heavy and light chain K loci, mADAM6 ”; Group 2: heterozygous mice for variable genetic loci of the heavy chain and homozygotes for variable k loci of the light chain k mADAM6 *) were dissected with the intact and heavy epididymis. The specimens were then fixed, embedded in paraffin, sectioned and marked with a hematoxylin and eosin marker (HE). Sections of testicles (2 testicles per mouse, for a total of 20) were examined for defects in morphology and evidence of sperm production, while sections of epididymis were examined for the presence of sperm.
[00297] [00297] In this experiment, no difference in testicle weight or morphology was observed between mADAM6 ”mice and mADAM6 * mice. Sperm was observed in all genotypes, both in the testicles and in the epididymis. These results
[00298] [00298] Mice without other members of the ADAM gene family are sterile due to defects in motility or sperm migration. Sperm migration is defined as the ability of sperm to pass from the uterus to the oviduct and is usually necessary for fertilization in mice. To determine whether deletion of mouse ADAM6a and ADAM6b affect this process, sperm migration was assessed in mADAMG6 mice ”. Sperm motility was also examined.
[00299] [00299] Briefly, the sperm was obtained from the testicles of (1) heterozygous mice for variable human loci of the human chain and homozygous for variable loci of the human K light chain (ADAM6 *); (2) mice homozygous for variable human heavy chain loci and homozygous for variable human K light chain loci (ADAM6 ”); (3) mice homozygous for variable human heavy chain loci and homozygous for 'wild' (ADAM6 ”mk) light chain; and, (4) wild mice C57 BL / 6 (WT). No significant abnormalities were observed in sperm count or total sperm motility by inspection. For all mice, cumulus dispersion was observed, indicating that each sperm sample was able to penetrate the cumulus cells and connect to the pellucid zone in vitro. These results establish that ADAM6 * mice have sperm that are capable of penetrating the cumulus and attaching to the pellucid zone.
[00300] [00300] Fertilization of mouse eggs in vitro (in vitro fertilization) was done using mouse sperm as described above. A slightly lower number of cleaved embryos was present for ADAM6 ”one day after in vitro fertilization, as well as a reduced number of sperm bound to the eggs. These results establish that sperm from ADAMG6 mice ”, once exposed to an egg, are able to penetrate the cumulus and bind to the pellucid zone.
[00301] [00301] In another experiment, the ability of ADAM6 mice 'sperm to migrate from the uterus and through the oviduct was determined in a sperm migration assay.
[00302] [00302] Briefly, a first group of five female superovulated mice were exposed to five ADAM6 males ”. A second group of five female superovulated mice were exposed to five ADAM6 ”* males”. The mating pairs were observed for copulation, and post-copulation for five to six hours, the uterus and the connected oviduct of all females were removed and washed for analysis. Washing solutions were checked for eggs to check ovulation and obtain a sperm count. Sperm migration was assessed in two different ways. First, both oviducts were removed from the uterus, washed with saline water, and any identified sperm were counted. The presence of eggs was also observed as evidence of ovulation. Second, the oviducts were left attached to the uterus and both tissues were fixed, embedded in paraffin, sectioned and marked (as described above). The sections were examined for the presence of sperm, both in the uterus and in both oviducts.
[00303] [00303] For the five females mated with five males A-DAMG6 ”, very little sperm was found in the oviduct washing solution. The oviduct washing solutions of the five females
[00304] [00304] Histological sections of uterus and oviduct were prepared. The sections were examined for the presence of sperm in the uterus and oviduct (colliculus tubarius). Inspection of histological sections of oviduct and uterus revealed that for female mice mated with ADAMG6 mice ”, sperm was found in the uterus but not in the oviduct. In addition, sections of females mated with ADAMG6 * mice revealed that sperm was not found at the uterotubary junction (UTJ). In sections of females mated with ADAMG6 ”* mice, sperm were identified in UTJ and in the oviduct.
[00305] [00305] These results establish that mice without ADAM6a and ADAM6b genes produce sperm that exhibit a migration defect in vivo. In all cases, sperm were observed inside the uterus, indicating that copulation and sperm release apparently occur normally, but little to no sperm was observed inside the oviducts after copulation as measured by sperm count or histological observation. These results establish that mice without the ADAM6a and ADAM6b genes produce sperm that exhibit an inability to migrate from the uterus to the oviduct. This defect apparently leads to infertility because the sperm is unable to cross the uterine-tubule junction in the oviduct, where the eggs are fertilized. Taken together, all of these results converge to support the hypothesis that mouse ADAMG6 genes help direct sperm with normal motility to migrate from the uterus, through the uterotubary junction and the oviduct, and thus approach an egg to reach the fertilization event. The mechanism by which ADAM6 achieves this can be directly by the action of ADAMG6 proteins, or by expression coordinated with other proteins, for example, other ADAM proteins, in the sperm cell, as described below. ADAM Gene Family Expression.
[00306] [00306] It is known that an ADAM protein complex is present as a complex on the surface of matured sperm. Mice without other members of the ADAM gene family lose this complex as mature sperm, and exhibit a reduction in multiple ADAM proteins in mature sperm. To determine whether a lack of ADAM6a and ADAM6b genes affects other ADAM proteins in a similar way, Western blots of protein extracts from the testicle (immature sperm) and epididymis (matured sperm) were analyzed to determine the expression levels of other members from the ADAM gene family.
[00307] [00307] In this experiment, protein extracts were analyzed from four ADAM6 ”and four ADAM6 *” mice. The results showed that the expression of ADAM2 and ADAMB3 was not affected in testis extracts. However, both ADAM2 and ADAM3 have been dramatically reduced in epididymis extracts. This demonstrates that the absence of ADAM6a and ADAM6b in the sperm of ADAMG6 mice ”can have a direct effect according to the expression and possibly the function of other ADAM proteins such as matured sperm (for example, ADAM2 and ADAM3). This suggests that ADAM6a and ADAMG6b are part of an ADAM protein complex on the surface of the sperm, which could be critical for proper sperm migration.
[00308] [00308] The use of a variable human heavy chain gene selected
[00309] [00309] Briefly, CD19 * B cells were purified from the spleens of mice mADAM6 * and ADAM6 * ”* using mouse CD19 microcounts (Miltenyi Biotec) and total RNA was purified using the RNeasy" "Mini kit (Qiagen). Genomic RNA was removed using a treatment with DNase free of RNase in column (Qiagen). Approximately 200 ng of mRNA was reverse transcribed into cDNA using First Stand cDNA Synthesis kit (Invitrogen) and then amplified with TAQMANT "Y Universal PCR Master Mix (Applied Biosystems) using the ABI 7900 Sequence Detection System (Applied Biosystems The relative expression of each gene was normalized to mouse Constant k (mMCK). Table 9 shows combinations of MGB sense / antisense / TAQMANTY probe used in this experiment. Table 9 Vi Huma- Sequence (5'- 3 ') SEQ | D no NOs: Direction: CAGGTACAGCTGCAGCAGTCA 6 Vu6-1 Antisense: GGAGATGGCACAGGTGAGTGA 7 mild O | Direction: TAGTCCCAGTGATGAGAAAGAGAT 9 Probe: TEAGTCCAGTCCAGGGA E-
[00310] [00310] In this experiment, the expression of the four human V genes was observed in the analyzed samples. In addition, expression levels were comparable between mMADAMG6 ”and A-DAMG6 *” * mice. These results demonstrate that the human V4 genes that were both distal to the modification site (V43-23 and V, 11-69) and proximal to the modification site (V41-2 and V46-1) were all able to recombine to form a functionally expressed human heavy chain. These results demonstrate that the ectopic genomic fragment comprising the mouse ADAM6a and ADAMG6b sequences inserted in a human heavy chain genomic sequence did not affect recombination of V (D) J gene segments of the human heavy chain within the locus and these mice - dongs are able to recombine gene segments of the human heavy chain in a normal way to produce functional heavy chain immunoglobulin proteins. Example X Identification of Human Heavy Chain Variable Regions Associated with Selected Human Light Chain Variable Regions
[00311] [00311] An in vitro expression system has been constructed to determine whether a single rearranged human germline light chain can be co-expressed with human heavy chains of human antibodies specific for the antigen.
[00312] [00312] Methods for generating human antibodies in genetically modified mice are known (see for e-
[00313] [00313] “Humanized mouse VELOCIMMUNEPO was immunized with a growth factor that promotes angiogenesis (Antigen C) and human antibodies specific for the antigen were isolated and sequenced for use of gene V using standard techniques recognized in the art. The selected antibodies were cloned into constant regions of the human heavy and light chain and 69 heavy chains were selected to match one of three human light chains: (1) the cognate K light chain bound to a constant region
[00314] [00314] In a similar experiment, humanized VELOCIMMUNEPO mice were immunized with several different antigens and selected heavy chains of human antibodies specific for the antigen were tested for their ability to pair with different rearranged human germline light chains (as described above) ). The antigens used in this experiment included an enzyme involved in cholesterol homeostasis (Antigen A), a serum hormone involved in the regulation of glucose homeostasis (Antigen B), a growth factor that promotes angiogenesis (Antigen C) and a cell surface receptor (D Antigen). Antigen-specific antibodies were isolated from mice
[00315] [00315] The results obtained from these experiments demonstrate that somatically mutated, high-affinity, heavy chains from different gene families are able to pair with rearranged human germline VK1- 39JK5 and VK3-20JK1 regions and be secreted from the cell as a molecule of normal antibody.
[00316] [00316] Several rearranged human germline light chain targeting vectors were made using VELOCIGENEGO genetic engineering technology (see, for example, US Pat. No. 6,586,251 and Valenzuela et a /. (2003) High-throughput engineering of the mouse genome coupled with high-resolution expression analysis, Nature Biotech. 21 (6): 652-659) to modify clones 302912 and 254m04 of mouse genomic Artificial Chromosome (BAC) (Invitrogen). When using these two BAC clones, genomic constructs were engineered to contain a region of the single rearranged human germline light chain and inserted into a locus of the x endogenous light chain that was previously modified to delete the «endogenous variable and join segments genic. Construction of Targeting Vectors for the Rearranged Human Germline Light Chain.
[00317] [00317] Three different regions of the human rearranged germline light chain were made using standard molecular biology techniques recognized in the art. The human variable gene segments used to construct these three regions included the rearranged human VK1-39JK5 sequence, a rearranged human VK3-20JK1 sequence and a rearranged human VpreBJI5 sequence.
[00318] [00318] A segment of DNA containing exon 1 (encoding the leader peptide) and intron 1 of the mouse VK3-7 gene was made by de novo DNA synthesis (Integrated DNA Technologies). The part of the 5 'region not translated to a Blp! Restriction enzyme site | naturally occurring has been included. Exons of human VK1-39 and Vkx3-20 genes were amplified by PCR from human genomic BAC libraries. The sense primers had a 5 'extension containing the intron 1 junction site of the VK3-7 gene of ca- - “mundongo. The antisense initiator used for sequence PCR
[00319] [00319] VK3-7 mouse exon 1 / intron 1, human variable light chain exons and human JKk-CK intron fragments were connected by overlap extension PCR, digested with BIpl and PI-Scel, and ligated on plasmid pBS-296-HA18-PIScel, which contained the human Vx3-15 variable gene segment promoter. A hygromycin / oxed cassette within plasmid pBS-296-HA18-PIScel was replaced by a FRTed hygromycin cassette flanked by Asc! and Notl. The Notl / PIl-Scel fragment of this plasmid was ligated into the modified mouse BAC 254m04, which contained the mouse JK-CK intron part, the mouse CK exon and approximately 75 kb of the genomic sequence downstream of the K locus of mouse that provided a 3 'homology arm for homologous recombination in mouse ES cells. The Notl / Ascl fragment of this BAC was then ligated into the modified mouse BAC 302912, which contained a FRTed neomycin cassette and approximately 23 kb of the genomic sequence upstream of the endogenous K locus for homologous recombination in the mouse ES cells. Targeting Vector VK1-39JK5 of Rearranged Human Germ Line (FIG. 19).
[00320] [00320] Enzyme restriction sites were introduced at the 5 'and 3' ends of a light chain insert engineered to clone into a targeting vector: an Ascl site at the 5 'end and a PI-SCEI site at the 3 end '. Within the Ascl 5 'site and the PI-SCEI 3' site, the 5 'to 3' targeting construct included a 5 'homology arm containing the 5' sequence for the endogenous mouse K light chain locus obtained from the Mouse BAC 302912, a FRTed neomycin resistance gene, a genomic sequence including the human Vx3-15 promoter, a leader sequence of the mouse variable Vx3-7 gene segment, an intron sequence of the gene segment mouse variable VxK3-7, an open reading region of a rearranged human germline VK1-39JK5 region, a genomic sequence containing a portion of the human Jk-CK intron and a 3 'homology arm containing the 3' sequence from the endogenous mouse JK5 gene segment obtained from the mouse BAC 254m04 clone (Figure 19, middle). Genes and / or sequences upstream of the endogenous mouse K light chain locus and downstream of most of the 3 'JK gene segment (for example, 3' endogenous enhancer) were not modified by the targeting construct (see Figure 19) . The sequence of the engineered human VK1-39JK5 locus is shown in SEQ ID NO: 59.
[00321] [00321] The targeted insertion of the rearranged human germline VK1-39JK5 region into BAC DNA was confirmed by the polymerase chain reaction (PCR) using primers located in sequences within the light chain region of the rearranged human germline. Briefly, the 3 'intron sequence to the mouse V <x3-7 leader sequence was confirmed with ULC-MIF primers (AGGTGAGGGT ACAGATAAGT GTTATGAG; SEQ ID NO: 60) and ULC-mM1R (TGACAAATGC CCTAATTATA GTGATCA; SEQ IDNO: 61) . The open reading region of the rearranged human germline VK1-39JK5 region was confirmed with primers 1633-h2F (GGGCAAGTCA GAGCATTAGC A; SEQ ID NO: 62) and 1633-h2R (TGCAAACTGG ATGCAGCATA G; SEQ ID NO: 63). The neomycin cassette was confirmed with neoF (ggtagagagg ctattcggc; SEQIDNO: 64) and neoR (gaacacggcg gcatcag; SEQ ID NO: 65) primers. Target BAC DNA was then used to electroporate mouse ES cells to create ES cells modified to generate chimeric mice that express a rearranged human germline VK1-39JK5 region.
[00322] [00322] The positive ES cell clones were confirmed by Tagman '"screening and karyotyping using probes specific for the engendered V <K1-39JK5 light chain region inserted into the endogenous locus. Briefly, the neoP probe (TGGGCACAAC AGACA-ATCGG CTG; SEQ ID NO: 66) which binds within the neomycin marker gene, ULC-m1iP probe (CCATTATGAT GCTCCATGCC TCTCTGTTC; SEQ ID NO: 67) which binds within the 3 'intron sequence to the leader sequence Vx3-7 of 1633h2P mouse and probe (ATCAGCAGAA ACCAGGGAAA GCCCCT; SEQ ID NO: 68) that binds within the rearranged human germline VK1-39JK5 open reading region. Positive ES cell clones were then used to implant female mice into give rise to a litter of puppies that express the VK1-39JK5 light chain region of the germline.
[00323] [00323] —Alternatively, ES cells carrying the rearranged human germline VK1-39JK5 light chain region are transfected with a construct that expresses FLP in order to remove the FRTed neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette is removed by reproduction to mice that express FLP recombinase (for example, US 6,774,279). Optionally, the neomycin cassette is maintained
[00324] [00324] In a similar way, an engineered light chain locus that expresses a rearranged human germline VK3-20JK1 region was made using a targeting construct including, from 5 'to 3, an arm 5 'homology containing 5' sequence to the endogenous mouse k light chain locus obtained from the mouse BAC 302g12 clone, a FRTed gene resistance gene, a genomic sequence including the human VK3-15 promoter, a leader sequence of the mouse VK3-7 variable gene segment, an intron sequence of the mouse VK3-7 variable gene segment, an open reading region of a rearranged human germline VK3-20JK1 region, a sequence genomic sequence containing a portion of the human JKk-CK intron and a 3 'homology arm containing 3' sequence of the endogenous mouse JK5 gene segment obtained from the mouse BAC clone 254m04 (Figure 20, medium). The sequence of the engineered human VK3-20JK1 locus is shown in SEQ ID NO: 69.
[00325] [00325] Targeted insertion of the VK3-20JK1 region of human germ line rearranged into BAC DNA was confirmed by the polymerase chain reaction (PCR) using primers located in sequences within the VK3 light chain region -20JK1 of rearranged human germline. Briefly, the 3 'intron sequence to the mouse VK3-7 leader sequence was confirmed with ULC-m1F (SEQ ID NO: 60) and ULC-MIR (SEQ ID NO: 61) primers. The open reading region of the rearranged human germline VK3-20JK1 region was confirmed with initiators 1635-h2F (TCCAGGCACC CTGTCTTTG; SEQ ID NO: 70) and 1635-h2R (AAGTAGCTGC TGCTAACACT CTGACT; SEQ ID NO: 711) . The neomycin cassette was confirmed with neoF (SEQ ID NO: 64) and neoR (SEQ ID NO: 65) primers. Targeted BAC DNA was then used to electroporate mouse ES cells to modified ES cells created to generate chimeric mice that express rearranged human germline VK3-20JK1 light chains.
[00326] [00326] The positive ES cell clones were confirmed by Tagman '"screening and karyotyping using probes specific for the engineered Vx3-20JK1 light chain region inserted into the endogenous K light chain locus. In short, the neoP probe (SEQ | D NO : 66) that binds within the neomycin marker gene, the ULC-mM1P probe (SEQ ID NO: 67) that binds within the mouse VK3-7 leader sequence and the 1635h2P probe (AAAGAGCCAC CCTCTCCTGC AGGG; SEQ ID NO: 72) that binds within the open reading region of human VK3-20JK1. The positive ES cell clones were then used to implant in female mice. A litter of puppies expressing the region of the VK3-20JK1 light chain of lineage human germinative.
[00327] [00327] —Alternatively, ES cells carrying the human germline VK3-20JK1 light chain region can be transfected with a construct that expresses FLP in order to remove the FRTed neomycin casing introduced by the targeting construct. to. Optionally, the neomycin cassette can be removed by reproducing mice that express FLP recombinase (for example, US 6,774,279). Optionally, the neomycin cassette is preserved in the mice. VpreBJI5 Targeting Vector of Human Germline Lineage rearranged (FIG. 21).
[00328] [00328] In a similar way, an engineered light chain locus that expresses a rearranged human germline VpreBJ15 region was made using a targeting construct including, from 5 to 3, a 5 'homology arm containing the sequence 5 'to the endogenous mouse light chain locus' obtained from the mouse BAC 302912 clone, a FRTed neomycin resistance gene, a genomic sequence including the human VK3-15 promoter, a leading sequence of the VK3 variable gene segment Mouse -7, an intron sequence of the variable gene segment of mouse VK3-7, an open reading region of a rearranged human germline VpreBJA5 region, a genomic sequence containing a portion of the JKk intron - human CK and a 3 'homology arm containing the 3' sequence of the endogenous mouse JK5 gene segment obtained from the mouse BAC 254m04 clone (Figure 21, medium). The sequence of the engineered VpreBJI5 locus is shown in SEQ ID NO: 73.
[00329] [00329] The targeted insertion of the rearranged human germline VpreBJA5 region into BAC DNA was confirmed by the polymerase chain reaction (PCR) using primers located in sequences within the rearranged human germline VpreBJAS region light chain region. Briefly, the 3 'intron sequence to the mouse VK3-7 leader sequence was confirmed with ULC-m1F primers (SEQ ID NO: 60 and ULC-m1R (SEQ ID NO: 61). of the rearranged human germline VpreBJAS region was confirmed with 1616-h1F (TGTCCTCGGC CCTTGGA; SEQ ID NO: 74) and 1616-h1R (CC-GATGTCAT GGTCGTTCCT; SEQ ID NO: 75) primers. The neomycin cassette was confirmed with primers neoF (SEQ ID NO: 64) and neoR (SEQ ID NO: 65). Targeted BAC DNA was then used to electroporate mouse ES cells to create modified ES cells to generate chimeric mice that express the VpreBJA5 light chain human germinative rearranged.
[00330] [00330] The positive ES cell clones are confirmed by Tagman '' screening and karyotyping using probes specific for the engineered VpreBJA5S light chain region inserted into the endogenous x light chain locus. Briefly, the neoP probe (SEQ ID NO: 66) that binds within the neomycin marker gene, ULC-mM1P probe (SEQ ID NO: 67) that binds within the mouse IgVKk3-7 leader sequence and the 1616hIP probe ( ACAATCCGCC TCACCTGCAC CCT; SEQ ID NO: 76) that binds within the open reading region of human VpreBJAS5. The positive ES cell clones are then used to implant female mice to give rise to a litter of pups that express a region of the germline light chain.
[00331] [00331] —Alternatively, ES cells carrying the rearranged human germline VpreBJIl5 light chain region are transfected with a construct that expresses FLP in order to remove the FRTed neomycin cassette introduced by the targeting construct. Optionally, the neomycin cassette is removed by reproduction for mice that express FLP recombinase (for example, US 6,774,279). Optionally, the neomycin cassette is preserved in the mice. Example XII Generation of Mice Expressing a Single Rearranged Human Light Chain
[00332] [00332] The targeted ES cells described above were used as donor ES cells and introduced into an 8 cell stage mouse embryo by the VELOCIMOUSEPO method (see, for example, US Pat. No. 7,294,754 and Poueymirou et al (2007) FO genera tion mice that are essentially fully derived from the donor gene-targeted ES cells allowing immediate phenotypic analyzes, Nature Biotech. 25 (1): 91-99.
[00333] [00333] The puppies are genotyped and a heterozygous or homozygous pup for the region of the single rearranged human germline light chain are selected to characterize the expression of the region of the rearranged human germline light chain. Flow cytometry.
[00334] [00334] The expression of the rearranged human light chain region in the normal antibody repertoire of mice of the common light chain was validated by the analysis of expression of immunoglobulin K and A in splenocytes and peripheral blood of mice of the common light chain. Cell suspensions from collected spleens and peripheral blood from wild mice (n = 5), heterozygous common light chain VK1-39JK5 (n = 3), homozygous common light chain VK1- 39JK5 (n = 3), heterozygotes from common light chain VK3-20JK1 (n = 2) and homozygous common light chain VK3-20JK1 (n = 2) were produced using standard methods and labeled with CD19 ”, Igl * and IgK * using fluorescently labeled antibodies (BD Pharmigen ).
[00335] [00335] Briefly, 1x10 th cells were incubated with mouse anti-CD16 / CD32 (clone 2.4G2, BD Pharmigen) on ice for 10 minutes, followed by staining with the following antibody cocktail for 30 minutes on ice: anti-CD19 of mouse conjugated to APC (clone 1D3, BD Pharmigen), anti-mouse cCD3 conjugated to PerCP-Cy5.5 (clone 17A2, BioLegend), anti-IgG-conjugated to FITC (clone 187.1, BD Pharmigen ), PE-conjugated mouse anti-IgA (clone RML-42, BioLegend). Following labeling, the cells were washed and fixed in 2% formaldehyde. Data acquisition was performed on an LSRII cytometer | and analyzed with FlowJo '", Passage: total B cells (CD19 + CD3-), Igk B cells (IgIgroD19 * CD3), Igl * B cells (IgkIgl" CD19 * CD3). The collected data on blood and splenocyte samples demonstrated similar results. Table 12 shows the percentage of CD19 * positive B cells from the peripheral blood of a mouse representative of each group that are Igl ”, IgK”, or Igl “IgK”. Percentage of CD19 * B cells in the peripheral blood of wild mice (WT) and homozygotes for the common light chain VK1-39JK5 or for VK3-20JK1 are shown in Figure 22. Table 12 Mouse Genotype BODTU gr Ig Igrigk * RR a E Common Light Chain Expression.
[00336] [00336] The expression of each common light chain (VK1-39JK5 and VK3-20JK1) was analyzed in heterozygous and homozygous mice using a quantitative PCR assay (for example, Tagman '“Y).
[00337] [00337] Briefly, CD19 * B cells were purified from the spleens of wild mice, homozygous for a replacement of the variable region loci of the mouse heavy chain and the light chain K with the variable region loci of the corresponding human heavy chain and the light chain K (Hx), as well as homozygous and heterozygous mice for each region of the rearranged human light chain (VK1-39JK5 or VK3-20JK1) using mouse CD19 micro accounts (Miltenyi Biotec) according to the manufacturer's specifications.
[00338] [00338] Common light chain mice carrying a common light chain of VK1-39JK5 or VK3-20JK1 at the endogenous mouse K light chain locus were immunized with B-galactosidase and the antibody titer was measured.
[00339] [00339] Briefly, B-galactosidase (Sigma) was emulsified in the TITERMAXTY adjuvant (Sigma), according to the manufacturer's instructions. Wild (n = 7), homozygous common light chain VK1- 39JK5 (n = 2) and homozygous common light chain VK3-20JK1 (n = 5) were immunized by subcutaneous injection with 100 µg of B-galactosidase / TITERMAX'Y . The mice were stimulated by subcutaneous injection twice, 3 weeks apart, with 50 µg of B-galactosidase / TITERMAXTY. After the second stimulus, blood was collected from anesthetized mice using retro-orbital bleeding in serum separator tubes. (BD Biosciences) according to the manufacturer's instructions. To measure IgG or IgM anti-B-galactosidase antibodies, ELISA plates (Nunc) were coated with 1 µg / ml B-galactosidase overnight at 4 ° C. The excess antigen was washed before blocking with PBS with 1% BSA for one hour at room temperature. Serial dilutions of the serum were added to the plates and incubated for one hour at room temperature before washing. The plates were then incubated with anti-IgM (Southern Biotech) or anti-IgG (Southern Biotech) conjugated to HRP for one hour at room temperature. After another wash, the plates were developed with TMB substrate (BD Biosciences). The reactions were stopped with 1N sulfuric acid and ODa5, was read using Victor X5 Plate Reader (Perkin Elmer). The data were analyzed with Prisma GRAPHPAD "Y and the signal was calculated as the dilution of the serum that is twice above the bottom. The results are shown in Figures 24A and 24B.
[00340] [00340] As shown in this Example, the proportion of BK / A cells in both the splenic and peripheral compartments of mice in the common light chain of VK1-39JK5 and VK3-20JK1 demonstrated a model close to the wild (Table 12 and FIG. 22). The mice in the VpreBJA5 common light chain, however, demonstrated fewer peripheral B cells, of which approximately 1-2% express the engineered human light chain region (data not shown). The expression levels of the rearranged human light chain regions of VK1-39JK5 and VK3-20JK1 of the endogenous K light chain locus were elevated compared to an endogenous light chain locus that contains a complete replacement of the VK and JK gene segments of mouse by human VK and JK gene segments (FIG. 23A, 23B and 23C). The expression levels of the rearranged VpreBJA5 human light chain region demonstrated similar high expression of the endogenous light chain locus in both heterozygous and homozygous mice (data not shown). This demonstrates that in direct competition with endogenous light chain loci À, K or both of mice, a single V, / J sequence, rearranged human may have a better yield than the wild level expression of the light chain locus Endogenous K and give rise to the normal splenic and blood B cell frequency. In addition, the presence of an engineered K light locus having a human VK1-39JK5 or human VK3-20JK1 sequence was well tolerated by mice and appears to function in the wild, representing a substantial portion of the light chain repertoire in the humoral component of the immune response (FIG. 24A and 24B). Example XIII Reproduction of Mice Expressing a Light Chain of
[00341] [00341] This Example describes several other genetically modified mouse strains that can be reproduced by any of the common light chain mice described in this application to create multiple genetically modified mouse strains that harbor multiple genetically modified immunoglobulin loci. Endogenous IgA knockout (KO).
[00342] [00342] To optimize the use of the engineered light chain locus, the mice carrying one of the rearranged human germline light chain regions are reproduced with another mouse that contains a deletion in the light chain locus À enogenous. In this way, the progeny obtained will express, as its only light chain, the region of the human germline lineage light chain rearranged as described in Example 11. Reproduction is carried out by standard techniques recognized in the art and, alternatively, by a commercial breeder (for example, Jackson Laboratories). Mouse lines carrying an engineered light chain locus and a deletion of the endogenous A light chain locus are screened for the presence of the single light chain region and the absence of endogenous mouse A light chains. Humanized Endogenous Heavy Chain Locus.
[00343] [00343] Mice carrying an engineered human germ line light chain locus are reproduced with mice containing a replacement of the endogenous mouse heavy chain variable gene locus with the human heavy chain variable gene locus (see US 6,596,541; humanized mouse VELOCIMMUNEG, Regeneron Pharmaceuticals, Inc.). VELOCIMMUNEGO humanized mouse comprises a genome comprising variable regions of the operative human heavy chain.
[00344] [00344] Mice carrying a replacement of the endogenous mouse Vu locus by the human V4 locus and a region of V, of human germline rearranged unique at the endogenous K light chain locus are obtained. Reverse chimeric antibodies containing somatically mutated heavy chains (V, human and C, mouse) with a single human light chain (V, human and C, mouse) are obtained by immunizing with an antigen of interest. The nucleotide sequences V, and V, of B cells expressing the antibodies are identified and the fully human antibodies are produced by the fusion of nucleotide sequences Vy and V, to human Ce C nucleotide sequences in a suitable expression system. Example XIV Generation of Mouse Antibodies Expressing Human Heavy Chains and a Rearranged Human Germ Line Light Chain Region
[00345] [00345] After breeding mice containing the human light chain region engineered for several desired strains that contain modifications and deletions from other endogenous Ig loci (as described in Example 12), selected mice can be immunized with an antigen from interest.
[00346] [00346] Generally, a humanized VELOCIMMU-NEQ mouse that contains one of the regions of the single rearranged human germline light chain is challenged with an antigen, and the lymphatic cells (such as B Cells) are recovered from the animals' serum. Lymphatic cells are fused with a myeloma cell line to prepare immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to identify hybridoma cell lines that produce antibodies that contain human heavy chain variables and le chains - rearranged human germline specimens that are specific for the antigen used for immunization. DNA encoding the variable regions of the heavy chains and the light chain is isolated and linked to desirable isotypic constant regions of the heavy chain and light chain. Due to the presence of the indigenous mouse sequences and any additional elements present acting on the cis at the endogenous locus, the single light chain of each antibody can be somatically mutated. This adds additional diversity to the antigen-specific repertoire comprising a single light chain and several heavy chain sequences. The resulting cloned antibody sequences are subsequently expressed in a cell, such as a CHO cell. Alternatively, DNA encoding antigen-specific chimeric antibodies or variable domains of light and heavy chains is identified directly from antigen-specific lymphocytes.
[00347] [00347] Initially, high-affinity chimeric antibodies are isolated having a human variable region and a constant mouse region. As described above, antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc. Mouse constant regions are replaced by a desired human constant region to generate the fully human antibody containing a somatically mutated human heavy chain and a single light chain derived from a rearranged human germline light chain region of the invention. Suitable human constant regions include, for example, wild or modified IgG1 or IgG4.
[00348] [00348] - “Separate cohorts of humanized VELO-CIMMUNEO mice that contain a replacement of the endogenous mouse heavy chain locus with human Vu, Du, and Ja gene segments and a replacement of the mouse K light chain locus en - dogen by the human light chain region of the engendered germline VK1-39JK5 or by the human light chain region of the engendered germline VK3-20JK1 (described above) were immunized with a human cell surface receptor protein (Antigen E). The E antigen is administered directly to the rear footpad of mice with six consecutive injections every 3-4 days. Two to three micrograms of Antigen E are mixed with 10 µg of the CpG oligonucleotide (Cat * tlrl-modn - ODN1826 oligonucleotide; InVivogen, San Diego, CA) and 25 µg of Adju-Phos (Adjuvant phosphate gel aluminum, Cat H-71639-250; Brenntag Biosector, Frederikssund, Denmark) before injection. A total of six injections are given before the final antigenic recovery, which is given 3-5 days before sacrifice. Bleeds after the 4th and 6th injection are collected and the antibody immune response is monitored by a specific immunoassay for the standard antigen.
[00349] [00349] When a desired immune response is achieved, splenocytes are collected and fused with mouse myeloma cells to preserve their viability and hybridoma cell lines. Hybridoma cell lines are screened and selected to identify cell lines that produce E-Antigen-specific common light chain antibodies. Using this technique, several E-Antigen-specific common light chain antibodies (ie, antibodies that have variable domains) of the human heavy chain, the same variable domain of the human light chain and mouse constant domains) are obtained.
[00350] [00350] Alternatively, common light chain antibodies to anti-E antigen are isolated directly from antigen-positive B cells without fusion to myeloma cells, as described in US 2007 / 0280945A1, in this application specifically incorporated by reference in its entirety. Using this method, a number of fully human anti-antigen E common light chain antibodies (i.e., antibodies that have variable domains of the human heavy chain, an engineered human VK1-39JK5 light chain or a region of the human VK3-20JkK1 light chain engineered and human constant domains) was obtained.
[00351] [00351] The biological properties of anti-antigen E specimens of the common light chain generated according to the methods of this Example are described in detail below.
[00352] [00352] To analyze the structure of light chain antibodies with a common anti-human E antigen produced, nucleic acids encoding variable regions of heavy chain antibody were cloned and sequenced. From the nucleic acid sequences and the predicted amino acid sequences of the antibodies, gene use was identified for the heavy chain variable region (HCVR) of selected common light antibodies obtained from humanized VELOCIMMUNEO mice containing the VK1 light chain -39JK5 engineered human or the engineered human VK3-20JK1 light chain region. The results are shown in Tables 14 and 15, which demonstrate that the mice according to the invention generate common light chain antibodies specific for the antigen of a variety of gene segments of the human heavy chain, due to a variety of rearrangements, when employing a mouse that expresses a light chain of only one human VK1-39 or a light chain derived from human Vx3-20. Gene segments V, humans from 2, 3, 4, and 5 families rearranged with a variety of D., human, and J, human segments to produce antibodies specific for the antigen.
[00353] [00353] Ninety-eight human common light chain antibodies raised against E Antigen have been tested for their ability to block the binding of the natural Antigen E ligand (Ligand Y) to Antigen E in an account-based assay.
[00354] [00354] The extracellular domain (ECD) of Antigen E was conjugated to the myc epitope markers and a 6X histidine marker (Antigen E-mmH) and coupled by the amine to carboxylated microspheres in a concentration of 20 ug / mL in the MES buffer . The mixture was incubated for two hours at room temperature followed by deactivation of bead with 1M Tris pH 8.0 followed by washing in PBS with 0.05% (v / v) Tween-20. The accounts were then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 2% BSA (w / v) (Sigma-Aldrich Corp., St. Louis, MO). In a 96-well plate with filter, supernatants containing common light chain antibodies specific for E Antigen were diluted 1:15 in the buffer. A negative control containing a supernatant without antibody with the same components of the media in relation to the supernatant with antibody was prepared. The beads marked with Antigen E were added to the supernatants and incubated overnight at 4 €. Biotinylated binding protein Y was added to a final concentration of 0.06 nM and incubated for two hours at room temperature. The detection of biotinylated Y ligand linked to beads marked with E-myc-myc-
[00355] [00355] In a similar experiment, the same 98 human common light chain antibodies originating against E Antigen were tested for their ability to block E Antigen binding to Y-labeled Ligand beads.
[00356] [00356] Briefly, Ligand Y was coupled by amine to carboxylated microspheres in a concentration of 20 µg / mL diluted in the MES buffer. The mixture was incubated for two hours at room temperature followed by deactivation of beads with Tris IM pH 8 then washing in PBS with 0.05% (v / v) Tween-20. The accounts were then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 2% BSA (w / v) (Sigma-Aldrich Corp., St. Louis, MO). In a 96-well filter plate, supernatants containing the common light chain antibodies specific for E Antigen were diluted 1:15 in the buffer. A negative control containing an antibody-free supernatant with the same components as the media in relation to the antibody supernatant was prepared. A biotinylated E-mmH antigen was added to a final concentration of 0.42 nM and incubated overnight at 4 °. Beads marked with ligand Y were then added to the antibody / E Antigen mixture and incubated for two hours at room temperature. The detection of biotinylated E-mmH antigen bound to Ligand Y beads was determined with R-phycoerythrin conjugated to Streptavidin (Moss Inc, Pasadena, MD) followed by measurement in an analyzer based on LUMINEXTY flow cytometry, Mean Fluorescence Intensity (MF !) background of a sample without Antigen E was subtracted from all samples. The percentage block was calculated by dividing the MFI subtracted from the bottom of each sample by the adjusted negative control value, multiplying by 100 and subtracting the resulting value from 100.
[00357] [00357] Tables 16 and 17 show the blocking percentage of 98 anti-antigen E common light chain antibodies tested in both LUMINEX'TY, ND assays: not determined under current experimental conditions.
[00358] [00358] In the first LUMINEXTY experiment described above, 80 common light chain antibodies that contain the engineered light chain of VK1-39JK5 were tested for their ability to block ligand Y binding to beads marked with E Antigen. Of these 80 common light chain antibodies, 68 demonstrated blockade> 50%, while 12 demonstrated blockade <50% (6 in blocking 25-50% and 6 in blocking <25%). Since 18 common light chain antibodies that contain the engineered VK3-20JK1 light chain, 12 demonstrated blocking> 50%, while 6 demonstrated blocking <50% (3 in blocking 25-50% and 3 in blocking <25 %) of ligand Y binding to accounts marked with E Antigen.
[00359] [00359] In the second LUMINEX'Y experiment described above, the same 80 common light chain antibodies that contain the engineered light chain of VK1-39JK5 were tested for their ability to block the binding of Antigen E to beads marked with Ligand Y. Of these 80 common light chain antibodies, 36 demonstrated
[00360] [00360] The data in Tables 16 and 17 establish that the rearrangements described in Tables 14 and 15 generated specific anti-E antigen E common light chain antibodies that blocked the binding of Link Y to its cognate receptor Antigen E with degrees efficacy, which is compatible with common anti-E chain light antibodies from Tables 14 and 15 which comprise antibodies with specificity of overlapping and non-overlapping epitope with respect to Antigen E. Example XVII Determination of Antibody Blocking Capacity Antigen-specific light chain filters by ELISA
[00361] [00361] Human common light chain antibodies raised against Antigen E were tested for their ability to block binding of Antigen E to a surface covered with Ligand Y in an ELISA assay.
[00362] [00362] Ligand Y was covered in 96-well plates at a concentration of 2 µg / mL diluted in PBS and incubated overnight followed by washing four times in PBS with 0.05% Tween-20. The plate was then blocked with PBS (Irvine Scientific, Santa Ana, CA) containing 0.5% (w / v) BSA (Sigma-Aldrich Corp., St. Louis, MO) for one hour at room temperature. On a separate plate, the supernatants containing common anti-E light chain antibodies were diluted 1:10 in the buffer. A supernatant without antibody with the same components as the antibodies was used as a
[00363] [00363] Tables 18 and 19 show 98 percent blocking of common anti-antigen E light chain antibodies tested in the ELISA assay. ND: not determined under current experimental conditions. Table 18 Common light chain antibodies Vx1-39Jx5 “Anti-stiffness - A deblocking% Antelope E in Antigen Solution E in Solution [e | ss am o me as
[00364] [00364] As described in this Example, of 80 common light chain antibodies containing the engineered VK1-39JK5 light chain tested for its ability to block Antigen E binding to a surface covered with Ligand Y, 22 demonstrated blocking> 50%, while 58 demonstrated block <50% (20 in block 25-50% and 38 in block <25%). For 18 common light chain antibodies that contain the engineered light chain of VK3-20JK1, one demonstrated blocking> 50%, while 17 demonstrated blocking <50% (5 in blocking 25-50% and 12 in blocking < 25%) of the E Antigen binding to a Ligand surface covered with Y.
[00365] [00365] These results are also compatible with the group of common light chain antibody specific for E Antigen which comprises antibodies with overlapping and non-overlapping epitope specificity for E Antigen.
[00366] [00366] Balance dissociation constants (Kp) for selected antibody supernatants were determined by SPR (Surface plasmon resonance) using a T100 BIAcher® device (GE Healthcare). All data were obtained using HBS-EP (HEPES 10 mm, NaCl 150 mm, EDTA 0.3 mM, P20 surfactant 0.05%, pH 7.4) both as running and sample buffers at 25CT. Antibodies were captured from supernatant samples crude on a CM5 sensor chip surface previously derived with a high density of anti-human Fc antibodies using standard amine coupling chemistry. During the capture step, supernatants were injected through the human anti-Fc surface. at a flow rate of 3 uL / min for a total of 3 minutes The capture step was followed by an injection of running buffer or analyte at a concentration of 100 nM for 2 minutes in a flow rate of 35 ul / min. Dissociation of the antigen from the captured antibody was monitored for 6 minutes. The captured antibody was removed by a brief injection of 10 mM glycine, pH 1.5. All sensorgrams were folded, referenced by subtracting sensorgrams from buffer injections from the analyte sensorgrams, by dissolving by removing artifacts caused by the dissociation of the antibody from the capture surface. The binding data for each antibody was fitted to a 1: 1 binding model with mass transport using the BIACORETY T100 v2.1 evaluation program. The results are shown in Tables 20 and 21.
[00367] [00367] The binding affinities of common light chain antibodies comprising the rearrangements shown in Tables 14 and 15 vary, with almost the entire exposure of a Kp in the nanomolar range. The affinity data are compatible with the common light chain antibodies that result from the combinatorial association of rearranged variable domains described in Tables 14 and 15 that are of high affinity, clonally selected, and somatically mutated. Coupled with data previously shown, the common light chain antibodies described in Tables 14 and 15 comprise a collection of several high-affinity antibodies that exhibit specificity of one or more epitopes on E Antigen.
[00368] [00368] The selected anti-antigen E common light chain antibodies were tested for their ability to bind to the Antigen E ECD and Antigen E ECD variants, including the cinomolgous monkey orthologist (Antigen E MP), which differs from human protein in approximately 10% of its amino acid residues; an Antigen E deletion mutant without the last 10 amino acids from the C-terminal end of ECD (Antigen E-ACT); and two mutants that contain an alanine substitution in positions suspected of interacting with Ligand Y (Antigen E-Ala1 and AntigenE-Ala2). Antigen E proteins were produced in CHO cells and each contained a myc-myc-His C-terminal marker.
[00369] [00369] For binding studies, Antigen E ECD protein or variant protein (described above) from 1 ml of culture medium was captured by incubation for 2 hours at room temperature with 1 x 10º microsphere beads (Luminex ' Y ") covalently coated with an anti-myc monoclonal antibody (MAb 9E10, CRL-17297Y hybridoma cell line; ATCC, Manassas, VA). The beads were then washed with PBS before use. Supernatants containing antibodies to common anti-antigen E light chain were diluted 1: 4 in buffer and added to 96-well plates with filter.A supernatant without antibody was used as a negative control. Beads containing captured Antigen E proteins were then added to the samples antibody (3000 beads per well) and incubated overnight40C The next day, the sample beads were washed and the bound common light chain antibody was detected with a human anti-IgG antibody conjugated to R-phycoerythrin. intensity of fluorescence of the beads (approximately 100 beads counted for each antibody sample binding for each Antigen E protein) was measured with an analyzer based on Lu-flow cytometry
[00370] [00370] The anti-E antigen E common light chain supernatants exhibited high specific binding to the E-ECD Antigen-linked beads. For these beads, the supernatant without negative control antibody resulted in an insignificant signal (<10 MFI) when combined with the sample of E-ECD Antigen beads, while the supernatants containing common anti-E light chain antibodies exhibited strong binding signal (mean MFI from 2627 to 98 antibody supernatants; MFI> 500 for antibody samples 91/98).
[00371] [00371] As a measure of the ability of selected anti-E antigen E common light chain antibodies to identify different epitopes on the E Antigen ECD, the relative binding of antibodies to variants has been determined. All four variants of Antigen E were captured for LUMINEX'Y anti-myc beads as described above for studies on binding to native E Antigen - ECD, and the relative binding proportions (MFlyariante / MFlantígeno E-ecD) were determined. For 98 common light chain antibody supernatants tested shown in Tables 21 and 22, the average proportions (MFI-variant / MFlantigene E-ecpD) differed for each variant, probably reflecting different amounts of protein capture in the beads ( average proportions of 0.61, 2.9, 2.0, and 1.0 for the E-ACT Antigen, E-Ala1 Antigen, E-Ala2 Antigen, and E Mf Antigen, respectively
[00372] [00372] These data establish that the common light chain antibodies described in Tables 14 and 15 represent a diverse group of E-Antigen-specific common light chain antibodies that specifically recognize more than one epitope on E Antigen.

权利要求:
Claims (17)
[1]
1. Method of producing a mouse, characterized by the fact that it comprises genetically modifying the mouse to include in its germline: (a) a variable locus of the humanized immunoglobulin heavy chain comprising at least one unreached human V "gene segment , at least one segment of gene D, human not rearranged, and at least one segment of gene J ", human not rearranged, in which the variable locus of the heavy chain of humanized immunoglobulin is operationally linked to a gene constant region of the immunoglobulin heavy chain; (b) a humanized immunoglobulin light chain variable locus comprising (i) a single rearranged human light chain V / J sequence, wherein the only rearranged human light chain V / J sequence is a VK1-39 / Rearranged human JK or a rearranged human VK3-20 / JK sequence, or (ii) no more than one V gene segment of the human light chain and no more than one J gene segment of the human light chain, where no more than that a V gene segment of the human light chain is VK1-39 or VK3-20, where the variable locus of the humanized immunoglobulin light chain is operably linked to an immunoglobulin light chain constant region gene; and, (c) an ectopic nucleic acid sequence that encodes a mouse or ortholog or homologous ADAM6 protein or functional fragment thereof, in which the mouse or ortholog or homologous ADAM6 protein is expressed from the ectopic nucleic acid sequence.
[2]
2. Method of producing a male mouse, characterized by the fact that it comprises in its germ line: a variable locus of the human immunoglobulin heavy chain
and a humanized immunoglobulin light chain variable locus, in which the mouse exhibits wild fertility, in which the humanized immunoglobulin heavy chain variable locus comprises a substitution in the variable endogenous locus of the mouse heavy chain all or substantially all of the functional V, D and J gene segments of the mouse immunoglobulin heavy chain with one or more non-rearranged human Vu gene segments, one or more D gene segments; non-rearranged humans, and one or more J gene segments, non-rearranged humans, where the one or more human Vy gene segments, one or more human Di gene segments, and one or more human J gene segments are operationally linked and capable of rearranging to form a rearranged Vx4 / Dy / J "y gene that is operationally linked to an immunoglobulin heavy chain constant region gene, where the variable locus of the humanized immunoglobulin light chain comprises: ( 1) no more than a V gene segment of the human light chain and no more than a J gene segment of the human light chain, operationally linked to an immunoglobulin light chain constant region gene, where no more than one V gene segment of the human light chain is VK1-39 or VK3-20, or (ii) a single V / J sequence of the rearranged human light chain, operationally linked to a light chain constant region gene of immunoglobulin, in which the unique V / J sequence of Rearranged human light ia is a rearranged human VK1-39 / JK sequence or a rearranged human VK3-20 / JK sequence.
[3]
Method according to claim 1, characterized by the fact that the ectopic nucleic acid sequence encoding the ADAM6 protein of mice or orthologs or homologues or fragments
Its functional development is at a different locus from the variable locus of the immunoglobulin heavy chain.
[4]
Method according to claim 1 or 2, characterized in that the immunoglobulin heavy chain constant region gene is a mouse immunoglobulin heavy chain constant region gene.
[5]
Method according to any one of claims 1 to 3, characterized in that the immunoglobulin light chain constant region gene is a mouse immunoglobulin light chain constant region gene.
[6]
Method according to any one of claims 1 to 5, characterized in that no more than one J segment of the human light chain is JK1 or JK5, or a V / J sequence of the rearranged human light chain includes a J segment which is JK1 or JK5.
[7]
7. Method of producing a genetically modified male mouse, characterized by the fact that it expresses a plurality of immunoglobulin heavy chains associated with universal humanized immunoglobulin light chains, in which each universal humanized immunoglobulin light chain is derived of a variable light chain locus comprising: (i) a single V / J sequence of the rearranged human light chain, wherein the single V / J sequence of the rearranged human light chain is a Vk1-39 / Jk sequence rearranged human or a rearranged human Vk3-20 / Jk sequence, or (ii) no more than one V gene segment of the human light chain and no more than one J gene segment of the human light chain, in which the no more than one V gene segment of the human light chain is VK1-39 or VK3-20, in which the light chain locus is present in the germ line of the mouse, and in which the male mouse is capable of generating offspring through intersection, with a frequency that is approximate the same as a wild rat.
[8]
8. Method of producing a genetically modified mouse, characterized by the fact that it expresses a plurality of different IgG antibodies, each comprising: immunoglobulin heavy chain that includes a variable domain of the human immunoglobulin heavy chain, in which different antibodies in the plurality of different IgG antibodies have different immunoglobulin heavy chains; and immunoglobulin light chains, where each immunoglobulin light chain includes a variable domain of the human immunoglobulin light chain encoded by the same unique V / J sequence as the rearranged light chain, where the unique V / J sequence of the chain mild rearranging is present in the mouse lineage, and in which the gene segment V in the single rearranged V / J sequence is Vk1-39 or Vk3-20; and in which the mouse includes in its genome an ectopic nucleic acid sequence that expresses an ADAM6 protein or ortholog or homolog or functional fragment thereof that is functional in a male mouse.
[9]
9. Use of a mouse, characterized by the fact that it is to produce a completely human antibody, or a completely human antigen-binding protein, in which the fully human antibody or fully-human antigen-binding protein comprises a immunoglobulin variable domain or functional fragment thereof, wherein the mouse is produced by a method, as defined in any one of claims 1 a.
[10]
10. Use of a mouse, characterized by the fact that it is to produce a fully human bispecific antibody, in which the mouse is produced by a method, as defined in any one of claims 1 to 8.
[11]
11. Use of a nucleic acid sequence produced by a mouse, characterized by the fact that it is to produce a human therapeutic product, and in which the use comprises expression of the nucleic acid sequence and in which the mouse is produced by a method as defined in any one of claims 1 to 8.
[12]
12. Use of a mouse, characterized by the fact that it is to produce an immortalized cell line, in which the mouse is produced by a method, as defined in any of claims 1 to 8.
[13]
13. Use of a mouse, characterized by the fact that it is to produce a hybridoma or quadroma, in which the mouse is produced by a method, as defined in any one of claims 1 to 8.
[14]
14. Use of a mouse, characterized by the fact that it is to produce a nucleic acid sequence that encodes a variable region of immunoglobulin or fragment thereof, in which the mouse is produced by a method, as defined in any of the claims 1 to 8
[15]
15. Use according to claim 9, characterized by the fact that the mouse is used to produce an antigen-binding protein, and in which the antigen-binding protein is selected from an antibody, a multispecific antibody , an scFv, bis-scFV, a diabody, a three-body, a tetrabody, a V-NAR, a Vu, a V ,, an F (ab), an F (ab) ,, a dVD, an sVD, or a bispecific T cell linker.
[16]
16. Use of a mouse, characterized by the fact that it is to produce a medicine or to produce a sequence that encodes a variable sequence of a medicine, for the treatment of a human disease or disorder, in which the mouse is produced. produced by a method as defined in any one of claims 1 to 8.
[17]
17. Invention, characterized in any form of its embodiments or in any applicable category of claim, for example, product or process or use encompassed by the material initially described, revealed or illustrated in the patent application.

类似技术:

---

公开号 | 公开日 | 专利标题

---

JP6886002B2|2021-06-16|Humanized universal light chain mouse

---

US20200221675A1|2020-07-16|Humanized light chain mice

---

EP2813573B1|2020-04-22|Adam6 mice

---

NZ620586B2|2015-12-01|Humanized universal light chain mice

---

NZ710301B2|2017-08-29|Humanized universal light chain mice

同族专利:

---

公开号 | 公开日

---

IL273982D0|2020-05-31|

---

EP2739740A1|2014-06-11|

---

PT3572517T|2021-06-23|

---

CA2844070A1|2013-02-14|

---

RS61946B1|2021-07-30|

---

JP2020072695A|2020-05-14|

---

SG2014007686A|2014-03-28|

---

DK3572517T3|2021-06-14|

---

AU2018203592B2|2020-12-10|

---

JP2014524243A|2014-09-22|

---

JP6886002B2|2021-06-16|

---

RU2014108208A|2015-09-10|

---

AU2018203592A1|2018-06-14|

---

EP3865581A1|2021-08-18|

---

HUE047278T2|2020-04-28|

---

JP2021118746A|2021-08-12|

---

PT2739740T|2020-01-09|

---

SI3572517T1|2021-09-30|

---

EP3572517A1|2019-11-27|

---

HRP20210916T1|2021-09-03|

---

HRP20192255T1|2020-03-06|

---

JP2017006146A|2017-01-12|

---

AU2012294624A1|2013-05-02|

---

MX2014001454A|2014-06-04|

---

US20130198879A1|2013-08-01|

---

AU2015255276A1|2016-01-28|

---

WO2013022782A1|2013-02-14|

---

ZA201401006B|2015-04-29|

---

IL268413D0|2019-09-26|

---

CN103917650B|2017-10-24|

---

IL230766D0|2014-03-31|

---

LT3572517T|2021-04-26|

---

JP2019062906A|2019-04-25|

---

CN103917650A|2014-07-09|

---

AU2015255276B2|2018-02-22|

---

JP6510234B2|2019-05-08|

---

MX357623B|2018-07-17|

---

SG10201914002RA|2020-03-30|

---

DK2739740T3|2019-12-09|

---

IL230766A|2019-10-31|

---

AU2020277108A1|2020-12-24|

---

AU2012294624B2|2015-08-13|

---

IL268413A|2020-05-31|

---

EP3572517B1|2021-03-24|

---

ES2758051T3|2020-05-04|

---

NZ710301A|2017-05-26|

---

NZ620586A|2015-08-28|

---

US20190133094A1|2019-05-09|

---

SI2739740T1|2019-12-31|

---

RU2664232C2|2018-08-15|

---

JP6724126B2|2020-07-15|

---

CN107602696A|2018-01-19|

---

PL2739740T3|2020-06-01|

---

RS59728B1|2020-02-28|

---

LT2739740T|2019-11-11|

---

PL3572517T3|2021-10-04|

---

SG10201606158TA|2016-09-29|

---

MY172718A|2019-12-11|

---

EP2739740B1|2019-10-02|

---

US10130081B2|2018-11-20|

---

ES2872081T3|2021-11-02|

---

HUE055276T2|2021-11-29|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

GB8626412D0|1986-11-05|1986-12-03|Clark M R|Antibodies|

---

GB8626413D0|1986-11-05|1986-12-03|Gilliland L K|Antibodies|

---

AT190355T|1988-09-06|2000-03-15|Xoma Corp|GENEXPRESSION ELEMENTS AND PRODUCTION OF CHIMERAL MOUSE-HUMAN ANTIBODIES|

---

GB8823869D0|1988-10-12|1988-11-16|Medical Res Council|Production of antibodies|

---

WO1991000906A1|1989-07-12|1991-01-24|Genetics Institute, Inc.|Chimeric and transgenic animals capable of producing human antibodies|

---

US5574205A|1989-07-25|1996-11-12|Cell Genesys|Homologous recombination for universal donor cells and chimeric mammalian hosts|

---

US5959177A|1989-10-27|1999-09-28|The Scripps Research Institute|Transgenic plants expressing assembled secretory antibodies|

---

CA2075206C|1989-12-01|2006-05-23|Herbert L. Heyneker|Production of recombinant polypeptides by bovine species and transgenic methods|

---

US6713610B1|1990-01-12|2004-03-30|Raju Kucherlapati|Human antibodies derived from immunized xenomice|

---

US6150584A|1990-01-12|2000-11-21|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

AU633698B2|1990-01-12|1993-02-04|Amgen Fremont Inc.|Generation of xenogeneic antibodies|

---

EP0652950B1|1992-07-24|2007-12-19|Amgen Fremont Inc.|Generation of xenogeneic antibodies|

---

US6075181A|1990-01-12|2000-06-13|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

US6657103B1|1990-01-12|2003-12-02|Abgenix, Inc.|Human antibodies derived from immunized xenomice|

---

US6673986B1|1990-01-12|2004-01-06|Abgenix, Inc.|Generation of xenogeneic antibodies|

---

US6255458B1|1990-08-29|2001-07-03|Genpharm International|High affinity human antibodies and human antibodies against digoxin|

---

US5770429A|1990-08-29|1998-06-23|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

CA2161351C|1993-04-26|2010-12-21|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

US7041871B1|1995-10-10|2006-05-09|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

CA2089661C|1990-08-29|2007-04-03|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

US5667988A|1992-01-27|1997-09-16|The Scripps Research Institute|Methods for producing antibody libraries using universal or randomized immunoglobulin light chains|

---

US7067284B1|1992-01-27|2006-06-27|The Scripps Research Institute|Methods for producing antibody libraries using universal or randomized immunoglobulin light chains|

---

AT149570T|1992-08-17|1997-03-15|Genentech Inc|SPECIFIC IMMUNOADHESINE|

---

CZ140195A3|1992-12-01|1996-06-12|Protein Desing Labs|Humanized antibodies reacting with l-selectin|

---

GB9308271D0|1993-04-21|1993-06-02|Univ Edinburgh|Method of isolating and/or enriching and/or selectively propagating pluripotential animal cells and animals for use in said method|

---

US5877396A|1993-04-23|1999-03-02|Sloan Kettering Institute For Cancer Research|Mice mutant for functional Fc receptors and method of treating autoimmune diseases|

---

US5693506A|1993-11-16|1997-12-02|The Regents Of The University Of California|Process for protein production in plants|

---

US5827690A|1993-12-20|1998-10-27|Genzyme Transgenics Corporatiion|Transgenic production of antibodies in milk|

---

AT213771T|1993-12-23|2002-03-15|Infigen Inc|EMBRYONIC STEM CELLS OF HIP ANIMALS AS CORE DONATORS AND CORE TRANSFER TECHNIQUES FOR THE PRODUCTION OF CHIMERIC AND TRANSGENIC ANIMALS|

---

GB9401380D0|1994-01-25|1994-03-23|Pharmaceutical Proteins Ltd|Embryonic cell isolation|

---

ES2247204T3|1994-01-31|2006-03-01|Trustees Of Boston University|BANKS OF POLYCLONAL ANTIBODIES.|

---

US7119248B1|1994-04-12|2006-10-10|Miltenyi Biotec Gmbh|Antibodies against epitopes with homology to self antigens, methods of preparation and applications thereof|

---

US6080560A|1994-07-25|2000-06-27|Monsanto Company|Method for producing antibodies in plant cells|

---

US5731168A|1995-03-01|1998-03-24|Genentech, Inc.|Method for making heteromultimeric polypeptides|

---

EP0910409A4|1996-03-05|2003-03-19|Scripps Research Inst|Recombinant constructs encoding t cell receptors specific for human hla-restricted tumor antigens|

---

AT218143T|1996-09-03|2002-06-15|Gsf Forschungszentrum Umwelt|USE OF BI AND TRISPECIFIC ANTIBODIES FOR INDUCING TUMOR IMMUNITY|

---

US7084260B1|1996-10-10|2006-08-01|Genpharm International, Inc.|High affinity human antibodies and human antibodies against human antigens|

---

EP2305027B1|1996-12-03|2014-07-02|Amgen Fremont Inc.|Transgenic mammals having human Ig loci including plural VH and Vkappa regions and antibodies produced therefrom|

---

EP0973871A1|1997-03-06|2000-01-26|Infigen, Inc.|Method of cloning animals|

---

CN1203922A|1997-03-21|1999-01-06|三共株式会社|Humanized anti-human fas antibody|

---

DE69800716T2|1997-04-14|2001-09-20|Micromet Ges Fuer Biomedizinis|NEW METHOD FOR PRODUCING ANTI-HUMAN ANTIGENT RECEPTORS AND THEIR USE|

---

US20020062010A1|1997-05-02|2002-05-23|Genentech, Inc.|Method for making multispecific antibodies having heteromultimeric and common components|

---

CA2288600C|1997-05-02|2010-06-01|Genentech, Inc.|A method for making multispecific antibodies having heteromultimeric and common components|

---

US6774279B2|1997-05-30|2004-08-10|Carnegie Institution Of Washington|Use of FLP recombinase in mice|

---

JP3992298B2|1997-10-03|2007-10-17|中外製薬株式会社|Natural humanized antibody|

---

ES2308327T3|1997-11-18|2008-12-01|Pioneer Hi-Bred International, Inc.|COMPOSITIONS AND METHODS FOR GENETIC MODIFICATION OF PLANTS.|

---

GB9823930D0|1998-11-03|1998-12-30|Babraham Inst|Murine expression of human ig locus|

---

US6914128B1|1999-03-25|2005-07-05|Abbott Gmbh & Co. Kg|Human antibodies that bind human IL-12 and methods for producing|

---

RU10506U1|1999-04-08|1999-08-16|Кривулин Виталий Николаевич|MANUAL CULTIVATOR|

---

SI1533380T1|1999-04-15|2010-03-31|Crucell Holland Bv|Recombinant protein production in a human cell comprising at least one E1 protein of adenovirus|

---

JP2003501016A|1999-05-27|2003-01-14|ヒューマンジノームサイエンシーズ，インコーポレイテッド|ADAM polynucleotides and polypeptides|

---

GB0001448D0|2000-01-21|2000-03-08|Novartis Ag|Organic compounds|

---

AU4535801A|2000-02-29|2001-09-12|Univ Auburn|Production of antibodies in transgenic plastids|

---

RU2262511C2|2000-05-18|2005-10-20|Джапан Тобакко, Инк.|Humanized monoclonal antibody raised against ailim, co-stimulating molecule for signal transfer and its pharmaceutical applying|

---

US20020103345A1|2000-05-24|2002-08-01|Zhenping Zhu|Bispecific immunoglobulin-like antigen binding proteins and method of production|

---

CN1455817A|2000-07-21|2003-11-12|美利坚合众国|Methods for replacement, translocation and stacking of DNA in eukaryotic genomes|

---

US7129084B2|2000-08-03|2006-10-31|Therapeutic Human Polyclonals, Inc.|Production of humanized antibodies in transgenic animals|

---

EP1184458A1|2000-08-28|2002-03-06|U-BISys B.V.|Differentially expressed CD46 epitopes, proteinaceous molecules capable of binding thereto, and uses thereof|

---

US20020119148A1|2000-09-01|2002-08-29|Gerritsen Mary E.|ErbB4 antagonists|

---

US6596541B2|2000-10-31|2003-07-22|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US7105348B2|2000-10-31|2006-09-12|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US6586251B2|2000-10-31|2003-07-01|Regeneron Pharmaceuticals, Inc.|Methods of modifying eukaryotic cells|

---

US7449179B2|2000-11-16|2008-11-11|Cornell Research Foundation, Inc.|Vectors for conditional gene inactivation|

---

TWI255272B|2000-12-06|2006-05-21|Guriq Basi|Humanized antibodies that recognize beta amyloid peptide|

---

DE10064750A1|2000-12-22|2002-06-27|Bayer Ag|Production of 1,6-hexane diol for use in polyester or polyurethane production involves reacting formaldehyde with propene to form a homo-allyl alcohol, catalytic metathesis to 3-hexene-1,6-diol and catalytic hydrogenation|

---

SK287954B6|2001-01-05|2012-07-03|Pfizer Inc.|Human monoclonal antibody or antigen-binding portion thereof that specifically binds to IGF-IR, pharmaceutical composition comprising the antibody or antigen-binding portion thereof, isolated cell line producing the antibody, isolated nucleic acid molecule, vector, host cell, transgenic animal, method of making of antibody or antigen-binding portion thereof and use of the antibody and the isolated nucleic acid molecule|

---

US6961875B2|2001-03-22|2005-11-01|International Business Machines Corporation|Method and apparatus for capturing event traces for debug and analysis|

---

GB0110029D0|2001-04-24|2001-06-13|Grosveld Frank|Transgenic animal|

---

US7034134B2|2001-04-26|2006-04-25|Bristol-Myers Squibb Company|Polynucleotide encoding a novel metalloprotease highly expressed in the testis, MMP-29|

---

US7074611B2|2001-04-27|2006-07-11|Gie-Cerbn, Centre Europeen De Recherche En Biologie Et En Medecine |Method for the stable inversion of DNA sequence by site-specific recombination and DNA vectors and transgenic cells thereof|

---

JP4115281B2|2001-05-11|2008-07-09|キリンファーマ株式会社|Human artificial chromosome containing human antibody λ light chain gene, and non-human animal containing the human artificial chromosome capable of offspring transmission|

---

AT477280T|2001-06-28|2010-08-15|Domantis Ltd|DOUBLE-SPECIFIC LIGAND AND ITS USE|

---

JP2005538706A|2001-07-12|2005-12-22|ジェファーソン フーテ，|Super humanized antibody|

---

US20030138440A1|2001-07-19|2003-07-24|Fang Fang|Multimeric proteins and methods of making and using same|

---

EP1298207B2|2001-10-01|2015-12-30|Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts|Methods of producing protein libraries and selection of proteins from them|

---

WO2003031656A1|2001-10-05|2003-04-17|United States Environmental Protection Agency|Genetic testing for male factor infertility|

---

US20060199204A1|2001-10-05|2006-09-07|U.S. Epa|Genetic testing for male factor infertility|

---

DK1461442T3|2001-11-30|2017-12-04|Amgen Fremont Inc|Transgenic animals with human Ig lambda light chain genes|

---

GB0130267D0|2001-12-19|2002-02-06|Neutec Pharma Plc|Focussed antibody technology|

---

US20050095712A1|2002-01-17|2005-05-05|Alberto Martin|Mutations caused by activation-induced cytidine deaminase|

---

JP2005527490A|2002-01-18|2005-09-15|イノヴィオアーエス|Bispecific antibody DNA constructs for intramuscular administration|

---

AU2003235833A1|2002-04-26|2003-11-10|Chugai Seiyaku Kabushiki Kaisha|Method of screening agonistic antibody|

---

US20040023880A1|2002-05-03|2004-02-05|Gale Nicholas W.|Methods of inducing formation of functional and organized lymphatic vessels|

---

CA2489467C|2002-06-14|2015-02-24|Immunomedics, Inc.|Humanized monoclonal antibody hpam4|

---

CN101962408A|2002-07-12|2011-02-02|杰斐逊·富特|Super-humanized antibody|

---

DK2314629T3|2002-07-18|2014-01-20|Merus B V|Recombinant preparation of mixtures of antibodies|

---

AR042145A1|2002-11-27|2005-06-08|Dow Agrociences Llc|IMMUNOGLOBULIN PRODUCTION IN PLANTS WITH A REDUCED FUCOCILATION|

---

GB0228210D0|2002-12-03|2003-01-08|Babraham Inst|Single chain antibodies|

---

GB0230203D0|2002-12-27|2003-02-05|Domantis Ltd|Fc fusion|

---

GB0230201D0|2002-12-27|2003-02-05|Domantis Ltd|Retargeting|

---

EP1439234A1|2003-01-08|2004-07-21|ARTEMIS Pharmaceuticals GmbH|Targeted transgenesis using the rosa26 locus|

---

US8337841B2|2003-01-21|2012-12-25|Chugai Seiyaku Kabushiki Kaisha|Methods of screening for antibody light chains|

---

US20060153826A1|2003-01-28|2006-07-13|Sylvain Arnould|Use of meganucleases for inducing homologous recombination ex vivo and in toto in vertebrate somatic tissues and application thereof|

---

US20070009957A1|2003-03-04|2007-01-11|Alexion Pharmaceuticals, Inc.|Vectors used to create hybrid constant regions|

---

EP2395016A3|2003-05-30|2012-12-19|Merus B.V.|Design and use of paired variable regions of specific binding molecules|

---

WO2005001087A2|2003-06-11|2005-01-06|Regeneron Pharmaceuticals, Inc.|Methods of modifying genes in eukaryotic cells|

---

EP1644417B1|2003-07-15|2014-04-30|Therapeutic Human Polyclonals, Inc.|Humanized immunoglobulin loci|

---

US20050153392A1|2003-08-11|2005-07-14|Roland Buelow|Transgenesis with humanized immunoglobulin loci|

---

RU2251699C1|2003-09-25|2005-05-10|Киселев Всеволод Иванович|Method for early and preclinical diagnostics of cervical cancer|

---

WO2005038001A2|2003-10-14|2005-04-28|Therapeutic Human Polyclonals, Inc.|Improved transgenesis by sperm-mediated gene transfer|

---

CA2550551C|2004-01-16|2013-10-29|Regeneron Pharmaceuticals, Inc.|Fusion polypeptides capable of activating receptors|

---

EP1723235B1|2004-02-12|2012-06-27|The Walter And Eliza Hall Institute Of Medical Research|Modified cells that co-express blimp1 and a reporter molecule and methods of using the same|

---

CN1560081A|2004-02-17|2005-01-05|大连帝恩生物工程有限公司|Preparing human source monoclone antibody by mouse capable of producing human IgGl weight chain-k light chain and application thereof|

---

US7625549B2|2004-03-19|2009-12-01|Amgen Fremont Inc.|Determining the risk of human anti-human antibodies in transgenic mice|

---

CA2827654C|2004-10-19|2019-04-02|Regeneron Pharmaceuticals, Inc.|Method for generating an animal homozygous for a genetic modification|

---

EP1812065A4|2004-10-22|2009-09-02|Medimmune Inc|High affinity antibodies against hmgb1 and methods of use thereof|

---

WO2006047367A2|2004-10-22|2006-05-04|Therapeutic Human Polyclonals, Inc.|Suppression of endogenous immunoglubolin expression in non-human transgenic animals|

---

WO2006056617A1|2004-11-26|2006-06-01|Frankgen Biotechnologie Ag|Gene trap cassettes for random and targeted conditional gene inactivation|

---

EP1662005A1|2004-11-26|2006-05-31|FrankGen Biotechnologie AG|Enhancer-containing gene trap vectors for random and targeted gene trapping|

---

US20110041370A1|2005-04-21|2011-02-24|Saint Andre M|Face sheet, identification band, and related methods|

---

WO2006117699A2|2005-04-29|2006-11-09|Innate Pharma|Transgenic animals and methods of making recombinant antibodies|

---

EP1896578A4|2005-05-14|2008-11-05|Univ Fudan|Piggybac as a tool for genetic manipulation and analysis in vertebrates|

---

EP3002330A1|2005-05-27|2016-04-06|Ospedale San Raffaele S.r.l.|Gene vector|

---

AT416465T|2005-06-30|2008-12-15|Borealis Tech Oy|COATING LAYER FOR ENERGY OR COMMUNICATION CABLE|

---

FR2888850B1|2005-07-22|2013-01-11|Pf Medicament|NOVEL ANTI-IGF-IR ANTIBODIES AND THEIR APPLICATIONS|

---

AU2006322445B2|2005-12-05|2011-05-12|Symphogen A/S|Anti-orthopoxvirus recombinant polyclonal antibody|

---

TWI404727B|2006-01-25|2013-08-11|Univ Erasmus Medical Ct|Allelic exclusion|

---

GB2434578A|2006-01-26|2007-08-01|Univ Basel|Transgenic animals|

---

US7462759B2|2006-02-03|2008-12-09|Pioneer Hi-Bred International, Inc.|Brittle stalk 2 gene family and related methods and uses|

---

GB0615327D0|2006-03-30|2006-09-13|Univ Edinburgh|Culture medium containing kinase inhibitors and uses thereof|

---

US7910798B2|2006-03-31|2011-03-22|Medarex, Inc.|Transgenic animals expressing chimeric antibodies for use in preparing human antibodies|

---

MY147468A|2006-06-02|2012-12-14|Regeneron Pharma|High affinity antibodies to human il-6 receptor|

---

WO2007149246A2|2006-06-12|2007-12-27|Massachusetts Institute Of Technology|Cre-lox based gene knockdown constructs and methods of use thereof|

---

JP2010501165A|2006-08-22|2010-01-21|ジーツーインフラメイションプロプライエタリーリミテッド|Antibody production method|

---

ES2378407T3|2006-09-01|2012-04-12|Therapeutic Human Polyclonals, Inc.|Increased expression of human or humanized immunoglobulin in non-human transgenic animals|

---

US7608693B2|2006-10-02|2009-10-27|Regeneron Pharmaceuticals, Inc.|High affinity human antibodies to human IL-4 receptor|

---

CA2664343C|2006-10-02|2016-04-26|Regeneron Pharmaceuticals, Inc.|High affinity human antibodies to human il-4 receptor|

---

RU2448979C2|2006-12-14|2012-04-27|Ридженерон Фармасьютикалз, Инк.|Human antibodies to delta-like human ligand-4|

---

GB0700194D0|2007-01-05|2007-02-14|Univ Edinburgh|Humanisation of animals|

---

EP2583551A1|2007-03-13|2013-04-24|National Jewish Health|Methods for generation of antibodies|

---

WO2008112226A2|2007-03-13|2008-09-18|Massachusetts Institute Of Technology|Cre-lox based gene knockdown constructs and methods of use thereof|

---

GB0706628D0|2007-04-04|2007-05-16|Univ Erasmus|Germ-line manipulation 1|

---

KR102096731B1|2007-06-01|2020-04-02|오픈 모노클로날 테크놀로지, 인코포레이티드|Compositions and methods for inhibiting endogenous immunoglobulin genes and producing transgenic human idiotype antibodies|

---

WO2009013620A2|2007-06-11|2009-01-29|Erasmus University Medical Center Rotterdam|Homologous recombination|

---

ITMI20071522A1|2007-07-27|2009-01-28|Areta Internat S R L|IDIOTYPIC VACCINE|

---

EP2185692A4|2007-08-10|2012-05-02|Medarex Inc|Hco32 and hco27 and related examples|

---

BRPI0815416A2|2007-08-15|2014-10-21|Amunix Inc|COMPOSITIONS AND METHODS FOR MODIFYING PROPERTIES OF BIOLOGICALLY ACTIVE POLYPEPTIDES|

---

BRPI0815848A2|2007-08-30|2017-06-06|The Burnet Inst|compound, stable antibody-producing cell line, composition, methods for modulating an immune response in an individual and for treating and / or preventing disease, uses of a compound and / or composition and dendritic cells or precursors thereof, methods to enrich and detect dendritic cells or a subset or precursors thereof, polypeptide, vector polynucleotide, host cell, transgenic plant, transgenic non-human animal, extract, process for preparing a compound or polypeptide, enriched dendritic cell population and / or precursors expanded dendritic cell population and / or precursors thereof, methods for identifying a molecule that binds to a polypeptide and screening for a compound that binds to a polypeptide, use of a polypeptide, a polynucleotide, a vector , a host cell, a transgenic plant, an extract, a cell population and / or a composition. tion, method for producing a compound, and kit.|

---

MX2010002661A|2007-09-14|2010-05-20|Adimab Inc|Rationally designed, synthetic antibody libraries and uses therefor.|

---

EP2050764A1|2007-10-15|2009-04-22|sanofi-aventis|Novel polyvalent bispecific antibody format and uses thereof|

---

WO2009051974A1|2007-10-17|2009-04-23|Nuvelo, Inc.|Antibodes to cll-1|

---

US7659842B2|2007-10-24|2010-02-09|Infineon Technologies Ag|Quantization error reduction in PWM full-MASH converters|

---

PL2222706T5|2007-12-14|2017-09-29|Novo Nordisk As|Antibodies against human nkg2d and uses thereof|

---

ES2563027T3|2008-01-07|2016-03-10|Amgen Inc.|Method for manufacturing antibody Fc heterodimer molecules using electrostatic conduction effects|

---

EP2262898B1|2008-03-07|2018-01-24|Regeneron Pharmaceuticals, Inc.|Es cell-derived mice from diploid host embryo injection|

---

CA2721231C|2008-04-14|2015-10-06|Innovative Targeting Solutions Inc.|Sequence diversity generation in immunoglobulins|

---

US20110123527A1|2008-05-23|2011-05-26|Hiroaki Shizuya|Method of generating single vl domain antibodies in transgenic animals|

---

US20100069614A1|2008-06-27|2010-03-18|Merus B.V.|Antibody producing non-human mammals|

---

EP3456190B1|2008-06-27|2021-11-24|Merus N.V.|Antibody producing transgenic murine animal|

---

CA3038954A1|2008-09-30|2010-04-08|Ablexis, Llc|Non-human mammals for the production of chimeric antibodies|

---

DK2356270T3|2008-11-07|2016-12-12|Fabrus Llc|Combinatorial antibody libraries and uses thereof|

---

US8497325B2|2008-12-15|2013-07-30|Exxonmobil Chemical Patents Inc.|Thermoplastic polyolefin blends and films therefrom|

---

SG172176A1|2008-12-18|2011-07-28|Univ Erasmus Medical Ct|Non-human transgenic animals expressing humanised antibodies and use therof|

---

EP2401298A1|2009-02-24|2012-01-04|Glaxo Group Limited|Antigen-binding constructs|

---

GB0905023D0|2009-03-24|2009-05-06|Univ Erasmus Medical Ct|Binding molecules|

---

RU2011149353A|2009-05-07|2013-06-20|Вольво Констракшн Эквипмент Аб|WORKING MACHINE AND METHOD FOR MANAGING ITS WORK|

---

CA2758356C|2009-05-29|2016-07-26|Morphosys Ag|A collection of vh and vl pairs having favourable biophysical properties and methods for its use|

---

KR101904065B1|2009-06-26|2018-10-04|리제너론 파마슈티칼스 인코포레이티드|Readily isolated bispecific antibodies with native immunoglobulin format|

---

WO2011158009A1|2010-06-17|2011-12-22|Kymab Limited|Animal models and therapeutic molecules|

---

US20120204278A1|2009-07-08|2012-08-09|Kymab Limited|Animal models and therapeutic molecules|

---

EP2517557B1|2009-07-08|2016-04-13|Kymab Limited|Animal models and therapeutic molecules|

---

RU2425880C2|2009-07-30|2011-08-10|Учреждение Российской академии наук Институт общей генетики им. Н.И. Вавилова РАН|Method of producing transgene mice|

---

AU2010320130B2|2009-11-17|2015-03-12|Sab, Llc|Human artificial chromosome vector|

---

LT2954779T|2009-12-10|2019-05-27|Regeneron Pharmaceuticals, Inc.|Mice that make heavy chain antibodies|

---

JP6529957B2|2013-03-13|2019-06-12|リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Mice Expressing Limited Immunoglobulin Light Chain Repertoire|

---

US20120021409A1|2010-02-08|2012-01-26|Regeneron Pharmaceuticals, Inc.|Common Light Chain Mouse|

---

KR102283195B1|2010-02-08|2021-07-29|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

US20130045492A1|2010-02-08|2013-02-21|Regeneron Pharmaceuticals, Inc.|Methods For Making Fully Human Bispecific Antibodies Using A Common Light Chain|

---

US20130185821A1|2010-02-08|2013-07-18|Regeneron Pharmaceuticals, Inc.|Common Light Chain Mouse|

---

US9796788B2|2010-02-08|2017-10-24|Regeneron Pharmaceuticals, Inc.|Mice expressing a limited immunoglobulin light chain repertoire|

---

KR20150126863A|2013-03-13|2015-11-13|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

CA2797981C|2010-05-14|2019-04-23|Rinat Neuroscience Corporation|Heterodimeric proteins and methods for producing and purifying them|

---

MY165287A|2010-06-22|2018-03-21|Regeneron Pharma|Mice expressing a light chain with human lambda variable and mouse constant regions|

---

WO2012018764A1|2010-08-02|2012-02-09|Regeneron Pharmaceuticals, Inc.|Mice that make binding proteins comprising vl domains|

---

WO2012063048A1|2010-11-08|2012-05-18|Kymab Limited|Cells & vertebrates for enhanced somatic hypermutation and class switch recombination|

---

ES2748832T3|2011-02-25|2020-03-18|Regeneron Pharma|ADAM6 mice|

---

HUE047278T2|2011-08-05|2020-04-28|Regeneron Pharma|Humanized universal light chain mice|

---

CN102957766A|2011-08-18|2013-03-06|佛山正能光电有限公司|Mobile device with detachable camera module|

---

WO2013041845A2|2011-09-19|2013-03-28|Kymab Limited|Animals, repertoires & methods|

---

EP3128009B1|2011-09-19|2020-07-29|Kymab Limited|Antibodies, variable domains & chains tailored for human use|

---

CA2791109C|2011-09-26|2021-02-16|Merus B.V.|Generation of binding molecules|

---

EP2761008A1|2011-09-26|2014-08-06|Kymab Limited|Chimaeric surrogate light chains comprising human vpreb|

---

PL2627773T3|2011-10-17|2017-11-30|Regeneron Pharmaceuticals, Inc.|Restricted immunoglobulin heavy chain mice|

---

GB2496375A|2011-10-28|2013-05-15|Kymab Ltd|A non-human assay vertebrate comprising human antibody loci and human epitope knock-in, and uses thereof|

---

MX356429B|2011-12-20|2018-05-29|Regeneron Pharma|Humanized light chain mice.|

---

GB201122047D0|2011-12-21|2012-02-01|Kymab Ltd|Transgenic animals|

---

DK3597038T3|2012-02-01|2021-06-28|Regeneron Pharma|Humanized rodents expressing heavy chains containing VL domains|

---

US9253965B2|2012-03-28|2016-02-09|Kymab Limited|Animal models and therapeutic molecules|

---

US20150196637A1|2012-04-20|2015-07-16|Merus B.V.|Methods and means for the production of ig-like molecules|

---

KR102266274B1|2012-06-12|2021-06-17|리제너론 파마슈티칼스 인코포레이티드|Humanized non-human animals with restricted immunoglobulin heavy chain loci|US20120204278A1|2009-07-08|2012-08-09|Kymab Limited|Animal models and therapeutic molecules|

---

JP6529957B2|2013-03-13|2019-06-12|リジェネロン・ファーマシューティカルズ・インコーポレイテッドＲｅｇｅｎｅｒｏｎ Ｐｈａｒｍａｃｅｕｔｉｃａｌｓ， Ｉｎｃ．|Mice Expressing Limited Immunoglobulin Light Chain Repertoire|

---

US20130045492A1|2010-02-08|2013-02-21|Regeneron Pharmaceuticals, Inc.|Methods For Making Fully Human Bispecific Antibodies Using A Common Light Chain|

---

US9796788B2|2010-02-08|2017-10-24|Regeneron Pharmaceuticals, Inc.|Mice expressing a limited immunoglobulin light chain repertoire|

---

KR102283195B1|2010-02-08|2021-07-29|리제너론 파마슈티칼스 인코포레이티드|Common light chain mouse|

---

RU2014153674A|2012-06-05|2016-07-27|Регенерон Фармасьютикалз, Инк.|METHOD FOR PRODUCING FULLY HUMAN BASSPECIFIC ANTIBODIES USING A GENERAL EASY LIGHT CHAIN|

---

JP6482757B2|2010-07-26|2019-03-13|トリアンニ インコーポレイテッドＴｒｉａｎｎｉ，Ｉｎｃ．|Transgenic animals and methods of use|

---

US10662256B2|2010-07-26|2020-05-26|Trianni, Inc.|Transgenic mammals and methods of use thereof|

---

US10793829B2|2010-07-26|2020-10-06|Trianni, Inc.|Transgenic mammals and methods of use thereof|

---

WO2012018764A1|2010-08-02|2012-02-09|Regeneron Pharmaceuticals, Inc.|Mice that make binding proteins comprising vl domains|

---

ES2748832T3|2011-02-25|2020-03-18|Regeneron Pharma|ADAM6 mice|

---

HUE047278T2|2011-08-05|2020-04-28|Regeneron Pharma|Humanized universal light chain mice|

---

EP3128009B1|2011-09-19|2020-07-29|Kymab Limited|Antibodies, variable domains & chains tailored for human use|

---

EP2761008A1|2011-09-26|2014-08-06|Kymab Limited|Chimaeric surrogate light chainscomprising human vpreb|

---

PL2627773T3|2011-10-17|2017-11-30|Regeneron Pharmaceuticals, Inc.|Restricted immunoglobulin heavy chain mice|

---

MX356429B|2011-12-20|2018-05-29|Regeneron Pharma|Humanized light chain mice.|

---

GB201122047D0|2011-12-21|2012-02-01|Kymab Ltd|Transgenic animals|

---

US20140013456A1|2012-03-16|2014-01-09|Regeneron Pharmaceuticals, Inc.|Histidine Engineered Light Chain Antibodies and Genetically Modified Non-Human Animals for Generating the Same|

---

CA2865644A1|2012-03-16|2013-09-19|Regeneron Pharmaceuticals, Inc.|Mice that produce antigen-binding proteins with ph-dependent binding characteristics|

---

ES2849349T3|2012-03-16|2021-08-17|Regeneron Pharma|Histidine Engineered Light Chain Antibodies and Genetically Modified Rodents for Generation|

---

EP2825037B1|2012-03-16|2019-05-01|Regeneron Pharmaceuticals, Inc.|Rodents expressing ph-sensitive immunoglobulin sequences|

---

US9445581B2|2012-03-28|2016-09-20|Kymab Limited|Animal models and therapeutic molecules|

---

US9253965B2|2012-03-28|2016-02-09|Kymab Limited|Animal models and therapeutic molecules|

---

US10251377B2|2012-03-28|2019-04-09|Kymab Limited|Transgenic non-human vertebrate for the expression of class-switched, fully human, antibodies|

---

GB2502127A|2012-05-17|2013-11-20|Kymab Ltd|Multivalent antibodies and in vivo methods for their production|

---

KR102266274B1|2012-06-12|2021-06-17|리제너론 파마슈티칼스 인코포레이티드|Humanized non-human animals with restricted immunoglobulin heavy chain loci|

---

RU2017114166A|2013-02-20|2019-01-29|Регенерон Фармасьютикалс, Инк.|NON-HUMAN ANIMALS WITH MODIFIED SEQUENCES OF HEAVY IMMUNOGLOBULIN CHAINS|

---

US9788534B2|2013-03-18|2017-10-17|Kymab Limited|Animal models and therapeutic molecules|

---

US20150033372A1|2013-05-01|2015-01-29|Kymab Limited|Human VpreB & Chimaeric Surrogate Light Chains in Transgenic Non-Human Vertebrates|

---

US9783618B2|2013-05-01|2017-10-10|Kymab Limited|Manipulation of immunoglobulin gene diversity and multi-antibody therapeutics|

---

US9783593B2|2013-05-02|2017-10-10|Kymab Limited|Antibodies, variable domains and chains tailored for human use|

---

AU2014330922A1|2013-10-01|2016-03-03|Kymab Limited|Animal models and therapeutic molecules|

---

WO2015112790A2|2014-01-24|2015-07-30|Children's Medical Center Corporation|High-throughput mouse model for optimizing antibody affinities|

---

RU2016141307A3|2014-03-21|2018-10-24|

---

KR20160131118A|2014-03-21|2016-11-15|리제너론 파마슈티칼스 인코포레이티드|Vl antigen binding proteins exhibiting distinct binding characteristics|

---

US11111314B2|2015-03-19|2021-09-07|Regeneron Pharmaceuticals, Inc.|Non-human animals that select for light chain variable regions that bind antigen|

---

EP3341485A4|2015-08-24|2019-03-27|Trianni, Inc.|Enhanced production of immunoglobulins|

---

KR20180070604A|2015-10-09|2018-06-26|리제너론 파마슈티칼스 인코포레이티드|Anti-LAG3 antibody and its use|

---

CN105274116B|2015-10-21|2020-09-29|重庆金迈博生物科技有限公司|Nucleic acid molecule for preparing humanized antibody and application thereof|

---

EP3384030A4|2015-12-03|2019-07-03|Trianni, Inc.|Enhanced immunoglobulin diversity|

---

JP6929877B2|2016-02-04|2021-09-01|トリアニ・インコーポレイテッドＴｒｉａｎｎｉ， Ｉｎｃ．|Enhancement of immunoglobulin production|

---

BR112018071285A2|2016-04-20|2019-02-12|Regeneron Pharma|cell, vector set, vector, system, and method|

---

SG11201809552SA|2016-05-20|2018-11-29|Regeneron Pharma|Methods for breaking immunological tolerance using multiple guide rnas|

---

CN113907043A|2016-06-03|2022-01-11|瑞泽恩制药公司|Non-human animals expressing exogenous terminal deoxynucleotidyl transferase|

---

BR112019016336A2|2017-02-10|2020-03-31|Regeneron Pharmaceuticals, Inc.|RADIORROTULATED ANTIBODY CONJUGATE, METHOD FOR IMAGING A FABRIC EXPRESSING LAG3 AND TO TREAT A TUMOR, AND, COMPOUND.|

---

CA3093995A1|2018-03-24|2019-10-03|Regeneron Pharmaceuticals, Inc.|Genetically modified non-human animals for generating therapeutic antibodies against peptide-mhc complexes, methods of making and uses thereof|

---

EP3927832A1|2019-02-18|2021-12-29|Biocytogen PharmaceuticalsCo., Ltd.|Genetically modified non-human animals with humanized immunoglobulin locus|

---

SG11202111258TA|2019-06-05|2021-11-29|Regeneron Pharma|Non-human animals having a limited lambda light chain repertoire expressed from the kappa locus and uses thereof|

---

WO2021113297A1|2019-12-02|2021-06-10|Regeneron Pharmaceuticals, Inc.|Peptide-mhc ii protein constructs and uses thereof|

法律状态:
2020-11-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-11-17| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2021-05-04| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|

---

2021-05-18| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161515374P| true| 2011-08-05|2011-08-05|

---

US61/515,374|2011-08-05|

---

PCT/US2012/049600|WO2013022782A1|2011-08-05|2012-08-03|Humanized universal light chain mice|

---