ACETYL-COA PRODUCING MICRO-ORGANISM, METHODS FOR PRODUCING ACETYL-COA, ACETONE, ISOPROPYL ALCOHOL AN

专利摘要:
microorganism that has carbon dioxide fixation cycle introduced into it, an acetyl-coa-producing microorganism, which is capable of efficiently synthesizing acetyl-coa using carbon dioxide, and a method of producing substances that uses it are provided. an acetyl-coa-producing microorganism that includes an acetyl-coa production cycle obtained by transmission of at least one type of enzymatic activity selected from the group consisting of malate thiokinase, malyl-coaliase, glyoxylate carboligase, 2-hydroxy -3-oxopropionate reductase and hydroxypyruvate reductase, to a microorganism.
公开号:BR112014001662B1
申请号:R112014001662-3
申请日:2012-07-27
公开日:2021-09-14
发明作者:Ryota Fujii；Tomokazu Shirai；Tadashi Araki；Koh Amano；Yoshiko Matsumoto；Nozomi Takebayashi；Takashi Morishige；Hitoshi Takahashi；Mitsufumi Wada；Hiroshi Shimizu；Chikara Furusawa；Takashi Hirasawa；Ayako Endo；Dominik Lukas Jürgen-Lohmann；Anjali Madhavan；Su Sun Chong
申请人:Mitsui Chemicals, Inc；
IPC主号:

专利说明:

technical field
[001] The present invention is related to an acetyl-CoA producing microorganism and a method of producing a substance using the acetyl-CoA producing microorganism. Fundamentals of technique
[002] Acetyl-CoA is one of the significantly important intermediaries in metabolic pathways of microorganisms. Several metabolites are produced through acetyl-CoA. Well-known examples of such substances produced by means of acetyl-CoA include amino acids such as, for example, L-glutamic acid, L-glutamine, L-proline, L-arginine, L-leucine and L-isoleucine; organic acids such as acetic acid, propionic acid, butyric acid, caproic acid, citric acid, 3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid and poly-3- hydroxybutyric; alcohols such as isopropyl alcohol, ethanol and butanol; acetone; and polyglutamic acids.
[003] In most microorganisms, acetyl-CoA is produced using a sugar, such as glucose, as a carbon source. Sugar is first converted to pyruvate through a metabolic pathway called the glycolytic pathway, for example, the Embden-Meyerhof pathway, Entner-Doudoroff pathway, or the pentose phosphate pathway. Subsequently, pyruvate is converted to acetyl-CoA by the actions of decarboxylase, pyruvate formate lyase, and the like. In this process, carbon dioxide and formate are generated as by-products, and some of the carbon derived from sugar will be lost. Therefore, several studies were carried out with the objective of obtaining the refixation of carbon dioxide in order to increase the yield of acetyl-CoA.
[004] In microorganisms, there are several known pathways for fixation of carbon dioxide as a carbon source (Appl. Environ. Microbiol. 77(6), 1925-1936, 2011). Specific examples of pathways include the carbon cycle Calvin-Benson, the TCA reductive cycle, the Wood-Ljungdahl pathway, the 3-hydroxypropionate cycle, and the 4-hydroxybutyrate cycle. The Calvin-Benson cycle is a CO2 fixation pathway that exists in photosynthetic plants and bacteria, and contains about 12 types of enzymes. In the Calvin-Benson cycle, CO2 is fixed by ribulose-1,5-bisphosphate carboxylase (RubisCO) and ultimately glyceraldehyde 3-phosphate is produced. The TCA reductive cycle is found in microaerophilic bacteria and anaerobic bacteria including green sulfur bacteria, and contains 11 types of enzymes. This cycle is characterized by CO2-fixing enzymes (ie, acetyl-CoA carboxylase, 2-oxoglutarate synthase) that require ferredoxin as a coenzyme. In the TCA reductive cycle, pyruvate is produced from CO2 by the reverse reaction of the common TCA cycle. The Wood-Ljungdahl pathway is found in anaerobic microorganisms such as acetic acid-producing bacteria and contains 9 types of enzymes. In the Wood-Ljungdahl pathway, CO2 and formate in a coenzyme are reduced by formate dehydrogenase, CO dehydrogenase etc., and ultimately converted to acetyl-CoA. The 3-hydroxypropionate cycle is found in Chloroflexus and similar bacteria and contains 13 types of enzymes. In the 3-hydroxypropionate cycle, CO2 is fixed by the action of acetyl-CoA (propionyl-CoA) carboxylase and acetyl-CoA is produced through malonyl-CoA and the like. The 4-hydroxybutyrate cycle exists in archaebacteria and the like. In the 4-hydroxybutyrate cycle, CO2 is fixed by the actions of pyruvate synthase, acetyl-CoA (propionyl-CoA) carboxylase, and phosphoenolpyruvate carboxylase, whereby acetyl-CoA is produced through 4-hydroxybutyryl CoA and the like.
[005] In order to produce a useful substance, several approaches have been reported as ideas to introduce a carbon dioxide fixation pathway into a useful compound-producing microorganism. For example, International Publication (WO) 2009/094485 and WO 2010/071697 disclose approaches to the production of acetyl-CoA from carbon dioxide, using a microorganism to which a pathway similar to the Wood-Ljungdahl pathway of acetic acid bacteria was introduced. As an example of CO2 fixation to produce a useful compound, WO 2009/046929 discloses an approach for producing lactic acid from carbon dioxide by using a microorganism to which hydrogenase and tetrahydrofolate lyase have been introduced. WO 2011/099006 proposes a cycle in which CO2 is fixed via a carbon dioxide fixation reaction to acetyl-CoA or a malonyl-CoA reduction reaction. German Patent No. 102007059248 proposes the production of acetyl-CoA in a similar way to the 4-hydroxybutyrate cycle. SUMMARY OF THE INVENTION Technical problem
[006] However, known carbon dioxide fixation cycles are not necessarily efficient from the standpoints of CO2 fixation and production of useful chemicals derived from acetyl-CoA. For example, the Calvin-Benson cycle is most famous as a carbon dioxide fixation cycle found in nature, but RubisCO, involved in carbon dioxide fixation, has a low reaction rate and causes side reactions like, for example, example, oxidative degradation. Therefore, RubisCO is inefficient as an enzyme (Journal of Bioscience and Bioengineering 94(6) 497-505, 2002). In the Wood-Ljungdahl route and the routes described in WO 2009/094485, WO 2010/071697, WO 2009/046929 and the like, a route for reducing CO2 to CO or formate is included. However, the reduction reaction hardly takes place under ordinary conditions, and the enzyme that catalyzes this type of strong reduction reaction often only works under a reductive environment. Therefore, it is difficult to introduce this type of pathway in microorganisms other than strictly anaerobic microorganisms. In the TCA reductive cycle, a reduction reaction by pyruvate synthase or 2-oxoglutarate synthase requires a strong reducing power of ferredoxin as an electron acceptor, and the reaction is difficult to carry out. The 4-hydroxybutyrate cycle, 3-hydroxypropionate cycle and the routes described in WO 2011/099006, WO 2009/046929, and the like use the reduction reaction to carboxylic acid or a (thio)ester thereof, e.g. succinyl-CoA or malonyl-CoA reduction. However, it is generally difficult to carry out this type of reaction as an enzymatic reaction, and it is desirable to avoid them as fermentation pathways when possible (Atsumi et al., Nature, 451, (3), 86-89, 2008; Yim et al., Nat. Chem. Biol., 7, 445-452, 2011). The 4-hydroxybutyrate cycle proceeds through a dehydration reaction such as 4-hydroxybutyryl CoA dehydration or 3-hydroxypropionate dehydration, but this cycle has a disadvantage in that this type of dehydration reaction often competes. with the reverse reaction (hydration) in water. In the 4-hydroxybutyrate cycle, in the 3-hydroxypropionate cycle, and in the TCA reductive cycle, the acetyl-CoA produced is converted into other substances within the cycle by the action of malonyl-CoA synthase or pyruvate synthase. Therefore, these cycles are not necessarily efficient from the standpoint of acetyl-CoA production.
[007] When trying to produce a certain substance by introducing this type of cycle to a microorganism, it is necessary to consider the number of enzymes involved in the cycle and the number of enzymatic activities to be further transmitted. That is, when the number of enzymes involved in the cycle or the number of enzymatic activities to be further transmitted increases, regulation becomes more difficult and the load on the microorganism increases. For example, in order to introduce the Wood-Ljungdahl pathway into Escherichia coli, it is necessary to introduce at least 9 types of genes. It would be a practically very difficult task to build a substance-producing pathway and also introduce and regulate so many genes. It would clearly be advantageous to construct a cycle that includes a small number of enzymes affecting a smaller number of enzymes, in terms of constructing the cycle and in terms of combination with another pathway of substance production.
[008] Consequently, in order to fix CO2 and convert it into acetyl-CoA, it would be ideal for (A) each enzyme involved in the pathway to have a sufficiently high activity; (B) the cycle does not include an enzyme that consumes acetyl-CoA; and (C) the cycle has a simple configuration and a small number of newly transmitted enzymes. However, none of the cycles for producing acetyl-CoA from CO2 reported so far satisfies all of the conditions (A) to (C) and therefore the possibility of carrying out these cycles is low. In fact, with regard to proposals regarding existing carbon dioxide fixation cycles, there was almost no real example of converting CO2 to acetyl-CoA or a substance derived from acetyl-CoA for use in transmission fermentation of an activity. enzyme to an industrially usable microorganism.
[009] The present invention provides a microorganism useful for the efficient production of acetyl-CoA using carbon dioxide, and a method of producing acetyl-CoA or a useful acetyl-CoA derivative metabolite using the microorganism. Solution to the problem
[010] The aspect of the invention is as follows.(a) [1] An acetyl-CoA producing microorganism that includes a cycle of acetyl-CoA production obtained by transmitting at least one type of enzymatic activity selected from the group consisting of in thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, 2-hydroxy-3-oxopropionate reductase, and hydroxypyruvate reductase, to a microorganism that has none of: (b) a carbon dioxide fixation cycle that has an enzymatic reaction of malonyl-CoA in semialdehyde malonate or 3-hydroxypropionate; (c) a carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate; (d) a carbon dioxide fixation cycle that has an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA; (e) a carbon dioxide fixation cycle that has an enzymatic reaction of CO2 in formate; or (f) at least one selected from the group consisting of malate thiokinase and malyl-CoA lyase,
[011] in which none of (a), (b), (c) or (d) is transmitted to the microorganism, or the microorganism does not exhibit any of the functions of (a), (b), (c) and (d), even though at least one of (a), (b), (c) or (d) is transmitted.
[012] [2] The acetyl-CoA producing microorganism according to [1], which includes an acetyl-CoA production cycle in which phosphoenolpyruvate or pyruvate is converted to oxaloacetate, and then to 2-hydroxy-3-oxopropionate as a function of the actions of thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, and then to phosphoenol pyruvate again through 2-phosphoglycerate.
[013] [3] The acetyl-CoA producing microorganism according to [1] or [2], which comprises an acetyl-CoA production cycle comprising:
[014] (f) at least one selected from the group consisting of:
[015] pyruvate kinase and pyruvate carboxylase;
[016] phosphoenolpyruvate carboxylase; and
[017] phosphoenolpyruvate carboxykinase;
[018] (g) malate dehydrogenase;
[019] (h) thiokinase malate;
[020] malyl-CoA lyase;
[021] (j) glyoxylate carboligase;
[022] (k) at least one selected from the group consisting of:
[023] 2-hydroxy-3-oxopropionate reductase; and
[024] hydroxypyruvate isomerase and hydroxypyruvate reductase;
[025] (l) at least one selected from the group consisting of:
[026] glycerate 2-kinase; and
[027] phosphoglycerate mutase and glycerate 3-kinase; and
[028] (m) enolase.
[029] [4] The acetyl-CoA producing microorganism according to any one of [1] to [3], wherein the microorganism is a microorganism that belongs to the Enterobacteriaceae or a microorganism that belongs to the coryneform bacteria.
[030] [5] The acetyl-CoA producing microorganism according to any one of [1] to [4], wherein the microorganism is from the Escherichia bacteria or Pantoea bacteria belonging to the Enterobacteriaceae, or the microorganism is from the Corynebacterium bacteria that belong to coryneform bacteria.
[031] [6] The acetyl-CoA producing microorganism according to any one of [1] to [5], wherein the microorganism is an Escherichia bacterium in which a lactate dehydrogenase activity possessed by the Escherichia bacterium is inactivated or reduced .
[032] [7] The acetyl-CoA producing microorganism according to any one of [1] to [6], wherein the microorganism is an Escherichia bacterium in which an activity of at least one enzyme selected from the group consisting of isocitrate lyase and malate synthase possessed by Escherichia bacteria is inactivated or reduced.
[033] [8] The acetyl-CoA producing microorganism according to any one of [1] to [7], wherein the microorganism is an Escherichia bacterium in which a thiolase activity, a CoA transferase activity and an activity of acetoacetate decarboxylase are transmitted or increased.
[034] [9] The acetyl-CoA producing microorganism according to any one of [1] to [8], wherein the microorganism is an Escherichia bacterium in which a thiolase activity, a CoA transferase activity, an activity of acetoacetate decarboxylase, and an isopropyl alcohol dehydrogenase activity are transmitted or increased.
[035] [10] The acetyl-CoA producing microorganism according to any one of [1] to [5], wherein the microorganism is a Pantoea bacterium in which fumarate hydratase A and fumarate hydratase C activities possessed by the Pantoea bacterium are inactivated or reduced.
[036] [11] The acetyl-CoA producing microorganism according to any one of [1] to [5] or [10], wherein the microorganism is a Pantoea bacterium in which a malate synthase activity possessed by the Pantoea bacterium is disabled or reduced.
[037] [12] The acetyl-CoA producing microorganism according to any one of [1] to [11], wherein the thiokinase malate used is a thiokinase malate obtained by modifying mtkB derived from Methylobacterium extorquens in order to alter an amino acid corresponding to the 144th amino acid in isoleucine, asparagine, aspartic acid, lysine, arginine, histidine, glutamine or proline, and/or in order to change the 244th amino acid into glutamic acid, alanine, leucine, isoleucine, methionine, asparagine , tyrosine, lysine or arginine.
[038] [13] A method of producing acetyl-CoA, which comprises producing acetyl-CoA from a carbon source material using the acetyl-CoA producing microorganism according to any one of [1] to [12].
[039] [14] A method of producing acetone, which comprises producing acetone from a carbon source material using the acetyl-CoA producing microorganism according to [9] or [12].
[040] [15] A method of producing isopropyl alcohol, which comprises the production of isopropyl alcohol from a carbon source material using the acetyl-CoA producing microorganism according to [9] or [12].
[041] [16] A method of producing glutamate, which comprises the production of glutamate from a carbon source material using the acetyl-CoA producing microorganism according to [5], [10], [11] or [12]. Advantageous Effects of the Invention
[042] The invention provides a microorganism useful for the efficient conversion of carbon dioxide to acetyl-CoA, and a method of producing acetyl-CoA or a useful metabolite using the microorganism. BRIEF DESCRIPTION OF THE DRAWINGS
[043] Fig. 1 is a route diagram for illustrating the description of the carbon dioxide fixation route according to an embodiment of the invention.
[044] Fig. 2A and Fig. 2B show the homology between various mtkB sequences.
[045] Fig. 3A and Fig. 3B show the homology between various mtkA sequences.
[046] Fig. 4 is a graph showing the 13C incorporation pattern of glutamate produced by various Pantoea bacteria according to Example 41.
[047] Fig. 5 is a graph showing the 13C incorporation pattern of glutamate produced by various Corynebacterium bacteria according to Example 50. DESCRIPTION OF MODALITIES
[048] The acetyl-CoA producing microorganism of the invention is an acetyl-CoA producing microorganism that includes a cycle of acetyl-CoA production obtained by transmitting at least one type of enzymatic activity selected from the group consisting of malate thiokinase, malyl-CoA lyase, glyoxylate carboligase, 2-hydroxy-3-oxopropionate reductase, and hydroxypyruvate reductase, to a microorganism having none of the following (a), (b), (c), (d) or (e) in that none of (a), (b), (c) or (d) is transmitted to the micro-organism, or the micro-organism exhibits none of the functions of (a), (b), (c) and (d), even though at least one of (a), (b), (c) or (d) is transmitted. (a) a carbon dioxide fixation cycle that has an enzymatic reaction of malonyl-CoA to semialdehyde malonate or 3-hydroxypropionate; (b) a carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate; (c) a carbon dioxide fixation cycle that has an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA; (d) a carbon dioxide fixation cycle that has an enzymatic reaction of CO2 in formate; or (e) at least one selected from the group consisting of malate thiokinase and malyl-CoA lyase.
[049] According to the invention, by transmitting a predetermined enzymatic activity, a carbon dioxide fixation cycle can be constructed that fixes CO2 generated during carbohydrate metabolism or CO2 supplied from abroad, and provided an acetyl-producing microorganism. CoA which has an acetyl-CoA production cycle in which CO2 is efficiently converted to acetyl-CoA.
[050] That is, as a result of several studies on the conversion of CO2 to acetyl-CoA, it was found that CO2 was converted to acetyl-CoA by transmission of at least one type of enzymatic activity selected from the group consisting of malate thiokinase, malyl-CoA lyase, glyoxylate carboligase, 2-hydroxy-3-oxopropionate reductase, and hydroxypyruvate reductase, to a microorganism that has none of: (a) a carbon dioxide fixation cycle that has an enzymatic reaction of malonyl-CoA in semialdehyde malonate or 3-hydroxypropionate; (b) a carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate; (c) a carbon dioxide fixation cycle that has an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA; (d) a carbon dioxide fixation cycle that has an enzymatic reaction of CO2 in formate; or (e) at least one selected from the group consisting of malate thiokinase and malyl-CoA lyase,
[051] in which none of (a), (b), (c) or (d) is transmitted to the micro-organism, or the micro-organism does not exhibit any of the functions of (a), (b), (c) and (d), even though at least one of (a), (b), (c) or (d) is transmitted.
[052] Furthermore, by using the acetyl-CoA producing microorganism that converts CO2 into acetyl-CoA, or additionally by transmitting a predetermined enzymatic activity to the microorganism, substances that include acetyl-CoA and useful metabolites derived from acetyl- CoA such as isopropyl alcohol, ethanol, acetone, citric acid, itaconic acid, acetic acid, butyric acid, (poly-)3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, acid methacrylic, (poly)glutamic acid, glutamic acid, arginine, ornithine, citrulline, leucine, isoleucine or proline are efficiently produced.
[053] The invention proposes the simplest and most practical acetyl-CoA production cycle that fixes CO2 and converts it into acetyl-CoA (Fig. 1).
[054] Preferred embodiments of the acetyl-CoA production cycle according to the invention include the acetyl-CoA production cycle shown in Fig. 1 (hereafter may be called "Fig. 1 cycle").
[055] The cycle involves 8 to 10 types of enzymes, consisting of,
[056] - at least one selected from the group consisting of:
[057] phosphoenolpyruvate carboxylase;
[058] phosphoenolpyruvate carboxykinase, and
[059] pyruvate carboxylase and pyruvate kinase;
[060] malate dehydrogenase;
[061] thiokinase malate;
[062] malyl-CoA lyase;
[063] glyoxylate carboligase;
[064] - at least one selected from the group consisting of:
[065] hydroxypyruvate isomerase and hydroxypyruvate reductase;
[066] 2-hydroxy-3-oxopropionate reductase;
[067] - at least one selected from the group consisting of:
[068] glycerate 2-kinase; and
[069] phosphoglycerate mutase and glycerate 3-kinase; and
[070] enolase.
[071] A (phosphoenol)pyruvate carboxylase or phosphoenolpyruvate carboxykinase is involved in carbon dioxide fixation. (Phosphoenol)pyruvate carboxylase is a carbon dioxide-fixing enzyme that has a high activity. For example, RubisCO used in photosynthesis in plants or the like is known to have a specific activity of about 3 U/mg to 20 U/mg (J. Biol. Chem. 274(8) 5,078-82 (1999), Anal. Biochem. 153(1) 97-101, 1986). On the other hand, (phosphoenol)pyruvate carboxylase has been reported to have a specific activity of 30 U/mg in Escherichia coli, or up to 100 U/mg to 150 U/mg (J. Biol. Chem. 247, 5785-5,792 (1972); Biosci. Biotechnol. Biochem. 59, 140-142 (1995); Biochim. Biophys. Acta. 1475 (3): 191-206, 2000). In terms of malate thiokinase (mtk) which synthesizes malyl-CoA, the present study revealed that malate thiokinase according to the invention has a higher activity compared to that of conventionally known enzymes (J. Biol. Chem. 248(21) 7295 303, 1973). The cycle in Fig. 1 is composed of 8 to 10 types of enzymes and is therefore the simplest cycle among known acetyl-CoA production cycles. It is only necessary for a small number of enzymes to be transmitted to the microorganism. Furthermore, the cycle of Fig. 1 does not include an enzyme that consumes acetyl-CoA. Therefore, it can be said that the cycle in Fig. 1 is a cycle for optimal CO2 fixation and converts it to acetyl-CoA.
[072] Another advantage of the cycle of Fig. 1 is that, insofar as the cycle is independent of glycolytic pathways, the cycle can be freely combined with multiple glycolytic pathways. For example, the cycle in Fig. 1 can be easily combined with one that produces NADPH with a high production rate and is often used in the production of substances (Japanese National Publication (JP-A) No. 2007-510411), to the extent wherein the cycle of Fig. 1 is independent of the pentose phosphate pathway.
[073] In the cycle of Fig. 1, each of malate dehydrogenase (mdh), 2-hydroxy-3-oxopropionate reductase (glxR), and hydroxypyruvate reductase (ycdW) consumes NADH (or NADPH) as the reducing power; each of thiokinase malate (mtk), glycerate 3-kinase (glxK), glycerate 2-kinase (garK), and pyruvate carboxylase (pyc) consumes ATP; and pyruvate kinase (pyk) produces pyruvate.
[074] When phosphoenolpyruvate is used as the starting substance, the balanced equation for the cycle in Fig. 1 is: “phosphoenolpyruvate + 2CoA + CO2 + 3NAD(P)H + 3ATP ^ 2-acetyl- CoA + 3NAD(P) + + 3ADP".
[075] When pyruvate is used as the starting substance, the balanced equation is: “pyruvate + 2CoA + CO2 + 3NAD(P)H + 4ATP ^ 2-acetyl—CoA + 3NAD(P)+ + 4ADP”.
[076] That is, the cycle in Fig. 1 requires supplementation of phosphoenolpyruvate (or pyruvate), NAD(P)H and ATP for CO2 fixation and its conversion into acetyl-CoA.
[077] Among the fermentation pathways that produce acetyl-CoA as an intermediate, balanced equations of pathways that consume oxygen during fermentation are listed in Table 1. It is assumed that, in these fermentation pathways, a reduced coenzyme such as, for example, NADH, is produced during the pathway and the reduced coenzyme is reconverted to the oxidized form by the action of oxygen. Therefore, if it is possible to consume the reduced coenzyme produced by the cycle in Fig. 1 instead of consuming oxygen, it can be expected that the reducing power generated in the fermentation can be efficiently used in the acetyl-CoA production cycles for CO2 and CO2 fixation. its conversion into products.
[078] Here, the term "reduced coenzyme" refers to a coenzyme in the reduced state and involved in an oxidation-reduction reaction, and examples of these include NADH, NADPH, FADH2, FMNH2 and the reduced quinone coenzyme. The reduced coenzyme is preferably NADH or NADPH, more preferably NADH. The term "oxidized coenzyme" refers to the oxidized form of a reduced coenzyme, and examples of these include NAD+, NADP+, FAD, FMN and an oxidized quinone coenzyme. The oxidized coenzyme is preferably NAD+ or NADP+, more preferably NAD+. Table 1

[079] As shown in Table 1, fermentation in which oxygen is present on the left side of the fermentation equation often requires a large amount of oxygen. In such cases, intense aeration and/or vigorous agitation may be necessary, which results in increases in equipment and electrical energy costs. Therefore, by introducing the cycle of Fig. 1, excess reducing power can be consumed and excessive aeration/agitation can be moderated, and it is expected that the cost of fermentation production can be reduced.
[080] In order to provide the reducing power to the cycle according to the invention, the reducing power can be provided by adding a substance that can generate a reducing power, or transmit energies from outside. Specific examples of these include using a substance that has a greater degree of reduction (eg hydrogen, sulfite, alcohols or paraffin) as a substrate; supply of reduction energies directly by electric culture; and supplying a reducing power by a photochemical reaction in an organism. In addition to the fermentation shown in Table 1, since the reducing power can be supplied from abroad, it is possible to direct the desired carbon dioxide fixation pathway even in a fermentation in which a reduced coenzyme is not produced.
[081] Aspects of the present invention are described below.
[082] The term "CO2 fixation" in the invention refers to that of CO2 generated in the metabolism of carbohydrates or CO2 supplied from abroad into an organic compound. CO2 can be HCO3-. Here, “CO2 fixation” can also be called “carbon dioxide fixation”.
[083] The term “process” in this descriptive report encompasses an independent process as well as a process that obtains a desired effect from the process, although it cannot be clearly distinguished from another process. In this descriptive report, a numeric range indicated using “to” means a range that includes numeric values given before and after “to” as a minimum value and a maximum value, respectively.
[084] In the invention, in reference to the amount of each ingredient in the composition, when the composition includes plural substances corresponding to each ingredient, the amount of (each) ingredient means the total amount of the various substances unless otherwise specified .
[085] As used herein, the term "inactivation" refers to a condition in which the activity of the enzyme (here, a factor that does not exhibit enzymatic activity by itself is also included in the scope of "enzyme", unless specifically indicated to be excluded), as measured by any existing measurement system, is not greater than 1/10 of the activity in the microorganism prior to inactivation, assuming that the activity in the microorganism prior to inactivation is 100.
[086] The "reduction" of an enzyme activity in the invention means a condition in which the enzyme activity is significantly reduced by a genetic recombination technique for a gene encoding the enzyme, compared to that before such treatment.
[087] The "increase" of an "activity" in the invention broadly means that an enzyme activity in microorganisms becomes greater after increase, compared to the enzyme activity before the increase.
[088] Methods for augmentation are not particularly restricted, as long as the activity of an enzyme possessed by microorganisms is increased. Examples include augmentation by an enzyme gene introduced from outside the cell, augmentation by increased expression of an enzyme gene within the cell, and any combination of these.
[089] Specific examples of augmentation by an enzyme gene introduced from outside the cell include: introduction of a gene encoding an active enzyme that has a higher activity than the host enzyme from outside the host microorganism cell by the technique of genetic recombination thereby adding the enzymatic activity of the introduced enzyme gene; substitution of the introduced enzyme activity for an intrinsic enzyme activity that the host originally possesses; increasing the copy number of a host enzyme gene or an enzyme gene introduced from outside the cell to two or more; and any combination of these.
[090] Specific examples of increased expression increase of an enzyme gene in the microorganism include: introduction of a base sequence that increases the expression of an enzyme gene from outside the host microorganism into the microorganism; substitution of another promoter for the promoter of an enzyme gene that the host microorganism has in its genome, thus increasing the expression of the enzyme gene; and any combination of these.
[091] The "transmission" of an "activity" in the invention broadly means providing the activity of a desired enzyme by introducing a gene encoding the enzyme from the outside into an organism that lacks a gene encoding the desired enzyme . The method of transmitting an activity is not particularly limited, as long as the activity of a desired enzyme can be transmitted to a microorganism, and examples include transformation with a plasmid harboring an enzyme gene, introducing an enzyme gene into the genome, and any combination of these.
[092] The promoter to be used for the "enhancement" or "transmission" of an "activity" is not particularly limited, as long as the promoter allows gene expression, and examples of this include constitutive promoters and inducible promoters.
[093] Whether or not the microorganism has the desired enzyme gene can be determined, with reference, for example, to the genetic information of the respective strains registered in KEGG (“Kyoto Encyclopedia of Genes and Genomes”; http://www.genome .jp/kegg/) or NCBI (“National Center for Biotechnology Information”; http://www.ncbi.nlm.nih.gov/gene/). In the invention, only the genetic information of respective strains registered in KEGG or NCBI is used.
[094] In the invention, enzymatic activity can be transmitted by introducing, from the outside, a gene encoding the enzyme into the cell using the technique of genetic recombination. In that case, the enzyme gene to be introduced can be homologous or heterologous to the host cell.
[095] Methods for preparing a genomic DNA necessary to introduce a gene from outside the cell into the cell, DNA cleavage and ligation, transformation, PCR (polymerase chain reaction), for the design and synthesis of oligonucleotides to be used as initiators etc. can be performed by common methods well known to those skilled in the art. These methods are described in Sambrook, J., et al., "Molecular Cloning A Laboratory Manual", Second Edition", Cold Spring Harbor Laboratory Press (1989) etc.
[096] The expression "by genetic recombination technique" in the invention encompasses any change to the base sequence caused by the insertion of another DNA into the base sequence of a native gene, substitution or deletion of a certain site in a gene, or any combinations thereof . For example, the alternation could result from a mutation.
[097] In the invention, the microorganism in which the activity of a factor or enzyme is inactivated refers to a microorganism in which the native activity is transmitted by a certain method applied from outside the cell to inside the cell. This microorganism can be generated, for example, by disruption of a gene that encodes the protein or enzyme (gene disruption).
[098] Examples of gene disruption in the invention include introducing a mutation to the base sequence of a gene, inserting another DNA into the base sequence, or deleting a certain part of a gene, which are performed in order to prevent the gene's function is carried out. As a result of gene disruption, for example, the gene becomes incapable of being transcribed into mRNA, and the structural gene stops being translated. Alternatively, due to the incomplete characteristic of the transcribed mRNA, the amino acid sequence of the translated structural protein is mutated or deleted and, therefore, the intrinsic functions of the structural protein are impossible to occur.
[099] The gene disruption variant can be prepared using any method, so long as the disruption variant in which the target enzyme or protein is not expressed can be obtained. Several methods for gene disruption have been reported (natural crossover, addition of a mutagen, UV irradiation, radiation irradiation, random mutagenesis, transposons, site-directed gene disruption). In view of disrupting only a specific gene, gene disruption by homologous recombination is preferable. Methods of gene disruption by homologous recombination are described in J. Bacteriol., 161, 1219-1,221 (1985), J. Bacteriol., 177, 1511-1519 (1995), Proc. Natl. Academic Sci. U.S.A., 97, 6,640-6,645 (2000), and the like, and those skilled in the art can easily perform homologous recombination using these methods or by applying these methods.
[100] The "host" in the invention means a microorganism in a state that the effect of the invention can be exerted as a result of introducing one or more genes from outside the microorganism.
[101] More specifically, the "host" in the invention means a microorganism that may acquire the ability to produce acetyl-CoA from a carbon source material by using a certain medium, regardless of whether the microorganism inherently possesses the ability innate to produce acetyl-CoA from a carbon source material.
[102] The "host" in the invention may have a pathway to produce a useful metabolite. The "useful metabolite" in the invention is used as a generic name for metabolites important in the metabolic pathways of microorganisms, for example alcohols, amino acids, organic acids and terpenes. The microorganism can be any microorganism, so long as it can acquire the ability to produce a useful metabolite by using any means, regardless of whether the microorganism intrinsically possesses the innate ability to produce the useful metabolite.
[103] The "useful acetyl-CoA derived metabolite" in the invention refers to any of several metabolites produced via acetyl-CoA in metabolic pathways. Examples of these include alcohols such as isopropyl alcohol, ethanol or butanol; amino acids such as, for example, L-glutamic acid, L-glutamine, L-arginine, L-ornithine, L-citrulline, L-leucine, L-isoleucine, or L-proline; organic acids such as 3-hydroxybutyric acid, poly-3-hydroxybutyric acid, polyglutamic acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, citric acid, acetic acid, propionic acid, acid butyric, caproic acid or mevalonic acid; and terpenes such as isoprene, squalene, steroid or carotenoid. Other examples of these include acetone. The microorganism can be any microorganism, as long as it can acquire the ability to produce a useful acetyl-CoA derived metabolite by using a certain medium, regardless of whether or not the microorganism intrinsically possesses the innate ability to produce the derived metabolite of useful acetyl-CoA.
[104] The "production of acetyl-CoA" in the invention refers to the conversion of any substance to acetyl-CoA in a metabolic pathway. As acetyl-CoA is a metabolic intermediate and is rapidly converted to various substances in metabolic pathways, the apparent amount of acetyl-CoA does not necessarily increase. However, the effect can be indirectly confirmed by detecting a CO2-derived marker in an acetyl-CoA-derived substance, by an increase in the yield of an acetyl-CoA-derived substance relative to sugar consumption, or the like. As several factors (eg, the amount of a coenzyme, the amount of a substrate, or a change in metabolism caused by a feedback inhibition) are involved in the conversion, the amount of acetyl-CoA production is not always proportional to the amount. of each of the acetyl-CoA-derived substances. However, when a pathway to produce a specific substance from acetyl-CoA is increased or when such a pathway is intrinsically increased (eg in the case of an isopropyl alcohol producing microorganism or a glutamate producing microorganism described below ), the conversion efficiency of acetyl-CoA is hardly affected by external factors and therefore the production efficiency of the specific substance can be considered as an index of the production efficiency of acetyl-CoA.
[105] The acetyl-CoA producing microorganism according to the invention includes a cycle of acetyl-CoA production obtained by transmitting at least one type of enzymatic activity selected from the group consisting of thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, 2-hydroxy-3-oxopropionate reductase and hydroxypyruvate reductase, to a microorganism that has none of: (a) a carbon dioxide fixation cycle that has an enzymatic reaction of malonyl-CoA to semialdehyde malonate or 3-hydroxypropionate ; (b) a carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate; (c) a carbon dioxide fixation cycle that has an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA; (d) a carbon dioxide fixation cycle that has an enzymatic reaction of CO2 in formate; or (e) at least one selected from the group consisting of malate thiokinase and malyl-CoA lyase,
[106] in which none of (a), (b), (c) or (d) is transmitted to the micro-organism, or the micro-organism exhibits none of the functions of (a), (b), (c) and (d), even though at least one of (a), (b), (c) or (d) is transmitted.
[107] In view of the efficiency of acetyl-CoA production, the acetyl-CoA producing microorganism preferably receives the enzymatic activities of malate thiokinase and malyl-CoA lyase, more preferably receives the enzymatic activities of malate thiokinase, malyl-CoA lyase and glyoxylate carboligase even more preferably receives the enzymatic activities of malate thiokinase, malyl-CoA lyase, glyoxylate carboligase and 2-hydroxy-3-oxopropionate reductase, and/or hydroxypyruvate reductase.
[108] The expression “does not have (naturally)” here means that the host microorganism does not intrinsically possess an attribute in nature.
[109] Here, the "carbon dioxide fixation cycle having an enzymatic reaction of malonyl-CoA to semialdehyde malonate or 3-hydroxypropionate" refers to the following cycles (1) to (7): [1] the cycle shown in Fig. 1 of WO 2011/099006, wherein acetyl-CoA is converted to malonyl-CoA, 3-hydroxypropionate, propionyl-CoA, malate and malyl-CoA, which are converted back to acetyl-CoA; [2] the cycle shown in Fig. 4A of WO 2011/099006, wherein acetyl-CoA is converted to malonyl-CoA, semialdehyde malonate, β-alanine, malate and malyl-CoA, which are again converted to acetyl-CoA; [3] the cycle shown in Fig. 4B, 16 or 18 of WO 2011/099006, wherein acetyl-CoA is converted to malonyl-CoA, hydroxypropionate, (R)-lactate or (S)-lactate, malate and malyl- CoA, which are converted back to acetyl-CoA; [4] the cycle shown in Fig. 8 of WO 2011/099006, wherein acetyl-CoA is converted to malonyl-CoA, semialdehyde malonate or hydroxypropionate, pyruvate, malate and malyl-CoA, which are again converted to acetyl-CoA; [5] the cycle shown in Fig. 9A, 9B or 9C of WO 2011/099006, where acetyl-CoA is converted to malonyl-CoA, hydroxypropionate, 2-ketoglutarate, malate and malyl-CoA, which are again converted to acetyl-CoA -CoA; [6] the cycle shown in Fig. 9D or 9F of WO 2011/099006, where acetyl-CoA is converted to malonyl-CoA, hydroxypropionate, methylmalonyl-CoA, malate and malyl-CoA, which are again converted to acetyl-CoA ; and [7] the cycle shown in Fig. 17 of WO 2011/099006, wherein acetyl-CoA is converted to malonyl-CoA, semialdehyde malonate or hydroxypropionate, methylmalonyl-CoA, pyruvate, oxaloacetate, malate and malyl-CoA, which are again converted to acetyl-CoA.
[110] All carbon dioxide fixation cycles (1) to (7) described above have an enzymatic reaction of malonyl-CoA in semialdehyde malonate or malonyl-CoA in 3-hydroxypropionate. This type of reaction is catalyzed by malonate semialdehyde dehydrogenase or malonyl-CoA reductase (WO 2011/099006). It is believed that the reduction reaction of carboxylic acid or a (thio)ester thereof, for example the reduction of succinyl-CoA or reduction of malonyl-CoA, is generally difficult to carry out as enzymatic reactions and should be avoided as pathways of fermentation when possible (Atsumi et al., Nature, 451,(3), 86-89, 2008; Yim et al., Nat. Chem. Biol., 7, 445-452, 2011).
[111] The "carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate" in this descriptive report refers to the following cycles (8) to (10):
[112] (8) the cycle shown in Fig. 1 of WO 2011/099006, wherein acetyl-CoA is converted to pyruvate, phosphoenolpyruvate, oxaloacetate, malate and malyl-CoA, which are again converted to acetyl-CoA;
[113] (9) the cycle shown in Fig. 7C, 7D or 7E of WO 2011/099006, wherein acetyl-CoA is converted to pyruvate, malate and malyl-CoA, which are converted back to acetyl-CoA; and
[114] (10) the cycle shown in Fig. 9M of WO 2011/099006, in which acetyl-CoA is converted to pyruvate, 2-ketoglutarate, malate and malyl-CoA, which are again converted to acetyl-CoA.
[115] All carbon dioxide fixation cycles (8) to (10) have an enzymatic reaction that converts acetyl-CoA and CO2 to pyruvate. This reaction is catalyzed by pyruvate synthase (WO 2011/099006). The synthetic reaction of pyruvate by pyruvate synthase requires a strong reducing power of ferredoxin and proceeds slowly, and proceeds only under strictly anaerobic conditions, as the reaction is sensitive to oxygen.
[116] The “carbon dioxide fixation cycle having an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA” in this specification refers to the cycle shown in Fig. 9H or 9J of WO 2011 /099006, where acetyl-CoA is converted to crotonyl-CoA, ethylmalonyl-CoA or glutaconyl-CoA, oxaloacetate, malate and malyl-CoA, which are again converted to acetyl-CoA.
[117] The conversion of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA is catalyzed by crotonyl-CoA carboxylase-reductase or methylcrotonyl-CoA carboxylase. As the Km value of crotonyl-CoA carboxylase-reductase for carbonates is high (14 mM; PNAS 104(25) 10.631-10.636, 2007), sufficient activity is not expected at a low substrate concentration. Crotonyl-CoA, which is a substrate for crotonyl-CoA carboxylase reductase, is produced from 3-hydroxybutyryl-CoA by a dehydration reaction. In general, an enzyme involved in a dehydration reaction predominantly catalyzes the reverse reaction (ie, hydration reaction) in an aqueous environment. Therefore, a sufficiently high production rate of crotonyl-CoA cannot be expected. Furthermore, the reported specific activity of methylcrotonyl-CoA carboxylase is not as high (0.2 U/mg to 0.6 U/mg; Arch. Biochem. Biophys. 310(1) 64-75, 1994), and a Sufficiently high production rate of crotonyl-CoA as a substrate cannot be expected for the same reason.
[118] The "carbon dioxide fixation cycle having an enzymatic reaction of CO2 in shape" in this specification refers to the cycle shown in Figs. 5, 6, 13 or 14 of WO 2009/046929, ie a cycle that has a pathway in which the reaction proceeds from CO2 via formate and serine, and oxaloacetate is converted to malate, malyl-CoA and glycerate , which are converted back to oxaloacetate.
[119] The enzymatic reaction of CO2 in forma requires strong reducing power, proceeds slowly, and proceeds only under strictly anaerobic conditions, as the reaction is sensitive to oxygen.
[120] In the present specification, “does not exhibit any of the functions” of the carbon dioxide fixation cycle “although it possesses it” means that the carbon dioxide fixation cycle exhibits no function, even when the desired enzyme activity it is transmitted by introducing a gene that encodes the enzyme that has the activity and is introduced into a microorganism that does not have the gene that encodes the desired enzyme. The fact that “the carbon dioxide fixation cycle does not work” can be indirectly confirmed, for example, by the absence of detection of a CO2-derived marker in a metabolite in the cycle or a substance derived from the metabolite in a test using a Marked CO2, or by the absence of an increase in the yield of a substance derived from a metabolite in the cycle in relation to sugar consumption.
[121] The acetyl-CoA production cycle to be constructed in the acetyl-CoA producing microorganism includes malate thiokinase, malyl-CoA lyase, hydroxypyruvate reductase, glyoxylate carboligase, or 2-hydroxy-3-oxopropionate reductase. An example of the acetyl-CoA production cycle is shown in Fig. 1. The acetyl-CoA production cycle does not include an enzyme that consumes acetyl-CoA, for example, acetyl-CoA carboxylase or pyruvate synthase.
[122] In the acetyl-CoA production cycle of Fig. 1, carbon dioxide is first bound to phosphoenolpyruvate or pyruvate by the action of phosphoenolpyruvate carboxylase (ppc), pyruvate carboxylase (pyc) or phosphoenolpyruvate carboxykinase (pck), and converted to oxaloacetate. Oxaloacetate is converted to malate by the action of malate dehydrogenase (mdh). Malate is converted to malyl-CoA (CoA malate) by the action of thiokinase malate (mtk). Malyl-CoA (CoA malate) is converted to acetyl-CoA and glyoxylate by the action of malyl-CoA lyase (Mcl). Glyoxylate is converted to 2-hydroxy-3-oxopropionate by the action of glyoxylate carboligase (gcl). 3-hydroxy-2-oxopropionate is converted to glycerate by the action of 2-hydroxy-3-oxopropionate reductase (glxR) or alternatively converted to hydroxypyruvate by the action of hydroxypyruvate isomerase (hyi) and then to glycerate by the action of hydroxypyruvate reductase (ycdW). Glycerate is converted to 3-phosphoglycerate by the action of glycerate 3-kinase (glxK), or converted to 2-phosphoglycerate by the action of glycerate 2-kinase (garK). 3-phosphoglycerate is converted to 2-phosphoglycerate by the action of phosphoglycerate mutase (gpm). 2-phosphoglycerate is converted to phosphoenolpyruvate by the action of enolase (ene). When pyruvate carboxylase is included in the cycle, phosphoenolpyruvate is converted to pyruvate by the action of pyruvate kinase (pyk).
[123] The enzymatic activity to be transmitted to the acetyl-CoA producing microorganism is not particularly limited, as long as the acetyl-CoA production cycle can be so functionally constructed, and can be properly selected within the scope described in this descriptive report , depending on the host microorganism.
[124] In a microorganism in which a closed loop cannot be formed with any of the pathways in Fig. 1 because of the partial absence of enzymes in the loop in Fig. 1, the missing enzyme(s) need be provided. For example, among Escherichia bacteria. Escherichia coli lacks thiokinase malate and malyl-CoA lyase, so at least these two enzymes need to be transmitted.
[125] Pantoea bacteria such as Pantoea ananatis lack malate thiokinase, malyl-CoA lyase, and glyoxylate carboligase, such that at least malate thiokinase, malyl-CoA lyase, and glyoxylate carboligase need to be transmitted.
[126] Among coryneform bacteria, eg Corynebacterium glutamicum, lack thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, 2-hydroxy-3-oxopropionate reductase, and hydroxypyruvate reductase, such that at least thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, and 2-hydroxy-3-oxopropionate reductase, and/or hydroxypyruvate reductase must be transmitted.
[127] The enzyme that consumes acetyl-CoA, as described above, refers to an enzyme that uses acetyl-CoA as a substrate and catalyzes the conversion of acetyl-CoA to another substance. Examples of these include acetyl-CoA carboxylase, which is classified as enzyme code number: 6.4.1.2 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB) and catalyzes a reaction to convert acetyl-CoA to malonyl -CoA; and pyruvate synthase, which is classified as enzyme code number: 1.2.7.1 and catalyzes a reaction to convert acetyl-CoA to pyruvate.
[128] The cycle that includes an acetyl-CoA consuming enzyme, as described above, refers to a closed cycle in which acetyl-CoA is converted, through the cycle, to acetyl-CoA again by the action of an acetyl-CoA consuming enzyme acetyl-CoA. When a substance produced by the conversion reaction of an enzyme consuming acetyl-CoA is further converted to another product without being converted to acetyl-CoA again (eg when the substance is converted via an isopropyl alcohol producing pathway into the product end, isopropyl alcohol), the cycle is not closed and therefore the cycle is excluded from the “cycle that includes an enzyme consuming acetyl-CoA”.
[129] The closed loop refers to a pathway from an arbitrary substance in the cycle, in which the substance is converted through the cycle into another substance and eventually converted into the same substance as the starting substance.
[130] Thiokinase malate is a generic name for enzymes that are classified as enzyme code number: 6.2.1.9 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a binding reaction of malate to CoA and conversion of malate to malil-CoA. In this reaction, an ATP molecule is consumed, and an ADP molecule and a phosphate molecule are produced. Thiokinase Malate has a large subunit of approximately 400 amino acids and a small subunit of 300 amino acids. In the gene, the large subunit is usually followed by the small subunit. Here, for convenience, the large subunit is called mtkB, and the small subunit is called mtkA. The specific activity of purified thiokinase malate is reported to be, for example, 2.5 U/mg (Anal. Biochem. 227(2), 363-367, 1995).
[131] Thiokinase malate is found primarily in an assimilation pathway for C1 carbon sources such as methane (J. Bacteriol. 176(23), 7.398-7.404, 1994) and a 3-hydroxypropionate pathway (Arch. Microbiol., 151,252-256, 1989), and is characterized by the fact that malyl-CoA lyase is present in its vicinity in the genome. This enzyme can be properly used. An example of evaluating the activity of a purified thiokinase malate is known in thiokinase malate derived from Methylobacterium extorquens, but there are only a few examples of comparing an activity with a real sequence. The only example of evaluating an activity along with a sequence is known in an enzyme derived from Methylobacterium extorquens AM1 (GenBank Accession Numbers AAA62654 and AAA62655) (J. Bacteriol. 176(23), 7.398-7.404, 1994). In this literature, the gene for thiokinase malate was closed, and the closed gene was introduced in the same strain of Methylobacterium extorquens for activity evaluation. However, when the present inventors actually synthesized the sequence and evaluated, no activity could be detected. In view of this, the sequence of AAA62655 was compared to the Methylobacterium extorquens-derived malate thiokinase sequence newly acquired in the invention (SEQ ID. NO: 70). As a result, AAA62655 was found to have a large deletion (36 amino acids) at the carboxy terminus, and is abnormally short compared to the sequences of other malate thiokinases (eg in Fig. 3). Therefore, it is believed that a wrong inactive type sequence is described in the above literature.
[132] This invention is, indeed, the first reported example in which malate thiokinase is actually cloned and expressed by a microorganism of another species, and the activity is correlated with the sequence.
[133] Examples of thiokinase malate include those derived from Methylobacterium such as, for example, Methylobacterium extorquens (SEQ IDS. NOS: 70 and 71), those derived from Hyphomicrobium such as, for example, Hyphomicrobium methylovorum or Hyphomicrobium denitrificans, those derived from Rhizobium such as, for example, Rhizobium sp. NGR234, those derived from Granulibacter such as, for example, Granulibacter bethesdensis (SEQ IDS. NOS: 107 and 108), those derived from Nitrosomonas such as, for example, Nitrosomonas europaea, those derived from Methylococcus, such as, for example, Metilococcus capsulatus, and those derived from Gammaproteobacteria.
[134] In view of the efficiency of producing useful substances produced by acetyl-CoA, specific examples of the preferred amino acid sequence include the amino acid sequences derived from Hyphomicrobium (IDS. DE SEQ. Nos: 73, 74, 110 and 111 ), amino acid sequences derived from Rhizobium (IDS. DE SEQ. Nos: 75 and 76), amino acid sequences derived from Nitrosomonas (IDS. DE SEQ. Nos: 113 and 114), amino acid sequences derived from Methylococcus (IDS. DE DE Nos: 75 and 76), SEQ. Nos: 116 and 117) and amino acid sequences derived from Gammaproteobacteria (e.g., SEQ IDS. Nos: 118 and 119).
[135] Hyphomicrobium-derived thiokinase malate (SEQ IDS. NOs: 73, 74, 110 and 111), Rhizobium-derived thiokinase malate (SEQ IDS. NOs: 75 and 76) and Nitrosomonas-derived thiokinase malate ( SEQ ID Nos: 113 and 114) share 65% to 80% sequence homology with each other. Thiokinase malate derived from Methylococcus (SEQ IDS. SEQ. Nos: 116 and 117) has 70% to 80% sequence homology with thiokinase malate derived from Gammaproteobacteria (e.g., SEQ IDS. NOS: 118 and 119) .
[136] Malate thiokinases that have at least 70% amino acid sequence homology to each of the amino sequences of Hyphomicrobium-derived malate thiokinase, Rhizobium-derived malate thiokinase, Nitrosomonas-derived malate thiokinase, Methylococcus-derived malate thiokinase, and malate thiokinase derived from Gammaproteobacteria disclosed herein, and which possess the malate thiokinase activity can suitably be used for the production of acetyl-CoA or for the production of a useful product derived from acetyl-CoA according to the invention.
[137] The result of the malate thiokinase alignment shown in the Examples is shown in Fig. 2A and Fig. 2B (MtkB: large subunit of mtk; Fig. 2A and Fig. 2B hereinafter collectively referred to as “Fig. 2”) and in Fig. 3A and Fig. 3B (MtkA: small subunit of mtk; Fig. 3A and Fig. 3B hereinafter collectively referred to as “Fig. 3”). As shown in Fig. 2 and Fig. 3, malate thiokinases were found to share highly homologous common sequences over their entire length, in which identical or homologous amino acids are conserved.
[138] Regarding amino acids, malate thiokinase derived from Methylobacterium extorquens (indicated by Me in Fig. 2 and Fig. 3), and malate thiokinases that have high enzymatic activity derived from Rhizobium sp. (indicated by Rh in Fig. 2 and Fig. 3), Hyphomicrobium methylovorum (indicated by Hme in Fig. 2 and Fig. 3), Hyphomicrobium denitrificans (indicated by Hd in Fig. 2 and Fig. 3), Nitrosomonas europaea (indicated by by Ne in Fig. 2 and Fig. 3), Methylococcus capsulatus (indicated by Mc in Fig. 2 and Fig. 3), and Gammaproteobacteria (indicated by gam in Fig. 2 and Fig. 3) were classified into 4 groups composed by first to fourth groups described below. In Fig. 2 and Fig. 3, these groups were indicated by y 4 types of symbols, “.+#*”, respectively.
[139] The first group includes the sites at which Rhizobium sp., Hyphomicrobium methylovorum, Hyphomicrobium denitrificans, Nitrosomonas europaea, Metilococcus capsulatus, and Gammaproteobacteria, which have high enzymatic activities, have sequences different from that of Methylobacterium extorquens “and is indicated by the symbol, .” in Fig. 2 and Fig. 3. The position of the sequence is described according to the position in the amino acid sequence of Methylobacterium extorquens.
[140] The first group in MtkBs (Fig. 2) includes histidine, proline, or lysine at position 18; arginine, glutamic acid, aspartic acid or alanine at position 21; tyrosine or histidine at position 26; glutamic acid, alanine or arginine at position 29; arginine or valine at position 34; arginine, serine or glutamic acid at position 36; arginine, threonine, valine or glycine at position 42; valine at position 44; aspartic acid, glutamic acid, histidine, isoleucine or leucine at position 66; histidine, lysine or glutamic acid at position 67; aspartic acid or glutamic acid at position 74; serine, phenylalanine, alanine or glutamic acid at position 75; threonine, lysine or histidine at position 80; histidine or proline at position 84; glutamine, alanine, glycine or lysine at position 89; leucine or valine at position 92; glutamic acid, alanine or glutamine at position 100; methionine, threonine, serine or valine at position 102; aspartic acid, asparagine, glutamic acid, histidine or serine at position 103; isoleucine or proline at position 104; alanine, aspartic acid, lysine or glutamine at position 105; phenylalanine or leucine at position 112; isoleucine at position 121; methionine, valine or threonine at position 122; serine or alanine at position 127; serine, alanine, glutamine or glutamic acid at position 128; alanine, serine, threonine, glutamic acid or arginine at position 139; isoleucine at position 144; arginine or lysine at position 146; glycine or alanine at position 166; aspartic acid, glutamic acid, lysine or arginine at position 170; asparagine, proline, aspartic acid or glycine at position 171; isoleucine or leucine at position 173; glycine, asparagine, proline or alanine at position 175; arginine, lysine, histidine or glutamine at position 176; glycine, alanine or arginine at position 183; cysteine or isoleucine at position 184; tyrosine, leucine or lysine at position 191; alanine at position 193; arginine, glutamic acid, asparagine or serine at position 206; glycine, lysine, asparagine, glutamic acid or proline at position 207; aspartic acid, glutamine, glutamic acid, serine or lysine at position 208; glutamic acid at position 231; arginine at position 233; lysine, asparagine or leucine at position 235; glutamic acid or isoleucine at position 238; threonine, isoleucine or valine at position 243; tyrosine, alanine or glutamic acid at position 244; glycine at position 249; aspartic acid at position 256; asparagine or aspartic acid at position 258; isoleucine, leucine or phenylalanine at position 278; lysine or asparagine at position 300; threonine, arginine, alanine, glutamic acid or glutamine at position 307; leucine, valine, cysteine or tyrosine at position 336; glycine, aspartic acid, glutamic acid, glutamine or arginine at position 340; arginine or leucine at position 358; alanine or aspartic acid at position 375; aspartic acid, lysine, glutamic acid or alanine at position 379; and tryptophan, alanine, arginine or valine at position 385.
[141] The first group in MtkAs (Fig. 3) includes phenylalanine at position 16; lysine, arginine, glutamic acid or glutamine at position 19; isoleucine or histidine at position 20; arginine or aspartic acid at position 30; glutamine, threonine or serine at position 46; alanine, serine, lysine or arginine at position 47; leucine or proline at position 49; methionine, arginine or leucine at position 51; aspartic acid or glutamic acid at position 67; alanine or valine at position 68; valine or isoleucine at position 71; proline at position 74; isoleucine at position 90; cysteine, alanine or isoleucine at position 93; valine at position 94; aspartic acid, alanine or serine at position 119; methionine, serine or cysteine at position 121; isoleucine, threonine or leucine at position 124; alanine or cysteine at position 137; arginine, valine or asparagine at position 151; valine at position 155; alanine, arginine or lysine at position 171; lysine, arginine or valine at position 193; methionine, valine or isoleucine at position 195; glutamic acid, glutamine, arginine or lysine at position 197; alanine or glycine at position 223; leucine or arginine at position 224; alanine at position 226; methionine at position 230; phenylalanine, alanine or glutamic acid at position 259; valine or methionine at position 267; glutamic acid or lysine at position 271; alanine, cysteine or leucine at position 273; threonine or asparagine at position 280; serine or alanine at position 282; alanine, lysine, glutamine, glycine or glutamic acid at position 294; and methionine, glutamine, arginine, leucine or histidine at position 295.
[142] Malate thiokinases that have one or more of these amino acid sequences are more preferable because of enzymatic activity.
[143] The second group includes common sequences characteristic for all of Rhizobium sp., Hyphomicrobium methylovorum, Hyphomicrobium denitrificans, Nitrosomonas europaea, Methylococcus capsulatus, and Gammaproteobacteria, and is indicated by the symbol '+' in Fig. 2 and Fig. 3. The Characteristic sequence positions are described according to the positions in the amino acid sequence of Hyphomicrobium methylovorum.
[144] The second group in MtkBs (Fig. 2) includes valine at position 43; isoleucine at position 120; isoleucine at position 143; alanine at position 192; glutamic acid at position 230; arginine at position 232; glycine at position 248; and aspartic acid at position 255.
[145] The second group in MtkAs (Fig. 3) includes phenylalanine at position 16; proline at position 74; isoleucine at position 90; valine at position 94; valine at position 155; alanine at position 226; and methionine at position 230.
[146] The region that has no homology, that is, the region other than those common characteristic sequences and the common sequences conserved among all sequences, may have a mutation. Malate thiokinases that have any of these amino acid sequences are more preferable due to enzymatic activity.
[147] The third group includes characteristic common sequences for Rhizobium sp., Hyphomicrobium methylovorum, Hyphomicrobium denitrificans, and Nitrosomonas europaea, and is indicated by the “#” symbol in Fig. 2 and Fig. 3. The positions of the common characteristic sequences are described according to the positions in the amino acid sequence of Hyphomicrobium methylovorum.
[148] The third group in MtkBs (Fig. 2) includes glutamic acid at position 29; arginine at position 34; isoleucine at position 68; histidine at position 83; leucine at position 91; leucine at position 95; isoleucine at position 103; phenylalanine at position 111; aspartic acid at position 141; glycine at position 182; cysteine at position 183; valine at position 252; lysine at position 299; valine at position 345; glutamic acid at position 354; arginine at position 357; and alanine at position 374.
[149] The third group in MtkAs (Fig. 3) includes isoleucine at position 20; alanine at position 68; cysteine at position 93; methionine at position 121; leucine at position 123; alanine at position 137; leucine at position 224; alanine at position 236; tyrosine at position 237; isoleucine at position 238; glutamic acid at position 261; valine at position 267; leucine at position 270; lysine at position 271; valine at position 275; isoleucine at position 277; threonine at position 280; and serine at position 282.
[150] The region that has no homology, that is, the region other than those common characteristic sequences and the common sequences conserved among all sequences, may have a mutation. Malate thiokinases that have any of these amino acid sequences are more preferable due to enzymatic activity.
[151] The fourth group includes common characteristic sequences for Methylococcus capsulatus and Gammaproteobacteria, and is indicated by the symbol “*” in Fig. 2 and Fig. 3. The positions of the common characteristic sequences are described according to the positions in the sequence of amino acids from Methylococcus capsulatus.
[152] The fourth group in MtkBs (Fig. 2) includes asparagine at position 2; tyrosine at position 15; proline at position 18; tyrosine at position 26; aspartic acid at position 28; valine at position 34; glutamic acid at position 36; isoleucine at position 38; glycine at position 53; valine at position 60; alanine at position 63; serine at position 65; glutamic acid at position 67; aspartic acid at position 74; methionine at position 76; isoleucine at position 114; glutamine at position 119; threonine at position 122; glutamic acid at position 128; glutamic acid at position 132; valine at position 136; lysine at position 143; valine at position 145; glutamic acid at position 147; isoleucine at position 153; cysteine at position 160; lysine at position 162; valine at position 163; alanine at position 166; isoleucine at position 167; leucine at position 173; methionine at position 174; glutamine at position 176; arginine at position 179; leucine at position 180; methionine at position 181; isoleucine at position 184; leucine at position 194; glutamine at position 195; isoleucine at position 203; valine at position 204; glycine at position 205; leucine at position 211; phenylalanine at position 218; asparagine at position 219; leucine at position 237; glutamic acid at position 239; glutamic acid at position 240; valine at position 245; glutamic acid at position 246; glycine at position 249; asparagine at position 253; alanine at position 256; alanine at position 277; histidine at position 281; glutamic acid at position 298; lysine at position 299; asparagine at position 302; cysteine at position 304; isoleucine at position 306; isoleucine at position 330; leucine at position 334; glutamine at position 336; serine at position 340; leucine at position 341; phenylalanine at position 370; asparagine at position 375; aspartic acid at position 377; aspartic acid at position 378; alanine at position 381; and isoleucine at position 386.
[153] The fourth group in MtkAs (Fig. 3) includes phenylalanine at position 4; valine at position 5; asparagine at position 6; histidine at position 8; serine at position 9; valine at position 11; isoleucine at position 12; histidine at position 20; alanine at position 28; arginine at position 30; threonine at position 33; leucine at position 56; aspartic acid at position 60; aspartic acid at position 72; valine at position 73; isoleucine at position 91; arginine at position 96; valine at position 97; alanine at position 102; valine at position 107; isoleucine at position 111; glutamine at position 114; arginine at position 117; glycine at position 119; aspartic acid at position 121; threonine at position 129; proline at position 130; threonine at position 134; glutamic acid at position 137; cysteine at position 138; lysine at position 139; valine at position 140; asparagine at position 163; glutamic acid at position 168; leucine at position 175; threonine at position 191; aspartic acid at position 192; valine at position 194; threonine at position 195; valine at position 196; alanine at position 199; valine at position 210; valine at position 221; alanine at position 222; alanine at position 224; arginine at position 225; alanine at position 227; glutamic acid at position 260; threonine at position 263; alanine at position 266; methionine at position 268; aspartic acid at position 269; alanine at position 270; glutamic acid at position 272; leucine at position 274; tyrosine at position 277; arginine at position 280; asparagine at position 281; alanine at position 283; isoleucine at position 285; leucine at position 290; arginine at position 291; alanine at position 292; and glutamic acid at position 295.
[154] The region that has no homology, that is, the region other than those common characteristic sequences and the common sequences conserved among all sequences, may have a mutation.
[155] Malate thiokinases that have any of these amino acid sequences are most preferred because of enzymatic activity.
[156] As a malate thiokinase (mtk) gene, a DNA that has the base sequence of a gene encoding malate thiokinase obtained from each of the enzyme's parent organisms mentioned above, or a synthetic DNA sequence that is synthesized based on a known base sequence of the gene, can be used.
[157] Preferable examples of these include a DNA having the base sequence of a gene derived from Methylobacterium such as, for example, Methylobacterium extorquens (SEQ IDS. NOS: 67 and 68), Hyphomicrobium such as, for example, Hyphomicrobium methylovorum or Hyphomicrobium denitrificans, Rhizobium such as, for example, Rhizobium sp. NGR234, Granulibacter such as, for example, Granulibacter bethesdensis, Nitrosomonas, such as, for example, Nitrosomonas europaea, Methylococcus, such as, for example, Methylococcus capsulatus or Gammaproteobacteria.
[158] In view of the efficiency of production of acetyl-CoA, a DNA that has the base sequence of a gene derived from Hyphomicrobium (SEQ IDS. NOS: 61, 62, 86, and 87), Rhizobium (for example , SEQ ID NOs: 63), Granulibacter (SEQ IDS Nos: 81 and 82), Nitrosomonas (SEQ IDS Nos: 91 and 92), Methylococcus (SEQ IDS Nos: 96) and 97) or Gammaproteobacteria (SEQ IDS. Nos. 102 and 103) is preferable.
[159] In particular, the base sequence of a gene derived from Hyphomicrobium (SEQ IDS. Nos: 61, 62, 86, and 87), Rhizobium whose codon usage is optimized (eg, SEQ ID. No.: 63), Nitrosomonas (SEQ IDS. Nos.: 91 and 92), Methylococcus (SEQ IDS. Nos.: 96 and 97) or Gammaproteobacteria (SEQ IDS. Nos.: 102 and 103) is preferable.
[160] Malil-CoA lyase is an enzyme that is classified as enzyme code number: 4.1.3.24 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyzes a glyoxylate production reaction and acetyl-CoA from malyl-CoA. Examples of malyl-CoA lyase include those derived from Methylobacterium such as, for example, Methylobacterium extorquens, Hyphomicrobium such as, for example, Hyphomicrobium methylovorum or Hyphomicrobium denitrificans, Chloroflexus such as, for example, Chloroflexus aurantiacus, Nitrosomonas, or, for example, monas Methylococcus such as Methylococcus capsulatus.
[161] In view of the efficiency of acetyl-CoA production, specific examples of preferred amino acid sequences include an amino acid sequence derived from Methylobacterium (SEQ ID. NO:69), Hyphomicrobium (SEQ ID. NO.:69) :72 and 109), Nitrosomonas (SEQ ID. NO: 112), or Methylococcus (SEQ ID. NO: 115).
[162] The specific activity of purified malyl-CoA lyase in Methylobacterium extorquens is reported to be, for example, 28.1 U/mg (Biochem. J. 139, 399-405, 1974).
[163] As a malyl-CoA lyase (mcl) gene, a DNA having the base sequence of a gene encoding malyl-CoA lyase obtained from any of the enzyme's parent organisms listed above, or a DNA sequence synthesized that is synthesized on the basis of a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Methylobacterium such as, for example, Methylobacterium extorquens, Hyphomicrobium such as, for example, Hyphomicrobium methylovorum or Hyphomicrobium denitrificans, or Chloroflexus such as, for example, Chloroflexus aurantiacus. In view of the efficiency of acetyl-CoA production, more preferable examples thereof include a DNA which has the base sequence of a gene derived from Methylobacterium and a gene which has the base sequence of a gene derived from Hyphomicrobium.
[164] Specific examples of the preferred base sequence of the Methylobacterium-derived gene include the base sequence of a gene derived from Methylobacterium extorquens (SEQ ID. NO: 66). Specific examples of the preferred base sequence of a gene derived from Hyphomicrobium include the base sequence of a gene derived from Hyphomicrobium methylovorum (SEQ ID. NO.: 60) or Hyphomicrobium denitrificans (SEQ. ID. NO.: 85) . Specific examples of the preferred base sequence of a gene derived from Nitrosomonas include the base sequence of a gene derived from Nitrosomonas europaea (SEQ ID. NO.: 90). Specific examples of the preferable base sequence of the Methylococcus derived gene include the base sequence of a gene derived from Methylococcus capsulatus (SEQ ID. NO: 95).
[165] Acetyl-CoA carboxylase is a general name for enzymes that are classified as enzyme code number: 6.4.1.2 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a reaction of conversion of acetyl-CoA and CO2 to malonyl-CoA.
[166] Semialdehyde malonate dehydrogenase is classified as enzyme code number: 1.2.1.18 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a reaction to convert malonyl-CoA to semialdehyde malonate .
[167] Malonyl-CoA reductase is a generic name for enzymes that catalyze a reaction to convert malonyl-CoA to semialdehyde malonate or 3-hydroxypropionate.
[168] Crotonyl-CoA carboxylase reductase is a generic name for enzymes that are classified as enzyme code number: 1.3.1.85 based on the Enzyme Commission of the International Union of Biochemistry (IUB) report, and which catalyze the conversion of crotonyl-CoA to ethylmalonyl-CoA.
[169] Methylcrotonyl-CoA carboxylase is a generic name for enzymes that are classified as enzyme code number: 6.4.1.4 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze an enzyme reaction conversion of crotonyl-CoA to glutaconyl-CoA.
[170] Pyruvate synthase is a generic name for enzymes which are classified as enzyme code number: 1.2.7.1 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze an acetyl conversion reaction -CoA in pyruvate.
[171] It is preferable that, in the acetyl-CoA producing microorganism, the activity of at least one enzyme selected from the group consisting of lactate dehydrogenase, malate synthase, and fumarate hydratase is inactivated or reduced. As a result, acetyl-CoA can be produced more efficiently.
[172] Among the lactate dehydrogenase, malate synthase, and fumarate hydratase mentioned above, each is the target enzyme whose activity may be inactivated or reduced, malate synthase catalyzes a reaction converting acetyl-CoA and glyoxylate to malate. This reaction is the reverse reaction of a reaction catalyzed by malate thiokinase and malyl-CoA lyase. Therefore, it is preferable to inactivate or reduce malate synthase activity, as the reaction of converting acetyl-CoA and glyoxylate to malate again can be blocked or reduced and the yield of acetyl-CoA is increased.
[173] Among lactate dehydrogenase, malate synthase, and fumarate hydratase, whose activity can be inactivated or reduced, it is preferable to inactivate fumarate hydratase because of the efficiency of acetyl-CoA production. Inactivation of fumarate hydratase prevents the conversion of malate to other substances including fumarate and a reduction in the amount of malate and thus increases the yield of acetyl-CoA.
[174] Lactate dehydrogenase (ldhA) is a generic name for enzymes that are classified as enzyme code number: 1.1.1.28 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a reaction of converting pyruvate to lactate, or converting lactate to pyruvate.
[175] Isocitrate lyase (aceA) is classified under enzyme code number: 4.1.3.1 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and is a generic name for enzymes that catalyze a reaction of converting isocitrate to succinate and glyoxylate.
[176] Malate synthase (aceB and glcB) is a generic name for enzymes that are classified as enzyme code number: 2.3.3.9 based on the Enzyme Commission of the International Union of Biochemistry (IUB) report, and which catalyze a reaction to convert acetyl-CoA and glyoxylate into malate and CoA. Depending on the micro-organisms, various malate synthase isomers are encoded in the genome. Most Escherichia coli strains have two genes called aceB and glcB, respectively, and both are described in this descriptive report. Each of Pantoea ananatis and Corynebacterium glutamicum has a single gene type that corresponds to aceB or glcB, and the gene is collectively described as aceB in this specification for convenience.
[177] Fumarate hydratase (fum) is a generic name for enzymes that are classified as enzyme code number: 4.2.1.2 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a reaction of converting malate to fumarate. Depending on the micro-organisms, various isomers of fumarate hydratase are encoded in the genome. For example, Escherichia coli has three types of fumarate hydratase, fumA, fumB and fumC. Pantoea ananatis has fumA and fumC, and Corynebacterium glutamicum has fumC.
[178] Phosphoenolpyruvate carboxylase is a generic name for enzymes which are classified as enzyme code number: 4.1.1.31 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a phosphoenolpyruvate conversion reaction and carbon dioxide in oxaloacetate and phosphate. Examples of phosphoenolpyruvate carboxylase include those derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, Pantoea bacteria such as Pantoea ananatis, Hyphomicrobium bacteria such as Hyphomicrobium methylovorum, Starkeya bacteria such as, for example, Starkeya novella, Rhodopseudomonas bacteria such as, for example, Rhodopseudomonas sp. or Streptomyces bacteria such as Streptomyces coelicolor.
[179] As a phosphoenolpyruvate carboxylase (ppc) gene, a DNA that has the base sequence of a gene encoding phosphoenolpyruvate carboxylase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as Corynebacterium glutamicum, Escherichia bacteria such as Escherichia coli, Pantoea bacteria such as Pantoea ananatis, Hyphomicrobium bacteria such as , eg Hyphomicrobium methylovorum, Starkeya bacteria such as Starkeya novella, Rhodopseudomonas bacteria such as Rhodopseudomonas sp. or Streptomyces bacteria such as Streptomyces coelicolor.
[180] Phosphoenolpyruvate carboxykinase is a generic name for enzymes that are classified as enzyme code number: 4.1.1.32, enzyme code number: 4.1.1.38, or enzyme code number: 4.1.1.49 based on the report by "Enzyme Commission of the International Union of Biochemistry" (IUB), and which catalyze a reaction to convert phosphoenolpyruvate and carbon dioxide into oxaloacetate. Among the enzyme code numbers, enzymes classified as enzyme code number: 4.1.1.32 are involved in a reaction to convert GDP to GTP; enzymes classified as enzyme code number: 4.1.1.38 are involved in a phosphate to pyrophosphate conversion reaction; and enzymes classified as enzyme code number: 4.1.1.49 are involved in an ADP to ATP conversion reaction. Examples of phosphoenolpyruvate carboxykinase include those derived from Actinobacillus bacteria such as, for example, Actinobacillus succinogenes, Mycobacterium bacteria such as, for example, Mycobacterium smegmatis, or Trypanosoma bacteria such as, for example, Trypanosoma brucei.
[181] As a phosphoenolpyruvate carboxykinase (pck) gene, a DNA that has the base sequence of a gene encoding phosphoenolpyruvate carboxykinase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Actinobacillus such as, for example, Actinobacillus succinogenes, Mycobacterium bacteria such as, for example, Mycobacterium smegmatis, or Trypanosoma bacteria such as, for example, Trypanosoma brucei.
[182] Pyruvate carboxylase is a generic name for enzymes that are classified as enzyme code number: 6.4.1.1 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a conversion reaction of pyruvate and carbon dioxide in oxaloacetate. The reaction consumes ATP and produces ADP and phosphate. Examples of pyruvate carboxylase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, or Mycobacterium bacteria such as, for example, Mycobacterium smegmatis.
[183] As a pyruvate carboxylase (pyc) gene, a DNA that has the base sequence of a gene encoding phosphoenolpyruvate carboxylase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, or Mycobacterium bacteria such as, for example, Mycobacterium smegmatis.
[184] Malate dehydrogenase is a generic name for enzymes that are classified as enzyme code number: 1.1.1.37 based on the Enzyme Commission of the International Union of Biochemistry (IUB) report, and which use NADH as a coenzyme and catalyze a malate production reaction from oxaloacetate. Examples of malate dehydrogenase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum or Escherichia bacteria such as, for example, Escherichia coli.
[185] As a malate dehydrogenase (mdh) gene, a DNA that has the base sequence of a gene encoding malate dehydrogenase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[186] Glyoxylate carboligase is a generic name for enzymes that are classified as enzyme code number: 4.1.1.47 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a conversion reaction of two molecules of glyoxylate into one molecule of 2-hydroxy-3-oxopropionate. This reaction is accompanied by decarboxylation of a carbon dioxide molecule. Examples of glyoxylate carboligase include those derived from Escherichia bacteria such as Escherichia coli or Rhodococcus bacteria such as Rhodococcus jostii.
[187] As a glyoxylate carboligase (gcl) gene, a DNA that has the base sequence of a gene encoding glyoxylate carboligase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Rhodococcus bacteria such as, for example, Rhodococcus jostii or Escherichia bacteria such as, for example, Escherichia coli.
[188] 2-Hydroxy-3-oxopropionate reductase is a generic name for enzymes that are classified as enzyme code number: 1.1.1.60 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which they use NADH as a coenzyme and catalyze a reaction to convert 2-hydroxy-3-oxopropionate to glycerate. Examples of 2-hydroxy-3-oxopropionate reductase include those derived from Escherichia bacteria such as Escherichia coli.
[189] As a 2-hydroxy-3-oxopropionate reductase (glxR) gene, a DNA that contains the base sequence of a gene encoding 2-hydroxy-3-oxopropionate reductase obtained from any of the source organisms of the enzyme listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples of these include a DNA having the base sequence of a gene derived from Escherichia bacteria such as, for example, Escherichia coli.
[190] Hydroxypyruvate isomerase is a generic name for enzymes which are classified as enzyme code number: 5.3.1.22 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze an isomerization reaction of 2-hydroxy-3-oxopropionate in hydroxypyruvate. Examples of hydroxypyruvate isomerase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[191] As a hydroxypyruvate isomerase (hyi) gene, a DNA that has the base sequence of a gene encoding hydroxypyruvate isomerase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[192] Hydroxypyruvate reductase is a generic name for enzymes that are classified as enzyme code number: 1.1.1.81 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which use NADH or NADPH as an coenzyme and catalyze a reaction to convert hydroxypyruvate to glycerate.
[193] Examples of hydroxypyruvate reductase include those derived from Escherichia bacteria such as Escherichia coli or Pantoea bacteria such as Pantoea ananatis.
[194] As a gene for hydroxypyruvate reductase (ycdW), a DNA having the base sequence of a gene encoding hydroxypyruvate reductase obtained from any of the enzyme's parent organisms listed above, or a synthetic DNA sequence synthesized with base in a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Escherichia bacteria such as Escherichia coli or Pantoea bacteria such as Pantoea ananatis.
[195] Glycerate 3-kinase is a generic name for enzymes that are classified as enzyme code number: 2.7.1.31 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a reaction of conversion of glycerate to 3-phosphoglycerate. In this reaction, an ATP molecule is consumed, and an ADP molecule and a phosphate molecule are produced. Examples of the glycerate 3-kinase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum or Escherichia bacteria such as, for example, Escherichia coli.
[196] As a glycerate 3-kinase (glxK) gene according to the invention, a DNA having the base sequence of a gene encoding glycerate 3-kinase obtained from any of the organisms of origin of the enzyme listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[197] Glycerate 2-kinase is a generic name for enzymes that are classified as enzyme code number: 2.7.1.165 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a reaction of conversion of glycerate to 2-phosphoglycerate. In this reaction, an ATP molecule is consumed, and an ADP molecule and a phosphate molecule are produced. Examples of glycerate 2-kinase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum or Escherichia bacteria such as, for example, Escherichia coli.
[198] As a glycerate 2-kinase (garK) gene according to the invention, a DNA having the base sequence of a gene encoding glycerate 2-kinase obtained from any of the organisms of origin of the enzyme listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[199] phosphoglycerate mutase is a generic name for enzymes that are classified as enzyme code number: 5.4.2.1 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a conversion reaction of 3-phosphoglycerate to 2-phosphoglycerate. Examples of the phosphoglycerate mutase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[200] As a phosphoglycerate mutase (gpm) gene, a DNA that has the base sequence of a gene encoding phosphoglycerate mutase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[201] Enolase is a generic name for enzymes that are classified as enzyme code number: 4.2.1.11 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a 2 conversion reaction -phosphoglycerate to phosphoenolpyruvate. Examples of enolase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[202] As an enolase (ene) gene, a DNA that has the base sequence of a gene encoding enolase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized with base in a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[203] Pyruvate kinase is a generic name for enzymes that are classified as enzyme code number: 2.7.1.40 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a conversion reaction of phosphoenolpyruvate and ADP to pyruvate and ATP. Examples of pyruvate kinase include those derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[204] As a pyruvate kinase (pyk) gene, a DNA that has the base sequence of a gene encoding pyruvate kinase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized based on a known base sequence of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Corynebacterium bacteria such as, for example, Corynebacterium glutamicum, Escherichia bacteria such as, for example, Escherichia coli, or Pantoea bacteria such as, for example, Pantoea ananatis.
[205] The Acetyl-CoA producing microorganism may be a microorganism that has, in addition to the pathway for converting acetyl-CoA into a useful metabolite, a pathway that produces another metabolite by using acetyl-CoA as a raw material, or it may be a microorganism whose enzymatic activity involved in a pathway that produces another metabolite is increased. As a result, useful acetyl-CoA-derived metabolites can be produced from a source material of carbon and carbon dioxide, and the productivity of the useful acetyl-CoA-derived metabolite can be increased.
[206] The microorganism used in the invention is not particularly limited, as long as the microorganism does not have any of: (a) a carbon dioxide fixation cycle that has an enzymatic reaction of malonyl-CoA to semialdehyde malonate or 3-hydroxypropionate ; (b) a carbon dioxide fixation cycle that has an enzymatic reaction of acetyl-CoA and CO2 to pyruvate; (c) a carbon dioxide fixation cycle that has an enzymatic reaction of crotonyl-CoA and CO2 to ethylmalonyl-CoA or glutaconyl-CoA; (d) a carbon dioxide fixation cycle that has an enzymatic reaction of CO2 in formate; or (e) at least one selected from the group consisting of malate thiokinase and malyl-CoA lyase.
[207] Examples of the microorganism include microorganisms that belong to Enterobacteriaceae and microorganisms that belong to coryneform bacteria. Specific examples of the microorganism include microorganisms belonging to the Enterobacteriaceae such as Escherichia bacteria and Pantoea bacteria; microorganisms that belong to coryneform bacteria such as, for example, Corynebacterium bacteria and Brevibacterium bacteria; filamentous fungi; and actinomycetes.
[208] Specific examples of microorganisms belonging to the Enterobacteriaceae include bacteria belonging to Enterobacter, Erwinia, Escherichia, Klebsiella, Pantoea, Providencia, Salmonella, Serratia, Shigella, Morganella or Erwinia. Among these, microorganisms belonging to Escherichia and microorganisms belonging to Pantoea are preferable from the point of view of efficient production of useful metabolites.
[209] Examples of Corynebacterium bacteria include Corynebacterium glutamicum.
[210] Escherichia bacteria are not particularly limited, and examples of these include Escherichia coli. Specific examples of Escherichia coli include Escherichia coli W3110 (ATCC 27325) and Escherichia coli MG1655 (ATCC 47076), derived from the wild type prototype strain K12, and Escherichia coli B (ATCC 11303) derived from the wild type B prototype strain.
[211] Both Escherichia and Pantoea bacteria belong to, and are closely related to, the Enterobacteriaceae (J. Gen. Appl. Microbiol. 43(6) 355361 (1997); International Journal of Systematic Bacteriology, pages 1.061-1067, 1997).
[212] In recent years, some bacteria belonging to Enterobacter have been reclassified into Pantoea agglomerans, Pantoea dispersa, or the like (International Journal of Systematic Bacteriology, July 39(3) 337-345, 1989).
[213] In addition, some bacteria belonging to Erwinia have been reclassified into Pantoea ananas or Pantoea stewartii (International Journal of Systematic Bacteriology, 43(1), 162-173, 1993).
[214] Examples of Enterobacter bacteria include Enterobacter agglomerans and Enterobacter aerogenes. More specifically, strains exemplified in European Patent submitted for public inspection N° 952221 can be used. Examples of representative strains of Enterobacter include Enterobacter agglomerans ATCC 12287.
[215] Examples of representative strains of Pantoea bacteria include Pantoea ananatis, Pantoea stewartii, Pantoea agglomerans, and Pantoea citrea. Specific examples of the strains include the following.
[216] - Pantoea ananatis AJ13355 (FERM BP-6614) (European patent submitted to public inspection No. 0952221)
[217] - Pantoea ananatis AJ13356 (FERM BP-6615) (European patent submitted to public inspection No. 0952221)
[218] Although these strains are described as Enterobacter agglomerans in European Patent submitted for public inspection No. 0952221, the strains have been reclassified into Pantoea ananatis, as described above, based on base sequence analysis of 16S rRNA and the like.
[219] "Coryneform bacteria" in the invention refers to microorganisms that belong to Corynebacterium, Brevibacterium or Microbacterium as defined in "Bergey's Manual of Determinative Bacteriology", 8, 599 (1974).
[220] Examples of coryneform bacteria still include microorganisms that were classified into Brevibacterium but were later reclassified into Corynebacterium (Int. J. Syst. Bacteriol., 41, 255, 1991) and related bacteria such as micro -organisms belonging to Brevibacterium. Examples of coryneform bacteria are listed below.
[221] That is, examples of these include Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium alkanolyticum, Corynebacterium callunae, Corynebacterium glutamicum, Corynebacterium lilium, Corynebacterium melassecola, Corynebacterium thermoaminogenes, Corynebacterium brevibacterium brevibacterium, brevibacterium brevibacterium, lacolyticum , Brevibacterium saccharolyticum, Brevibacterium tiogenitalis, Corynebacterium ammoniagenes, Brevibacterium album, Brevibacterium cerinum and Microbacterium ammoniaphilum.
[222] Specific examples of these include the following strains:
[223] Corynebacterium acetoacidophilum ATCC 13870, Corynebacterium acetoglutamicum ATCC 15806, Corynebacterium alkanolyticum ATCC 21511, Corynebacterium callunae ATCC 15991, Corynebacterium glutamicum ATCC 13020, ATCC 13032 and ATCC 12MM 13060, Corynebacterium alkanolyticum ATCC 21511, Corynebacterium callunae ATCC 15991, Corynebacterium glutamicum ATCC 13020, ATCC 13032 and ATCC 12340M BP-1539), Corynebacterium herculis ATCC13868, Brevibacterium divaricatum ATCC 14020, Brevibacterium flavum ATCC 13826, ATCC 14067 and AJ 12418 (FERM BP-2205), Brevibacterium immariophilum ATCC 14068, Brevibacterium lactofermentum (Corynebacterium glutamicum) 1, ATCC 13869, ATCC 13869 Brevibacterium saccharolyticum ATCC 14066, Brevibacterium tiogenitalis ATCC 19240, Corynebacterium ammoniagenes ATCC 6871 and ATCC 6872, Brevibacterium album ATCC 15111, Brevibacterium cerinum ATCC 15112 and Microbacterium ammoniaphilum ATCC 15354.
[224] When Escherichia bacterium is used as the microorganism, preferable examples of the acetyl-CoA producing microorganism in the invention include an acetyl-CoA producing Escherichia bacterium in which the thiolase activity, the CoA transferase activity and the activity of acetoacetate decarboxylase are transmitted or increased.
[225] When Escherichia bacterium is used as the microorganism, preferable examples of the acetyl-CoA producing microorganism in the invention further include an acetyl-CoA producing Escherichia bacterium in which the thiolase activity, the CoA transferase activity, the acetoacetate decarboxylase activity and isopropyl alcohol dehydrogenase activity are transmitted or increased.
[226] Thiolase is a generic name for enzymes that are classified as enzyme code number: 2.3.1.9 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze an acetoacetyl production reaction -CoA from acetyl-CoA.
[227] Examples of thiolase include those derived from Clostridium bacteria such as Clostridium acetobutylicum or Clostridium beijerinckii, Escherichia bacteria such as Escherichia coli, Halobacterium sp., Zoogloea bacteria such as Zoogloea ramigera, Rhizobium sp. , Bradyrhizobium bacteria such as Bradyrhizobium japonicum, Candida such as Candida tropicalis, Caulobacter bacteria such as Caulobacter crescentus, Streptomyces bacteria such as Streptomyces collinus or Enterococcus bacteria such as Enterococcus faecalis.
[228] As a thiolase gene, a DNA that has the base sequence of a thiolase-encoding gene obtained from any of the enzyme's source organisms listed above, or a synthesized DNA sequence that is synthesized on the basis of a sequence known basis of the gene, can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Clostridium bacteria such as, for example, Clostridium acetobutylicum or Clostridium beijerinckii; Escherichia bacteria such as Escherichia coli, Halobacterium sp., Zoogloea bacteria such as Zoogloea ramigera, Rhizobium sp., Bradyrhizobium bacteria such as Bradyrhizobium japonicum, Candida such as Candida tropicalis, Caulobacter bacteria such as , for example Caulobacter crescentus, Streptomyces bacteria such as Streptomyces collinus or Enterococcus bacteria such as Enterococcus faecalis. More preferable examples of these include a DNA having the base sequence of a gene derived from a prokaryote such as, for example, Clostridium bacteria or Escherichia bacteria, and a DNA having the base sequence of a gene derived from Clostridium acetobutylicum or Escherichia coli is particularly preferable.
[229] Acetoacetate decarboxylase is a generic name for enzymes which are classified as enzyme code number: 4.1.1.4 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze an enzyme production reaction acetone from acetoacetate.
[230] Examples of acetoacetate decarboxylase include those derived from Clostridium bacteria such as Clostridium acetobutylicum or Clostridium beijerinckii; or Bacillus bacteria such as Bacillus polymyxa.
[231] As an acetoacetate decarboxylase gene, a DNA that has the base sequence of a gene encoding acetoacetate decarboxylase obtained from any of the enzyme source organisms listed above, or a synthesized DNA sequence that is synthesized on the basis of a known base sequence of the gene can be used. Preferable examples of these include a DNA having the base sequence of a gene derived from Clostridium bacteria or Bacillus bacteria. Specific examples of these include a DNA having the base sequence of a gene derived from Clostridium acetobutylicum or Bacillus polymyxa. The DNA is most preferably a DNA having the base sequence of a gene derived from Clostridium acetobutylicum.
[232] As an acetoacetate decarboxylase gene, a DNA having the base sequence of a gene encoding acetoacetate decarboxylase obtained from any of the organisms of origin of the enzyme listed above can be used. Preferable examples of these include a DNA having the base sequence of a gene derived from Clostridium bacteria or Bacillus bacteria. Specific examples of these include a DNA having the base sequence of a gene derived from Clostridium acetobutylicum or Bacillus polymyxa. The DNA is most preferably a DNA having the base sequence of a gene derived from Clostridium acetobutylicum.
[233] Isopropyl alcohol dehydrogenase is a generic name for enzymes that are classified as enzyme code number: 1.1.1.80 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a production reaction of isopropyl alcohol from acetone.
[234] Examples of isopropyl alcohol dehydrogenase include those derived from Clostridium bacteria such as Clostridium beijerinckii.
[235] As an isopropyl alcohol dehydrogenase gene, a DNA that has the base sequence of a gene encoding isopropyl alcohol dehydrogenase obtained from any of the enzyme's parent organisms listed above can be used. Preferable examples of these include a DNA having the base sequence of a gene derived from Clostridium bacteria such as, for example, Clostridium beijerinckii.
[236] CoA transferase is a generic name for enzymes which are classified as enzyme code number: 2.8.3.8 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze an enzyme production reaction acetoacetate from acetoacetyl-CoA.
[237] Examples of CoA transferase include those derived from Clostridium bacteria such as Clostridium acetobutylicum or Clostridium beijerinckii; Roseburia bacteria such as Roseburia intestinalis; Faecalibacterium bacteria such as, for example, Faecalibacterium prausnitzii; Coprococcus bacteria; trypanosomes such as Trypanosoma brucei; or Escherichia bacteria such as Escherichia coli.
[238] As a CoA transferase gene, a DNA that has the base sequence of a gene encoding CoA transferase obtained from any of the organisms of origin of the enzyme listed above, or a DNA sequence synthesized based on a sequence of known basis of the gene, can be used.
[239] Preferable examples of these include a DNA having the base sequence of a gene derived from Clostridium bacteria such as Clostridium acetobutylicum, Roseburia bacteria such as Roseburia intestinalis, Faecalibacterium bacteria such as Faecalibacterium prausnitzii, Coprococcus bacteria, trypanosomes such as Trypanosoma brucei or Escherichia bacteria such as Escherichia coli. More preferred examples thereof include a DNA having the base sequence of a gene derived from Clostridium bacteria or Escherichia bacteria, and a DNA having the base sequence of a gene derived from Clostridium acetobutylicum or Escherichia coli is even more preferable.
[240] From the standpoint of enzymatic activity, it is preferable that each of the four types of enzymes is an enzyme derived from at least one selected from the group consisting of Clostridium bacteria, Bacillus bacteria and Escherichia bacteria. In particular, a case in which that acetoacetate decarboxylase and isopropyl alcohol dehydrogenase are derived from Clostridium bacteria, and in which the CoA transferase activity and the thiolase activity are derived from Escherichia bacteria, is more preferable.
[241] In particular, from the standpoint of enzymatic activity, it is preferable that each of the four types of enzymes are derived from either Clostridium acetobutylicum, Clostridium beijerinckii, or Escherichia coli. It is more preferable that acetoacetate decarboxylase is an enzyme derived from Clostridium acetobutylicum, and that each of CoA transferase and thiolase is derived from Clostridium acetobutylicum or Escherichia coli, and that isopropyl alcohol dehydrogenase is derived from Clostridium beijerinckii. With respect to the four types of enzymes, it is preferable that the acetoacetate decarboxylase activity is derived from Clostridium acetobutylicum, and that the isopropyl alcohol dehydrogenase activity is derived from Clostridium beijerinckii, and that the CoA transferase activity and the thiolase activity are derived of Escherichia coli, from the point of view of enzymatic activity.
[242] The CoA transferase (atoD and atoA) genes and the thiolase (atoB) gene derived from Escherichia coli form an operon in the genome of Escherichia coli in the order of atoD, atoA and atoB (Journal of Bacteriology Vol. 169 pages 42 -52 Lauren Sallus Jenkins et al). Therefore, the expression of the CoA transferase genes and the thiolase gene can be simultaneously controlled by modification of the atoD promoter.
[243] In view of the above, when CoA transferase activity and thiolase activity are those obtained by the genomic genes of the Escherichia coli host, it is preferable to increase the expression of both enzyme genes, eg, by promoter replacement responsible for the expression of both enzyme genes by another promoter, from the point of view of obtaining sufficient isopropyl alcohol production ability. Examples of the promoter to be used in order to increase the expression of CoA transferase activity and thiolase activity include the Escherichia coli derived GAPDH promoter described above.
[244] Examples of the acetyl-CoA producing microorganism that produces another metabolite by using acetyl-CoA as a raw material include a microorganism obtained by transmitting or increasing, or inactivating or reducing, any of the enzymatic activities described above, using Escherichia coli which has an isopropyl alcohol production system (hereinafter referred to as “Isopropyl alcohol producing Escherichia coli”) as a host.
[245] Isopropyl alcohol-producing Escherichia coli can be any Escherichia coli, as long as the respective genes for transmitting the ability to produce isopropyl alcohol can be introduced or modified.
[246] Escherichia coli is more preferably Escherichia coli to which the ability to produce isopropyl alcohol was imparted in advance. By using this Escherichia coli, isopropyl alcohol can be efficiently produced.
[247] An example of an isopropyl alcohol-producing Escherichia coli is an isopropyl alcohol-producing Escherichia coli to which acetoacetate decarboxylase activity, isopropyl alcohol dehydrogenase activity, CoA transferase activity, and thiolase activity have been transmitted in a manner to being able to produce isopropyl alcohol from a plant-derived raw material, and which is described, for example, in WO 2009/008377. Other examples of isopropyl alcohol producing Escherichia coli include microorganisms described in WO 2009/094485, WO 2009/094485, WO 2009/046929 or WO 2009/046929.
[248] Isopropyl alcohol producing Escherichia coli is Escherichia coli which has an isopropyl alcohol production system, and has an isopropyl alcohol production ability that is introduced by a genetic recombination technique. The isopropyl alcohol production system can be any system that causes the Escherichia coli of interest to produce isopropyl alcohol.
[249] In the isopropyl alcohol-producing Escherichia coli according to the invention, preferably, four enzymatic activities - an acetoacetate decarboxylase activity, an isopropyl alcohol dehydrogenase activity, a CoA transferase activity and the aforementioned thiolase activity - are transmitted from outside the cell.
[250] In the invention, examples of isopropyl alcohol producing Escherichia coli having an isopropyl alcohol production system include a pIPA/B variant and a pIaaa/B variant described in WO 2009/008377. Examples of isopropyl alcohol-producing Escherichia coli also include a variant in which, among the enzymes involved in the production of isopropyl alcohol, CoA transferase activity and thiolase activity are increased by increased expression of the respective genes in the Escherichia coli genome, and in which isopropyl alcohol dehydrogenase activity and acetoacetate decarboxylase activity are increased by increasing the expression of the respective genes using a plasmid or plasmids (sometimes called “pIa/B::atoDAB variant”).
[251] In the invention, the isopropyl alcohol producing Escherichia coli may be an isopropyl alcohol producing Escherichia coli including an isopropyl alcohol production system, in which the GntR transcriptional repressor activity is inactivated, and the isopropyl alcohol producing Escherichia coli includes a group of auxiliary enzymes that have a pattern of enzymatic activity whereby the ability to produce isopropyl alcohol obtained by inactivating GntR activity is maintained or increased. Consequently, the production of isopropyl alcohol can be further increased.
[252] The term "a group of auxiliary enzymes" in the invention refers to an enzyme or two or more enzymes, which affect the ability to produce isopropyl alcohol. Furthermore, the activity of enzymes included in the group of auxiliary enzymes is inactivated, activated or increased. The phrase "enzymatic activity pattern of the auxiliary enzyme group", as used herein, refers to the pattern of enzymatic activity of enzymes that is capable of maintaining or increasing the amount of isopropyl alcohol production obtained increased by inactivating the GntR activity alone, and encompasses an enzyme from a combination of two or more of the enzymes.
[253] Examples of preferable enzyme activity patterns from the auxiliary enzyme group include the following patterns: (1) maintenance of wild-type activities of glucose-6-phosphate isomerase (Pgi), glucose-6-phosphate-1-dehydrogenase ( Zwf) and phosphogluconate dehydrogenase (Gnd); (2) inactivation of glucose-6-phosphate isomerase (Pgi) activity and increased glucose-6-phosphate-1-dehydrogenase (Zwf) activity; and (3) inactivation of glucose-6-phosphate isomerase (Pgi) activity, increased glucose-6-phosphate-1-dehydrogenase (Zwf) activity and inactivation of phosphogluconate dehydrogenase (Gnd) activity.
[254] Among these, the pattern of enzymatic activity of the auxiliary enzyme group described in item (3) above is more preferable from the standpoint of isopropyl alcohol production ability.
[255] The group of auxiliary enzymes and the pattern of their enzymatic activity are not limited to those described above. Any group of auxiliary enzymes and their enzymatic activity pattern which include inactivation of GntR activity, and with which the amount of isopropyl alcohol production in an isopropyl alcohol producing Escherichia coli can be increased, are within the scope of the invention. The auxiliary enzyme group is not necessarily made up of several enzymes, and can be made up of one enzyme.
[256] GntR refers to a transcription factor that downregulates an operon involved in gluconate metabolism via the Entner-Doudoroff pathway. GntR is a generic name for transcriptional repressors of GntR that suppress the functions of two groups of genes (GntI and GntII), which are responsible for gluconic acid uptake and metabolism.
[257] Glucose-6-phosphate isomerase (Pgi) is a generic name for enzymes that are classified as enzyme code number: 5.3.1.9 based on the report of the “Enzyme Commission of the International Union of Biochemistry” (IUB), and which catalyze a reaction to produce D-fructose-6-phosphate from D-glucose-6-phosphate.
[258] Glucose-6-phosphate-1-dehydrogenase (Zwf) is classified as enzyme code number: 1.1.1.49 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB) and which catalyzes a reaction to the production of D-glucone-1,5-lactone-6-phosphate from D-glucose-6-phosphate.
[259] Examples of glucose-6-phosphate-1-dehydrogenase include those derived from Deinococcus bacteria such as, for example, Deinococcus radiophilus; Aspergillus fungi such as, for example, Aspergillus niger or Aspergillus aculeatus; Acetobacter bacteria such as Acetobacter hansenii; Thermotoga bacteria such as Thermotoga maritima; Cryptococcus fungi such as Cryptococcus neoformans; Dictyostelium fungi such as Dictyostelium discoideum; Pseudomonas such as, for example, Pseudomonas fluorescens or Pseudomonas aeruginosa; Saccharomyces such as, for example, Saccharomyces cerevisiae; Bacillus bacteria such as Bacillus megaterium; or Escherichia bacteria such as Escherichia coli.
[260] As a glucose-6-phosphate-1-dehydrogenase (Zwf) gene, a DNA having the base sequence of the gene encoding thiolase obtained from any of the enzyme's parent organisms listed above, or a sequence of Synthesized DNA that is synthesized based on a known base sequence of the gene can be used. Preferable examples thereof include a DNA having the base sequence of a gene derived from Deinococcus bacteria such as, for example, Deinococcus radiophilus, Aspergillus fungi such as, for example, Aspergillus niger or Aspergillus aculeatus; Acetobacter bacteria such as Acetobacter hansenii, Thermotoga bacteria such as Thermotoga maritima, Cryptococcus fungi such as Cryptococcus neoformans, Dictyostelium fungi such as Dictyostelium discoideum, Pseudomonas such as Pseudomonas fluorescens or Pseudomonas fluorescens aeruginosa, Saccharomyces such as, for example, Saccharomyces cerevisiae, Bacillus bacteria such as, for example, Bacillus megaterium, or Escherichia bacteria such as, for example, Escherichia coli. More preferable examples thereof include a DNA having the base sequence of a gene derived from a prokaryote such as, for example, Deinococcus bacteria, Aspergillus fungi, Acetobacter bacteria, Thermotoga bacteria, Pseudomonas, Bacillus bacteria or Escherichia bacteria. The DNA is most preferably a DNA which has the base sequence of a gene derived from Escherichia coli.
[261] Phosphogluconate dehydrogenase (Gnd) is a generic name for enzymes that are classified as enzyme code number: 1.1.1.44 based on the report of the Enzyme Commission of the International Union of Biochemistry (IUB), and which catalyze a reaction of production of D-ribulose-5-phosphate and CO2 from 6-phospho-D-gluconate.
[262] Each of the activities of these enzymes in the invention can be an activity introduced from outside the cell into the cell, or an activity obtained by overexpression of the enzyme gene that the host bacterium has in its genome by increasing the activity of the promoter for the enzyme gene or replacement of the promoter with another promoter.
[263] Escherichia coli which has increased enzymatic activity in the invention refers to Escherichia coli in which the enzymatic activity is increased by a certain method. This type of Escherichia coli can be constructed by introducing a gene encoding the enzyme or protein from outside the cell into the cell using a plasmid by gene recombination technology, as described above; or by overexpression of the enzyme gene that the host bacterium has in its genome by increasing the activity of the promoter for the enzyme gene or by replacing the promoter with another promoter; or a combination of these methods.
[264] The promoter of the gene applicable to isopropyl alcohol-producing Escherichia coli can be any promoter capable of controlling the expression of any of the genes described above. The gene promoter is preferably a potent promoter which works constitutively in the microorganism, and which is not susceptible to repression of expression, even in the presence of glucose. Specific examples of these include the glyceraldehyde-3-phosphate dehydrogenase promoter (hereinafter sometimes referred to as "GAPDH") or the serine hydroxymethyltransferase promoter.
[265] The promoter in isopropyl alcohol-producing Escherichia coli signifies a salvage to which an RNA polymerase that has a sigma factor binds to initiate transcription. For example, an Escherichia coli-derived GAPDH promoter is described in Base Nos. 397 to 440 in the base sequence information of Accession Number in GenBank X02662.
[266] In isopropyl alcohol-producing Escherichia coli, lactate dehydrogenase (LdhA) may be disrupted. The breakdown of lactate dehydrogenase suppresses lactate production even under culture conditions where oxygen supply is restricted and, as a result, isopropyl alcohol can be efficiently produced. The “conditions in which the oxygen supply is restricted” generally means conditions: 0.02 vvm to 2.0 vvm (vvm: aeration volume [ml]/net volume [ml]/time [min]) at a rate of stirring at 200 to 600 rpm when only air is used as the gas.
[267] Lactate dehydrogenase (LdhA) refers to an enzyme that produces D-lactate and NAD from pyruvate and NADH.
[268] The acetyl-CoA producing microorganism for acetone production may be one that has only thiolase activity, CoA transferase activity, and acetoacetate decarboxylase activity among activity in the isopropyl alcohol production system. That is, when acetone is produced by using the acetyl-CoA-producing microorganism, the microorganism that has the activity of isopropyl alcohol dehydrogenase can be used.
[269] Other examples of the pathway for producing another metabolite using acetyl-CoA as a raw material include a pathway that produces glutamate from acetyl-CoA. Preferable examples of the microorganism that has a pathway that produces another metabolite or the microorganism whose enzymatic activity involved in a pathway that produces another metabolite is increased include a microorganism obtained by transmission or augmentation, or inactivation of enzymatic activities in the pathway described above that produces glutamate a from acetyl-CoA or reduction of an enzymatic activity that inhibits the production of glutamate from acetyl-CoA by using a microorganism that has a pathway that efficiently produces a glutamate (hereinafter sometimes called "glutamate-producing microorganism" ) or by using a glutamate-producing microorganism as a host.
[270] Examples of the glutamate-producing microorganism include the microorganisms mentioned above that have an ability to produce L-amino acids.
[271] Specific examples of the glutamate-producing microorganism include, without limitation, Enterobacteriaceae bacteria such as Escherichia bacteria or Pantoea bacteria and coryneform bacteria such as Corynebacterium glutamicum.
[272] The glutamate-producing microorganism can be any microorganism that allows the introduction or modification of a gene to transmit the ability to produce glutamate. It is more preferable that the glutamate-producing micro-organism is a Pantoea bacterium or a coryneform bacterium to which the ability to produce glutamate has been imparted in advance. By using this type of micro-organism, glutamate can be produced more efficiently.
[273] Examples of a method of transmitting the ability to produce glutamate to a microorganism include modifying the microorganism in such a way that the expression of a gene encoding an enzyme involved in L-glutamate biosynthesis is increased and/or overexpressed . Examples of the enzyme involved in the L-glutamate biosynthetic pathway include glutamate dehydrogenase, glutamine synthetase, glutamate synthase, isocitrate dehydrogenase, aconitate hydratase, citrate synthase, phosphoenolpyruvate carboxylase, pyruvate carboxylase, pyruvate dehydroglycase, phosphoolpyrutase, pyruvate, phospho-erutase, pyruvate, phospho-erutase kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-phosphate isomerase, fructose-bisphosphate aldolase, phosphofructokinase and glucose-phosphate isomerase. Among these enzymes, it is preferable that one or more of citrate synthase, phosphoenolpyruvate carboxylase and glutamate dehydrogenase have an increased activity, and it is more preferable that all three enzymes have increased activities.
[274] Examples of the glutamate-producing micro-organism include a glutamate-producing micro-organism described in Japanese Patent Application submitted for public inspection (JP-A) No. 2005-278643.
[275] The L-glutamate-producing microorganism to be used may be a microorganism that has an ability to accumulate L-glutamate in an amount that exceeds the saturation concentration of L-glutamate in a liquid medium when the microorganism has been cultured under conditions acidic (hereafter referred to as “the ability to accumulate L-glutamate under acidic conditions”). For example, a variant that has increased resistance to L-glutamate in a low pH environment can be obtained by a method described in European Patent submitted for public inspection No. 1078989, whereby the ability to accumulate L-glutamate in an amount that exceeds the saturation concentration is transmitted.
[276] Specific examples of the microorganism that has an intrinsic ability to accumulate L-glutamate under acidic conditions include Pantoea ananatis AJ13356 (FERM BP-6615) and AJ13601 (FERM BP-7207) (see European Patent Submitted to Public Inspection No. 0952221 ). Pantoea ananatis AJ13356 has been deposited with the “National Institute of Bioscience and Human-Technology”, “Agency of Industrial Science and Technology”, “Ministry of International Trade and Industry” (current name: “International Patent Organism Depositary”, “National Institute of Technology and Evaluation” (IPOD, NITE); address: Tsukuba Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8566, Japan) under Accession No. FERM P-16645 on February 19, 1998, and after transferred to an international depositary authority under the Budapest Treaty under Accession No. FERM BP-6615 on January 11, 1999. This strain was identified as Enterobacter agglomerans and deposited as Enterobacter agglomerans AJ13355 when first isolated but according to recent 16S rRNA base sequence analysis and the like, the strain has been reclassified as Pantoea ananatis (see Examples below). Similarly, AJ13356 and AJ13601 mentioned below induced from AJ13355 were deposited in the above depository as Enterobacter agglomerans, but these strains are described as Pantoea ananatis in the present specification. AJ13601 has been deposited with the “National Institute of Bioscience and Human-Technology”, “Agency of Industrial Science and Technology”, “Ministry of International Trade and Industry” (current name: “International Patent Organism Depositary”, “National Institute of Technology and Evaluation ” (IPOD, NITE) under Accession No. FERM P-17156 on 18 August 1999, and then transferred to an international depositary authority under the Budapest Treaty under Accession No. FERM BP-7207 on 6 July of 2000.
[277] Other examples of the method of transmitting or enhancing the ability to produce L-glutamate include a method of transmitting resistance to an organic acid analogue or a respiratory inhibitor, and a method of transmitting sensitivity to a wall synthesis inhibitor cell phone. Specific examples of the method include resistance transmission to monofluoracetic acid (JP-A No. S50-113209), resistance transmission to adenine or thymine resistance (JP-A No. S57-065198), urease weakening (JP-A N ° S52-038088), transmission of resistance to malonic acid (JP-A No. S52-038088), transmission of resistance to benzopyrone or naphthoquinones (JP-A No. S56- 001889), transmission of resistance to HOQNO (JP-A No. S56-140895 A), transmission of resistance to α-ketomalonic acid (JP-A No. S57-002689 A), transmission of resistance to guanidine (JP-A No. S56-035981) and method of transmission of resistance to penicillin (JP-A No. H04-088994).
[278] Specific examples of resistant microorganisms include the following strains.
[279] - Brevibacterium flavum AJ3949 (FERM BP-2632; see JP-A No. S50-113209)
[280] - Corynebacterium glutamicum AJ11628 (FERM P-5736; see JP-A No. S57-065198)
[281] - Brevibacterium flavum AJ11355 (FERM P-5007; see JP-A No. S56-001889)
[282] - Corynebacterium glutamicum AJ11368 (FERM P-5020; see JP-A S56-001889)
[283] - Brevibacterium flavum AJ11217 (FERM P-4318; see JP-A No. S57-002689)
[284] - Corynebacterium glutamicum AJ11218 (FERM P-4319; see JP-A No. S57-002689)
[285] - Brevibacterium flavum AJ11564 (FERM P-5472; see JP-A No. S56-140895)
[286] - Brevibacterium flavum AJ11439 (FERM P-5136; see JP-A No. S56-035981)
[287] - Corynebacterium glutamicum H7684 (FERM BP-3004; see JP-A No. H04-088994)
[288] - Brevibacterium lactofermentum AJ11426 (FERM P 5123; see JP-A No. S56-048890)
[289] - Corynebacterium glutamicum AJ11440 (FERM P-5137; see JP-A No. S56-048890)
[290] - Brevibacterium lactofermentum AJ11796 (FERM P6402; see JP-A No. S58-158192)
[291] Preferable examples of the microorganism that has an ability to produce L-glutamine include a microorganism in which the glutamate dehydrogenase activity is increased, a microorganism in which the glutamine synthetase (glnA) activity is increased, and a microorganism in which the glutaminase gene is disrupted (European patents submitted for public inspection Nos. 1229121 and 1424398). Increased glutamine synthetase activity can also be achieved by disruption of glutamine adenylyl transferase (glnE) or by disruption of PII regulatory protein (glnB). Other preferable examples of the L-glutamine producing microorganism include a variant belonging to the genus Escherichia, and the variant harbors a mutant glutamine synthetase in which the tyrosine residue at position 397 in glutamine synthetase is replaced by another amino acid residue (US Patent Application Published No. 2003-0148474).
[292] Other method of transmission or enhancement of L-glutamine production ability include transmission of resistance to 6-diazo-5-oxo-norleucine (JP-A No. H03- 232497), transmission of resistance to an analogue of purine and methionine sulfoxide resistance (JP-A No. S61-202694) and transmission resistance to α-cetomaleic acid (JP-A No. S56-151495). Specific examples of coryneform bacteria that possess the ability to produce L-glutamine include the following microorganisms.
[293] - Brevibacterium flavum AJ11573 (FERM P-5492; JP-A No. S56-161495)
[294] - Brevibacterium flavum AJ11576 (FERM BP-10381; JP-A No. S56-161495)
[295] - Brevibacterium flavum AJ12212 (FERM P-8123; JP-A No. S61-202694)
[296] Preferable examples of microorganisms that produce proline, leucine, isoleucine, valine, arginine, citrulline, ornithine, and/or polyglutamic acid include a microorganism described in JP-A No. 2010-41920. Microorganisms that produce acetic acid, (poly)3-hydroxybutyric acid, itaconic acid, citric acid and/or butyric acid are described in "Fermentation Handbook" (Kyoritsu Shuppan Co., Ltd.).
[297] Examples of microorganisms that produce 4-aminobutyric acid include a microorganism in which glutamate decarboxylase is introduced into a glutamate producing microorganism, such as those described in JP-A No. 2011167097.
[298] Examples of microorganisms that produce 4-hydroxybutyric acid include a microorganism in which glutamate decarboxylase, transaminase, and/or aldehyde dehydrogenase are introduced into a glutamate producing microorganism, such as those described in JP-A No. 2009171960.
[299] Examples of microorganisms that produce 3-hydroxyisobutyric acid include a microorganism to which a pathway described in WO 2009/135074 or WO 2008/145737 has been introduced.
[300] Examples of microorganisms that produce 2-hydroxyisobutyric acid include a microorganism to which a pathway described in WO 2009/135074 or WO 2009/156214 has been introduced.
[301] Examples of microorganisms that produce 3-aminoisobutyric acid or methacrylic acid include a microorganism to which a pathway described in WO 2009/135074 has been introduced.
[302] The microorganism in the invention is a microorganism that is constructed to have the acetyl-CoA production cycle of Fig. 1 by transmission of at least malate thiokinase and malyl-CoA lyase. Therefore, microorganisms that intrinsically possess malate thiokinase and malyl-CoA lyase are not included in the acetyl-CoA producing microorganism of the invention.
[303] Examples of microorganisms that intrinsically possess Mtk and mcl include methanotrophic microorganisms such as Methylobacterium extorquens. As suitable vector systems for methanotrophic microorganisms or techniques for modifying genomic genes of methanotrophic microorganisms have not been developed, the genetic manipulation of microorganisms is more difficult than industrial microorganisms such as Escherichia coli and Corynebacterium. Furthermore, these microorganisms grow slowly in many cases and therefore are not suitable for producing useful metabolites.
[304] The method of producing acetyl-CoA, acetone, isopropyl alcohol or glutamate according to the invention includes the production of acetyl-CoA, acetone, isopropyl alcohol or glutamate as the product of interest from a source material of carbon using the acetyl-CoA producing microorganism described above. That is, the acetyl-CoA production method includes: cultivating the acetyl-CoA producing microorganism in a state in which the acetyl-CoA producing microorganism makes contact with a carbon source material (hereinafter, culture process ), and collection of the product of interest (acetyl-CoA, acetone, isopropyl alcohol or glutamate) obtained by contact (hereinafter, collection process).
[305] According to the acetyl-CoA production method, as the acetyl-CoA producing microorganism is cultivated in a state in which the acetyl-CoA producing microorganism makes contact with a carbon source material, the material- The carbon source is assimilated by the acetyl-CoA producing microorganism, and the product of interest can be efficiently produced while carbon dioxide is fixed.
[306] The carbon source material is not restricted, as long as the material contains a carbon source that can be assimilated by the micro-organism, and the material is preferably a plant-derived raw material.
[307] In the invention, plant-derived raw material refers to organs such as roots, stems, trunks, branches, leaves, flowers and seeds; plant bodies containing the organs; and decomposition products from plant organs, and further encompasses carbon sources that can be used as carbon sources by microorganisms during cultivation among the carbon sources obtained from plant bodies, plant organs and their decomposition products .
[308] General examples of carbon sources in plant-derived raw materials include sugars such as starch, sucrose, glucose, fructose, xylose and arabinose; decomposition products of herbaceous and woody plants or cellulose hydrolysates, each containing the above ingredients in large quantities; and combinations of these. The carbon source in the invention can further include glycerin and fatty acids derived from vegetable oil.
[309] Preferable examples of the plant-derived raw material include agricultural crops such as, for example, grains, corn, rice, wheat, soybeans, sugar cane, sugar beet, cotton, and the like, and combinations thereof. The form of these as raw materials is not specifically limited, and may be raw products, squeezed juice, crushed products, or the like. Alternatively, the plant-derived feedstock may be in a form consisting solely of the carbon source described above.
[310] In the culture process, contact between the acetyl-CoA-producing microorganism and the plant-derived raw material is usually made by culturing the acetyl-CoA-producing microorganism in a culture medium containing the derived raw material of plant.
[311] The contact density between the plant-derived raw material and the acetyl-CoA producing microorganism can be varied depending on the activity of the acetyl-CoA producing microorganism. In general, the concentration of the plant-derived raw material in the culture medium can be such that the initial sugar concentration in terms of glucose can be adjusted to be 20% by mass or less with respect to the total mass of the mixture. From the standpoint of sugar tolerance of the acetyl-CoA producing microorganism, the initial sugar concentration is preferably adjusted to be 15% by mass or less. Other components can be added in addition amounts common to microorganism culture media, without particular limitation.
[312] The content of the acetyl-CoA producing microorganism in the culture medium can be varied with the type and activity of the microorganism, and the amount of a preculture bacterial liquid (OD 660 nm =4 to 8) a be added when starting cultivation initially can generally be adjusted from 0.1% by mass to 30% by mass relative to the culture liquid, and is preferably adjusted to be from 1% by mass to 10% by mass relative to the culture liquid from the point of view of control of culture conditions.
[313] The medium to be used for culturing the acetyl-CoA-producing microorganism can be any commonly employed culture medium that includes a carbon source, a nitrogen source, and an inorganic ion, and an additional inorganic trace element, a nucleic acid, and a vitamin etc., needed by microorganisms to produce the product of interest, without particular limitation.
[314] The culture conditions for the culture process are not particularly restricted, and cultivation can be carried out, for example, under aerobic conditions at a suitably controlled pH and temperature within a range of pH 4 to 9, preferably pH 6 at 8, and within a range of 20°C to 50°C, preferably 25°C to 42°C.
[315] The gas aeration volume in the mixture described above is not particularly restricted. When only air is used as the gas, the aeration volume is generally 0.02 vvm to 2.0 vvm (vvm: aeration volume [ml]/net volume [ml]/time [min]) at 50 to 600 rpm. From the standpoint of suppressing physical damage to Escherichia coli, aeration is preferably carried out at 0.1 vvm to 2.0 vvm, more preferably at 0.1 vvm to 1.0 vvm.
[316] The culture process can be continued from the beginning of the cultivation until the carbon source material in the mixture is exhausted, or until the activity of the acetyl-CoA producing microorganism disappears. The duration of the culture process can be varied with the number and activity of the acetyl-CoA producing microorganism in the mixture and the quantity of the carbon source material. In general, the duration can be at least one hour and preferably at least four hours. The duration of the culture process can be continued unlimitedly by a new addition of the carbon source material or the acetyl-CoA producing microorganism. However, from the point of view of process efficiency, the duration can generally be adjusted to 5 days or less, preferably 72 hours or less. With respect to other conditions, the conditions employed for common cultivation can be applied in the same way.
[317] The methods of collecting the product of interest accumulated in the culture medium are not particularly restricted. For example, a method that includes removing microorganism cells from the culture medium can be employed, for example, by centrifugal separation and then separation of the product of interest using a common separation method such as, for example, distillation or membrane separation under conditions appropriate to the type of product of interest.
[318] The method of producing acetyl-CoA according to the invention may further include, prior to the culture process, a pre-culture process to obtain an appropriate cell number and/or an appropriate activated state of the producing microorganism of acetyl-CoA to be used. The preculture process can be any culture carried out under suitable conditions normally employed for the type of acetyl-CoA producing microorganism.
[319] The acetyl-CoA producing microorganism used in the acetone production method is preferably the acetyl-CoA producing microorganism having the thiolase activity, the CoA transferase activity and the acetoacetate decarboxylase activity, described above as an aspect preferable of the acetyl-CoA producing microorganism, from the standpoint of efficiency of acetone production.
[320] The acetyl-CoA producing microorganism used in the isopropyl alcohol production method is preferably the acetyl-CoA producing microorganism which has the thiolase activity, the CoA transferase activity, the acetoacetate decarboxylase activity and the alcohol activity isopropyl dehydrogenase, described above as a preferable aspect of the acetyl-CoA producing microorganism, from the standpoint of isopropyl alcohol production efficiency.
[321] The isopropyl alcohol production method or the acetone production method preferably includes a culture process in which the acetyl-CoA producing microorganism is cultivated while gas is supplied in the mixture containing the acetyl-CoA producing microorganism and the carbon source material; and a collection process for collecting the product of interest, in which isopropyl alcohol or acetone produced by the cultivation is separated and collected from the mixture.
[322] According to the isopropyl alcohol production method or the acetone production method, the acetyl-CoA producing microorganism is cultured while gas is supplied in the mixture (air culture). In this aeration culture, the produced isopropyl alcohol or the produced acetone is released into the mixture, and evaporated from the mixture. As a result, the isopropyl alcohol produced or the acetone produced can be easily separated from the mixture. Furthermore, as the produced isopropyl alcohol or produced acetone is continuously separated from the mixture, an increase in the concentration of isopropyl alcohol or acetone in the mixture can be suppressed. Therefore, it is not necessary to worry too much about the tolerance of the acetyl-CoA producing microorganism against isopropyl alcohol or acetone.
[323] The mixture in this method can be composed primarily of a basic medium commonly used for culturing the host microorganism. With regard to culture conditions, those described above can be applied in the same way.
[324] In the collection process, isopropyl alcohol or acetone produced in the culture process and separated from the mixture is collected. The collection method may be any method capable of collecting isopropyl alcohol or acetone in a gaseous or evaporated droplet state from the mixture by ordinary cultivation. Examples of these include a collection method in a collection component such as a commonly used airtight container. In particular, the method preferably includes contacting a capture solution for capturing isopropyl alcohol or acetone with the separate isopropyl alcohol or acetone from the mixture, from the standpoint of collecting only isopropyl alcohol or acetone with high purity.
[325] In the isopropyl alcohol production method or the acetone production method, isopropyl alcohol or acetone can be collected in a state in which isopropyl alcohol or acetone is dissolved in a capture solution or in the mixture. Examples of the collection method include a method described in WO 2009/008377. The collected isopropyl alcohol or acetone can be confirmed using a common detection means such as HPLC. The collected isopropyl alcohol can be further purified if necessary. Examples of the purification method include distillation etc.
[326] When the collected isopropyl alcohol or acetone is in an aqueous solution state, the isopropyl alcohol production method or the acetone production method may further include a dehydration process in addition to the collection process. Dehydration from isopropyl alcohol or acetone can be carried out by a common method.
[327] Examples of apparatus applicable to the method of producing isopropyl alcohol or acetone in which isopropyl alcohol or acetone can be collected in the dissolved state in the capture solution or in the mixture include the production apparatus shown in Fig. 1 of WO 2009/008377 .
[328] In this production apparatus, an injection pipe for injecting a gas from the outside into the apparatus is connected to the culture tank which contains a culture medium that includes a microorganism to be used and a plant-derived raw material allowing , in this way, the aeration to the culture medium.
[329] A capture tank that contains a capture solution as the capture liquid is connected to the culture tank via a connecting pipe. A gas or liquid that has been moved into the capture tank makes contact with the capture solution, and bubbling occurs.
[330] As a result, isopropyl alcohol or acetone, which was produced in the culture tank by cultivation under aeration, is evaporated due to the aeration and therefore easily separated from the culture medium, and is captured in the capture solution in the culture tank. catch. As a result, isopropyl alcohol or acetone can be produced in a more purified state in a simple and continuous way.
[331] A method of producing glutamate according to the invention includes producing glutamate as the product of interest from a carbon source material using the acetyl-CoA producing microorganism described above. Specifically, the glutamate production method includes cultivating the acetyl-CoA producing microorganism in a state in which the acetyl-CoA producing microorganism makes contact with a carbon source material (hereinafter, culture process), and collecting of the product of interest (glutamate) obtained by contact (hereafter collection process).
[332] According to the glutamate production method, as the acetyl-CoA producing microorganism is cultivated in a state in which the acetyl-CoA producing microorganism makes contact with a carbon source material, the carbon source material carbon is assimilated by the acetyl-CoA producing microorganism, and the product of interest can be efficiently produced while carbon dioxide is fixed.
[333] The culture medium to be used for culture can be any culture medium commonly employed that includes a carbon source, a nitrogen source, and an inorganic salt; and an organic micronutrient such as an amino acid or vitamins as needed. A synthetic culture medium or a natural culture medium can be used. The carbon source and nitrogen source used in the culture medium can be of any type that can be used by the microorganisms to be cultivated.
[334] Examples of the carbon source material that can be used include sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, hydrolyzed starch and molasses; and organic acids such as acetic acid or citric acid, and alcohols such as ethanol can be used alone or in combination with other carbon sources.
[335] Examples of the nitrogen source that can be used include ammonia, ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate or ammonium acetate, and nitric acid salts.
[336] Examples of the organic micronutrient that can be used include amino acids, vitamins, fatty acids, and nucleic acids; and peptones, casamino acids, yeast extracts and soy protein hydrolysates, each containing the above ingredients. When an auxotrophic mutant that requires an amino acid and the like for growth is used, it is preferable to provide a nutrient that is needed.
[337] Examples of the inorganic salt that can be used include phosphoric acid salts, magnesium salts, calcium salts, iron salts and manganese salts.
[338] Cultivation is preferably carried out at a fermentation temperature of 20°C to 45°C at a pH of 3 to 9 under aeration. For pH adjustment, an inorganic or organic substance, acidic or alkaline, ammonia gas etc. can be used. L-amino acid is accumulated in the culture medium or cells by culturing the microorganism preferably for 10 hours to 120 hours under these conditions.
[339] When the L-amino acid of interest is L-glutamate, the culture can be carried out in such a way that the L-glutamate produced is precipitated and accumulated in the culture medium, using a liquid medium whose conditions are adjusted to precipitate L-glutamate. For example, the conditions for precipitating L-glutamate may be a pH of 5.0 to 4.0, preferably a pH of 4.5 to 4.0, more preferably a pH of 4.3 to 4.0, even more preferably a pH of 4.0. For obtaining both increased growth under acidic conditions and efficient L-glutamate precipitation, the pH is preferably from 5.0 to 4.0, more preferably from 4.5 to 4.0, even more preferably from 4.3 to 4 .0. Cultivation at the pH described above can be carried out for the entire culture period or for a part of the culture period.
[340] L-amino acid can be collected from the culture liquid after completion of culture according to a known collection method. For example, collection can be performed by a method in which concentration crystallization is performed after removal of bacterial cells from a culture medium, or by ion exchange chromatography. When the culture was carried out under conditions that allow precipitation of L-glutamate in a culture medium, the L-glutamate precipitated in the culture medium can be collected by centrifugal separation, filtration, or the like. In such cases, the dissolved L-glutamate remaining in the culture medium can be crystallized, and the crystallized L-glutamate can be isolated together.
[341] Examples of methods for producing proline, leucine, isoleucine, valine, arginine, citrulline, ornithine, acetic acid, (poly)3-hydroxybutyric acid, itaconic acid, citric acid, butyric acid, or polyglutamic acid include methods described in “ Fermentation Handbook” (Kyoritsu Shuppan Co., Ltd.).
[342] Examples of methods for producing 4-aminobutyric acid include a production method using a microorganism obtained by introducing glutamate decarboxylase into a glutamate producing microorganism, and which is described, for example, in JP-A No. 2011 -167097.
[343] Examples of methods for producing 4-hydroxybutyric acid include a production method using a microorganism obtained by introducing glutamate decarboxylase, aminotransferase, and aldehyde dehydrogenase to a glutamate-producing microorganism, and which is described, for example, in JP -A No. 2009-171960.
[344] Examples of methods for producing 3-hydroxyisobutyric acid include a production method using a microorganism to which the route described, for example, in WO 2009/135074 or WO 2008/145737 has been introduced.
[345] Examples of methods for producing 2-hydroxyisobutyric acid include a production method using a microorganism to which the route described, for example, in WO 2009/135074 or WO 2009/156214 has been introduced.
[346] Examples of methods for producing 3-aminoisobutyric acid or methacrylic acid include a production method using a microorganism to which the route described, for example, in WO 2009/135074 has been introduced. EXAMPLES
[347] In the following, examples of the present invention will be described in detail. However, the invention is by no means limited to these examples. Example 1 Preparation of Escherichia coli B, atoD variant with enhanced genome
[348] The entire genomic DNA sequence of Escherichia coli MG1655 is known (GenBank Accession Number U00096), and the base sequence of a gene encoding CoA transferase α subunit (hereinafter sometimes abbreviated to “atoD” ) of Escherichia coli MG1655 has also been reported. That is, atoD is described in 2321469 to 2322131 of the genome sequence Escherichia coli MG1655, which is described in GenBank Accession Number U00096.
[349] As the base sequence of a promoter necessary to express the gene mentioned above, the promoter sequence of glyceraldehyde-3-phosphate dehydrogenase (hereafter sometimes called "GAPDH") derived from Escherichia coli, which is described in 397 to 440 in the base sequence information with a GenBank Accession Number X02662 can be used. In order to obtain the GAPDH promoter, amplification by a PCR method was performed using the genomic DNA of Escherichia coli MG1655 as a template and using CGCTCAATTGCAATGATTGACACGATTCCG (SEQ ID. NO: 1) and ACAGAATTCGCTATTTGTTAGTGAATAAAAGG (SEQ ID. NO: 1) and ACAGAATTCGCTATTTGTTAGTGAATAAAAGG (SEQ ID. NO.: 1) No.: 2) as primers and the DNA fragment obtained was digested with restriction enzymes MfeI and EcoRI, thus obtaining a DNA fragment of about 100 bp encoding the GAPDH promoter. The DNA fragment obtained and a fragment obtained by digestion of plasmid pUC19 (GenBank Accession Number X02514) with restriction enzyme EcoRI, followed by treatment with alkaline phosphatase were mixed, and the mixed fragments were ligated using a ligase. Next, competent cells of Escherichia coli DH5α (DNA-903, manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 50 µg/ml ampicillin were obtained. Ten of the colonies obtained were individually cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and plasmids were recovered, and plasmids from which the GAPDH promoter was not clipped when digested with EcoRI and KpnI restriction enzymes were selected. Furthermore, the DNA sequence of these was verified, and a plasmid into which the GAPDH promoter was properly inserted was called pGAP. The pGAP obtained was digested with EcoRI and KpnI restriction enzymes.
[350] Furthermore, in order to obtain atoD, amplification by a PCR method was performed using Escherichia coli genomic DNA MG1655 as a template and using CGAATTCGCTGGTGGAACATATGAAAACAAAATTGATGACATTACAAGAC (SEQ ID NO: 3) and GCGGTACCTTATTTGCTCTCCIDTGTGAAA DE SEQ NO: 4) as primers, and the obtained DNA fragment was digested with restriction enzymes EcoRI and KpnI thereby obtaining an atoD fragment of about 690 bp. This DNA fragment was mixed with pGAP that had been previously digested with EcoRI and KpnI restriction enzymes. The mixed fragments were ligated using a ligase. Next, competent cells of Escherichia coli DH5α (DNA-903, manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 50 µg/ml ampicillin were obtained. A plasmid was recovered from the obtained bacterial cells, and it was confirmed that atoD was inserted properly. The plasmid obtained was called pGAPatoD.
[351] Here, Escherichia coli MG1655 is available from the “American Type Culture Collection”.
[352] As described above, the base sequence of atoD in the genomic DNA of Escherichia coli MG1655 has also been reported. PCR was performed using genomic DNA from Escherichia coli MG1655 as a template and using GCTCTAGATGCTGAAATCCACTAGTCTTGTC (SEQ ID. NO: 5) and TACTGCAGCGTTCCAGCACCTTATCAACC (SEQ ID. NO: 6) as primers, which were prepared based on the information. gene of the 5' flanking region of atoD of Escherichia coli MG1655 and, consequently, a DNA fragment of about 1.1 kbp was amplified.
[353] Furthermore, PCR was performed using the pGAPatoD expression vector prepared above as a template, and using GGTCTAGAGCAATGATTGACACGATTCCG (SEQ ID. NO: 7) prepared based on sequence information from the GAPDH promoter from Escherichia coli MG1655 and an ID initiator. OF SEQ. No.: 4 prepared based on the sequence information of atoD from Escherichia coli MG1655 and, therefore, a DNA fragment of about 790 bp which contains the promoter of GAPDH and atoD was obtained.
[354] The fragments obtained as above were digested with restriction enzymes PstI and XbaI, and XbaI and KpnI, respectively, and the resulting fragments were mixed with a fragment obtained by digestion of a temperature-sensitive plasmid pTH18cs1 (Accession No. no. GenBank AB019610) [Hashimoto-Gotoh, T., Gene, 241, 185191 (2000)] with PstI and KpnI, and the scrambled fragments were ligated using a ligase. Next, DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. The colonies obtained were cultured at 30°C overnight in a liquid LB medium containing 10 μg/ml of chloramphenicol, and plasmids were recovered from the bacterial cells obtained. Escherichia coli B (ATCC 11303) was transformed with the plasmid, and was cultured at 30°C overnight on an LB agar plate containing 10 µg/ml chloramphenicol and, consequently, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. The cultured bacterial cells obtained were applied to an LB agar plate containing 10 μg/ml of chloramphenicol and cultured at 42°C and, consequently, colonies were obtained. The colonies obtained were cultivated in an antibiotic-free liquid LB medium at 30°C for 2 hours, and the resulting culture was then applied to an antibiotic-free LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[355] Of the colonies that emerged, 100 colonies were randomly picked, and each individually grown on either an antibiotic-free LB agar plate or an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, a fragment of about 790 bp that contained the GAPDH and atoD promoter was amplified by PCR from the chromosomal DNA of these clones, and a variant in which a region of the atoD promoter was replaced by the GAPDH promoter was selected. Next, a clone meeting the above conditions was named Escherichia coli B, variant with enhanced atoD genome (hereafter sometimes abbreviated as “B::atoDAB variant”).
[356] Here, Escherichia coli B (ATCC 11303) is available from the “American Type Culture Collection”, which is a bank of cells, microorganisms and genes. Example 2 Preparation of Escherichia coli B, variant with enhanced atoD genome, pgi gene deleted
[357] The entire genomic DNA sequence of Escherichia coli MG1655 is known (GenBank Accession Number U00096), and the base sequence of a gene encoding phosphoglucose isomerase (hereafter sometimes referred to as “pgi”) from Escherichia coli has also been reported (GenBank Accession Number X15196). In order to clone a region flanking the base sequence of the gene encoding pgi (1650 bp), four types of oligonucleotide primers represented by CAGGAATTCGCTATATCTGGCTCTGCACG (SEQ ID. NO: 8), CAGTCTAGAGCAATACTCTTCTGATTTTGAG (SEQ ID. No: 9), CAGTCTAGATCATCGTCGATATGTAGGCC (SEQ ID NO: 10), and GACCTGCAGATCATCCGTCAGCTGTACGC (SEQ ID NO: 11) were synthesized. The initiator of the ID. OF SEQ. No: 8 has an EcoRI recognition site on the 5' end side of it, each of the IDS primers. OF SEQ. Nos: 9 and 10 has an XbaI recognition site on the 5' end side of these, and the ID primer. OF SEQ. No: 11 has a PstI recognition site on the 5' end side of it.
[358] Genomic DNA from Escherichia coli MG1655 (ATCC 700926) was prepared, and PCR was performed using the obtained genomic DNA as a template and using a pair of ID primers. OF SEQ. No.: 8 and ID. OF SEQ. No.: 9 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called "pgi-L fragment") was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 10 and ID. OF SEQ. No.: 11 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called "pgi-R fragment") was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. The pgi-L fragment was digested with EcoRI and XbaI, and the pgi-R fragment was digested with XbaI and PstI. The two types of digested fragments and a fragment obtained by digestion of a temperature sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI and PstI were mixed, and were reacted using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. Plasmids were recovered from the obtained transformants, and it was confirmed that the two fragments - the fragment from the 5'-upstream flanking region and the fragment from the 3'-downstream flanking region of the gene encoding pgi - were inserted properly into pTH18cs1. The plasmid obtained was digested with XbaI, and then subjected to blunt-end treatment with T4 DNA polymerase. The resulting DNA fragment was mixed with a kanamycin resistance gene obtained by digesting plasmid pUC4K (GenBank Accession Number X06404) (Pharmacia) with EcoRI and submitting the resulting product to blunt-end treatment with T4 DNA polymerase, and the scrambled fragments were ligated using T4 DNA ligase. Subsequently, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 10 µg/ml chloramphenicol and 50 µg/ml kanamycin at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the kanamycin resistance gene was properly inserted between the 5'-upstream flanking region fragment and the 3'-downstream flanking region fragment of the gene encoding pgi. The plasmid obtained was called pTH18cs1-pgi.
[359] Here, Escherichia coli MG1655 can be obtained from the “American Type Culture Collection”.
[360] The B::atoDAB variants prepared in Example 1 were transformed with the plasmid pTH18cs1-pgi thus obtained, and were cultured at 30°C overnight on an LB agar plate containing 10 µg/ml chloramphenicol and 50 μg/ml of kanamycin and, consequently, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 50 μg/ml of kanamycin, and cultured at 30°C overnight. Subsequently, part of the resulting culture liquid was applied to an LB agar plate containing 50 μg/ml of kanamycin and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium containing 50 μg/ml of kanamycin, and were applied to an LB agar plate containing 50 μg/ml of kanamycin and, consequently, colonies that grew to 42°C were obtained.
[361] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate containing 50 μg/ml kanamycin and an LB agar plate containing 10 μg/ml chloramphenicol, and clones sensitive to chloramphenicol that grew only on the LB agar plate containing kanamycin were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 3.3 kbp, which indicates replacement of the pgi gene by the kanamycin resistance gene, could be amplified, was selected. . The obtained variant was named Escherichia coli B, variant with enhanced atoD genome, deleted pgi gene (hereinafter sometimes abbreviated to “B::atoDABΔpgi variant”).
[362] Here, Escherichia coli MG1655 and Escherichia coli B are available from the “American Type Culture Collection”. Example 3 Preparation of Escherichia coli B :: variant with enhanced atoD genome, pgi gene deleted, gntR gene deleted
[363] The entire genomic DNA sequence of Escherichia coli B is known (GenBank Accession No. CP000819), and the base sequence encoding GntR is described in 3509184 to 3510179 of the Escherichia coli B genomic sequence, which is described at GenBank Accession No. CP000819. In order to clone a region flanking the base sequence of the gene encoding GntR (gntR), four types of oligonucleotide primers represented by GGAATTCGGGTCAATTTTCACCCTCTATC (SEQ ID. NO: 12), GTGGGCCGTCCTGAAGGTACAAAAGAGATAGATTCTC (SEQ ID. NO: 12), GTGGGCCGTCCTGAAGGTACAAAAGAGATAGATTCTC (SEQ ID. °: 13), CTCTTTTGTACCTTCAGGACGGCCCACAAATTTGAAG (SEQ ID. NO: 14) and GGAATTCCCAGCCCCGCAAGGCCGATGGC (SEQ ID. NO: 15) were synthesized. Each of the IDS initiators. OF SEQ. Nos: 12 and 13 have an EcoRI recognition site on the 5' end side of these.
[364] Escherichia coli B genomic DNA (GenBank Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 12 and ID. OF SEQ. No.: 13 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “gntR-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 14 and ID. OF SEQ. No.: 15 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “gntR-R fragment”) was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. PCR was performed using the gntR-L and gntR-R fragments as templates and using a pair of ID primers. OF SEQ. No.: 12 and ID. OF SEQ. No.: 15 and, as a result, a DNA fragment of about 2.0 kbp (hereafter sometimes called “gntR-LR fragment”) was amplified. This gntR-LR fragment was separated by agarose electrophoresis, recovered, digested with EcoRI, and mixed with a fragment obtained by digestion of a temperature-sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the gntLR fragment was properly inserted into pTH18cs1. The plasmid obtained was called pTH18cs1-gntR.
[365] The Escherichia coli B::atoDABΔpgi variant prepared in Example 2 was transformed with the plasmid pTH18cs1-gntR thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 µg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[366] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the gntR gene, could be amplified, was selected. The variant obtained was named Escherichia coli B, variant with enhanced atoD genome, deleted pgi gene, deleted gntR gene (hereinafter sometimes abbreviated to “variant B::atoDABΔpgiΔgntR”). Example 4 Preparation of Escherichia coli B, variant with enhanced atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted
[367] In order to clone a region flanking the base sequence of the gene encoding phosphogluconate dehydrogenase (gnd), four types of oligonucleotide primers represented by CGCCATATGAATGGCGCGGGGGCCGGTGG (SEQ ID NO: 16), TGGAGCTCTGTTTACTCCTGTCAGGGGG (ID. SEQ ID NO: 17), TGGAGCTCTCTGATTTAATCAACAATAAAATTG (SEQ ID NO: 18), and CGGGATCCACCACCATAACCAAACGACGG (SEQ ID NO: 19) were synthesized. The initiator of the ID. OF SEQ. No.: 16 has an NdeI recognition site on the 5' end side of it, and each of the IDS primers. OF SEQ. Nos: 17 and 18 have a SacI recognition site on the 5' end side of these. Also, the initiator's ID. OF SEQ. No.: 19 has a BamHI recognition site on the 5' end side of it.
[368] Escherichia coli B genomic DNA (GenBank Accession No. CP000819) was prepared, and PCR was performed using a pair of ID primers. OF SEQ. No.: 16 and ID. OF SEQ. No.: 17 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “gnd-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 18 and ID. OF SEQ. No.: 19 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “gnd-R fragment”) was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. The gnd-L fragment was digested with NdeI and SacI, and the gnd-R fragment was digested with SacI and BamHI. These two types of digested fragments were mixed with a fragment obtained by digestion of a temperature sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with NdeI and BamHI, and the mixed fragments were allowed to react using T4 DNA ligase. Next, competent cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants that grew on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. Plasmids were recovered from the obtained transformants, and it was confirmed that the two fragments - the fragment from the 5'-upstream flanking region and the fragment from the 3'-downstream flanking region of the gene encoding gnd - were inserted properly into pTH18cs1. The plasmid obtained was named pTH18cs1-gnd.
[369] The Escherichia coli B::atoDABΔpgiΔgntR variant prepared in Example 3 was transformed with the plasmid pTH18cs1-gnd thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 μg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Then, part of this culture liquid was applied to an LB agar plate containing 10 μg/ml of kanamycin and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[370] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the gnd gene, could be amplified, was selected. The variant obtained was named Escherichia coli B, variant with enhanced atoD genome, deleted pgi gene, deleted gntR gene, deleted gnd gene (variant B::atoDABΔpgiΔgntRΔgnd). Example 5 Preparation of Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted
[371] In order to clone a region flanking the base sequence of the gene encoding D-lactate dehydrogenase (hereinafter sometimes abbreviated to "ldhA") (990 bp), four types of oligonucleotide primers represented by GGAATTCGACCATCGCTTACGGTCAATTG ( SEQ ID NO: 20), GAGCGGCAAGAAAGACTTTCTCCAGTGATGTTG (SEQ ID NO: 21), GGAGAAAGTCTTTCTTGCCGCTCCCCTGCAAC (SEQ ID NO: 22), and GGAATTCTTTAGCAAATGGCTTTCTTC (SEQ ID NO: 23) were synthesized. Each of the IDS initiators. OF SEQ. Nos: 20 and 23 have an EcoRI recognition site on the 5' end side of these.
[372] Escherichia coli B genomic DNA (GenBank Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 20 and ID. OF SEQ. No.: 21 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called "ldhA-L fragment") was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 22 and ID. OF SEQ. No.: 23 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called "ldhA-R fragment") was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. PCR was performed using the ldhA-L and ldhA-R fragments as templates and using a pair of ID primers. OF SEQ. No.: 20 and ID. OF SEQ. No.: 23 and, as a result, a DNA fragment of about 2.0 kbp (hereafter sometimes called "ldhA-LR fragment") was amplified. This ldhA-LR fragment was separated by agarose electrophoresis, recovered, digested with EcoRI, and mixed with a fragment obtained by digesting a temperature-sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the ldhA-LR fragment was properly inserted into pTH18cs1. The plasmid obtained was named pTH18cs1-ldhA.
[373] The Escherichia coli B::atoDABΔpgiΔgntRΔgnd variant prepared in Example 4 was transformed with the plasmid pTH18cs1-ldhA thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 μg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[374] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates a deletion of the ldhA gene, could be amplified, was selected. The variant obtained was named Escherichia coli B, variant with enhanced atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted (hereinafter sometimes abbreviated to "variant B::atoDABΔpgiΔgntRΔgndΔldhA" ). Example 6 Preparation of Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted
[375] In order to clone a region flanking the base sequence of the gene encoding isocitrate lyase and the gene encoding malate synthase (hereafter sometimes abbreviated as "aceBA") (2936 bp), four types of primers oligonucleotides represented by GGAATTCATTCAGCTGTTGCGCATCGATTC (SEQ ID. NO: 24), CGGTTGTTGTTGCCGTGCAGCTCCTCGTCATGGATC (SEQ ID. NO: 25), GGAGCTGCACGGCAACAACAACCGTTGCTCTGACTG (SEQ ID. °: 27) were synthesized. Each of the IDS initiators. OF SEQ. Nos: 24 and 27 have an EcoRI recognition site on the 5' end side of these.
[376] Escherichia coli B genomic DNA (GenBank Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 24 and ID. OF SEQ. No.: 25 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “aceBA-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 26 and ID. OF SEQ. No.: 27 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “aceBA-R fragment”) was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. PCR was performed using the aceBA-L and aceBA-R fragments as templates and using a pair of ID primers. OF SEQ. No.: 24 and ID. OF SEQ. No.: 27 and, as a result, a DNA fragment of about 2.0 kbp (hereafter sometimes called “aceBA-LR fragment”) was amplified. This aceBA-LR fragment was separated by agarose electrophoresis, recovered, digested with EcoRI, and mixed with a fragment obtained by digestion of a temperature-sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the aceBA-LR fragment was properly inserted into pTH18cs1. The plasmid obtained was called pTH18cs1-aceBA.
[377] The Escherichia coli B::atoDABΔpgiΔgntRΔgndΔldhA variant prepared in Example 5 was transformed with the plasmid pTH18cs1-aceBA thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 μg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[378] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the aceBA gene, could be amplified, was selected. The obtained variant was named Escherichia coli B, variant with enhanced atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted (hereinafter sometimes abbreviated to “variant B::atoDABΔpgiΔgntRΔgndΔldhAΔaceBA”). Example 7 Preparation of Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted, glcB gene deleted
[379] In order to clone a region flanking the base sequence of the gene encoding malate synthase G (hereinafter sometimes abbreviated to "glcB") (723 bp), four types of oligonucleotide primers represented by GGAATTCCAGGAGAAAGGGCTGGCACGGG (ID DE SEQ ID NO: 28), CTTTTTTGACGCTATGTTTATCTCCTCGTTTTCGC (SEQ ID NO: 29), GAGATAAACATAGCGTCAAAAAAGCCCCGGC (SEQ ID NO: 30) and GGAATTCCGTCCATCATCATTGCTACCAGCC (SEQ ID NO: 31) were synthesized. . Each of the IDS initiators. OF SEQ. Nos: 28 and 31 have an EcoRI recognition site on the 5' end side of these.
[380] Genomic DNA from Escherichia coli B (GenBank Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 28 and ID. OF SEQ. No.: 29 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “glcB-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 30 and ID. OF SEQ. No.: 31 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called "glcB-R fragment") was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. PCR was performed using the glcB-L and glcB-R fragments as templates and using a pair of ID primers. OF SEQ. No.: 28 and ID. OF SEQ. No.: 31 and, as a result, a DNA fragment of about 2.0 kbp (hereafter sometimes called “glcB-LR fragment”) was amplified. This glcB-LR fragment was separated by agarose electrophoresis, recovered, digested with EcoRI, and mixed with a fragment obtained by digestion of a temperature-sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the glcB-LR fragment was properly inserted into pTH18cs1. The plasmid obtained was called pTH18cs1-glcB.
[381] The Escherichia coli B::atoDABΔpgiΔgntRΔgndΔldhAΔaceBA variant prepared in Example 6 was transformed with the plasmid pTH18cs1-glcB thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 μg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[382] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the glcB gene, could be amplified, was selected. The variant obtained was named Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted, glcB gene deleted (hereinafter some sometimes abbreviated to “variant B::atoDABΔpgiΔgntRΔgndΔldhAΔaceBAΔglcB”). Example 8 Preparation of Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted, glcB gene deleted, fumAC gene deleted
[383] In order to clone a region flanking the base sequence of the gene encoding fumarate hydratase A and the gene encoding fumarate hydratase C (hereinafter sometimes abbreviated to "fumAC") (3193 bp), four types of oligonucleotide primers represented by CGCCATATGATCGCCAGCGCGCGGGATTTTTC (SEQ ID NO: 32), CGAGCTCTGTTCTCTCACTTACTGCCTGG (SEQ ID NO: 33), ATGAGCTCTCTGCAACATACAGGTGCAG (SEQ ID. NO.: 34) and DECTCGGA SEQ. No.: 35) were synthesized. The initiator of the ID. OF SEQ. No.: 32 has an NdeI recognition site on the 5' end side of it. Each of the IDS initiators. OF SEQ. Nos: 33 and 34 have a SacI recognition site on the 5' end side of these. The initiator of the ID. OF SEQ. No.:35 has a BamHI recognition site on the 5' end side of it.
[384] Escherichia coli B genomic DNA (GenBank Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 32 and ID. OF SEQ. No.: 33 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “smoke-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 34 and ID. OF SEQ. No.: 35 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “fumC-R fragment”) was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. The fumA-L fragment was digested with NdeI and SacI, and the fumC-R fragment was digested with SacI and BamHI. These digested fragments were mixed with a fragment obtained by digestion of a temperature sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with NdeI and BamHI. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the fumA-L fragment and the fumC-R fragment were properly inserted into pTH18cs1. The plasmid obtained was called pTH18cs1-fumAC.
[385] The Escherichia coli B::atoDABΔpgiΔgntRΔgndΔldhAΔaceBAΔglcB variant prepared in Example 7 was transformed with the plasmid pTH18cs1-fumAC thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 μg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[386] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates a deletion of the fumAC gene, could be amplified, was selected. The variant obtained was named Escherichia coli B, variant with improved atoD genome, pgi gene deleted, gntR gene deleted, gnd gene deleted, ldhA gene deleted, aceBA gene deleted, glcB gene deleted, fumAC gene deleted (hereinafter sometimes abbreviated to “variant B::atoDABΔpgiΔgntRΔgndΔldhAΔaceBAΔglcBΔfumAC”). Example 9 Plasmid preparation pIaz
[387] Clostridium bacterial acetoacetate decarboxylase is described in GenBank Accession Number M55392, and Clostridium bacterial isopropyl alcohol dehydrogenase is described in GenBank Accession Number AF157307.
[388] As the base sequence of a promoter necessary to express the aforementioned group of genes, the promoter sequence of glyceraldehyde-3-phosphate dehydrogenase (hereafter sometimes called "GAPDH") from Escherichia coli, which is described in 397 to 440 in the base sequence information with an Accession Number in GenBank X02662, can be used.
[389] In order to obtain the GAPDH promoter, amplification by a PCR method was performed using the genomic DNA of Escherichia coli MG1655 as a template and using CGAGCTACATATGCAATGATTGACACGATTCCG (SEQ ID. NO: 36) and CGCGCGCATGCTATTTGTTAGTGAATAAAAGG (ID. .DE SEQ. NO.: 37), and the obtained DNA fragment was digested with restriction enzymes NdeI and SphI and, consequently, a DNA fragment of about 110 bp corresponding to the GAPDH promoter was obtained. The DNA fragment obtained was mixed with a fragment obtained by digestion of plasmid pBR322 (GenBank Accession Number J01749) with restriction enzymes NdeI and SphI, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells (Toyobo Co., Ltd., DNA-903) were transformed with the ligation product, and transformants growing on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and the plasmid pBRgapP was recovered from the bacterial cells obtained.
[390] In order to obtain the isopropyl alcohol dehydrogenase gene, amplification by a PCR method was performed using Clostridium beijerinckii NRRL B-593 genomic DNA as a template and using AATATGCATGCTGGTGGAACATATGAAAGGTTTTGCAATGCTAGG (SEQ ID NO: 38 ) and ACGCGTCGACTTATAATATAACTACTGCTTTAATTAAGTC (SEQ ID. NO.: 39), and the obtained DNA fragment was digested with restriction enzymes SphI and SalI and, consequently, an isopropyl alcohol dehydrogenase fragment of about 1.1 kbp was obtained . The DNA fragment obtained was mixed with a fragment obtained by digestion of plasmid pUC119 with restriction enzymes SphI and SalI, and these fragments were ligated together using ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and plasmids were recovered from the bacterial cells obtained. The correct insertion of the IPAdh was confirmed, and the plasmid obtained was named pUC-I.
[391] The fragment having IPAdh obtained by digestion of plasmid pUC-I with restriction enzymes SphI and EcoRI was mixed with a fragment obtained by digestion of plasmid pBRgapP with restriction enzymes SphI and EcoRI, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and plasmids were recovered from the obtained bacterial cells, and it was confirmed that IPAdh was inserted properly. The plasmid obtained was called pGAP-I.
[392] In order to obtain the acetoacetate decarboxylase gene, amplification by a PCR method was performed using Clostridium acetobutilicum ATCC 824 genomic DNA as a template and using ACGCGTCGACGCTGGTGGAACATATGTTAAAGGATGAAGTAATTAAACAAATTAGC (SEQ ID. (SEQ ID. NO: 41), and the obtained DNA fragment was digested with restriction enzymes SalI and XbaI and, in consequence, an acetoacetate decarboxylase fragment of about 700 bp was obtained. The obtained DNA fragment was mixed with a fragment obtained by digestion of plasmid pGAP-I prepared above with restriction enzymes SalI and XbaI, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and plasmids were recovered from the obtained bacterial cells, and it is confirmed that adc was inserted correctly. The plasmid obtained was called pIa.
[393] In order to obtain the glucose-6-phosphate-1-dehydrogenase (zwf) gene, amplification by a PCR method was performed using the genomic DNA of Escherichia coli B (GenBank Accession No. CP000819) as a template and using GCTCTAGACGGAGAAAGTCTTATGGCGGTAACGCAAACAGCCCAGG (SEQ ID. NO: 42) and CGGGATCCCGGAGAAAGTCTTATGAAGCAAACAGTTTATATCGCC (SEQ ID. NO: 43), and the obtained DNA fragment was digested with restriction enzymes XbaI, XbaI and consequently BamHI and consequently BamHI restriction enzymes. a fragment of glucose-6-phosphate-1-dehydrogenase of about 1500 bp was obtained. The obtained DNA fragment was mixed with a fragment obtained by digestion of plasmid pIa prepared above with restriction enzymes BamHI and XbaI, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and this plasmid was named pIaz. Example 10 Preparation of plasmid pMWGKC
[394] Amplification by a PCR method was performed using pBRgapP as a template and using CCGCTCGAGCATATGCTGTCGCAATGATTGACACG (SEQ ID. NO: 44) and GCTATTCCATATGCAGGGTTATTGTCTCATGAGC (SEQ ID. NO: 45), and the DNA fragment obtained was phosphorylated using T4 polynucleotide kinase (Takara) and, consequently, a DNA fragment harboring the GAPDH promoter was obtained. In addition, plasmid pMW119 (GenBank Accession Number AB005476) was treated with restriction enzyme NdeI, and the obtained DNA fragment was subjected to blunt-end treatment with KOD plus DNA polymerase (Takara) and, consequently, a fragment of DNA harboring the replication origin of pMW119 was obtained. The DNA fragment harboring the GAPDH promoter and the DNA fragment harboring the pMW119 origin of replication were scrambled, and the scrambled fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 50 µg/ml ampicillin were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 50 μg/ml ampicillin, and plasmid pMWG was recovered from the bacterial cells obtained.
[395] In order to obtain a chloramphenicol resistance gene, amplification by a PCR method was performed using pTH18cs1 (GenBank Accession No. AB019610) as a template and using TCGGCACGTAAGAGGTTCC (SEQ ID. NO.: 46) ) and CGGGTCGAATTTGCTTTCG (SEQ ID. NO.: 47), and the obtained DNA fragment was phosphorylated using T4 polynucleotide kinase (Takara) and, consequently, a DNA fragment containing a chloramphenicol resistance gene was obtained. Furthermore, amplification by a PCR method was performed using pMWG as a template and using CTAGATCTGACAGTAAGACGGGTAAGCC (SEQ ID. NO: 48) and CTAGATCTCAGGGTTATTGTCTCATGAGC (SEQ ID. NO: 49). The obtained DNA fragment was mixed with the DNA fragment containing the chloramphenicol resistance gene, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 25 µg/ml of chloramphenicol were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 25 μg/ml of chloramphenicol, and the plasmid obtained was called pMWGC.
[396] Amplification by a PCR method was performed using the gene from pMWGC as a template and using CCTTTGGTTAAAGGCTTTAAGATCTTCCAGTGGACAAACTATGCC (SEQ ID. NO: 50) and GGCATAGTTTGTCCACTGGAAGATCTTAAAGCCTTTAACCAAAGG (SEQ ID. NO.: 50) and GGCATAGTTTGTCCACTGGAAGATCTTAAAGCCTTTAACCAAAGG (SEQ.ID. NO.: 50). Next, competent Escherichia coli DH5α cells were transformed with the obtained DNA fragment, and transformants that grew on an LB agar plate containing 25 μg/ml of chloramphenicol were obtained. The colonies obtained were cultured at 37°C overnight in a liquid LB medium containing 25 μg/ml of chloramphenicol, and plasmid pMWGKC was recovered from the bacterial cells obtained. Example 11 Construction of expression plasmid for thiokinase malate derived from Methylobacterium extorquens IAM12632
[397] Methylobacterium extorquens IAM 12632 was acquired from "IAM Culture Collection", "Institute of Molecular and Cellular Biosciences", "University of Tokyo". IAM 12632 was cultured in a medium (medium number: 352, NBRC), and chromosomal DNA was obtained from it using “DNeasy Blood & Tissue Kit” (QIAGEN).
[398] PCR was performed using the chromosomal DNA of Methylobacterium extorquens IAM 12632 as a template and using AAAAGGCGGAATTCACAAAAAGGATAAAACAATGGACGTTCACGAGTACCAAGCC (SEQ ID. NO.: 52) and CATGCCTGCAGGTCGACTCTAGAGGCGAGGTT as primers, SEQ. , a fragment of thiokinase malate was obtained. In addition, PCR was performed using chromosomal DNA from Methylobacterium extorquens as a template and using GGATCCTCTAGACTGGTGGAATATATGAGCTTCACCCTGATCCAGCAG (SEQ ID. NO.: 54) and GGCATGCAAGCTTTTATTACTTTCCGCCCATCGCGTC (SEQ. ID. NO.: 55) as a consequence, as a consequence, in consequence, malyl-CoA lyase fragment was obtained. The malate thiokinase fragment and the malyl-CoA lyase fragment from Methylobacterium extorquens were ligated to pMWGKC, and the plasmid obtained was named pMWGKC_mtk(Mex)_mcl.
[399] pMWGKC_mtk(Mex)_mcl harbors the base sequence of the mcl gene (SEQ ID. NO: 66), the base sequence of the mtkA gene (SEQ ID. NO: 67), and the base sequence of the mtkB gene (SEQ ID. NO: 68) derived from Methylobacterium extorquens. The amino acid sequences of mcl, mtkA and mtkB derived from Methylobacterium extorquens are shown in the ID. OF SEQ. No.: 69, ID. OF SEQ. No.: 70 and ID. OF SEQ. No.: 71, respectively. Example 12 Construction of expression plasmid for thiokinase malate derived from Hyphomicrobium methylovorum NBRC 14180
[400] Hyphomicrobium methylovorum NBRC 14180 was purchased from NBRC (“Biological Resource Center”, “Biotechnology Field”, “National Institute of Technology and Evaluation”). NBRC 14180 was cultured in a medium (medium number: 233, NBRC), and chromosomal DNA was obtained from it using “DNeasy Blood & Tissue Kit” (QIAGEN).
[401] A primer (SEQ ID. NO:56) was prepared based on the DNA sequence of the serine-glyoxylate aminotransferase N-terminal region of NBRC 14180 (GenBank Accession No. D13739).
[402] Based on the amino acid sequence of phosphoenolpyruvate carboxylase from Hyphomicrobium denitrificans (http://www.ncbi.nlm.nih.gov/nuccore/300021538 from=3218417 &to=3221272&report=gbwithparts), the sequence homology was compared using a homology search tool by NCBI (“National Center for Biotechnology Information”) (http://blast.ncbi.nlm.nih.gov/Blast.cgi PROGRAM=blastp&BLA ST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&L INK_LOC=blasthome ).
[403] A primer (SEQ ID. NO: 57) was prepared based on an amino acid sequence that has high homology.
[404] PCR was performed using ID primers. OF SEQ. No.: 56 and ID. OF SEQ. No.: 57 obtained as described above and the chromosomal DNA obtained above as a template. The obtained fragment was ligated to a DNA prepared by digestion of pUC19 with SmaI, by which part of the phosphoenolpyruvate carboxylase gene was cloned by the serine-glyoxylate aminotransferase gene derived from Hyphomicrobium methylovorum NBRC 14180. After confirmation of the clone sequence, primers (IDS) .DE SEQ Nos: 58 and 59) were prepared.
[405] PCR was performed using the chromosomal DNA of Hyphomicrobium methylovorum NBRC 14180 as a template and IDS primers. OF SEQ. Nos: 58 and 59 obtained as described above, and the obtained DNA was digested with EcoRI and XbaI and, in consequence, a DNA fragment containing the Hyphomicrobium mcl and mtk genes was obtained. In addition, the plasmid pMWGKC_mtk(Mex)_mcl described above was digested, and a fragment of about 4.3 kb containing mcl was recovered. This obtained fragment was ligated to the DNA fragment containing the Hyphomicrobium mcl and mtk genes. The plasmid obtained was named pMWGKC_mcl(Hme)_mtk(Hme)_mcl.
[406] pMWGKC_mcl(Hme)_mtk(Hme)_mcl contains the base sequence of the mcl gene (SEQ ID. NO: 60), the base sequence of the mtkA gene (SEQ ID. NO.: 61) and the base sequence of the mtkB gene (SEQ ID. NO: 62) derived from Hyphomicrobium methylovorum. The amino acid sequences of mcl, mtkA and mtkB derived from Hyphomicrobium methylovorum are as shown in ID. OF SEQ. No.: 72, ID. OF SEQ. No.: 7.3 and ID. OF SEQ. No.: 74, respectively. Example 13 Construction of expression plasmid for thiokinase malate derived from Rhizobium sp. NGR234
[407] Based on amino acid sequence information from the malate thiokinase beta subunit (GenBank Accession No. ACP26381) and the succinyl-CoA synthetase alpha subunit (GenBank Accession No. ACP26382) of Rhizobium sp. NGR234, the full length thiokinase malate gene was synthesized (SEQ ID. NO:63). The gene obtained was digested with NdeI and XbaI, and ligated to pMWGKC digested with NdeI and XbaI. The plasmid obtained was named pMWGKC_mtk(Rhi). Furthermore, PCR was performed using chromosomal DNA from Methylobacterium extorquens as a template and IDS primers. OF SEQ. Nos: 64 and 65, and the DNA obtained was digested with XbaI and HindIII. The obtained fragment was subjected to blunt-end treatment, and ligated to a gene obtained by digestion of MWGKC_mtk(Rhi) with XbaI and submission of the resulting fragment to blunt-end treatment and phosphorylation treatment. A resulting plasmid into which the mtk gene and the mcl gene were introduced in the same direction was named pMWGKC_mtk(Rhi)_mcl. The amino acid sequences of mtkA and mtkB derived from Rhizobium sp. are as shown in the ID. OF SEQ. No.: 75 and ID. OF SEQ. No.: 76, respectively. Example 14 Preparation of isopropyl alcohol producing variant with introduced thiokinase malate and malyl-CoA lyase
[408] Competent Escherichia coli B variant cells (atoDAB, Δpgi_gntR_gnd_ldhA_aceBA_glcB_fumAC) prepared in Example 8 were transformed with the plasmid pIaz prepared in Example 9 and each of the plasmids expressing mtk and mcl. Transformants that grew on an LB agar plate containing 25 mg/l chloramphenicol and 100 mg/l ampicillin were named as follows (see Table 2).
[409] The variant numbers in Table 2 represent the variants made by introducing pIaz and each of the plasmids described in Table 2 in the Escherichia coli B variant (atoDAB, Δpgi_gntR_gnd_ldhA_aceBA_glcB_fumAC). Table 2
Example 15 Confirmation of the incorporation of 13C-labeled CO2 in isopropyl alcohol
[412] One hundred ml of liquid LB medium was added to a 500 ml Erlenmeyer flask equipped with a baffle, and it was sterilized by autoclaving at 121°C for 20 minutes. To the sterilized medium, ampicillin was added to have a final concentration of 50 µg/ml, and chloramphenicol was added to have a final concentration of 34 µg/ml. Subsequently, a platinum loop of each of the variants shown in Table 2 which has a carbon dioxide fixation pathway introduced into it was inoculated into the medium, and cultured at 30°C and 130 rpm for about 20 hours. Only the bacterial cells were separated from the culture liquid by centrifugation (5,000 G for 15 minutes), and then the separated bacterial cells were resuspended in 10 ml of saline, thus obtaining the respective bacterial suspensions.
[413] In a 100 ml Erlenmeyer flask, 30 ml of M9 minimal medium containing 100 mM 13C-labelled sodium hydrogen carbonate, 50 g/l glucose, 34 μg/ml chloramphenicol and 50 μg/ml ampicillin were prepared. Three ml of the bacterial suspension obtained above were inoculated in this medium, and cultured at 30°C, 100 rpm for 24 hours, while the flask was hermetically sealed with a silicone plug. The culture liquid obtained was filtered under reduced pressure using a hydrophilic PTFE membrane filter (H050A047A, pore size: 0.5 μm; diameter: 47 mm; manufactured by ADVANTEC) placed in a filter holder for filtration under reduced pressure (KGS-47; manufactured by ADVANTEC) thereby separating the bacterial cells from the culture supernatant.
[414] The membrane filter to which the bacterial cells were adhered was immediately immersed in 1.6 ml of methanol (LC/MS grade) cooled to -20°C and shaken, and the membrane was allowed to stand at -20 °C for 1 hour. Next, 1.6 ml of chloroform (HPLC grade) cooled to -20°C and 0.64 ml of pure water cooled to 4°C were added thereto, followed by vortex mixing for 30 seconds. Subsequently, the supernatant was collected by centrifugal separation at 4°C, thus obtaining a methanol extract of the bacterial cells. The extract obtained was analyzed by LC-MS/MS and the molecular weight distribution of acetyl-CoA in bacterial cells was determined. The results are shown in Table 3. The molecular weight distribution of acetyl-CoA was calculated by defining the proportions of mass spectrometry peaks at molecular weights of 808, 809 and 810 as M+0, M+1 and M+2 , respectively.
[415] Separately, from the culture supernatant obtained above, alcohols and acetone were recovered in high concentrations by distillation, and used as raw materials for measuring the molecular weight distribution. Molecular weight distributions of isopropyl alcohol and ethanol in the culture supernatant were analyzed by GC-MS. The results are shown in Tables 4 and 5. The molecular weight distribution of isopropyl alcohol (IPA) (Table 4) was calculated by defining the proportions of mass spectrometry peaks at molecular weights of 117, 118 and 119 as M+0 , M+1, and M+2, respectively. The molecular weight distribution of ethanol (EtOH) (Table 5) was calculated by defining the proportions of mass spectrometry peaks at molecular weights of 103, 104 and 105 as M+0, M+1 and M+2, respectively. Table 3
Table 4
Table 5

[416] As shown in Table 3, the MT-1 variant to MT-2 variant had a high proportion of acetyl-CoA in which 13C was not incorporated (M+0) and a high proportion of acetyl-CoA in which a 13C atom was incorporated (M+1), when compared to the control strain. In particular, the proportion of M+1 was high in the MT-2 variant. From this result, it was found that 13C-labeled carbonate derived carbon was incorporated into acetyl-CoA in the MT-1 variant and in the MT-2 variant. and that the effect was especially pronounced for the MT-2 variant.
[417] In addition, the MT-2 variant had a low proportion of isopropyl alcohol or ethanol in which 13C was not incorporated (M+0) and a high proportion of isopropyl alcohol or ethanol in which one atom of 13C was incorporated (M +1), compared to commercially available isopropyl alcohol or ethanol (Table 4 and Table 5). From this result, it was verified that carbon derived from the carbonate labeled with 13C was also incorporated in isopropyl alcohol or ethanol in the MT-2 variant. Example 16 Measurement of glyoxylate production activity using malate as substrate
[418] The mtk and mcl expressing variants described above were cultured in 2 ml of LB medium containing 25 µg/ml chloramphenicol and 100 µg/ml ampicillin. A crude enzyme solution was extracted according to the following method. That is, bacterial cells in logarithmic growth phase were collected by centrifugation, and washed with 200 mM MOPS-K buffer (pH 7.7) and then dissolved in buffer MOPS-K, followed by sonification. The supernatant obtained by centrifugal separation (12,000 rpm for 2 minutes) was used as the crude enzyme solution.
[419] The protein concentration in the crude enzyme solution was determined based on a calibration curve generated with OD values at 595 nm measured with a UV plate reader (Molecular Devices, SpectraMax 190) using the crude enzyme solution and known concentrations of BSA for preparation of the calibration curve, each of which has been reacted with Quick Start Bradford Dye Reagent (manufactured by Bio-Rad Laboratories, Inc.) and subjected to color development.
[420] The enzyme activity in the solution was determined according to the following procedure. That is, MOPS-K buffer (pH 7.7), 3.5 mM phenylhydrazine, 10 mM MgCl2, 3 mM ATP, 0.3 mM CoA and 10% by mass crude enzyme solution were mixed in a microwell and the mixture was incubated at room temperature for 30 minutes. As baseline values, changes in OD values at 324 nm with time were measured using a UV plate reader. To the mixture, (S)-L-sodium malate solution (pH 7.5) was added to have a final concentration of 5 mM, and the changes in OD values at 324 nm with time were measured. In order to generate a calibration curve for glyoxylate, glyoxylate was added to the above buffer and the mixture was allowed to stand for 5 minutes at room temperature and then the OD values at 324 nm were measured. In relation to the enzyme activity value, the slope of the basal values was subtracted from the slope of the OD values at 324 nm after the addition of (S)-L-sodium malate and the value obtained was converted into a glyoxylate consumption rate based on the calibration curve for glyoxylate. Enzyme activity per protein was determined by dividing the rate of glyoxylate consumption by the protein concentration (Table 6).
[421] As shown in Table 6, all MT-1, MT-2, and MT-3 variants have been confirmed to have enzymatic activity. The MT-2 variant and the MT-3 variant were found to have a higher enzyme activity compared to the MT-1 variant. In contrast, no enzyme activity was demonstrated in the control. Table 6
Example 17 Number of viable cells and plasmid retention rate in the malate thiokinase and malyl-CoA lyase variant introduced
[422] In a 100 ml Erlenmeyer flask, 30 ml of M9 minimal medium or LB medium, each containing 50 g/l glucose, 30 µg/ml chloramphenicol, and 100 µg/ml ampicillin, were prepared. Each of the above mtk and mcl expressing variants was inoculated into M9 minimal medium or LB medium and cultured at 30°C, 100 rpm for 24 hours, while the vial was hermetically sealed with a silicone plug. The culture liquid was diluted with water, and 100 µl of the diluted culture liquid was applied to an LB plate without antibiotic. The total number of viable cells was counted. In addition, the diluted culture liquid was applied to an LB plate containing 30 μg/ml of chloramphenicol, and the number of bacterial cells that retain the plasmid harboring mtk (smt) and mcl was counted.
[423] As shown in Table 7, it was found that each of the MT-2 variant and the MT-3 variant had a higher number of viable cells in the culture fluid and grew better compared to the MT-1 variant. Plasmids harboring mtk and mcl were stably maintained in all MT-1, MT-2 and MT-3 variants.Table 7
Example 18 Construction of expression plasmid for thiokinase malate derived from Granulibacter bethesdensis BAA-1260
[424] Granulibacter bethesdensis BAA-1260D-5 genomic DNA was purchased from ATCC.
[425] PCR was performed using the Granulibacter bethesdensis genomic DNA as a template and using CCCTGAGGAGGGTCCAAGAGATGGACGTCCATGAGTACCA (SEQ ID. NO.: 77) and GCTCTAGATCAGGCTGCCTGACGCCCA (SEQ. ID. NO.: 78) as primers and, therefore, a fragment of mtk from Granulibacter was obtained. In addition, PCR was performed using pMWGKC_mcl(Hme)_mtk(Hme)_mcl prepared in Example 12 as a template and using GGAATTCACAAAAAGGATAAAA (SEQ ID. NO.: 79) and TGGTACTCATGGACGTCCATCTCTTGGACCCTCCTCAGGG (SEQ. ID. NO.: 80) as primers and therefore a Hyphomicrobium mcl fragment was obtained. PCR was performed using the obtained Granulibacter mtk fragment and Hyphomicrobium mcl fragment as ID templates and primers. OF SEQ. No.: 79 and ID. OF SEQ. No.: 78 thus obtaining a DNA fragment containing mcl from Hyphomicrobium and the gene of the mtk fragment from Granulibacter. The DNA fragment obtained was digested with restriction enzymes EcoRI and XbaI, and ligated to plasmid pMWGKC prepared in Example 10. The plasmid obtained was named pMWGKC_mcl(Hme)_mtk(Gb).
[426] pMWGKC_mcl(Hme)_mtk(Gb) harbors the mtkA gene (SEQ ID. NO: 81) and the mtkB gene (SEQ ID. NO: 82) derived from Granulibacter bethesdensis. The amino acid sequences of mtkA and mtkB derived from Granulibacter bethesdensis are shown in ID. OF SEQ. No.: 107 and ID. OF SEQ. No.: 108, respectively. Example 19 Expression plasmid construction for thiokinase malate derived from Hyphomicrobium denitrificans DSM 1869
[427] Hyphomicrobium denitrificans DSM 1869 was purchased from DSMZ (“Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH”, Germany). DSM1869 was cultured in a medium (media number: 803, DSMZ), and chromosomal DNA was obtained from it using “DNeasy Blood & Tissue Kit” (QIAGEN).
[428] PCR was performed using the chromosomal DNA of Hyphomicrobium denitrificans as a template and using ACCAGGGAATTCACAAAAAGGATAAAACAATGAGCTATACCCTCTACCCAACCGTAAGC (SEQ ID. NO.: 83) and GCCCACTCTAGATCAGGCAACTTTTTTCTGCTTGCCGAGAACC. a Hyphomicrobium mcl-mtk fragment was obtained. The obtained fragment was ligated to plasmid pMWGKC_mcl(Hme)_mtk(Hme)_mcl prepared in Example 12. The obtained plasmid was named pMWGKC_mcl(Hde)_mtk(Hde)_mcl.
[429] pMWGKC_mcl(Hde)_mtk(Hde)_mcl harbors the base sequence of the mcl gene (SEQ ID. NO: 85), the base sequence of the mtkA gene (SEQ ID. NO.: 86) and the base sequence of the mtkB gene (SEQ ID. NO: 87) derived from Hyphomicrobium denitrificans. The amino acid sequences of mcl, mtkA and mtkB derived from Hyphomicrobium denitrificans are shown in the ID. OF SEQ. No.: 109, ID OF SEQ. No.: 110 and ID. OF SEQ. No.: 111, respectively. Example 20 Construction of expression plasmid for thiokinase malate derived from Nitrosomonas europaea NBRC 14298
[430] Nitrosomonas europaea NBRC 14298 was purchased from NBRC (“Biological Resource Center”, NITE). NBRC 14298 was cultured in a medium (media number: 829, NBRC), and chromosomal DNA was obtained from it using “DNeasy Blood & Tissue Kit” (QIAGEN).
[431] PCR was performed using chromosomal DNA from Nitrosomonas europaea as a template and using GCGGGGGAATTCACAAAAAGGATAAAACAATGAGTCATACCCTGTATGAACCAAAACAC (SEQ ID. NO.: 88) and CAGGCGTCTAGATTAGAGTCCGGCCAGAACTTTTGCGACG. an mtk fragment of Nitrosomonas europaea was obtained. The obtained fragment was ligated to plasmid pMWGKC_mcl(Hme)_mtk(Hme)_mcl prepared in Example 12. The obtained plasmid was named pMWGKC_mcl(Ne)_mtk(Ne)_mcl.
[432] pMWGKC_mcl(Ne)_mtk(Ne)_mcl harbors the base sequence of the mcl gene (SEQ ID. NO: 90), the base sequence of the mtkA gene (SEQ ID. NO.: 91) and the base sequence of the mtkB gene (SEQ ID. NO: 92) derived from Nitrosomonas europaea. The amino acid sequences of mcl, mtkA and mtkB derived from Nitrosomonas europaea are shown in the ID. OF SEQ. No.: 112, ID. OF SEQ. No.: 113 and ID. OF SEQ. No.: 114, respectively. Example 21 Construction of expression plasmids for thiokinase malate derived from Methylococcus capsulatus ATCC 33009
[433] Genomic DNA of Methylococcus capsulatus ATCC 33009D-5 was purchased from ATCC.
[434] PCR was performed using the chromosomal DNA of Methylococcus capsulatus as a template and using GGAATTCCATATGGCTGTTAAAAATCGTCTAC (SEQ ID. NO: 93) and GCTCTAGATCAGAATCTGATTCCGTGTTC (SEQ. ID. NO: 94) as primers and therefore a mcl-mtk fragment of Methylococcus was obtained. The obtained fragment was ligated to plasmid pMWGKC prepared in Example 10, or to plasmid pMWGC prepared in Example 10. The plasmid obtained was named pMWGKC_mcl(Mc)_mtk(Mc) or pMWGC_mcl(Mc)_mtk(Mc).
[435] Each of pMWGKC_mcl(Mc)_mtk(Mc) and pMWGC_mcl(Mc)_mtk(Mc) harbors the mcl gene base sequence (SEQ ID. SEQ. NO: 95), the gene base sequence of mtkA (SEQ ID. NO: 96) and the base sequence of the mtkB gene (SEQ ID. NO: 97) derived from Methylococcus capsulatus. The amino acid sequences of mcl, mtkA and mtkB derived from Methylococcus capsulatus are shown in ID. OF SEQ. No.: 115, ID. OF SEQ. No.: 116 and ID. OF SEQ. No.: 117, respectively. Example 22 Construction of expression plasmid for thiokinase malate derived from uncultured gamma proteobacteria (GenBank: AP011641.1)
[436] In order to obtain mtk derived from an uncultured gamma proteobacteria, an mtk derived from gamma proteobacteria was designed based on the GenBank amino acid sequence: AP011641.1, and the following DNA fragment (SEQ ID. SEQ. °: 98) was prepared by DNA synthesis.
[437] PCR was performed using the DNA fragment prepared as a template and using GTTGAACGAGGAGATCGTCCATGAACATTCACGAATATCA (SEQ ID. NO: 99) and GCTCTAGATTAGCCAGAAACTGCAGATCC (SEQ ID. NO: 100) as primers and, therefore, a mtk fragment of the gamma proteobacteria was obtained. Furthermore, PCR was performed using pMWGKC_mcl(Mc)_mtk(Mc) or pMWGK_mcl(Mc)_mtk(Mc) prepared in Example 21 as a template and using ID primers. OF SEQ. No.: 93 and TGATATTCGTGAATGTTCATGGACGATCTCCTCGTTCAAC (SEQ ID. No.: 101) thereby obtaining a Methylococcus mcl fragment. Furthermore, PCR was performed using the obtained gamma proteobacteria mtk fragment and the obtained Methylococcus mcl fragment as templates and using ID primers. OF SEQ. No.: 93 and ID. OF SEQ. No.: 100 thus obtaining a DNA fragment containing the Methylococcus mcl gene and the mtk fragment gene from the gamma proteobacteria. The DNA fragment obtained was ligated to plasmid pMWGKC prepared in Example 10. The plasmid obtained was named pMWGKC_mcl(Mc)_mtk(gamma).
[438] pMWGKC_mcl(Mc)_mtk(gamma) harbors the mtkA gene (SEQ ID. NO: 102) and the mtkB gene (SEQ ID. NO: 103) derived from the uncultivated gamma proteobacteria. The amino acid sequences of mtkA and mtkB derived from the uncultured gamma proteobacteria are shown in the ID. OF SEQ. No.: 118 and ID. OF SEQ. No.: 119, respectively. Example 23 Variant preparation with introduced thiokinase- malate and malyl-CoA lyase, isopropyl alcohol producer, with enhanced atoD genome, deleted pgi gene, deleted gntR gene, deleted gnd gene, deleted ldhA gene, deleted fumAC gene, aceBA gene deleted, glcB gene deleted
[439] Competent Escherichia coli B variant cells (atoDAB, Δpgi_gntR_gnd_ldhA_aceBA_glcB_fumAC) prepared in Example 8 were transformed with plasmid pIaz and each of the mtk and mcl expressing plasmids prepared in Examples 18 to 22 were grown in an LB medium. containing 25 mg/l chloramphenicol and 100 mg/l ampicillin were named as follows (see Table 8).
[440] The variant numbers described in Table 8 represent the variants made by introducing pIaz and each of the plasmids described in Table 8 in the Escherichia coli B variant (atoDAB, Δpgi_gntR_gnd_ldhA_aceBA_glcB_fumAC). Table 8
Example 24 Measurement of glyoxylate production activity using malate as substrate
[443] As in Example 16, enzyme activity per protein was determined (Table 9).
[444] As shown in Table 9, it was confirmed that each of the MT-4 to MT-8 variants had enzyme activity, and that the enzyme activity was greater, compared to the MT-1 variant. In particular, it was found that the MT-5 variant, the MT-6 variant, the MT-7 variant and the MT-8 variant have equivalent or greater activity compared to the MT-2 variant and the MT-3 variant shown. in Example 16. In contrast, no enzyme activity was detected in the control. Table 9
Example 25 Variant preparation with enhanced atoD genome, aceB gene deleted
[445] In order to clone a region flanking the base sequence of the gene encoding malate synthase (hereinafter sometimes abbreviated to "aceB") (1602 bp), four types of oligonucleotide primers represented by GGAATTCATTCAGCTGTTGCGCATCGATTC (ID. SEQ ID NO: 24), GTTATGTGGTGGTCGTGCAGCTCCTCGTCATGG (SEQ ID NO: 104), GAGCTGCACGACCACCACATAACTATGGAG (SEQ ID NO: 105) and GGAATTCCAGTTGAACGACGGCGAGCAG (SEQ ID NO: 106) were synthesized. Each of these primers has an EcoRI recognition site on the 5' end side of them.
[446] Genomic DNA from Escherichia coli B (Accession No. CP000819) was prepared, and PCR was performed using the obtained genomic DNA as a template and using a pair of ID primers. OF SEQ. No.: 24 and ID. OF SEQ. No.: 106 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “aceB-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 105 and ID. OF SEQ. No.: 106 and, as a result, a DNA fragment of about 1.0 kb (hereafter sometimes called “aceB-R fragment”) was amplified. These DNA fragments were separated by electrophoresis in agarose, and recovered. PCR was performed using the aceB-L and aceB-R fragments as templates and using a pair of ID primers. OF SEQ. No.: 24 and ID. OF SEQ. No.: 108 and, as a result, a DNA fragment of about 2.0 kbp (hereafter sometimes called “aceB-LR fragment”) was amplified. The aceB-LR fragment was separated by agarose electrophoresis, and recovered, digested with EcoRI, and mixed with a fragment obtained by digestion of a temperature-sensitive plasmid pTH18cs1 (GenBank Accession Number AB019610) with EcoRI and dephosphorylation thereof. The scrambled fragments were allowed to react using T4 DNA ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 10 µg/ml chloramphenicol at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the aceB-LR fragment was properly inserted into pTH18cs1. The plasmid obtained was called pTH18cs1-aceB.
[447] The Escherichia coli B::atoDAB variant prepared in Example 1 was transformed with the plasmid pTH18cs1-aceB thus obtained, and was cultured at 30°C overnight on an LB agar plate containing 10 µg/ ml of chloramphenicol and, in consequence, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[448] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the aceB gene, could be amplified, was selected. The variant obtained was termed variant with enhanced atoD genome, aceB gene deleted (hereinafter sometimes abbreviated to “variantB::atoDABΔaceB”). Example 26 Variant preparation with enhanced atoD genome, aceB gene deleted, glcB gene deleted
[449] The Escherichia coli B::atoDAB'aceB variant prepared in Example 25 was transformed with the plasmid pTH18cs1-gclB prepared in Example 7, and was grown at 30°C overnight on an LB agar plate containing 10 μg/ml of chloramphenicol and, consequently, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[450] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates deletion of the glcB gene, could be amplified, was selected. The variant obtained was termed variant with enhanced atoD genome, aceB gene deleted, glcB gene deleted (hereinafter sometimes abbreviated to “B::atoDABΔaceBΔgclB variant”). Example 27 Variant preparation with enhanced atoD genome, ldhA gene deleted
[451] The Escherichia coli B::atoDAB variant prepared in Example 1 was transformed with plasmid pTH18cs1-ldhA prepared in Example 5 and cultured at 30°C overnight on an LB agar plate containing 10 µg /ml of chloramphenicol and, therefore, transformants were obtained. The transformants obtained were inoculated into a liquid LB medium containing 10 μg/ml of chloramphenicol, and cultured at 30°C overnight. Subsequently, part of the culture liquid was applied to an LB agar plate containing 10 μg/ml of chloramphenicol and, as a result, colonies that grew at 42°C were obtained. The colonies obtained were cultivated at 30°C for 24 hours in a liquid LB medium, and were applied to an LB agar plate and, consequently, colonies that grew at 42°C were obtained.
[452] Of the colonies that emerged, 100 colonies were randomly picked, and each grown individually on an LB agar plate and an LB agar plate containing 10 μg/ml chloramphenicol, and chloramphenicol sensitive clones were selected. Furthermore, the chromosomal DNAs of these target clones were amplified by PCR, and a variant from which a fragment of about 2.0 kbp, which indicates a deletion of the ldhA gene, could be amplified, was selected. The variant obtained was termed variant with enhanced atoD genome, deleted ldhA gene (hereinafter sometimes abbreviated to “B::atoDABΔldhA variant”). Example 28 Preparation of pBRgapP variant, pMWGC_mcl(Mc)_mtk(Mc)/B and pBRgapP variant, pMWGC/B
[453] Competent Escherichia coli B cells were transformed with plasmid pBRgapP prepared in Example 2, and plasmid pMWGC_mcl(Mc)_mtk(Mc) prepared in Example 21 or plasmid pMWGC prepared in Example 21, and applied to a plate. LB agar containing 25 mg/l chloramphenicol and 100 mg/l ampicillin. As a result, transformants that grew on the medium were obtained. Example 29 Preparation of pIa variant, pMWGC_mcl(Mc)_mtk(Mc)/B::atoDAB and pIa variant, pMWGC/B::atoDAB
[454] Competent Escherichia coli B variant (B::atoDAB) cells prepared in Example 1 were transformed with the plasmid pIa prepared in Example 9, and the plasmid pMWGC_mcl(Mc)_mtk(Mc) prepared in Example 21 or the plasmid pMWGC prepared in Example 21, and applied to an LB agar plate containing 25 mg/l chloramphenicol and 100 mg/l ampicillin. As a result, transformants that grew in the medium were obtained. Example 30 Preparation of pIa variant, pMWGC_mcl(Mc)_mtk(Mc)/B::atoDAB'aceB and pla variant, pMWGC/B::atoDAB'aceB
[455] Competent Escherichia coli B variant cells (B::atoDAB'aceB) prepared in Example 25 were transformed with plasmid pIa prepared in Example 9, and plasmid pMWGC_mcl(Mc)_mtk(Mc) prepared in Example 21 or the plasmid pMWGC prepared in Example 21, and applied on an LB agar medium containing 25 mg/l chloramphenicol and 100 mg/l ampicillin, and transformants that grew on the medium were obtained. Example 31 Preparation of pIa variant, pMWGC_mcl(Mc)_mtk(Mc)/B::atoDABΔaceBΔglcB and pla variant, pMWGC/B::atoDABΔaceBΔglcB
[456] Escherichia coli B variant competent cells (B::atoDAB'aceB'glcB) prepared in Example 26 were transformed with plasmid pIa prepared in Example 9, and plasmid pMWGC_mcl(Mc)_mtk(Mc) prepared in Example 21 or plasmid pMWGC prepared in Example 21, and applied to an LB agar medium containing 25 mg/l chloramphenicol and 100 mg/l ampicillin. As a result, transformants that grew in the medium were obtained. Example 32 Preparation of pIa variant, pMWGC_mcl(Mc)_mtk(Mc)/B::atoDABΔldhA and pla variant, pMWGC/B::atoDABΔldhA
[457] Competent Escherichia coli B variant cells (B::atoDABΔldhA) prepared in Example 27 were transformed with plasmid pIa prepared in Example 9, and plasmid pMWGC_mcl(Mc)_mtk(Mc) prepared in Example 21 or the plasmid pMWGC prepared in Example 21, and applied to an LB agar medium containing 25 mg/l chloramphenicol and 100 mg/l ampicillin. As a result, transformants that grew in the medium were obtained. Example 33 Isopropyl alcohol production
[458] In this example, isopropyl alcohol was produced using a production apparatus shown in Fig. 1 of WO 5 2009/008377. The culture tank used was a tank having a capacity of 3 liters and made of glass. In the capture tanks, water as a capture solution (capture water) in an amount of 9 liters per tank was injected, and the two capture tanks were connected for 10 usage.
[459] A list of variants used in evaluating isopropyl alcohol production is shown in Table 10. Table 10


[462] As a preculture, each of the variants to be evaluated was individually inoculated into an Erlenmeyer flask having a capacity of 500 ml and containing 50 ml of an LB Miller broth (Difco 244620) containing 25 mg/l of chloramphenicol and 100 mg/l of ampicillin, and grown overnight at a culture temperature of 30°C while shaking at 120 rpm. Next, 45 ml of the preculture was transferred to a culture tank (BMS-PI culture device manufactured by ABLE Corporation) which has a capacity of 3 liters and which contains 900 g of the medium having the following composition, and was cultivated. The culture was carried out at an aeration volume of 0.45 l/min, an agitation rate of 490 rpm, a culture temperature of 30°C and a pH of 7.0 (adjusted with aqueous NH3 solution) under pressure atmospheric. To the culture, a 50 w/w% aqueous glucose solution was added at a flow rate of 20 g/l/hour during the period from the start of cultivation to 8 hours after the start of cultivation. Next, an aqueous 50 w/w% glucose solution was added at a flow rate of 20 g/l/hour, as appropriate, in such a way that the amount of glucose left in the culture tank was minimized. The bacterial culture liquid was collected several times during the period from the beginning of the cultivation until 30 hours after the beginning of the cultivation, and then the bacterial cells were removed by centrifugal operation, the amounts of isopropyl alcohol, acetone, and main by-products accumulated in the obtained culture and capture water supernatants were measured by HPLC according to a common method. Each of the measurement values is a sum of the amounts in the culture liquid and the two catch tanks after cultivation. The results are shown in Table 11, and the by-products are shown in Table 12. Composition of the culture medium
[463] Corn steep water (manufactured by Nihon 5 Shokuhin Kako Co., Ltd.), 50 g/l
[464] Fe2SO4.7H2O: 0.1 g/l
[465] K2HPO4: 2 g/l
[466] KH2PO4: 2 g/l
[467] MgSO4.7H2O: 2 g/l 10
[468] (NH4)2SO4: 2 g/l
[469] ADEKANOL LG126 (ADEKA Corporation): 0.1 g/l
[470] (Balance: water) Table 11
Table 12


[472] As a result of the evaluation, the amount of isopropyl alcohol produced by the control strain (vec/atoDAB) was 33.2 g/30 h, and the amount produced by the variant with introduced mtk (mtk_mcl/atoDAB) was 34 .6 g/30 h. The amount of acetone produced was 6.0 g/30 h in the control strain (vec/atoDAB), and 8.8 g/30 h in the variant with introduced mtk (mtk_mcl/atoDAB). From these results, it was verified that the production amounts of isopropyl alcohol and acetone are increased by the introduction of mtk and mcl. The yield of isopropyl alcohol in relation to sugar consumption within 30 hours after the start of cultivation was 15.8% in the control strain (vec/atoDAB), and 16.5% in the variant with introduced mtk + mcl (mtk_mcl/atoDAB) ). The yield of isopropyl alcohol and acetone in relation to sugar consumption within 30 hours after the start of cultivation was 18.6% in the control strain (vec/atoDAB), and 20.7% in the variant with introduced mtk + mcl ( mtk_mcl/atoDAB). From these results, it was demonstrated that the conversion efficiencies of sugar to isopropyl alcohol or acetone were increased by introducing the mtk + mcl pathway.
[473] With respect to atoDABΔldhA, the production amounts of isopropyl alcohol and acetone and the yields of isopropyl alcohol and acetone relative to sugar consumption were increased in the variant with mtk + mcl introduced similarly to the case of atoDAB. Regarding atoDABΔldhA, atoDABΔaceB and atoDABΔaceBΔglcB, the yields in relation to sugar consumption were increased in the variant with introduced mtk + mcl, compared to that of the control strain (vec) of each variant. Therefore, it is believed that the production of acetyl-CoA and the useful substances derived from acetyl-CoA was efficiently increased by mtk + mcl.
[474] Table 12 shows the by-products. Compared with the control strain (vec/B), it was found that the amounts of ethanol, pyruvate and succinate were reduced in the variant with mtk + mcl introduced (mtk_mcl/B) within 30 hours after the start of cultivation, and the total amount of by-products was also unexpectedly reduced in the variant with mtk + mcl introduced. Similarly, in relation to atoDAB, atoDABΔaceB, atoDABΔaceBΔglcB and atoDABΔldhA, the amounts of ethanol, pyruvate and succinate and the total amount of by-products were reduced in the variants with mtk + mcl introduced, compared to the respective control strains. From these results, it was verified that mtk + mcl produced similar effects with or without atoDAB.
[475] In relation to atoDABΔaceB and atoDABΔaceBΔglcB, the IPA yield and the IPA and acetone yield relative to sugar consumption were nearly equal to those in the atoDAB variant. However, the total amount of by-products was reduced in both vec-introduced and mtk-introduced variants. Unexpectedly, the amounts of lactate and succinate accumulated were significantly decreased in the introduced mtk + mcl variants. Therefore, atoDABΔaceB and atoDABΔaceBΔglcB are industrially preferable, as fewer by-products allow for a significant reduction in the purification load when isopropyl alcohol or acetone is collected from a culture liquid.
[476] In relation to atoDABΔldhA, it was shown that alcohol and acetone production amounts and alcohol and acetone yields in relation to sugar consumption were increased in the mtk + mcl variant introduced similarly to the atoDAB case. In relation to all of the above variants, the yields in relation to sugar consumption were increased in the variants with introduced mtk + mcl, when compared to the q control strain (vec). Therefore, it is believed that acetyl-CoA and the useful substances derived from acetyl-CoA were efficiently increased.
[477] Relative to atoDABΔldhA, the total amount of by-products was reduced, and the amount of accumulated pyruvate was significantly reduced in the variant with introduced mtk + mcl. Furthermore, isopropyl alcohol and acetone yields in relation to sugar consumption were increased in the variant with mtk + mcl introduced atoDABΔldhA, indicating that isopropyl alcohol and acetone were efficiently produced by both the glucose pathway and the mtk + mcl pathways. The amount of by-products in atoDABΔldhA was reduced similarly to the cases of atoDABΔaceB and atoDABΔaceBΔglcB. Furthermore, isopropyl alcohol and acetone yields relative to sugar consumption were increased in atoDABΔldhA when mtk + mcl was introduced. These results indicate that, in the industrial production of isopropyl alcohol and/or acetone, the breakdown of ldhA is preferable due to the reduction of the purification load during collection of isopropyl alcohol and/or acetone and due to the increase in their yields.
[478] The isopropyl alcohol production pathway and the acetone production pathway were introduced in the B variants. As the amount of acetate was significantly increased in the B variants, it is believed that acetyl-CoA was primarily converted to acetate. Furthermore, it is assumed that the increased acetyl-CoA was converted to acetate and ethanol in the variant with introduced mtk + mcl (mtk_mcl/B). These results indicate that the amount of acetyl-CoA was increased by the effect of mtk + mcl, even in the B variants. Example 34 pGAPS plasmid construction
[479] In order to obtain a spectinomycin resistance gene, amplification by a PCR method was performed using plasmid pIC156 (Steinmetz et al., Gene, 1994, 142(1): 79-83) as a template and CCGCGGTACCGTATAATAAAGAATAATTATTAATCTGTAGACAAATTGTGAAAGG (SEQ ID. NO: 120) and CTTTTGTTTATAAGTGGGTAAACCGTGAATATCGTGTTCTTTTCAC (SEQ ID. NO: 121), and the obtained DNA fragment was phosphorylated using T4 polynucleotide kinase (Toyobo) and, consequently, a DNA fragment containing a spectinomycin resistance gene was obtained. In addition, plasmid pGAP was treated with PvuI, and the obtained DNA fragment was subjected to blunt-end treatment with Toyobo BLUNTING HIGH, and ligated to the DNA fragment described above that contains the spectinomycin resistance gene.
[480] Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 120 µg/ml of spectinomycin were obtained. The colonies obtained were cultured overnight in a liquid LB medium containing 120 μg/ml of spectinomycin, and the plasmid obtained was called pGAPS. Example 35 Preparation of plasmid pGAPS_gcl
[481] Chromosomal DNA was obtained from Escherichia coli MG1655 using “DNeasy Blood & Tissue Kit” (QIAGEN). Based on the glyoxylate carboligase-containing operon (gcl, NCBI-GI: 945394), two types of primers represented by AAGAACTCTAGAACAAAAAGGATAAAACAATGGCAAAAATGAGAGCCGTTGACGCGGCA ATG (SEQ ID NO: 122) and GACCAGCTGCAGTATCAGTCCAGTT were prepared.
[482] In addition, two types of primers represented by ACACAACTGCAGACAAAAAGGATAAACAATGAAGATTGTCATTGCGCCAGACTCTTTT AAAGAGAGCT (SEQ ID. NO: 124) and GCCCCCAAGCTTTCAGTTTTTAATTCCCTGACCTATTTTAATGGCGCAGG (SEQ ID. NO.: 124) and GCCCCCAAGCTTTCAGTTTTTAATTCCCTGACCTATTTTAATGGCGCAGG (SEQ ID. NO.: 124) and GCCCCCAAGCTTTCAGTTTTTAATTCCCTGACCTATTTTAATGGCGCAGG (SEQ.
[483] PCR amplification was performed using chromosomal DNA from Escherichia coli MG1655 as a template and using primers from the IDS. OF SEQ. Nos: 122 and 123 obtained as described above, and therefore a DNA fragment of about 3 kb was obtained. In addition, PCR amplification was performed using chromosomal DNA from Escherichia coli MG1655 as a template and using IDS primers. OF SEQ. Nos: 124 and 125 obtained as described above, and therefore a DNA fragment of about 1.1 kb was obtained. These DNAs obtained were digested with PstI, and these fragments were ligated together. PCR amplification was performed using the ligated DNA as a template and using AAGAACTCTAGAACAAAAAGGATAAAACAATGGCAAAAATGAGAGCCGTTGACGCGGCA ATG (SEQ ID. NO: 126) and GCCCCCAAGCTTTCAGTTTTTAATTCCCTGACCTATTTTAATGGCGCAGG (SEQ ID. NO: 126) and GCCCCCAAGCTTTCAGTTTTTAATTCCCTGACCTATTTTAATGGCGCAGG (ID. of DNA was obtained. The DNA fragment obtained was digested with restriction enzymes XbaI and HindIII, and ligated to a plasmid pGAPS which was digested with restriction enzymes XbaI and HindIII.
[484] Next, Escherichia coli DH5α was transformed with the ligation product, and cultured on an LB agar plate containing spectinomycin, and a plasmid was recovered from the obtained transformants.
[485] The plasmid was digested with restriction enzymes ClaI and HindIII, and an approximately 4 kb DNA fragment harboring pGAPS and the gcl gene was recovered. The DNA fragment was subjected to blunt-end treatment and self-ligation. Escherichia coli DH5α was transformed with the ligation product, and cultured on an LB agar plate containing 120 μg/ml of spectinomycin. Bacterial cells that grew on the plate were cultivated in a liquid LB medium containing 120 μg/ml of spectinomycin and, consequently, transformants were obtained. A plasmid was recovered from the obtained transformants and, therefore, plasmid pGAPS_gc1 was obtained. Example 36 Obtaining the variant of Pantoea ananatis PA
[486] Plasmid RSFCPG was recovered from Pantoea ananatis AJ13601 (patent filed strain BP-7207). Plasmid RSFCPG is a tetracycline resistance plasmid that contains the enzymes glutamate dehydrogenase, citrate synthase and phosphoenolpyruvate carboxylase that catalyze the L-glutamate biosynthesis reaction (JP-A No. 2001-333769). Pantoea ananatis AJ417 (patent filed strain BP-8646) was transformed with RSFCPG using the CaCl2 method ("Molecular Cloning", 3rd Edition, Cold Spring Harbor Press, 2001), and cultured in a liquid LB medium containing 10 µg/ml of tetracycline and, consequently, Pantoea ananatis AJ417/RSFCPG (hereinafter sometimes abbreviated to "PA variant") was obtained. Example 37 Preparation of the variant with deleted Pantoea ananatis aceB gene
[487] The entire genomic DNA sequence of Pantoea ananatis AJ13355 (patent filed strain BP-6614) is known (GenBank Accession Number AP012032) and the base sequence of the gene encoding Pantoea ananatis malate synthase (hereinafter sometimes called “PAaceB”) has also been reported (GenBank Accession Number NC_017531). In order to clone a region flanking the base sequence of the gene encoding aceB (1,599 bp), four types of oligonucleotide primers represented by GACTCTAGAGGATCCCCGGGATGACAGACTCGGTTATCAACAGTGAATTACTTTTCAG (SEQ ID. NO.: 128), GACGGGACGGCGCTTGTTGGAA No.: 129), TTGAGACACAACGTGGCTTTCCCAGCAAGGACAGCGCGCGCAATGAATG (SEQ ID. NO.: 130) and ATGACCATGATTACGAATTCTCAGGGAAGCAGGCGGTAGCCTGGCAGAGTCAG (SEQ. ID. NO.: 131) were synthesized.
[488] Furthermore, in order to clone a kanamycin resistance gene, two types of oligonucleotide primers represented by TTTTTCATAACGCGGAAGCCAACAAAGCCGCCGTCCCGTCAAGTCAGC (SEQ ID. NO.: 132) and CGCGCGCTGTCCTTGCTGGGAAAGCCACGTTGCTTGCTGATCAA (NTGCTTGGATCAAC. ) were synthesized.
[489] Genomic DNA from Pantoea ananatis AJ417 was prepared, and PCR amplification was performed using the obtained genomic DNA as a template and an ID primer pair. OF SEQ. No.: 128 and ID. OF SEQ. No.: 129 and, as a result, a DNA fragment containing a sequence flanking the aceB gene (hereinafter sometimes called "PAaceB-L fragment") was obtained. In addition, PCR amplification was performed using a pair of ID primers. OF SEQ. No.: 130 and ID. OF SEQ. No.: 131 and, as a result, a DNA fragment containing a sequence flanking the aceB gene (hereinafter sometimes called "PAaceB-R fragment") was obtained. In addition, PCR amplification was performed using plasmid pUC4K which carries a kanamycin resistance gene and using a pair of ID primers. OF SEQ. No.: 132 and ID. OF SEQ. No.: 133 and, as a result, a DNA fragment containing the kanamycin resistance gene (hereafter sometimes called “KanR fragment”) was amplified. Plasmid pUC18 was treated with EcoRI and XmaI thereby preparing a pUC18 fragment. These PAaceB-L fragment, PAaceB-R fragment, KanR fragment and pUC18 fragment were recovered, and the fragments were mixed together and treated using the In-fusion HD cloning kit (Invitrogen). Competent cells of Escherichia coli DH5α (NEB5α; New England Biolabs) were transformed with the reaction product, and cultured in an LB plate containing 30 µg/ml of kanamycin. A plasmid was recovered from the obtained transformants, and it was confirmed by DNA sequencing that the pUC18 vector was constructed in such a way that the sequence of the "aceB gene 5' flanking sequence_kanamycin resistance_aceB 3' flanking sequence" was included. PCR was performed using this plasmid as a template and using GCCGCCGAATTCCCGAAAAGTGCCACCTGACGTCTAAGAAACC (SEQ ID NO: 134) and ATGACCATGATTACGAATTCTCAGGGAAGCAGGCGGTAGCCTGGCAGAGTCAG (SEQ ID NO: 135). The amplification product was purified and digested with EcoRI, followed by self-ligation of the resulting fragment using DNA ligase (Takara) and, consequently, a plasmid which does not have an origin of replication was obtained. Pantoea ananatis AJ417 was transformed with the plasmid obtained, and cultivated in an LB plate containing 30 μg/ml of kanamycin. The colonies obtained were submitted to genomic PCR and DNA sequencing, and it was confirmed that the aceB gene was properly deleted. The bacteria obtained were transformed with RSFCPG using the CaCl2 method, and cultivated in LB medium containing 10 μg/ml of tetracycline. The variant obtained was named the Pantoea ananatis AJ417 variant with aceB gene deleted (hereinafter sometimes abbreviated to “PAΔaceB variant”). Example 38 Preparation of Pantoea ananatis variant with deleted fumA gene
[490] Genomic DNA of Bacillus subtilis subspecies subtilis strain 168 (ATCC 23857) was prepared, and amplification by a PCR method was performed using the obtained genomic DNA as a template and using AGTCTAGAGATCCTTTTTAACCCATCAC (SEQ ID. NO.: 136) and AGTCTAGAAGTCGATAAACAGCAATATT (SEQ ID NO: 137) as primers. The DNA fragment obtained was digested with restriction enzyme XbaI, thus obtaining a DNA fragment of about 2.0 kbp containing the sacB gene. The DNA fragment obtained was mixed with a DNA fragment prepared by digesting plasmid pHSG298 (Takara) with restriction enzyme XbaI and submitting the resulting product to alkaline phosphatase treatment, and the mixed fragments were ligated using a ligase. Competent cells of Escherichia coli DH5α (Toyobo Co., Ltd., DNA-903) were transformed with the resulting ligation product, and transformants growing on an LB agar plate containing 25 µg/ml of kanamycin were obtained. A plasmid was recovered from the obtained bacterial cells and, consequently, the plasmid pHSG-sacB, in which the DNA fragment containing the sacB gene was inserted into pHSG298, was obtained.
[491] The entire sequence of plasmid pEA320, originally found in Pantoea ananatis AJ13355, is known (Reference Sequence in NCBI NC_017533.1) and the base sequence of the gene encoding class I fumarate hydratase (hereinafter sometimes referred to as " smoke”) was also reported. In order to clone a region flanking the base sequence of the gene encoding fumA (1,647 bp), four types of oligonucleotide primers represented by GCAACGTTGGCTCTCATCT (SEQ ID. NO: 138), CGGGATCCAAACACGCGGCGGAAAACA (SEQ ID. NO: 138), No: 139), CGGGATCCGTTAACGCAGGCTGAC (SEQ ID NO: 140) and GCTGCTGGCGTACTGGTTC (SEQ ID NO: 141) were synthesized.
[492] Genomic DNA from Pantoea ananatis AJ417 was prepared, and PCR was performed using the obtained genomic DNA as a template and using a pair of ID primers. OF SEQ. No.: 138 and ID. OF SEQ. No.: 139 and, as a result, a DNA fragment of about 0.7 kb (hereafter sometimes called “smoke-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 140 and ID. OF SEQ. No.: 141 and, as a result, a DNA fragment of about 0.9 kb was amplified (hereafter sometimes called “fumA-R fragment”) was amplified.
[493] These DNA fragments were separated by agarose electrophoresis and recovered, and each of the fumA-L fragment and the fumA-R fragment was digested with BamHI. The resulting fragments were ligated using a ligase, and the 5' ends of the ligated product were phosphorylated using T4 polynucleotide kinase. The obtained DNA fragment was mixed with a DNA fragment prepared by digesting the pHSG-sacB described above with BamHI and further submitting the resulting product to blunt-end treatment with T4 DNA polymerase and alkaline phosphatase treatment, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the ligation product, and transformants growing on an LB agar plate containing 25 µg/ml kanamycin at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the two fragments - the fragment of the 5'-upstream flanking region and the fragment of the 3'-downstream flanking region of the gene encoding fumA - were inserted properly into pHSG-sacB. The plasmid obtained was called psacB-PAfumA.
[494] Plasmid psacB-PAfumA is replicable in Pantoea ananatis. Therefore, in order to obtain a fumA gene deletion plasmid devoid of an origin of replication and which would not replicate in Pantoea ananatis, PCR amplification was performed using psacB-PAfumA as a template and a CTTTACACTTTATGCTTCC primer pair ( SEQ ID. NO: 142) and TTGAGCTCGAGAGGTCTGCCTCGTGA (SEQ ID. NO: 143) which have a SacI recognition site on the 5' end side thereof and therefore a DNA fragment of about 5 kb was obtained. The DNA fragment obtained was digested with SacI and allowed to ligate using a ligase, and therefore plasmid pPAfumA was obtained. The pPAfumA obtained harbors the fumA-Lo fragment, the fumA-R fragment, the sacB gene and the kanamycin resistance gene, but no origin of replication. Pantoea ananatis AJ417 was transformed with pPAfumA by electroporation, and applied to an LB agar plate containing 40 μg/ml of kanamycin. The single cross clone that grew in the above medium was grown overnight in a liquid LB medium, and part of the culture liquid was applied to an LB agar medium containing 10% (w/v) sucrose.
[495] Subsequently, among the clones obtained with the above medium, kanamycin-sensitive clones that grew in the medium containing sucrose were selected. In addition, chromosomal DNAs from these clones were amplified by PCR using a pair of ID primers. OF SEQ. No.: 138 and ID. OF SEQ. No.: 141, and a variant from which a fragment of about 1.5 kbp, which indicates deletion of the fumA gene, can be amplified, was selected. The variant obtained was named Pantoea ananatis AJ417 variant with deleted fumA gene (hereinafter sometimes abbreviated to “PAΔfumA variant”). Example 39 Preparation of Pantoea ananatis variant with fumA gene deleted, fumC gene deleted
[496] In order to clone a region flanking the base sequence of the gene encoding class II fumarate hydratase (hereinafter sometimes referred to as "fumC") (1,398 bp), four types of oligonucleotide primers represented by TCGCCATGATGCTGCTGTG (ID SEQ ID NO: 144), CGGGATCCGACTTAGCGTCATCGGTTG (SEQ ID NO: 145), CGGGATCCGATGAAGATTGCTAACGACG (SEQ ID NO: 146) and TGATGCCGACAATATTACGC (SEQ ID NO: 147) were synthesized. .
[497] Genomic DNA from Pantoea ananatis AJ417 was prepared, and PCR was performed using the obtained genomic DNA as a template and using a pair of ID primers. OF SEQ. No.: 144 and ID. OF SEQ. No.: 145 and, as a result, a DNA fragment of about 0.8 kb (hereafter sometimes called “fumC-L fragment”) was amplified. In addition, PCR was performed using a pair of ID primers. OF SEQ. No.: 146 and ID. OF SEQ. No.: 147 and, as a result, a DNA fragment of about 0.7 kb (hereafter sometimes called “fumC-R fragment”) was amplified.
[498] These DNA fragments were separated by agarose electrophoresis and recovered. Each of the fumC-L fragment and the fumC-R fragment was digested with BamHI, and these fragments were allowed to ligate using a ligase, followed by phosphorylation treatment of the 5' ends using T4 polynucleotide kinase. The resulting DNA fragment was mixed with a DNA fragment prepared by digesting pHSG-sacB prepared in Example 38 with BamHI and further submitting the resulting product to blunt-end treatment with T4 DNA polymerase and alkaline phosphatase treatment, and the fragments mixed were linked using a ligase. Next, competent Escherichia coli DH5α cells (manufactured by Toyobo Co., Ltd.) were transformed with the resulting ligation product, and transformants growing on an LB agar plate containing 25 µg/ml kanamycin at 30°C were obtained. A plasmid was recovered from the obtained transformants, and it was confirmed that the two fragments - the 5'-upstream flanking region fragment and the 3'-downstream flanking region fragment from the gene encoding fumC - were inserted properly into pHSG-sacB. The plasmid obtained was called psacB-PAfumC.
[499] Plasmid pPAfumC for deletion of the fumC gene which does not have an origin of replication and would not replicate in Pantoea ananatis was obtained in the same manner as in Example 38, except that plasmid psacB-PAfumC was used instead of psacB- PAfumA. Furthermore, kanamycin sensitive clones growing in a medium containing sucrose were selected in the same way as in Example 38, except that plasmid pPAfumC was used instead of pPAfumA and that variant PAΔfumA was used instead of Pantoea ananatis AJ417. Chromosomal DNAs from these clones were amplified by PCR using a pair of ID primers. OF SEQ. No.: 138 and ID. OF SEQ. No.: 141, and a variant from which a fragment of about 1.5 kbp, which indicates deletion of the fumC gene, can be amplified, was selected. The variant obtained was transformed with RSFCPG by the CaCl2 method, and cultivated in LB medium containing 10 μg/ml of tetracycline. The variant obtained was termed Pantoea ananatis variant, fumA gene deleted, fumC gene deleted (hereinafter sometimes abbreviated to “PAΔfumAC variant”). Example 40 Construction of Pantoea ananatis variants for evaluation
[500] Each of the Pantoea ananatis PA variant prepared in Example 36, the PAΔaceB variant prepared in Example 37, and the PAΔfumAC variant prepared in Example 39, were transformed with pGAPS prepared in Example 34, pGAPS_gcl prepared in Example 35, pMWGKC prepared in Example 10 and/or pMWGKC_mcl(Mc)_mtk(Mc) in Example 21 by the CaCl2 or electroporation method, and was applied to an LB agar plate containing 30 μg/ml chloramphenicol, 120 μg/ml spectinomycin and 15 μg/ ml of tetracycline. The colony that grew on the plate was used as the variant for evaluation. The variants obtained are summarized in Table 13. Table 13
Example 41 Confirmation of 13C-labeled CO2 incorporation into glutamate in Pantoea variants
[502] Each of the target Pantoea variants was pre-cultured in an LB medium containing 30 μg/ml chloramphenicol, 120 μg/ml spectinomycin, and 15 μg/ml tetracycline at 30°C, 220 rpm. Bacterial cells were collected from the pre-culture by centrifugal separation (5,000 rpm for 5 minutes). Two ml of minimal medium for Pantoea (17 g/l Na2HPO4 • 12H2O, 3 g/l KH2PO4, 0.5 g/l NaCl, 1 g/l NH4Cl, 10 mM MgSO4, 10 μM CaCl2, 50 mg/l L-lysine, 50 mg/l L-Methionine, pH 6.0) containing 100 mM sodium hydrogen carbonate (labelled with 13C), 20 g/l glucose, 30 μg/ml chloramphenicol, 120 μg/ml of spectinomycin and 15 μg/ml of tetracycline was prepared, and the obtained bacterial cells were added to it in such a way that the OD was adjusted to be within the range of 1 to 5. After hermetically sealing the culture vessel , bacterial cells were cultured at 30°C, 220 rpm for 1 day. The culture liquid was periodically collected, and bacterial cells were removed by centrifugal separation (12,000 rpm for 3 minutes). The supernatant obtained was filtered through a hydrophilic PTFE membrane filter (Millipore Corporation, MSGVN2B50) thus obtaining a sample of the culture. Variants used as culture samples are summarized in Table 13.
[503] For measurement of 13C glutamate content in each culture sample, 500 µl of MTBSTFA with 1% TBDMSCl (manufactured by Sigma-Aldrich Co., 375934) and 500 µl of dry DMF were added to an appropriate amount of the sample , which has been dried, for example, by freeze drying or vacuum drying. The mixture obtained was heated at 80°C for 2 hours, and then separated by centrifugation (14,000 rpm for 5 minutes). The supernatant obtained was analyzed by GC-MS (Agilent 7890A and 5975c). The respective mass spectral peak areas at molecular weights of 432, 433 and 434, each supposedly corresponding to a structure in which a t-butyl group was removed from a glutamate derivative, were measured. Here, it is assumed that the molecular weight of 432 corresponds to a structure in which all atoms are formed by the most abundant isotopes, that the molecular weight of 433 corresponds to a structure that contains a neutron, and that the molecular weight of 434 corresponds to a structure that contains two neutrons. Peaks at molecular weights of 432, 433 and 434 were defined as [M+0], [M+1] and [M+2], respectively. The value of [M+1]/[M+0] was tabulated on the x-axis and the value of [M+2]/[M+0] was tabbed on the y-axis. The results of the analysis are shown in Table 4.
[504] In general glutamate fermentation, 13C derived from NaH13CO3 is incorporated via oxaloacetate into glutamate only at the C1 or C5 position. Therefore, the values mentioned above will be positioned on a reference line. The reference line was determined according to the following equations.
[505] x = (x0 - x0 x α + α)/(1 - α).
[506] y = (y0 - y0 x α + x0 x α)/(1 - α).
[507] α represents the ratio of the 13C isotope on carbon derived from CO2 (at the C1 position or C5 position) to glutamate [~13C/(13C+12C)]. x and y represent the coordinates of an arbitrary point on the reference line. x0 and y0 represent the values of x and y, assuming that the proportion of 12C isotope on carbon derived from CO2 (in one of position 1 and position 5 of glutamate) in glutamate is 100% and that the proportions of isotopes of others atoms are the same as two natural isotope ratios (that is, the values of x and y, if α = 0). x0 and y0 were set to 0.358527 and 0.16822084314, respectively. By solving the above equations, the reference line is expressed in the following equation.
[508] Y = x0 • x + y0 - x02
[509] In the intrinsic glutamate production pathway, 13C derived from NaH13CO3 is fixed by a carbon dioxide-fixing enzyme such as phosphoenolpyruvate carboxylase (ppc), pyruvate carboxylase (pyc) or phosphoenolpyruvate carboxykinase (pck), and incorporated via oxaloacetate into glutamate at position C1 or position C5. Although the values of [M+1] and [M+2] vary depending on the proportions of 12CO2 and 13CO2 incorporated per ppc, the values are always tabulated at the reference line when incorporation occurs at a single position. On the other hand, when the desired carbon dioxide fixation pathway works, 13C is incorporated into glutamate via both oxaloacetate and acetyl-CoA. In this case, there is a possibility that 13C is incorporated into glutamate at both the C1 and C5 positions and therefore the value of [M+2] must be increased to generate a tabulated value above the reference line.
[510] As shown in Fig. 4, the PA/mtk_mcl_gcl variant, the PAΔaceB/mtk_mcl_gcl variant, and the PAΔfumAC/mtk mcl gcl variant each generated a tabulated value significantly above the baseline. That is, it is believed that fixed CO2 was incorporated into glutamate through acetyl-CoA. On the other hand, the control strain (PA/vec) generated a tabulated value in the reference line, and 13C incorporation through acetyl-CoA was not observed. Similarly, 13C incorporation via acetyl-CoA was not observed in the variant in which only mtk + mcl was introduced (PA/mtk_mcl). It is believed that as Pantoea ananatis lacks gcl, transmission of only mtk and mcl was insufficient to allow further conversion of glyoxylate and therefore the reaction did not proceed. From these results, it was demonstrated that, as shown in Fig. 1, not only the introduction of mtk and mcl, but also the binding of the downstream gcl pathway, are necessary for the conversion of CO2 to acetyl-CoA. Example 42 Glutamate production by Pantoea variants
[511] The amount of glutamate and the amounts of by-products in the culture liquid in Example 41 were measured. The amount of glutamate in the culture sample was measured using an HPLC (2695, Waters) equipped with an NN-814 column (Showa Denko KK) and a UV/Vis detector (2489, Waters). The amounts of glucose and other products in the filtrate were measured using an HPLC (2695, Waters) equipped with an ULTRON PS-80H column (Shinwa Chemical Industries Ltd.) and an RI detector (2414, Waters). The results are shown in Tables 14 and 15. Table 14

Table 15

[514] The variant with introduced mtk + mcl + gcl (PA/mtk_mcl/gcl) showed an increased yield in relation to sugar consumption when compared with the control strain (PA/vec) and with the variant with mtk + mcl introduced (PA/mtk_mcl). In the case of disruption of the aceB gene or the fumAC gene (PAΔaceB/mtk_mcl/gcl, PAΔfumAC/mtk_mcl/gcl), the yield in relation to sugar consumption was further increased.
[515] Regarding the amounts of by-products, when compared to the control strain (PA/vec), it was found that, unexpectedly, the amounts of succinate and 2,3-butanediol (2,3-BDO) were reduced and the Total amounts of by-products were reduced in the variant with mtk + mcl + gcl introduced (PA/mtk_mcl/gcl). Furthermore, when compared to the variant with the undisrupted aceB gene (PA/mtk_mcl/gcl), it was revealed that, unexpectedly, the amounts of succinate and acetate were reduced, and also the total amount of by-products was markedly reduced in the variant with the disrupted aceB gene (PAΔaceB/mtk_mcl/gcl). In the variant with the disrupted fumAC gene (PAΔfumAC/mtk_mcl/gcl), the amount of succinate was markedly decreased, compared to the variant with the undisrupted fumAC gene (PA/mtk_mcl/gcl), but the amount of acetate was increased and the total amount of by-products was reduced. These variants are industrially preferable as a smaller amount of by-products allows for a significant reduction in the purification load when glutamate is collected from a culture liquid.
[516] The above by-product decreasing effect was similarly observed in the PA variant that lacks RSFCPG. Example 43 pCASET plasmid preparation
[517] Amplification by a PCR method was performed using pHSG298 (Takara) as a template and using CGCCTCGAGTGACTCATACCAGGCCTG (SEQ ID. NO: 148) and CGCCTCGAGGCAACACCTTCTTCACGAG (SEQ. ID. NO: 149) as primers, and the obtained DNA fragment was digested with XhoI restriction enzyme and ligated using a ligase. Next, competent Escherichia coli DH5α cells (Toyobo Co., Ltd., DNA-903) were transformed with the ligation product, and transformants growing on an LB agar plate containing 25 µg/ml of kanamycin were obtained. Plasmids were recovered from the obtained bacterial cells, and a plasmid into which an XhoI recognition site is inserted into pHSG298 was named pHSG298-XhoI.
[518] In order to obtain the tac promoter, amplification by a PCR method was performed using pKK223-3 (Pharmacia) as a template and using ATCATCCAGCTGTCAGGCAGCCATCGGAAG (SEQ ID. NO: 150) and ATCCCCGGGAATTCTGTT (DE ID. DE SEQ NO: 151) as primers, and the obtained DNA fragment was digested with restriction enzymes PvuII and SmaI and, consequently, a DNA fragment of about 0.2 kbp encoding the tac promoter was obtained. The DNA fragment obtained was mixed with a DNA fragment of about 2.4 kbp prepared by digesting plasmid pHSG298-XhoI with restriction enzyme PvuII and submitting the resulting product to treatment with alkaline phosphatase, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells (Toyobo Co., Ltd., DNA-903) were transformed with the ligation product, and transformants growing on an LB agar plate containing 25 µg/ml of kanamycin were obtained. A plasmid was recovered from the obtained bacterial cells thereby obtaining a plasmid pHSGT1 in which the lac promoter of pHSG298-XhoI is replaced by the tac promoter and the tac promoter is inserted in the same direction as the original lac promoter.
[519] In order to ligate the pHSG298 multiple cloning site downstream of the pHSGT1 tac promoter, pHSG298 was digested with EcoRI and ClaI restriction enzymes thereby obtaining an approximately 1.0 kbp DNA fragment containing the site of multiple cloning of pHSG298. The DNA fragment obtained was mixed with a DNA fragment of about 1.7 kbp prepared by digesting plasmid pHSGT1 with restriction enzymes EcoRI and ClaI and submitting the resulting product to treatment with alkaline phosphatase, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells (Toyobo Co., Ltd., DNA-903) were transformed with the ligation product, and transformants growing on an LB agar plate containing 25 µg/ml of kanamycin were obtained. A plasmid was recovered from the obtained bacterial cells thereby obtaining a plasmid pHSGT2 in which the multiple cloning site of pHSG298 is linked downstream of the tac promoter.
[520] The following DNA fragment (SEQ ID. NO: 152) which contains the origin of replication, repA and repB from pCASE1 (Appl. Microbiol. Biotechnol. (2009) 81: 1.107-1.115) isolated from Corynebacterium casei JCM 12072 was prepared by DNA synthesis. Your sequence is shown below.
[521] CGCCTCGAGCACTGGAAGGGTTCTTCAGGGGAACCCCCGGAAACCGGGG AAACATCTGACTTGGTTAAATGTCGTATTATGAACACGCCGAGGAATGAAAACCGACCG TGCACGCTCGTGTGAGAAAGTCAGCTACATGAGACCAACTACCCGCCCTGAGGGACGCT TTGAGCAGCTGTGGCTGCCGCTGTGGCCATTGGCAAGCGATGACCTCCGTGAGGGCATT TACCGCACCTCACGGAAGAACGCGCTGGATAAGCGCTACGTCGAAGCCAATCCCGACGC GCTCTCTAACCTCCTGGTCGTTGACATCGACCAGGAGGACGCGCTTTTGCGCTCTTTGT GGGACAGGGAGGACTGGAGACCTAACGCGGTGGTTGAAAACCCCTTAAACGGGCACGCA CACGCTGTCTGGGCGCTCGCGGAGCCATTTACCCGCACCGAATACGCCAAACGCAAGCC TTTGGCCTATGCCGCGGCTGTCACCGAAGGCCTACGGCGCTCTGTCGATGGCGATAGCG GATACTCCGGGCTGATCACCAAAAACCCCGAGCACACTGCATGGGATAGTCACTGGATC ACCGATAAGCTGTATACGCTCGATGAGCTGCGCTTTTGGCTCGAAGAAACCGGCTTTAT GCCGCCTGCGTCCTGGAGGAAAACGCGGCGGTTCTCGCCAGTTGGTCTAGGTCGTAATT GCGCACTCTTTGAAAGCGCACGTACGTGGGCATATCGGGAGGTCAGAAAGCATTTTGGA GACGCTGACGGCCTAGGCCGCGCAATCCAAACCACCGCGCAAGCACTTAACCAAGAGCT GTTTGATGAACCACTACCTGTGGCCGAAGTTGACTGTATTGCCAGGTCAATCCATAAAT GGATCATCACCAAGTCACGCATGTGGACAGACGGCGCCGCCGTCTACGACGCCACATTC ACCGCAATGCAATCCGCACGCGGGAAGAAAGGCTGGCAACGAAG CGCTGAGGTGCGTCG TGAGGCTGGACATACTCTTTGGAGGAACATTGGCTAAGGTTTATGCACGTTATCCACGC AACGGAAAAACAGCCCGCGAGCTGGCAGAACGTGCCGGTATGTCGGTGAGAACAGCTCA ACGATGGACTTCCGAACCGCGTGAAGTGTTCATTAAACGTGCCAACGAGAAGCGTGCTC GCGTCCAGGAGCTGCGCGCCAAAGGTCTGTCCATGCGCGCTATCGCGGCAGAGATTGGT TGCTCGGTGGGCACGGTTCACCGCTACGTCAAAGAAGTTGAAGAGAAGAAAACCGCGTA AATCCAGCGGTTTAGTCACCCTCGGCGTGTTCAAAGTCCATCGTAACCAAGTCAGCTCG AGGCG
[522] The prepared DNA fragment was digested with restriction enzyme XhoI. The DNA fragment obtained was mixed with a DNA fragment prepared by digesting plasmid pHSGT2 with restriction enzyme XhoI and submitting the resulting product to alkaline phosphatase treatment, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells (Toyobo Co., Ltd., DNA-903) were transformed with the ligation product, and transformants growing on an LB agar plate containing 25 µg/ml of kanamycin were obtained. Plasmids were recovered from the obtained bacterial cells, and a plasmid in which the DNA fragment containing the replication origin, repA, and repB of pCASE1, is inserted into the XhoI recognition site of pHSGT2 was named pCASET. In the retrieved pCASET, the pCASE1-derived repA was inserted in the opposite direction with respect to the tac promoter. Example 44 pCASEL plasmid construction
[523] The DNA fragment synthesized in Example 43 (SEQ ID. NO: 152) containing the origin of replication, repA, and repB from pCASE1, was digested with restriction enzyme XhoI. The DNA fragment obtained was mixed with a DNA fragment prepared by digesting plasmid pHSG298-XhoI prepared in Example 43 with restriction enzyme XhoI and submitting the resulting product to treatment with alkaline phosphatase, and the mixed fragments were ligated using a ligase. Next, competent Escherichia coli DH5α cells were transformed with the ligation product, and transformants that grew on an LB agar plate containing 25 µg/ml of kanamycin were obtained. Plasmids were recovered from the obtained bacterial cells, and a plasmid in which the DNA fragment containing the replication origin, repA, and repB of pCASE1, is inserted into the XhoI recognition site of pHSG298-XhoI, was called pCASEL. In recovered pCASEL, the pCASE1-derived repA was inserted in the opposite direction to the pHSG298-derived lac promoter. Example 45 Expression plasmid construction for mtk and mcl derived from Methylococcus capsulatus
[524] PCR was performed using pMWGKC_mcl(Mc)_mtk(Mc) as a template and using a pair of primers from GGAATTCACAAAAAGGATAAAACAATGGCTGTCAAGAACCGTCTAC (SEQ ID. NO: 153) and CGAATTCTCAGAATCTGATTCCGTGTTCCTG (SEQ ID. NO: 153) and CGAATTCTCAGAATCTGATTCCGTGTTCCTG (SEQ ID: 154) (SEQ ID. NO.: 154) and, in consequence, a DNA fragment containing Methylococcus mcl-mtk was obtained. Each of the IDS initiators. OF SEQ. Nos: 153 and 154 has an EcoRI recognition site on the 5' end side. Each of the obtained DNA fragment and plasmid pCASET was digested with EcoRI and dephosphorylated, and the resulting fragments were left to be ligated. Similarly, the obtained DNA fragment and plasmid pCASEL were digested. By DNA sequencing, it was confirmed that the mcl-mtk fragment was inserted in the proper direction for expression with the plasmid promoter. The plasmid obtained was named pCASET_mcl(Mc)_mtk(Mc) or pCASEL_mcl(Mc)_mtk(Mc). Example 46 Construction of expression plasmids for mtk derived from Granulibacter bethesdensis, Nitrosomonas europaea and Hyphomicrobium methylovorum
[525] Competent cells of Escherichia coli dam-/dcm- (New England Biolabs) were transformed with each of pMWGKC_mcl(Hme)_mtk(Gb), pMWGKC_mcl(Hme)_mtk(Hme)_mcl and pMWGKC_mcl(Ne)_mt ) and developed in an LB medium containing 30 μg/ml of chloramphenicol. A plasmid was recovered from them and digested with restriction enzymes EcoRI and XbaI and, consequently, a DNA fragment of about 3 kb containing mtk and mcl was obtained. The DNA fragment containing mtk and mcl was ligated to a plasmid pCASEL which was digested with restriction enzymes EcoRI and XbaI thereby preparing vectors pCASEL_mcl(Hme)_mtk(Gb), pCASEL_mcl(Hme)_mtk(Hme) and pCASEL_mcl( Ne)_mtk(Ne) for mtk and mcl expression in Corynebacterium. Each of these vectors has mtk from Granulibacter bethesdensis, Nitrosomonas europaea or Hyphomicrobium methylovorum.
[526] The plasmids for Corynebacterium prepared are summarized in Table 16. Table 16
Example 47 Measurement of mtk activity in Corynebacterium
[527] Corynebacterium glutamicum ATCC 13012 was transformed with each of the plasmids prepared in Example 45 and Example 46 by electroporation. The resultant was applied to an LB agar plate containing 15 μg/mg kanamycin, and cultured at 30°C for 1 to 4 days. The colonies obtained were cultivated at 30°C for 1 to 4 days in a liquid LB medium containing 15 μg/mg kanamycin, and bacterial cells were collected by centrifugal separation. Bacterial cells were suspended in MOPS-K buffer (pH 7.7), and the suspension obtained was ground with 0.1 mm glass beads using a Beads Shocker (MB5000, Yasui Kikai Corporation). Next, the supernatant obtained by centrifugal separation (13,000 rpm for 2 minutes) was used as a crude mutant enzyme extract. Activity on bacterial cells was measured using the extract in the same way as in Example 16. The results are shown in Table 17. Table 17

[528] When plasmid pCASEL was used as the expression vector, the plasmid expressing mtk derived from Methylococcus capsulatus provided the highest activity value. Furthermore, when compared to Table 9, almost the same correlation was observed between mtk that has high activity and mtk that has low activity. The evaluation of mtk activities derived from Methylococcus capsulatus introduced into pCASEL and that introduced into pCASET showed a higher activity in the variant that has mtk introduced into pCASET. Example 48 Construction of expression plasmid for mtk, mcl, gcl and glxR in Corynebacterium
[529] Rhodococcus jostii NBRC16295 was acquired from NBRC (“Biological Resource Center”, “Biotechnology Field”, “National Institute of Technology and Evaluation). NBRC16295 was cultured in a medium (medium number: 802, NBRC), and genomic DNA was obtained from it using “DNeasy Blood & Tissue Kit” (QIAGEN). PCR was performed using this genomic DNA as a template and using CGAGCTCAAGCTTACAAAAAGGATAAAACAATGAGCACCATTGCATTCATCGG (SEQ ID. NO.: 155) and CGGGATCCCTAGTCCAGCAGCATGAGAG (SEQ. ID. NO.: 156) as primers and therefore a glxR-gcl fragment Rhodococcus (SEQ ID. NO: 157) was obtained. The obtained fragment was digested with SacI and BamHI, and the resultant was ligated to a fragment obtained by digestion of pCASET_mcl(Mc)_mtk(Mc) with SacI and BamHI. The plasmid obtained was named pCASET_mcl(Mc)_mtk(Mc)_glxR(Rj)_gcl(Rj). Example 49 Construction of the Corynebacterium glutamicum variant for evaluation of glutamate production and 13C incorporation
[530] Corynebacterium glutamicum DSM1412 (hereafter sometimes referred to as "CG strain") was transformed with each of the plasmids constructed in Examples 43, 45 and 48 by electroporation, and applied to an LB agar plate containing 15 μg/ml of kanamycin. The colony that grew on the plate was used as the variant for evaluation. The variants obtained are summarized in Table 18. Table 18
Example 50 Confirmation of the introduction of 13C-labeled CO2 into glutamate in Corynebacterium variants
[532] Each of the microorganism variants to be analyzed was grown in 2 ml of liquid LB medium containing 15 μg/ml of kanamycin at 30°C and 280 rpm until sufficient growth was obtained. In a 100 ml Erlenmeyer flask equipped with agitator blades, 10 ml of minimal medium [30 g/l of (NH4)2SO4, 3 g/l of Na2HPO4, 6 g/l of KH2PO4, 2 g/l of NaCl, 84 mg/l of CaCl2, 3.9 mg/l of FeCl3, 0.9 mg/l of ZnSO4^7H2O, 0.3 mg/l of CuCl2^H2O, 5.56 mg/l of MnSO4^5H2O, 0 0.1 mg/l of (NH4) and Mθ7•24•4H2O, 0.3 mg/l of Na2B4O7*10^0, 0.4 g/l of MgSO4•7H2O, 40 mg/l of FeSO4•7H2O, 500 μg/l of Vitamin B1»HCl, 0.1 g/l of EDTA, 10 μg/l of Biotin] for Corynebacterium containing 20 g/l of glucose and 15 μg/ml of kanamycin were prepared. One ml of culture in the liquid LB medium above was added to it, and the mixture was grown for 1 to 4 days until sufficient growth was obtained, whereby a pre-culture was obtained. From the pre-culture, bacterial cells were collected by centrifugal separation (5,000 rpm for 5 minutes).
[533] Two ml of minimal medium for Corynebacterium (final Biotin concentration was changed to 2 µg/l) containing 100 mM sodium hydrogen carbonate (labeled 13C), 20 g/l glucose, 1.5% Tween 60 (w/v) (manufactured by Sigma-Aldrich Co.), and 15 μg/ml of kanamycin were prepared, and bacterial cells from the preculture were added to it in such a way that the OD was adjusted to the range of 1 at 5. After hermetically sealing the culture vessel, the bacterial cells were cultured at 30°C and 150 rpm for 1 to 2 days. The culture liquid was periodically collected, and bacterial cells were removed by centrifugal separation (Millipore Corporation, 12,000 rpm for 3 minutes). The supernatant obtained was filtered through a hydrophilic PTFE membrane filter (Millipore Corporation, MSGVN2B50) thus obtaining a sample of the culture. The 13C content of the culture sample was analyzed in the same way as in Example 41. That is, the respective peak areas at molecular weights of 432, 433 and 434 in the GC-MS analysis were defined as [M], [M +1] and [M+2], respectively, and the value of [M+1]/[M] was tabulated on the x-axis and the value of [M+2]/[M] was tabulated on the y-axis. The reference line was obtained by a calculation according to the method described in Example 41.
[534] Based on Fig. 5, the variant with mtk + mcl + gcl + glxR introduced (CG/mtk_mcl_gcl_glxR) generated a tabulated value above the baseline, and it is believed that fixed CO2 was incorporated into glutamate via acetyl-CoA. On the other hand, the control strain (CG/vec) generated a tabulated value close to the reference line, and 13C incorporation through acetyl-CoA was not observed. Similarly, the variant with introduced mtk + mcl (CG/mtk_mcl) generated a tabulated value near the baseline, and 13C incorporation via acetyl-CoA was not observed. It is believed that, as Corynebacterium glutamicum does not have gcl and glxR, the transmission of only mtk and mcl was insufficient to allow the reaction to proceed, as in the case of Pantoea ananatis. Example 51 Test for glutamate production in Corynebacterium variants
[535] The amount of glutamate and the amounts of by-products in the culture liquid in Example 50 were measured. As in Example 42, glutamate, glucose and other organic compounds in the culture liquid were analyzed. The results are shown in Tables 19 and 20. Table 19
Table 20

[538] The variant with introduced mtk + mcl + gcl + glxR (CG/mtk_mcl_gcl_glxR) showed an increased yield in relation to sugar consumption, when compared to the control strain (CG/vec), and the variant (CG/mtk_mcl ) in which only mtk + mcl were introduced.
[539] Regarding the amounts of by-products, when compared to the control strain (CG/vec), it was found that, unexpectedly, the amount of lactate was mainly reduced and the total amount of by-products was reduced in the variant with mtk + mcl + gcl + glxR introduced (CG/mtk_mcl_gcl_glxR). In the variant (CG/mtk_mcl), in which only mtk + mcl were introduced, the amounts of by-products were almost equal to those in the control strain. Example 52 Increased activity by introducing mutations in the malate thiokinase gene derived from Methylobacterium extorquens
[540] PCR was performed using pMWGKC_mtk(Mex)_mcl as a template and each of the primer pairs shown in Table 21. The template was digested with restriction enzyme DpnI. Next, competent Escherichia coli DH5α cells were transformed with the product obtained, and transformants that grew on an LB agar plate containing 10 μg/ml of chloramphenicol were obtained. The colonies obtained were cultured at 30°C overnight in a liquid LB medium containing 10 μg/ml of chloramphenicol. A plasmid was recovered from a part of the culture liquid, and its DNA sequence was verified. A plasmid into which the desired mutation was properly introduced was used as the mutant sample. This sample was pre-cultured in a liquid LB medium containing 10 μg/ml of chloramphenicol, and then inoculated into 3 ml of liquid LB medium containing 10 μg/ml of chloramphenicol and cultured at 30°C and 280 rpm for one day other. Two milliliters of the culture were separated by centrifugation at 10,000 rpm for 5 minutes to remove the supernatant, and 2 ml of 10 mM phosphate buffer (pH 7.0) was added thereto, followed by washing the cells. The washing operation was repeated once, and the cells were suspended in 500 µl of 10 mM phosphate buffer (pH 7.0). The obtained suspension was ground with 0.1 mm glass beads using a Beads Shocker (MB5000, Yasui Kikai Corporation), and the supernatant obtained by centrifugal separation (13,000 rpm for 2 minutes) was used as a crude mutant enzyme extract.
[541] The activity of each crude mutant enzyme extract was evaluated according to the method described in Example 16. The results are shown in Table 21. As a result, the Q244E mutation in mtkB and the L144I mutation in mtkB increased the value of activity, compared to the non-mutated mtkB. Furthermore, the activity was increased by introducing another amino acid at position Q244 of mtkB, when the amino acid introduced was A, L, I, M, N, Y, K or R. Furthermore, the activity was increased by introducing a mutation at position L144 of mtkB, when the amino acid introduced was N, D, K, R, H, Q or P.Table 21


[542] According to the invention, CO2 can be converted to acetyl-CoA. Furthermore, according to the invention, substances derived from acetyl-CoA such as, for example, isopropyl alcohol, acetone and glutamic acid can be efficiently produced.
[543] The disclosure of Japanese Patent Application No. 2011167808 filed on July 29, 2011 is hereby incorporated by reference in its entirety.
[544] All publications, patent applications, and technical standards referenced in this specification are hereby incorporated by reference to the same degree as if each individual publication, patent application, or technical standard were specifically and individually indicated to be incorporated by reference.

权利要求:
Claims (13)
[0001]
1. Acetyl-CoA producing microorganism characterized by comprising a cycle of acetyl-CoA production obtained by transmitting to a microorganism at least one type of gene encoding enzyme selected from the group consisting of gene encoding malate thiokinase, gene of malyl-CoA lyase coding, glyoxylate carboligase coding gene, 2-hydroxy-3-oxopropionate reductase coding gene, and hydroxypyruvate reductase coding gene, wherein, (i) the microorganism is Escherichia coli, and at least one type of gene encoding enzyme includes mtk gene encoding malate thiokinase and mcl gene encoding malyl-CoA lyase, or (ii) the microorganism is Pantoea ananatis, and at least one type of gene encoding enzyme includes gene mtk which encodes a malate thiokinase, the mcl gene which encodes a malyl-CoA lyase and the gcl gene which encodes a glyoxylate carboligase, or (iii) the microorganism is Corynebacterium glutamicum, and at least one type of gene q Enzyme encoding includes the mtk gene encoding a malate thiokinase, the mcl gene encoding a malyl-CoA lyase, the gcl gene encoding a glyoxylate carboligase, and at least one of the glxR genes encoding a 2-hydroxy-3-oxopropionate reductase or the ycdW gene which encodes a hydroxypyruvate reductase.
[0002]
2. Acetyl-CoA producing microorganism, according to claim 1, characterized in that it comprises an acetyl-CoA production cycle in which phosphoenolpyruvate or pyruvate is converted into oxaloacetate, and then into 2-hydroxy-3-oxopropionate as a function of actions of thiokinase malate, malyl-CoA lyase, glyoxylate carboligase, and then into phosphoenolpyruvate again via 2-phosphoglycerate.
[0003]
3. Acetyl-CoA producing microorganism, according to claim 1 or 2, characterized in that it comprises an acetyl-CoA production cycle comprising: (a) at least one selected from the group consisting of: - pyruvate kinase and pyruvate carboxylase; - phosphoenolpyruvate carboxylase; and - phosphoenolpyruvate carboxykinase; (b) malate dehydrogenase; (c) thiokinase malate; (d) malyl-CoA lyase; (e) glyoxylate carboligase; (f) at least one selected from the group consisting of: - 2-hydroxy-3-oxopropionate reductase; and - hydroxypyruvate isomerase and hydroxypyruvate reductase; (g) at least one selected from the group consisting of: - glycerate 2-kinase; and - phosphoglycerate mutase and glycerate 3-kinase; and (h) enolase.
[0004]
4. Acetyl-CoA producing microorganism, according to any one of claims 1 to 3, characterized in that the microorganism is an Escherichia bacterium in which a lactate dehydrogenase activity possessed by the Escherichia bacterium is inactivated or reduced.
[0005]
5. Acetyl-CoA producing microorganism according to any one of claims 1 to 4, characterized in that the microorganism is an Escherichia bacterium in which an activity of at least one enzyme selected from the group consisting of isocitrate lyase and malate synthase possessed by the Escherichia bacteria is inactivated or reduced.
[0006]
6. Acetyl-CoA producing microorganism according to any one of claims 1 to 5, characterized in that the microorganism is an Escherichia bacterium in which a thiolase activity, a CoA transferase activity and an acetoacetate decarboxylase activity are transmitted or augmented.
[0007]
7. Acetyl-CoA producing microorganism, according to any one of claims 1 to 6, characterized in that the microorganism is an Escherichia bacterium in which a thiolase activity, a CoA transferase activity, an acetoacetate decarboxylase activity, and an isopropyl alcohol dehydrogenase activity are transmitted or increased.
[0008]
8. Acetyl-CoA producing microorganism, according to any one of claims 1 to 3, characterized in that the microorganism is a Pantoea bacterium in which: (i) fumarate hydratase A and fumarate hydratase C activities possessed by the Pantoea bacterium are inactivated or reduced; or (ii) a malate synthase activity possessed by the Pantoea bacteria is inactivated or reduced.
[0009]
9. Acetyl-CoA producing microorganism, according to any one of claims 1 to 8, characterized in that the thiokinase malate used is a thiokinase malate obtained by modifying mtkB derived from Methylobacterium extorquens in order to change a corresponding amino acid to the 144th amino acid into isoleucine, asparagine, aspartic acid, lysine, arginine, histidine, glutamine or proline, and/or in order to change the 244th amino acid into glutamic acid, alanine, leucine, isoleucine, methionine, asparagine, tyrosine, lysine or arginine.
[0010]
A method for producing acetyl-CoA characterized in that it comprises producing acetyl-CoA from a carbon source material using the acetyl-CoA producing microorganism as defined in any one of claims 1 to 9.
[0011]
A method for producing acetone characterized in that it comprises producing acetone from a carbon source material using the acetyl-CoA producing microorganism as defined in any one of claims 6, 7 or 9.
[0012]
A method for producing isopropyl alcohol characterized in that it comprises the production of isopropyl alcohol from a carbon source material using the acetyl-CoA producing microorganism as defined in claim 7 or 9.
[0013]
A method for producing glutamate characterized in that it comprises producing glutamate from a carbon source material using the acetyl-CoA producing microorganism as defined in any one of claims 1, 8, or 9.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112014001662B1|2021-09-14|ACETYL-COA PRODUCING MICRO-ORGANISM, METHODS FOR PRODUCING ACETYL-COA, ACETONE, ISOPROPYL ALCOHOL AND GLUTAMATE

---

Meiswinkel et al.2013|Crude glycerol-based production of amino acids and putrescine by Corynebacterium glutamicum

---

EP3020807B1|2019-04-10|Process for producing l-glutamine, l-glutamic acid, l-arginine and l-proline

---

JP5805202B2|2015-11-04|Microorganism producing O-phosphoserine and method for producing L-cysteine or a derivative thereof from O-phosphoserine using the same

---

US9828618B2|2017-11-28|Microorganism having carbon dioxide fixation cycle introduced thereinto

---

JP2018531617A|2018-11-01|Method for producing aldehyde

---

JP2019531756A|2019-11-07|Production method of target substance

---

JP2019531757A|2019-11-07|Production method of target substance

---

TW202136505A|2021-10-01|Method for the fermentative production of guanidinoacetic acid

---

JP2019536449A|2019-12-19|Production method of target substance

---

JP2019531758A|2019-11-07|Method for producing L-methionine or a metabolite requiring S-adenosylmethionine for synthesis

---

EP2948539B1|2017-10-18|Microorganism for production of chemicals derived from acetyl-coa

---

JP2019134700A|2019-08-15|Method for manufacturing target substance

---

WO2014115816A1|2014-07-31|Microorganisms having carbon dioxide fixation pathway introduced thereinto

---

JP2020526205A|2020-08-31|Methionine-producing yeast

---

JP2017104099A|2017-06-15|Method for producing limonene

同族专利:

---

公开号 | 公开日

---

JP5922124B2|2016-05-24|

---

BR112014001662A2|2017-02-21|

---

KR101596605B1|2016-02-22|

---

DK2738247T3|2017-01-09|

---

TWI573869B|2017-03-11|

---

CN103703122A|2014-04-02|

---

EP2738247A4|2015-03-04|

---

KR20140027541A|2014-03-06|

---

US9822387B2|2017-11-21|

---

TW201311889A|2013-03-16|

---

CN103703122B|2019-04-26|

---

US20140363847A1|2014-12-11|

---

WO2013018734A1|2013-02-07|

---

JPWO2013018734A1|2015-03-05|

---

EP2738247B1|2016-09-14|

---

PL2738247T3|2017-05-31|

---

HUE032394T2|2017-09-28|

---

EP2738247A1|2014-06-04|

---

MY165731A|2018-04-20|

---

ES2599482T3|2017-02-01|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

JPS50113209A|1974-02-13|1975-09-05|

---

JPS559197B2|1975-09-19|1980-03-08|

---

JPS5718795B2|1979-06-20|1982-04-19|

---

JPS5832596B2|1979-08-10|1983-07-14|Ajinomoto Kk|

---

JPS5810075B2|1979-08-31|1983-02-24|Ajinomoto Kk|

---

JPS6236676B2|1980-04-02|1987-08-07|Ajinomoto Kk|

---

US4372753A|1980-04-23|1983-02-08|Source Technology, Inc.|Liquid fuel for use in internal combustion engines|

---

JPS6321479B2|1980-04-25|1988-05-07|Ajinomoto Kk|

---

JPS5765198A|1980-10-09|1982-04-20|Ajinomoto Co Inc|Fermentative production of l-glutamic acid|

---

JPS614519B2|1981-03-23|1986-02-10|Ajinomoto Kk|

---

JPH0529436B2|1982-03-15|1993-04-30|Ajinomoto Kk|

---

JPH0430275B2|1985-03-07|1992-05-21|

---

JPH03232497A|1990-02-08|1991-10-16|Asahi Chem Ind Co Ltd|Production of l-glutamine by fermentation|

---

JPH0488994A|1990-07-30|1992-03-23|Kyowa Hakko Kogyo Co Ltd|Production of l-glutamine by fermentation|

---

AU725516B2|1997-09-19|2000-10-12|Metabolix, Inc.|Biological systems for manufacture of polyhydroxyalkanoate polymers containing 4-hydroxyacids|

---

AU756507B2|1998-03-18|2003-01-16|Ajinomoto Co., Inc.|L-glutamic acid-producing bacterium and method for producing L-glutamic acid|

---

JP4427878B2|1999-08-20|2010-03-10|味の素株式会社|Method for producing L-glutamic acid by fermentation method with precipitation|

---

JP4560998B2|2001-02-05|2010-10-13|味の素株式会社|Method for producing L-glutamine by fermentation and L-glutamine producing bacteria|

---

RU2230114C2|2001-11-30|2004-06-10|Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика"|Mutant glutamine synthetase, dna fragment, strain of escherichia coli as p roducer of l-glutamine and method for preparing l-amino acids|

---

FR2862068B1|2003-11-06|2007-10-12|Metabolic Explorer Sa|OPTIMIZED MICROORGANISM STRAINS FOR NADPH CONSUMPTION BIOSYNTHESIS PATHWAYS|

---

JP4665558B2|2004-03-04|2011-04-06|味の素株式会社|L-glutamic acid-producing microorganism and method for producing L-glutamic acid|

---

RU2004124226A|2004-08-10|2006-01-27|Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика" |USE OF PHOSPHOCETHOLASE FOR PRODUCTION OF USEFUL METABOLITES|

---

EP1995308B1|2006-02-24|2014-07-30|Mitsubishi Chemical Corporation|Bacterium capable of producing organic acid, and method for production of organic acid|

---

WO2008145737A1|2007-06-01|2008-12-04|Evonik Degussa Gmbh|A process for preparing methacrylic acid or methacrylic esters|

---

JP2010041920A|2006-12-19|2010-02-25|Ajinomoto Co Inc|Method for producing l-amino acid|

---

BRPI0814681B1|2007-07-11|2018-12-26|Mitsui Chemicals Inc|recombinant isopropyl alcohol producing bacterium of the genus escherichia and method of producing isopropyl alcohol using the same|

---

DE102007047206B4|2007-10-02|2016-08-11|Insilico Biotechnology Ag|Biotechnological fixation of carbon dioxide|

---

DE102007059248A1|2007-12-07|2009-06-10|Albert-Ludwigs-Universität Freiburg|Recombinant cell capable of converting bicarbonate to organic compounds utilizes a 16-step metabolic pathway starting with acetyl coenzyme A|

---

JP2009148222A|2007-12-21|2009-07-09|Research Institute Of Innovative Technology For The Earth|Method for producing l-glutamic acid|

---

WO2009094485A1|2008-01-22|2009-07-30|Genomatica, Inc.|Methods and organisms for utilizing synthesis gas or other gaseous carbon sources and methanol|

---

AU2009242615A1|2008-05-01|2009-11-05|Genomatica, Inc.|Microorganisms for the production of methacrylic acid|

---

DE102008002715A1|2008-06-27|2009-12-31|Evonik Röhm Gmbh|2-hydroxyisobutyric acid producing recombinant cell|

---

CN102307986A|2008-12-16|2012-01-04|基因组股份公司|Microorganisms and methods for conversion of syngas and other carbon sources to useful products|

---

US8361760B2|2009-03-06|2013-01-29|Massachusetts Institute Of Technology|Microbial production of 3-hydroxyacids from glucose and glycolate|

---

WO2011099006A2|2010-02-11|2011-08-18|Yeda Research And Development Co. Ltd.|Enzymatic systems for carbon fixation and methods of generating same|

---

JP2011167097A|2010-02-17|2011-09-01|Kobe Univ|METHOD FOR PRODUCING gamma-AMINOBUTYRIC ACID|US8647642B2|2008-09-18|2014-02-11|Aviex Technologies, Llc|Live bacterial vaccines resistant to carbon dioxide , acidic PH and/or osmolarity for viral infection prophylaxis or treatment|

---

BR112015017299A2|2013-01-24|2017-11-21|Mitsui Chemicals Inc|microorganism for the production of chemicals derived from acetyl-coa|

---

WO2014115816A1|2013-01-24|2014-07-31|三井化学株式会社|Microorganisms having carbon dioxide fixation pathway introduced thereinto|

---

US9828618B2|2013-01-24|2017-11-28|Mitsui Chemicals, Inc.|Microorganism having carbon dioxide fixation cycle introduced thereinto|

---

EP3013971A4|2013-06-29|2016-11-30|Univ California|Recombinant plants and microorganisms having a reverse glyoxylate shunt|

---

JP2016163540A|2013-07-09|2016-09-08|味の素株式会社|Production method of useful materials|

---

JP2016165225A|2013-07-09|2016-09-15|味の素株式会社|Method for producing useful substance|

---

CN104004700A|2014-06-17|2014-08-27|江南大学|High-yield propionic acid propionibacterium jensenii engineering bacterium and application thereof|

---

BR112017003733A2|2014-09-03|2017-12-05|Global Bioenergies|"Recombinant microorganism that produces alkenes from acetyl coa".|

---

KR101750293B1|2015-03-04|2017-06-26|한국과학기술연구원|Transformed synechococcus elongatus having capability of producing acetone from carbon dioxide|

---

CN104726505A|2015-03-31|2015-06-24|上海交通大学|Method for producing three-carbon compounds by using gene engineering cyanobacteria|

---

KR101828551B1|2016-01-11|2018-02-13|한국과학기술원|Recombinant Variant Microorganism Having a Producing Ability of Malonic Acid and Method for Preparing Malonic Acid Using the Same|

---

CN106362578A|2016-09-28|2017-02-01|徐明好|Flue gas treatment method|

---

US11180535B1|2016-12-07|2021-11-23|David Gordon Bermudes|Saccharide binding, tumor penetration, and cytotoxic antitumor chimeric peptides from therapeutic bacteria|

---

US11129906B1|2016-12-07|2021-09-28|David Gordon Bermudes|Chimeric protein toxins for expression by therapeutic bacteria|

---

RU2019129161A3|2017-03-14|2021-07-20|

---

EP3507272A1|2017-04-04|2019-07-10|NNB Nutrition USA, LLC|Preparation of -3-hydroxybutyric acid or its salts by one-step fermentation|

---

CN108998501A|2018-08-08|2018-12-14|大连大学|A kind of efficient cryogenic uses the carbon dioxide kit of Enzymatic cycling|

---

US20200263210A1|2019-02-15|2020-08-20|Braskem S.A.|Microorganisms and methods for the production of glycolic acid and glycine via reverse glyoxylate shunt|

法律状态:
2019-07-09| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-09-29| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-03-23| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-08-03| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-09-14| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 27/07/2012, OBSERVADAS AS CONDICOES LEGAIS. |

---

2021-10-05| B16C| Correction of notification of the grant [chapter 16.3 patent gazette]|Free format text: REF. RPI 2645 DE 14/09/2021 QUANTO AO INVENTOR (ITEM 72). |

优先权:

---

申请号 | 申请日 | 专利标题

---

JP2011167808|2011-07-29|

---

JP2011-167808|2011-07-29|

---

PCT/JP2012/069247|WO2013018734A1|2011-07-29|2012-07-27|Microorganism having carbon dioxide fixation pathway introduced thereinto|

---