negative regulation of gene expression in insect pests

专利摘要:
NEGATIVE REGULATION OF GENETIC EXPRESSION IN INSECT PEST. The present invention relates to the genetic control of infestation by species of insect pests, particularly prevention and / or control of plant infestation by pests, using interfering ribonucleic acid (RNA) molecules. Compositions and combinations containing the interfering RNA molecules of the invention for use in topical applications, for example, in the form of insecticides.
公开号:BR112014001398A2
申请号:R112014001398-5
申请日:2012-05-02
公开日:2020-12-01
发明作者:Myriam Beghyn；Thierry Bogaert；Pascale Feldman；Romaan Raemaekers
申请人:Devgen Nv；
IPC主号:

专利说明:

[01] [01] The present invention relates generally to the genetic control of infestation by species of insect pests, particularly prevention and / or control of plant infestation by pests. More specifically, the invention relates to the down regulation of target gene expression in insect pest species by interfering ribonucleic acid (RNA) molecules. Also provided are compositions and combinations containing the interfering RNA molecules of the invention for use in topical applications, for example, in the form of insecticides.
[02] [02] There are an abundance of insect pest species that can infect or infest a wide variety of host environments and organisms. Insect pests include a variety of species from the Hemiptera insect orders (bedbugs), Coleoptera (beetles), Siphonaptera (fleas), Dichyoptera (cockroaches and mantis), Lepidoptera (moths and butterflies), Orthoptera (for example, locusts and Diptera (true flies). Pest infestation can lead to significant damage. Insect pests that infest plant species are particularly problematic in agriculture as they can cause serious damage to crops and significantly reduce plant yields. of different types of plants it is susceptible to infestation by pests, including commercial crops such as rice, cotton, soy, potatoes and corn.
[03] [03] Traditionally, infestation with insect pests has been prevented or controlled using chemical pesticides. However, these chemicals are not always suitable for use in crop treatment, as they can be toxic to other species and can cause significant environmental damage. In recent decades, researchers have developed more environmentally friendly pest control methods. For example, microorganisms such as Bacillus thuringiensis bacteria have been used, which naturally express proteins toxic to insect pests. Scientists have also isolated the genes that encode these insecticidal proteins and used them to generate transgenic crops resistant to insect pests, for example, genetically engineered corn and cotton plants to produce proteins from the Cry family.
[04] [04] Although bacterial toxins have been highly successful in controlling certain types of pests, they are not effective against all species of pests. As a result, the researchers considered other approaches more focused on pest control and, in particular, RNA interference or 'genetic silencing' as a means of controlling pests at the genetic level.
[05] [05] RNA interference or '"RNAi'! Is a process by which gene expression, in the context of a complete cell or organism, is downregulated in a sequence-specific manner. RNAi is now a well-established technique in the field to inhibit or downregulate gene expression in a wide variety of organisms, including pest organisms, such as fungi, nematodes and insects. In addition, previous studies have shown that down-regulation of target genes in insect pest species can be used as a means to control pest infestation.
[06] [06] WO2007 / 074405 describes methods to inhibit expression of target genes in invertebrate pests, including the Colorado potato beetle. In addition, WO2009 / 091864 describes compositions and methods for the suppression of target genes from insect pest species, including pests of the Lygus genus.
[07] [07] Although the use of RNAi to negatively regulate gene expression in pest species is known in the area, the success of this technique for use as a pest control measure depends on the selection of the most appropriate target genes, namely those in which loss of function causes significant destruction of an essential biological process and / or death of the organism. Thus, the present invention is directed to the negative regulation of particular target genes in insect pests as a means of achieving more effective prevention and / or control of insect pest infestation, particularly of plants.
[08] [08] The present inventors sought to identify improved ways to prevent and / or control infestation by insect pests using genetic approaches. In particular, they researched the use of RNAi to downregulate genes in order to weaken the insect pest's ability to survive, grow, colonize specific environments and / or infest host organisms and thus limit the damage caused by the pest.
[09] [09] Consequently, according to one aspect of the invention, an interfering ribonucleic acid (RNA or double-stranded RNA) is provided which acts by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest,
[010] [010] in which the RNA comprises at least one silencing element, in which the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, in which one of these strands comprises Or consists of a sequence of nucleotides that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene
[011] [011] In a particular aspect of the invention, interfering RNA molecules of the present invention comprise at least one double stranded region, typically the interfering RNA silencing element, comprising a sense hybridized RNA strand, by pairing complementary bases, with a complementary base. antisense RNA strand, wherein the sense strand of the dsRNA molecule comprises a nucleotide sequence complementary to a nucleotide sequence located in the RNA transcript of the target gene.
[012] [012] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA or double-stranded RNA) that works by uptake by a species of insect pest to negatively regulate the expression of a target gene in said pest. insects, in which the RNA comprises at least one silencing element, in which the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, in which one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene
[013] [013] These target genes encode proteins in the troponin / myofilament complex.
[014] [014] In another embodiment, the present invention relates to an interfering ribonucleic acid (RNA or double-stranded RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said pest of insects, in which the RNA comprises at least one silencing element, in which the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, in which one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and wherein the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs. 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167,
[015] [015] These target genes encode ribosomal insect proteins.
[016] [016] In certain embodiments, the present invention relates to an interfering RNA molecule comprising at least one double stranded region, typically the silencing element of the interfering RNA molecule, comprising a hybridized sense RNA strand, by pairing complementary bases, with an antisense RNA strand, where the sense strand of the dsRNA molecule comprises a sequence of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600 , 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 contiguous nucleotides which is at least 75%, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or 100% complementary to a nucleotide sequence located in the RNA transcript of a target gene of the troponin / myofilament complex.
[017] [017] In one embodiment, the target gene encodes an insect "wings up" protein (troponin I) (for example, an insect ortholog of the CG7178 Dm protein), where said target gene is represented by SEQ ID NOs 1, 2, 174, 404, 175, 180, 181, 188 and 189. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or more of SEQ ID NOs. 79, 349, 405, 352 or 356.
[018] [018] In one embodiment, the target gene encodes an "upheld" protein (for example, a CG7107 Dm protein insect orthologist), wherein said target gene is represented by SEQ ID NOs 121, 130, 142, 143, 176, 177, 182 and 183. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or more of SEQ ID NOs. 330, 350 or
[019] [019] In one embodiment, the target gene encodes the tropomyosin 1 protein (for example, a CG4898 Dm insect orthologist), or the tropomyosin 2 protein (for example, a CG4843 Dm insect orthologist), where said target gene is represented by SEQ ID NOs 123 and 132. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity of amino acid sequences with SEQ ID NO. 332.
[020] [020] In one embodiment, the target gene encodes the myosin heavy chain (for example, a CG17927 Dm protein insect orthologist), wherein said target gene is represented by SEQ ID NOs 122, 131, 144, 145, 178 and 179. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or more SEQ ID NOs. 331 or 351.
[021] [021] In one embodiment, the target gene encodes the cytoplasmic protein of the myosin light chain (for example, an insect ortholog of the CG3201 Dm protein), wherein said target gene is represented by SEQ ID NOs 124 and 133. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 333.
[022] [022] In one embodiment, the target gene encodes the "spaghetti squash" protein (for example, an insect orthologist of the CcG3595 Dm protein), where said target gene is represented by SEQ ID NOs 125 and 134. In one preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity with SEQ ID NO. 334.
[023] [023] In one embodiment, the target gene encodes the zipper protein (for example, an insect ortholog of the CG15792 Dm protein), wherein said target gene is represented by SEQ ID NOs 126 and 135. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity with SEQ ID NO. 335.
[024] [024] In one embodiment, the target gene encodes troponin C (for example, a CG2981, CG7930, CcG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 or CG6514 Dm insect orthologist), wherein said target gene is represented by SEQ ID NOs 127 and 136, or 128 and 137, or 184 and 185. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98 %, 99% or 100% identity of amino acid sequences with one or more of SEQ ID NOs. 336, 337 and 354.
[025] [025] According to another embodiment, the present invention relates to an interfering RNA molecule that comprises at least one double stranded region, typically the silencing element of the interfering RNA molecule, comprising a hybridized sense RNA strand, for example pairing complementary bases with an antisense RNA strand, where the sense strand of the dsRNA molecule comprises a sequence of at least 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550 , 600, 700, 800, 900 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 contiguous nucleotides which is at least 75%, preferably at least 80%, 85%, 90%, 95%, 98%, 99% or 100% complementary to a nucleotide sequence located in the RNA transcript of a target gene encoding an insect ribosomal protein.
[026] [026] In one embodiment, the target gene encodes the ribosomal protein S3A (for example, an insect ortholog of the CG2168 Dm protein), wherein said target gene is represented by SEQ ID NOs 11, 12 and 141. In one embodiment Preferred, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or both SEQ ID NOs. 84 or 328.
[027] [027] In one embodiment, the target gene encodes the ribosomal protein LPl (for example, an insect ortholog of the CG4087 Dm protein), wherein said target gene is represented by SEQ ID NO 3 and 4. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.80.
[028] [028] In one embodiment, the target gene encodes the ribosomal protein S3 (e.g., an insect ortholog of the CG6779 Dm protein), wherein said target gene is represented by SEQ ID NOs 7 and 8. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.82.
[029] [029] In one embodiment, the target gene encodes the ribosomal protein L10Ab (for example, an insect ortholog of the CG7283 Dm protein) represented by SEQ ID NOs 9 and 10. In a preferred embodiment, the insect orthologist has at least 85 %, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.
[030] [030] In one embodiment, the target gene encodes the ribosomal protein S18 (e.g., an insect ortholog of the CG8900 Dm protein), wherein said target gene is represented by SEQ ID NOs 13 and 14. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.85.
[031] [031] In one embodiment, the target gene encodes the ribosomal protein L4 (for example, an insect ortholog of the CG5502 Dm protein), wherein said target gene is represented by SEQ ID NO 5 and 6. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.81.
[032] [032] In one embodiment, the target gene encodes the ribosomal protein S27 (for example, an insect ortholog of the CG10423 Dm protein), wherein said target gene is represented by SEQ ID NO 15 and 16, 204 and 205. In a preferred modality, the insect orthologist has at least
[033] [033] In one embodiment, the target gene encodes the L6 ribosomal protein (for example, an insect ortholog of the CGl1522 Dm protein), wherein said target gene is represented by SEQ ID NO 17 and 18. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 87.
[034] [034] In one embodiment, the target gene encodes the ribosomal protein S13 (e.g., an insect orthologist of the CG13389 Dm protein), wherein said target gene is represented by SEQ ID NO 19 and 20. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 88.
[035] [035] In one embodiment, the target gene encodes the ribosomal protein L12 (e.g., an insect orthologist of the CG3195 Dm protein), wherein said target gene is represented by SEQ ID NOs 21 and 22. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.89.
[036] [036] In one embodiment, the target gene encodes the ribosomal protein L26 (e.g., an insect ortholog of the CG6846 Dm protein), wherein said target gene is represented by SEQ ID NOs 158 and 159. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 343.
[037] [037] In one embodiment, the target gene encodes the ribosomal protein L21 (for example, an insect ortholog of the CG12775 Dm protein), wherein said target gene is represented by SEQ ID NO 165, 166 and 167. In one embodiment Preferred, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NOs 347 and 348.
[038] [038] In one embodiment, the target gene encodes the ribosomal protein S12 (e.g., an insect ortholog of the CGl1271 Dm protein), wherein said target gene is represented by SEQ ID NOs 156 and 157. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 342.
[039] [039] In one embodiment, the target gene encodes the ribosomal protein S28b (for example, an insect ortholog of the CG2998 Dm protein), wherein said target gene is represented by SEQ ID NOs 160 and 161. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 344.
[040] [040] In one embodiment, the target gene encodes the ribosomal protein L13 (e.g., an insect ortholog of the CG4651 Dm protein), wherein said target gene is represented by SEQ ID NOs 154 and 155. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 341.
[041] [041] In one embodiment, the target gene encodes the ribosomal protein L10 (e.g., an insect ortholog of the CG17521 Dm protein), wherein said target gene is represented by SEQ ID NOs 163 and 164. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 345.
[042] [042] In one embodiment, the target gene encodes the ribosomal protein L5 (for example, an insect ortholog of the CG17489 Dm protein), wherein said target gene is represented by SEQ ID NOs 152 and 153. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 340.
[043] [043] In one embodiment, the target gene encodes the ribosomal protein S15Aa (for example, an insect ortholog of the CG2033 Dm protein), wherein said target gene is represented by SEQ ID NOs 150 and 151. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 339.
[044] [044] In one embodiment, the target gene encodes the ribosomal protein L19 (for example, an insect ortholog of the CG2746 Dm protein), wherein said target gene is represented by SEQ ID NOs. 200 and 201. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO .357.
[045] [045] In one embodiment, the target gene encodes the ribosomal protein L27 (e.g., an insect ortholog of the CG4759 Dm protein), wherein said target gene is represented by SEQ ID NO. 386. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.390 .
[046] [046] In one embodiment, the target gene encodes the mitochondrial cytochrome c oxidase subunit II protein (e.g., an insect ortholog of the CG34069 Dm protein), wherein said target gene is represented by SEQ ID NO 25 and 26 In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 91.
[047] [047] In one embodiment, the target gene encodes the ATP synthase-y chain (for example, an insect orthologist of the CG7610 Dm protein), wherein said target gene is represented by SEQ ID NOs 129 and 138. In one preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 338.
[048] [048] In one embodiment, the target gene encodes ubiquitin 5E (for example, an insect ortholog of the CG32744 Dm protein), wherein said target gene is represented by SEQ ID NOs. 186 and 187, 202 and 203. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or both SEQ ID NOs. 355 and 358.
[049] [049] In one embodiment, the target gene encodes the proteasome beta-type subunit (for example, an insect orthologist of the CG17331l Dm protein), wherein said target gene is represented by SEQ ID NO. 387. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.391 .
[050] [050] In one embodiment, the target gene encodes the protein which is an insect ortholog of the CG13704 Dm protein, wherein said target gene is represented by SEQ ID NO.388. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.392.
[051] [051] In one embodiment, the target gene encodes the Rpnl2 protein (for example, an insect ortholog of the CG4157 Dm protein), wherein said target gene is represented by SEQ ID NO. 389. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.393 .
[052] [052] According to a second aspect of the invention, a composition for preventing and / or controlling infestation by insect pests is provided, comprising at least one interfering ribonucleic acid (RNA) and at least one suitable carrier, excipient or diluent , where oO
[053] [053] where the RNA comprises at least one silencing element, where the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, where one of these strands comprises Or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9 , 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19 , 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209 , 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 12 4, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 through 229, 127, 148, 136, 230 through 233, 128, 149, 184, 137, 185, 234 through 237, 302 to 305, 129, 138, 238 to
[054] [054] The composition of the invention can be used for the prevention and / or control of pest infestation. In certain embodiments, the composition can be used as a pesticide for a plant or for plant propagating OR reproductive material. In another aspect, a combination is provided here for the prevention and / or control of pest infestation comprising the composition of the invention and at least one other active agent.
[055] [055] In another aspect, a method of downregulating the expression of a target gene in an insect pest species is provided here to prevent and / or control pest infestation, which comprises contacting said pest species with an effective amount of at least one interfering ribonucleic acid (RNA), in which the interfering RNA functions by uptake by the pest to negatively regulate the expression of a target gene in said pest, in which the RNA comprises at least one silencing element, in which the silencing element is a double-stranded RNA region comprising hybridized complementary strands, one of which strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene
[056] [056] According to another aspect of the invention, an isolated polynucleotide selected from the group consisting of: (i) a polynucleotide comprising at least 21, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 contiguous nucleotides of a nucleotide sequence represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123 , 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184 , 137, 185, 234 to
[057] [057] The amino acid sequences encoded by the target genes of the present invention are represented by SEQ ID NOs 79, 349, 405, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87 to 91, 330, 350, 353, 331, 351, 332 to 336, 337, 354, 338 to 344, 346, 345, 347, 348, 357, 355, 358, 390 to 393, respectively.
[058] [058] In a particular aspect of the invention, the isolated polynucleotide is part of an interfering RNA molecule, typically part of the silencing element, comprising —at least a double strand region comprising a hybridized sense RNA strand by complementary base pairing , with an antisense RNA strand, wherein the sense strand of the dsRNA molecule comprises a nucleotide sequence complementary to a nucleotide sequence located in the RNA transcript of the target gene. More in particular, the isolated polynucleotide is cloned into a DNA construct in a sense and antisense orientation so that, by transcription of the sense and antisense polynucleotide, a dsRNA molecule is formed, which works by uptake by a pest to inhibit or regulate negatively the expression of a target gene in said pest.
[059] [059] In one embodiment, the present invention relates to an isolated polynucleotide that is cloned into a DNA construct in a sense and antisense orientation so that, by transcription of the sense and antisense polynucleotide, a dsRNA molecule is formed, which works by uptake by an insect to inhibit or downregulate the expression of a target gene in the troponin / myofilament complex.
[060] [060] In one embodiment, the target gene encodes an insect "wings up" protein (troponin 1) (for example, an insect ortholog of the CG7178 Dm protein), wherein said target gene is represented by SEQ ID NOs 1, 2, 174, 404, 175, 180, 181, 188 and 189. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or more of SEQ ID NOs. 79, 349, 405, 352 or 356.
[061] [061] In one embodiment, the target gene encodes an "upheld" protein (for example, an insect ortholog of the CG7107 Dm protein), wherein said target gene is represented by SEQ ID NOs 121, 130, 142, 143, 176, 177, 182 and 183. In a preferred embodiment, the insect orthologist has at least 85%, 90%,
[062] [062] In one embodiment, the target gene encodes the tropomyosin 1 protein (for example, a CG4898 Dm insect orthologist), or the tropomyosin 2 protein (for example, a CG4843 Dm insect orthologist), where said target gene is represented by SEQ ID NOs 123 and 132. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity of amino acid sequences with SEQ ID NO. 332.
[063] [063] In one embodiment, the target gene encodes the myosin heavy chain (for example, an insect ortholog of the CG17927 Dm protein), wherein said target gene is represented by SEQ ID NOs 122, 131, 144, 145, 178 and 179. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or more SEQ ID NOs. 331 or 351.
[064] [064] In one embodiment, the target gene encodes the cytoplasmic protein of the myosin light chain (for example, an insect orthologist of the CG3201 Dm protein), where said target gene is represented by SEQ ID NOs 124 and 133. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 333.
[065] [065] In one embodiment, the target gene encodes the "spaghetti squash" protein (for example, an insect orthologist of the CcG3595 Dm protein), where said target gene is represented by SEQ ID NOs 125 and 134. In one preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity with SEQ ID NO. 334.
[066] [066] In one embodiment, the target gene encodes the zipper protein (for example, an insect ortholog of the CG15792 Dm protein), wherein said target gene is represented by SEQ ID NOs 126 and 135. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% identity with SEQ ID NO. 335.
[067] [067] In one embodiment, the target gene encodes troponin C (for example, a CG2981, CG7930 CcG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 or CG6514 Dm insect orthologist), wherein said gene target is represented by SEQ ID NOs 127 and 136, or 128 and 137, or 184 and 185. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98% , 99% or 100% identity of amino acid sequences with one or more of SEQ ID NOs. 336, 337 and 354.
[068] [068] According to other modalities, the present invention relates to an isolated polynucleotide that is cloned into a DNA construct in a sense and antisense orientation so that, by transcription of the sense and antisense polynucleotide, a molecule of dsRNA, which functions by uptake by an insect to inhibit or downregulate the expression of a target gene encoding an insect ribosomal protein.
[069] [069] In one embodiment, the target gene encodes the ribosomal protein S3A (for example, an insect ortholog of the CG2168 Dm protein), wherein said target gene is represented by SEQ ID NOs 11, 12 and 141. In one embodiment Preferred, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or both SEQ ID NOs. 84 or 328.
[070] [070] In one embodiment, the target gene encodes the ribosomal protein LPl (for example, an insect ortholog of the CG4087 Dm protein), wherein said target gene is represented by SEQ ID NO 3 and 4. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.80.
[071] [071] In one embodiment, the target gene encodes the ribosomal protein S3 (for example, an insect ortholog of the CG6779 Dm protein), wherein said target gene is represented by SEQ ID NOs 7 and 8. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.82.
[072] [072] In one embodiment, the target gene encodes the ribosomal protein L10Ab (for example, an insect ortholog of the CG7283 Dm protein) represented by SEQ ID NOs 9 and 10. In a preferred embodiment, the insect orthologist has at least 85 %, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.
[073] [073] In one embodiment, the target gene encodes the ribosomal protein S18 (for example, an insect orthologist of the CG8900 Dm protein), wherein said target gene is represented by SEQ ID NOs 13 and 14. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.85.
[074] [074] In one embodiment, the target gene encodes the ribosomal protein L4 (e.g., a CG5502 Dm protein insect orthologist), wherein said target gene is represented by SEQ ID NO 5 and 6. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.81.
[075] [075] In one embodiment, the target gene encodes the ribosomal protein S27 (for example, an insect ortholog of the CG10423 Dm protein), wherein said target gene is represented by SEQ ID NOs 15 and 16, 204 and 205. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with one or both of SEQ ID NOs.86 and 359.
[076] [076] In one embodiment, the target gene encodes the L6 ribosomal protein (for example, an insect ortholog of the CGl11522 Dm protein), wherein said target gene is represented by SEQ ID NO 17 and 18. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 87.
[077] [077] In one embodiment, the target gene encodes the ribosomal protein S13 (e.g., an insect ortholog of the CG13389 Dm protein), wherein said target gene is represented by SEQ ID NO 19 and 20. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 88.
[078] [078] In one embodiment, the target gene encodes the ribosomal protein L12 (e.g., an insect ortholog of the CG3195 Dm protein), wherein said target gene is represented by SEQ ID NOs 21 and 22. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.89.
[079] [079] In one embodiment, the target gene encodes the ribosomal protein L26 (for example, an insect ortholog of the CG6846 Dm protein), wherein said target gene is represented by SEQ ID NOs 158 and 159. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 343.
[080] [080] In one embodiment, the target gene encodes the ribosomal protein L21 (for example, an insect ortholog of the CG12775 Dm protein), wherein said target gene is represented by SEQ ID NO 165, 166 and 167. In one embodiment preferred, the insect orthologist has at least
[081] [081] In one embodiment, the target gene encodes the ribosomal protein S12 (for example, an insect ortholog of the CGl1271 Dm protein), wherein said target gene is represented by SEQ ID NOs 156 and 157. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 342.
[082] [082] In one embodiment, the target gene encodes the ribosomal protein S28b (for example, an insect ortholog of the CG2998 Dm protein), wherein said target gene is represented by SEQ ID NOs 160 and 161. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 344.
[083] [083] In one embodiment, the target gene encodes the ribosomal protein L13 (e.g., an insect ortholog of the CG4651 Dm protein), wherein said target gene is represented by SEQ ID NOs 154 and 155. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 341.
[084] [084] In one embodiment, the target gene encodes the ribosomal protein L10 (for example, an insect ortholog of the CG17521 Dm protein), wherein said target gene is represented by SEQ ID NOs 163 and 164. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 345.
[085] [085] In one embodiment, the target gene encodes the ribosomal protein L5 (for example, an insect ortholog of the CG17489 Dm protein), wherein said target gene is represented by SEQ ID NOs 152 and 153. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 340.
[086] [086] In one embodiment, the target gene encodes the ribosomal protein S15Aa (for example, an insect ortholog of the CG2033 Dm protein), wherein said target gene is represented by SEQ ID NOs 150 and 151. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO. 339.
[087] [087] In one embodiment, the target gene encodes the ribosomal protein L19 (e.g., an insect ortholog of the CG2746 Dm protein), wherein said target gene is represented by SEQ ID NOs. 200 and 201. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO .357.
[088] [088] In one embodiment, the target gene encodes the ribosomal protein L27 (e.g., an insect ortholog of the CG4759 Dm protein), wherein said target gene is represented by SEQ ID NO. 386. In a preferred embodiment, the insect orthologist has at least 85%, 90%, 92%, 94%, 96%, 98%, 99% or 100% amino acid sequence identity with SEQ ID NO.390 .
[089] [089] Preferably, the methods of the invention have practical application in preventing and / or controlling infestation by insect pests, in particular, infestation control, by insect pests, of crop plants such as but not limited to cotton , potato, rice, strawberries, alfalfa, soy, tomato, canola, sunflower, sorghum, millet, corn, eggplant, pepper and tobacco. In addition, the interfering RNA of the invention can be introduced into plants to be protected by routine genetic engineering techniques.
[090] [090] In all aspects of the invention, in preferred embodiments, the target gene (1) is selected from the group of genes having a nucleotide sequence comprising any of the
[091] [091] These target genes encode proteins in the troponin / myofilament complex.
[092] [092] In all aspects of the invention, in preferred embodiments, the target gene (1) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs. 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70,
[093] [093] These target genes encode ribosomal insect proteins.
[094] [094] In all aspects of the invention, in preferred embodiments, the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, or its complement, or having a nucleotide sequence so that when the two sequences are optimally aligned and compared, it is at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189 , 27 to 30, 282 to 285, 294 to 297, 310 to 313, or its complement, or
[095] [095] Table 1 New targets of Lygus hesperus identified from the first screening.
[096] [096] Table 1B New targets of Lygus hesperus in the Lh594 pathway.
[097] [097] Table 1C New targets of Lygus hesperus identified from second round screening.
[098] [098] Table 2 Polynucleotide sequences of target genes identified in Lygus hesperus.
[099] [099] Table 3 Amino acid sequences of target genes identified in Lygus hesperus.
[0100] [0100] Table 4 dsRNAs (sense strand represented by the equivalent DNA sequence) corresponding to target genes of Lygus hesperus and "primers" for the production of dsRNAs.
[0101] [0101] Table 5 Classification of Lygus hesperus targets according to dose response curves (CRDs) and comparison with reference targets Lh423 and Lhl105.
[0102] [0102] Table 6 Classification of Lygus hesperus targets from second round screening according to CRDs and comparison with reference targets Lh423 and Lh594.
[0103] [0103] Table 7 Polynucleotide sequences of target genes identified in Colorado potato beetle (BBC).
[0104] [0104] Table 8 Amino acid sequences of target genes identified in BBC.
[0105] [0105] Table 9 dsRNAs (sense strand represented by the equivalent DNA sequence) corresponding to BBC target genes and "primers" for the production of dsRNAs.
[0106] [0106] Table 10 Polynucleotide sequences of target genes identified in brown cicadela (CM).
[0107] [0107] Table 11 Amino acid sequences of target genes identified in CM.
[0108] [0108] Table 12 dsRNAs (sense strand represented by the equivalent DNA sequence) corresponding to CM target genes and "primers" for the production of dsRNAs.
[0109] [0109] Table 13 "Primers" used for amplification of aphid cDNAs, based on the genomic sequence of the pea aphid.
[0110] [0110] Table 14 Polynucleotide sequences of target genes identified in aphids.
[0111] [0111] Table 15 Amino acid sequences of target genes identified in aphids.
[0112] [0112] Table 16 dsRNAs (sense strand represented by the equivalent DNA sequence) corresponding to aphid target genes and primers for the production of dsRNAs.
[0113] [0113] Table 17 Degenerate primers used for BBC Ld594 cDNA amplification
[0114] [0114] Table 18 Degenerate primers used for the amplification of CM cDNAs
[0115] [0115] Table 19: New targets for Leptinotarsa decemlineata from screening.
[0116] [0116] Table 20: New identified target of Nilaparvata lugens.
[0117] [0117] Table 21: New targets identified for Acyrthosiphon pisum.
[0118] [0118] Figure 1: Lh001 009 plates from the second confirmation test. Dark bars: mortality on days 3 to 6, light bars: mortality on days 6 to 8. Candidate clones are named using the “Lygxxx” tracking codes and “Lhxxx” target nomenclature codes.
[0119] [0119] Figure 2: Lh010 020 plates from the second confirmation test. Dark bars: mortality on days 3 to 6, light bars: mortality on days 6 to 8. Candidate clones are named using the “Lygxxx” tracking codes and “LhxXxX” target nomenclature codes.
[0120] [0120] Figure 3: Analysis of the mortality of new Lygus targets from plates Lh001 to Lh009, expressed as% of mortality over a period of 10 days. The controls are indicated in dotted lines. Positive control: Lh423 dsRNA (RpL19). Negative controls: GFP dsRNA and diet only (Control).
[0121] [0121] Figure 4: Analysis of the mortality of new Lygus targets from plates Lh010 to Lh020, expressed as% of mortality over a period of 10 days. The controls are indicated in dotted lines. Positive control: Lh423 (RpLl9). Negative controls: GFP and diet only (Control).
[0122] [0122] Figures 5 to 9 New targets of Lygus hesperus - dose response curves to concentrations of purified synthetic dAsRNA ranging from 0.4 to 0.025 u1ug / uLl (the figure “vg / VL” is not shown in the figure). GFP dsRNA and milliQ water were used as negative controls. dsRNA targets were produced using primers as described in example section 1.1.
[0123] [0123] Figure 10 Lh594 dose response curve, to dsRNA concentrations ranging from 0.05 to 0.001 uvg / pVL. GFP dAsRNA and milliq water were used as negative controls.
[0124] [0124] Figure 11 dAsRNA Activity in the Lygus hesperus bioassay in the absence of tRNA. Lh594 (5 µg / µL); positive control: Lh423 (5 pg / ulL); negative controls: GFP dAsRNA (5 vg / ul) and millio water; B Identification of the Lh594 activity limit using decreasing concentrations of dsRNA (from 5 pg to 0.25 pg). Negative controls: GFP dsRNA (5 µg / pL) and millium water.
[0125] [0125] Figure 12 Plates Lh010 to Lh020 of the second target confirmation test of the second scan. Dark bars: mortality on days 4 to 8, light bars: mortality on days 4 to 6. Candidate clones are named using the “Lygxxx” tracking codes and “Lhxxx” target nomenclature codes.
[0126] [0126] Figure 13 Test results for targets of the Lygus troponin pathway, tested at 0.5 µg / µl fixed.
[0127] [0127] Figures 14 AB New targets of the Lygus hesperus troponin pathway - dose response curves to concentrations of purified synthetic dAsRNA ranging from 0.4 to 0.025 vp9 / pWL (the figure “ug / uL is not always shown in the figure ”). GFP dsRNA and milliQ water were used as negative controls.
[0128] [0128] Figures 15 A-D New target targets for the second screening of Lygus hesperus - dose response curves to concentrations of purified synthetic dsRNA ranging from 0.5 to 0.05 pg / pL. GFP dsRNA and milliQ water were used as negative controls.
[0129] [0129] Figure 16 Survival analysis of BBC larvae treated with 1 pg of Ld594, Ld619 and Ld620 dsRNA. Positive controls included 1 µg of dsRNA from reference targets Ld513 and Ld049. Negative controls included milliQ and FP water.
[0130] [0130] Figure 17 Effects of Ld594, Ld619 and Ld620 dsRNAs on pupils of BBC 4th instar larvae, compared to untreated control (CNT). The stink bugs were fed with 1 µg of dsRNA distributed in potato leaf discs, then they were allowed to feed on untreated potato leaves (A) for 4 days before being placed in vermiculite. To assess the effect of dsRNA, dead insects were excavated from the vermiculite (due to the strong effects induced by dsRNA of Ld594, it was not possible to recover any pupae from the vermiculite and thus
[0131] [0131] Figure 18 Effect of BBC Ld594, 619 and 620 dsRNAs on the survival and physical condition of BBC adults. The evaluations were carried out on days 4, 6, 7, 8, 11 and 13. Control MO: millio water.
[0132] [0132] Figure 19 Activity of dsRNA of the N1594 pathway in brown cicadela. DSsRNAs were tested at 0.5 p9g / pL in the presence of 0.1% CHAPSO. Positive control: N1537 dsRNA (0.5 vg / uL), negative controls: GFP dsRNA (0.5 ug / uLl and diet only.
[0133] [0133] Figure 20 Ap594, Ap423, Ap537 and Ap560 dsRNA activity in A. pisum. DsSRNAs were tested at 0.5 unug / phl in the presence of 5 µg / µl tRNA. Negative control: GFP dsRNA (0.5 µg / µL).
[0134] [0134] Figure 21 Mortality percentages of L. decemlineata larvae in an artificial diet treated with dsRNA. Ld583, Ld584, Ld586 and Ld588 represent target clones. Positive control: Ld513; negative control: FP.
[0135] [0135] The present inventors have found that down-regulation of the expression of particular target genes in insect pest species by RNAi can be used to prevent and / or effectively control infestation by said insect pest.
[0136] [0136] As used here, the term "pest infestation control" refers to any effect on a pest that serves to limit and / or reduce the number of pest organisms and / or the damage caused by the pest. As a result, preferred target genes are essential genes that control or regulate one or more essential biological functions in insect pests, for example, cell division, reproduction, energy metabolism, digestion, neurological function and the like. Negative regulation of these essential genes by RNAi techniques can lead to the death of the insect, or significantly slow growth and development or weaken the pest's ability to colonize an environment or infest host organisms.
[0137] [0137] The present inventors have now identified superior target genes from insect pest species belonging to the genera Lygus, Leptinotarsa, Nilaparvata and Acyrthosiphum, whose targets are intended to be used alone or in combination as an effective means of control, mediated by RNAi, from infestation by insects, for example, of agronomically important crops. Orthologists of these newly identified target genes can be used in other insect species to control pest infestation of the corresponding relevant crops.
[0138] [0138] More specifically, the present inventors describe here that genes encoding troponin / myofilament complex proteins form excellent target genes for suppression by RNA inhibition machinery. One of these target genes encoded the insect protein troponin I ("wings up" A) which is an ortholog of the Drosophila CG7178 protein. This protein is involved in muscle contraction and belongs to a physiological pathway that has not yet been fully explored to control pests (insects) by inhibiting RNA. In addition, since this protein complex is specific to animals, plant gene homologues or orthologs are not known, reducing the risk of plant phenotypes of different types than those predicted when expressing target dsRNA in plants. Additionally, in Drosophila, troponin IL is described as a haplo-insufficient gene, exhibiting a mutant phenotype in the heterozygous state. Such genes are particularly susceptible to reduced levels of mRNA expression and, as such, can be considered ideal targets for RNAi.
[0139] [0139] Other interesting target genes in this troponin / myofilament complex are listed below.
[0140] [0140] Thus, according to one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest , where the RNA comprises at least one silencing element, where theThe silencing element is a region of double-stranded RNA comprising complementary hybridized strands, where one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene
[0141] [0141] In a preferred embodiment, the target gene encodes an insect protein chosen from the troponin / myofilament complex chosen from the group comprising troponin I (for example, an insect orthologist of the CG7178 Dm protein), the "upheld" protein ( for example, an insect orthologist of the CG7107 Dm protein), the tropomyosin 1 protein
[0142] [0142] In other embodiments, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and wherein the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs. 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, or its complement, or having a nucleotide sequence so that when the two sequences are optimally aligned and compared, it is at least 75%, preferably at least 80% , 85%, 90%, 95%, 98% or 99% identical to any of SEQ ID NOs. 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, or its complement, or
[0143] [0143] In a preferred embodiment, the target gene encodes an insect ribosomal protein chosen from the group comprising the ribosomal protein S3A (for example, an insect ortholog of the CG2168 Dm protein), the ribosomal protein LPl (for example, an insect of the CG4087 Dm protein), the S3 ribosomal protein (for example, a CG6779 Dm protein insect orthologist), the L10Ab ribosomal protein (for example, a CG7283 Dm protein insect orthologist), the S18 ribosomal protein (for example , a CG8900 Dm insect orthologist), the L4 ribosomal protein (for example, a CG5502 Dm insect orthologist), the S27 ribosomal protein (for example, a CG10423 Dm insect orthologist), the ribosomal protein L6 (for example, a CG11522 Dm protein insect orthologist), the S13 ribosomal protein (for example, a CG13389 Dm insect orthologist), and the L12 ribosomal protein (for example, a CG3195 Dm insect orthologist) ), the r protein ibossomal L26 (for example, an insect ortholog of the CG6846 Dm protein), the ribosomal protein L21 (for example, an insect ortholog of the CG1l2775 Dm protein), the ribosomal protein S12 (for example, an insect ortholog of the CGl1271 Dm protein ), the ribosomal protein S28b (for example, an insect ortholog of the CG2998 Dm protein), the ribosomal protein L13 (for example, an insect ortholog of the CG4651 Dm protein), the ribosomal protein L10 (for example, an insect orthologist of the CG17521 Dm protein), the L5 ribosomal protein (for example, a CG17489 Dm insect orthologist), the S15Aa ribosomal protein (for example, a CG2033 Dm insect orthologist), the L19 ribosomal protein (for example, an insect ortholog of the CG2746 Dm protein), the ribosomal protein L27 (e.g., an insect ortholog of the CG4759 Dm protein).
[0144] [0144] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene (1) is selected from the group of genes having a nucleotide sequence comprising any of the
[0145] [0145] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene (1) is selected from the group of genes having a nucleotide sequence comprising any of the
[0146] [0146] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene
[0147] [0147] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene (1) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 19, 20, or its complement, or having a nucleotide sequence so that , when the two sequences are optimally aligned and compared, it is at least 75%, preferably at least 80%, 85%, 90%, 95% 98% or 99% identical to any of SEQ ID NOs 1 9, 20, or its complement, or
[0148] [0148] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene
[0149] [0149] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene
[0150] [0150] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene
[0151] [0151] In one embodiment, the present invention relates to an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a region of double stranded RNA comprising complementary hybridized strands, wherein one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a nucleotide sequence target in the target gene, and where the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 128, 149, 184, 137, or its complement, or having a sequence of nucleotides so that when the two sequences are optimally aligned and compared, it is at least 75%, preferably at least 80%, 85%, 90%, 95%, 98% or 99% identical to any of the s SEQ ID NOs 128, 149, 184, 137, or its complement, or (ii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from either
[0152] [0152] In still other embodiments, the present invention relates to an interfering ribonucleic acid (RNA or double-stranded RNA) that inhibits or downregulates the expression of a target gene encoding a mitochondrial cytochrome c oxidase subunit II protein (for example, an insect orthologist of the CG34069 Dm protein).
[0153] [0153] Thus, in one aspect, the invention provides an interfering ribonucleic acid (RNA) that functions by uptake by a species of insect pest to negatively regulate the expression of a target gene in said insect pest.
[0154] [0154] As used here, a "target gene" comprises any insect pest gene that is intended to downregulate.
[0155] [0155] Target genes can be expressed in all or some of the cells of the insect pest. In addition, the target genes can be expressed by the insect pest only at a particular stage in its life cycle, for example, the mature adult phase, the immature nymph or larvae phase or the egg phase.
[0156] [0156] As used here, species of "pests" are preferably species of insects that cause infection or infestation, preferably of plants. Insect species can comprise species belonging to the Orders Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera, or Siphonaptera.
[0157] [0157] Preferred pathogenic plant insects according to the invention are plant pests selected from the group consisting of Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Laodelphax spp. (for example, L. striatellus (small brown cicada)); Nephotettix spp. (for example, N. virescens or N. cincticeps (green leafhopper), or N.nigropictus (rice flea)); Sogatella spp. (for example, S. furcifera (white-backed cicada)); Chilo spp. (for example, C. suppressalis (streaked rice stem borer), C. auricilius (golden-rimmed stem borer), or C. polychrysus (dark-headed stem borer)); Sesamia spp. (for example, S. inferens (pink rice borer)); Tryporyza Spp. (for example, T. innotata (white rice borer), or T. incertulas (yellow rice borer)); Anthonomus spp. (for example, A. grandis (cotton capsule weevil)); Phaedon spp. (for example, P. cochleariae (mustard leaf beetle)); Epilachna spp. (for example, E. varivetis (Mexican bean beetle)); Tribolium spp. (for example, T. castaneum (brown beetle)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm), D. virgifera zeae ( Mexican corn rootworm); Ostrinia spp. (eg O. nubilalis (European corn borer)); Anaphothrips spp. (eg A. obscrurus (grass thrips)); Pectinophora spp. (eg , P. gossypiella (pink caterpillar)); Heliothis spp. (For example, H. virescens (apple caterpillar)); Trialeurodes spp. (For example, T. abutiloneus (white-winged fly),
[0158] [0158] According to a more specific modality,
[0159] [0159] According to a more specific modality,
[0160] [0160] A plant to be used in the methods of the invention, or a transgenic plant according to the invention, covers any plant, but is preferably a plant that is susceptible to infestation by a pathogenic plant insect.
[0161] [0161] Accordingly, the present invention extends to plants and methods as described here, wherein the plant is chosen from the following group of plants (or crops): alfalfa, apple, apricot, artichoke, asparagus, avocado, banana , barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, carrot, cassava, cauliflower, a cereal, celery, cherry, citrus, clementine, coffee, corn, cotton, eggplant, endive, eucalyptus, figs, grapes, grapefruit, mendubis, English tomato, kiwi, lettuce, leek, lemon, lime, pine, maize, mango, melon, millet, mushroom, oat grain, okra, onion, orange, an ornamental plant or flower or tree, papaya, parsley, pea, peach, peanut, peat, pepper, persimmon, pineapple, plantain, plum, pomegranate, potato, pumpkin, chicory, radish, raspberry rapeseed, rice, rye, sorghum, soy, beans soy, spinach, strawberry, sugar beet, sugar cane, sunflower, sweet potato, mandarin, tea, tobacco, tomato, a vine, watermelon, wheat, yams and courgette.
[0162] [0162] In specific embodiments, the present invention provides target genes that encode proteins involved in the function of a "wings up" A (troponin LI), a mitochondrial cytochrome c oxidase subunit II protein, or one of the ribosomal proteins specified in the Table 1.
[0163] [0163] In preferred embodiments, the present invention provides target genes selected from the group of genes (i) having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189 , 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 up to 46, 141, 11, 12, 47 up to 50, 13, 14, 51 up to 54, 15, 204, 16, 205, 55 up to 58, 322 up to 325, 17, 18, 59 up to 62, 19, 20, 63 up to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289 , 298 through 301, 145, 122,
[0164] [0164] and wherein the nucleotide sequence of said gene is no more than 10,000, 9000, 8000, 7000, 6000, 5000, 4000, 3000, 2000 or 1500 nucleotides.
[0165] [0165] The amino acid sequences encoded by the target genes of the present invention are represented by SEQ ID NOs. 79, 349, 405, 352, 356, 80, 326, 81, 327, 82, 83, 328, 84, 329, 85, 86, 359, 87 through 91, 330, 350, 353, 331, 351, 332 through 336, 337, 354, 338 to 344, 346, 345, 347, 348, 357, 355, 358, 390 to 393.
[0166] [0166] As used here, the term "possessing" has the same meaning as "comprising".
[0167] [0167] As used here, the term "sequence identity" is used to describe the sequence relationship between two or more nucleotide or amino acid sequences. The percentage of “sequence identity” between two sequences is determined by comparing two sequences optimally aligned in a comparison window (a defined number of positions), in which the portion of the sequence in the comparison window. it can comprise additions or deletions (that is, spacing) compared to the reference sequence to achieve optimal alignment. The percentage of sequence identity is calculated by determining the number of positions where the nucleotide base or identical amino acid residue occurs in both sequences to obtain the number of * corresponding 'positions, dividing the number of corresponding positions by the total number of positions in the comparison window and multiplying the result by 100. Methods and "software" for determining the identity of strings are available in the area and include Blast software and GAP analysis. For nucleic acids, the percentage of identity is calculated preferably by the BlastN alignment tool, so that the percentage of identity is calculated over the entire length of the search nucleotide sequence.
[0168] [0168] The practitioner will recognize that homologues or orthologs (homologues existing in different species) of the target genes represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 can be identified up to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46 , 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66 , 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147 , 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 up to 245, 152, 153, 246 up to 249, 154, 155, 250 up to 253, 156, 157, 254 up to 257, 158, 159, 258 up to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 until 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388,
[0169] [0169] Other homologues are genes that are alleles of a gene comprising a sequence represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175 181, 189, 27 to 30, 282 to 285, 294 up to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 up to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70 , 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144 , 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229 , 127, 148, 136, 230 through 233,
[0170] [0170] The 'interfering ribonucleic acid (RNA)' of the present invention encompasses any type of RNA molecule capable of downregulating or 'silencing'! the expression of a target gene, including but not limited to sense RNA, antisense RNA, small interfering RNA (SiRNA), microRNA (miRNA), double-stranded RNA (dsRNA), clamp RNA (RNA) and the like. Assessment methods for functional interfering RNA molecules are well known in the art and are disclosed here elsewhere.
[0171] [0171] The interfering RNA molecules of the present invention effect sequence-specific down regulation of the expression of a target gene by binding to a target nucleotide sequence in the target gene. Linkage occurs due to base pairing between complementary regions of the interfering RNA and the target nucleotide sequence. As used herein, the term 'silencing element' refers to the portion or region of the interfering RNA comprising or consisting of a nucleotide sequence that is complementary, or at least partially complementary, to a target nucleotide sequence in the target gene, and that it acts as the active portion of the interfering RNA to direct the down regulation of the expression of said target gene. In an embodiment of the invention, the silencing element comprises or consists of a sequence of at least 17 contiguous nucleotides, preferably at least 18 or 19 contiguous nucleotides, more preferably at least 21 contiguous nucleotides, still more preferably at least 22, 23, 24 or 25 contiguous nucleotides complementary to a target nucleotide sequence in the target gene.
[0172] [0172] As used here, "expression of a target gene" refers to the transcription and accumulation of the RNA transcript encoded by a target gene and / or translation of the mRNA into protein. The term 'downregulate' is intended to refer to any of the methods known in the art by which interfering RNA molecules reduce the level of primary RNA, mRNA or protein transcripts produced from a target gene. In certain embodiments, negative regulation refers to a situation in which the level of RNA or protein produced from a gene is reduced by at least 10%, preferably by at least 33%, more preferably by at least 50%, still more preferably at least 80%. In particularly preferred embodiments, downregulation refers to a reduction in the level of RNA or protein produced from a gene by at least 80%, preferably at least 90%, more preferably at least 95%, and most preferably at at least 99% in insect pest cells compared to an appropriate control insect pest that, for example, has not been exposed to an interfering RNA or has been exposed to an interfering control RNA molecule. Methods of detecting reductions in RNA or protein levels are well known in the art and include hybridization of RNA in solution, "Northern" hybridization, reverse transcription (eg, quantitative RT-PCR analysis), microseries analysis, antibody binding , enzyme linked immunosorbent assay (ELISA) and "Western" staining. In another embodiment of the invention, downregulation refers to a reduction in levels of RNA or proteins sufficient to cause a detectable change in a pest phenotype compared to an appropriate pest control, for example, cell death, growth cessation, or the like. Thus, negative regulation can be measured by phenotypic analysis of the insect pest using routine techniques in the area.
[0173] [0173] In a preferred embodiment of the invention, the interfering RNA downregulates gene expression by RNA or RNAi interference.
[0174] [0174] Longer double-stranded RNA (AsRNA) molecules comprising one or more functional double-stranded silencing elements, as described here elsewhere, and capable of RNAi-mediated genetic silencing are also contemplated within the scope of the present invention. Such longer dsRNA molecules comprise at least 80, 200, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 pairs of bases. These dsRNA molecules can serve as precursors to the active siRNA molecules that direct the RNA transcript to the RISC complex for subsequent degradation. DsRNA molecules present in the environment surrounding an organism or its cells can be captured by the organism and processed by an enzyme called Dicer to give rise to siRNA molecules. Alternatively, the dsRNA can be produced in vivo, that is, transcribed from a polynucleotide or polynucleotides encoding the same present in a cell, for example, a bacterial cell or a plant cell, and subsequently processed by Dicer in the host cell or preferably in insect pest cells after uptake of the longer dsRNA precursor. The dsRNA can be formed from two separate strands (sense and antisense) of RNA that hybridize due to the pairing of complementary bases. Alternatively, the dsRNA can consist of a single strand that is capable of folding back on itself to form a clamp RNA (RNA) or stem-loop structure. In the case of an RNA, the double stranded region or 'stem' is formed from two regions or segments of the RNA that are essentially inverted repeats of each other and have sufficient complementarity to allow the formation of a double stranded region. One or more functional double-stranded muffler elements may be present in this 'rod region' of the molecule. The regions of inverted repeats are typically separated by a region or segment of the RNA called the 'loop' region. This region can comprise any nucleotide sequence giving “sufficient flexibility to allow the occurrence of self-matching between complementary flanking regions of the RNA. In general, the loop region is substantially single-stranded and acts as a spacer between inverted repetitions.
[0175] [0175] All interfering RNA molecules of the invention effect negative, sequence-specific regulation of the expression of a target gene by binding to a target nucleotide sequence in the target gene. Connection occurs due to the pairing of complementary bases between the silencing element of the interfering RNA and the target nucleotide sequence.
[0176] [0176] or (iii) a polynucleotide comprising at least 21, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450,
[0177] [0177] or (v) a polynucleotide consisting of a fragment of at least 21, preferably at least 22, 23 or 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 contiguous nucleotides of a nucleotide sequence represented in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 at is 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153 , 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167 , 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386 , 387, 388, 389, or its complement, and wherein said fragment or said complement has a nucleotide sequence which, when said fragment is optimally aligned and compared with the corresponding fragment in any of the SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204,
[0178] [0178] Preferably, the interfering RNA molecules of the present invention comprise at least one double stranded region, typically the interfering RNA silencing element, comprising a sense hybridized RNA strand by pairing complementary bases with an RNA strand antisense, wherein the sense strand of the dsRNA molecule comprises a nucleotide sequence complementary to a nucleotide sequence located in the RNA transcript of the target gene.
[0179] [0179] The silencing element, or at least one of its strands when the silencing element has a double stripe, can be totally complementary or partially complementary to the target nucleotide sequence of the target gene.
[0180] [0180] It will be appreciated by the professional that the degree of complementarity shared between the silencing element and the target nucleotide sequence may vary, depending on the target gene to be down-regulated or depending on the species of insect pest whose gene expression is intended to be controlled .
[0181] [0181] In another embodiment of the present invention, theThe silencing element comprises a nucleotide sequence that is the RNA equivalent of any of the polynucleotides selected from the group consisting of a polynucleotide comprising at least 21, preferably at least 22, 23, 24 , 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350 , 400, 450, 500, 550, 600, 700, 800, 900, 1000, 1100 or 1115 contiguous nucleotides of a nucleotide sequence represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175 , 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9 , 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204,
[0182] [0182] The target nucleotide sequence can be selected from any suitable region or nucleotide sequence of the target gene or its RNA transcript. For example, the target nucleotide sequence may be located at the 5 '"UTR or 3'UTR of the target gene or transcript of
[0183] [0183] The practitioner will be aware of methods for identifying the most appropriate target nucleotide sequences in the context of the complete target gene. For example, multiple silencing elements targeting different regions of the target gene can be synthesized and tested. Alternatively, digestion of the RNA transcript with enzymes such as RNAse H can be used to determine RNA sites that are in a conformation susceptible to genetic silencing. Target sites can also be identified using in silico approaches, for example, using computational algorithms designed to predict the effectiveness of genetic silencing based on the approach of different sites in the complete gene.
[0184] [0184] The interfering RNAs of the present invention can comprise a silencing element or multiple silencing elements, wherein each silencing element comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in a target gene and that it works by uptake by a species of insect pest to negatively regulate the expression of that target gene. Such concatemeric RNA constructions are described in WO2006 / 046148, incorporated herein by reference. In the context of the present invention, the term multiple ”means at least two, at least three, at least four, etc., and up to at least 10, 15, 20 or at least 30. In one embodiment, the interfering RNA comprises multiple copies of a single silencing element, that is, repetitions of a silencing element that bind to a particular target nucleotide sequence in a specific target gene. In another embodiment, the silencing elements in the interfering RNA comprise or consist of different nucleotide sequences complementary to different target nucleotide sequences. It should be clear that combinations of multiple copies of the same silencing element combined with silencing elements binding to different target nucleotide sequences are within the scope of the present invention.
[0185] [0185] The different target nucleotide sequences may originate from a single target gene in an insect pest species to achieve improved down regulation of a specific target gene in an insect pest species. In that case, the silencing elements can be combined into the interfering RNA in the original order in which the target nucleotide sequences occur in the target gene, or the silencing elements can be mixed and matched randomly in any hierarchical order in the context of the interfering RNA compared to order of the target nucleotide sequences in the target gene.
[0186] [0186] Alternatively, the different target nucleotide sequences represent a single target gene but originate from different species of insect pests.
[0187] [0187] Alternatively, different target nucleotide sequences may originate from different target genes. If it is intended to use interfering RNA to prevent and / or control pest infestation, it is preferred that the different target genes are chosen from the group of genes that regulate essential biological functions of insect pest species, including but not limited to survival , growth, development, reproduction and pathogenicity. Target genes can regulate the same or different biological pathways or processes. In one embodiment, at least one of the silencing elements comprises or consists of a sequence of nucleotides that is at least partially complementary to a sequence of target nucleotides in a target gene, wherein the target gene is selected from the group of genes previously described.
[0188] [0188] In another embodiment of the invention, the different genes addressed by the different silencing elements originate from the same species of insect pest. This approach is designed to achieve an increased attack against a single species of insect pest. In particular, the different target genes can be differentially expressed at different stages of the insect's life cycle, for example, the stages of mature adults, immature larvae and eggs. Thus, the interfering RNA of the invention can be used to prevent and / or control infestation by insect pests at more than one stage of the insect's life cycle.
[0189] [0189] In an alternative embodiment of the invention, the different genes addressed by the different silencing elements originate from different species of insect pests. Thus, the interfering RNA of the invention can be used to prevent and / or control infestation by more than one species of insect pest simultaneously.
[0190] [0190] the silencing elements can be arranged in the form of a contiguous region of the interfering RNA or they can be separated by the presence of linker sequences. The linker sequence can comprise a small random nucleotide sequence that is not complementary to any target nucleotide sequences or target genes. In one embodiment, the linker is a conditional self-cleaving RNA sequence, preferably a pH-sensitive linker or a linker sensitive to hydrophobic conditions. In one embodiment, the linker comprises a nucleotide sequence equivalent to an intronic sequence. The length of linker sequences of the present invention can vary from about 1 base pair to about 10,000 base pairs, as long as the linker does not weaken the interfering RNA's ability to downregulate the expression of target gene (s).
[0191] [0191] In addition to the silencing element (s) and any linker sequences, the interfering RNA of the invention can comprise “at least one additional polynucleotide sequence. In different embodiments of the invention, the additional sequence is chosen from (i) a sequence capable of protecting the interfering RNA against RNA processing, (ii) a sequence that affects the stability of the interfering RNA, (iii) a sequence that allows binding of proteins, for example, to facilitate the uptake of interfering RNA by cells of the insect pest species, (iv) a sequence that facilitates large-scale production of the interfering RNA, (v) a sequence that is an aptamer that binds to a receptor or molecule on the surface of insect pest cells to facilitate uptake, or (v) a sequence that catalyzes the processing of interfering RNA in insect pest cells and thereby increases the effectiveness of interfering RNA . Structures for increasing the stability of RNA molecules are well known in the art and are further described in WO2006 / 046148, incorporated herein by reference.
[0192] [0192] It is necessary that the length of the interfering RNA of the invention be sufficient for the uptake by cells of a species of insect pest and down regulation of target genes in the pest, as described here elsewhere. However, the upper length limit may depend on (i) the requirement that the interfering RNA be collected by pest cells and (ii) the requirement that the interfering RNA be processed in the pest cells to mediate genetic silencing by via RNAi. The length can also be dictated by the production method and the formulation for distribution of interfering RNA in cells. Preferably, the interfering RNA of the present invention will be between 21 and 10,000 nucleotides in length, preferably between 50 and 5000 nucleotides or between 100 and 2500 nucleotides, more preferably between 80 and 2000 nucleotides.
[0193] [0193] The interfering RNA can contain bases of DNA, unnatural bases or unnatural linkages of the main chain or modifications of the main chain of sugar-phosphate, for example, to increase the stability during the storage or to increase the resistance to degradation by nucleases . In addition, the interfering RNA can be produced chemically or enzymatically by the professional through manual or automated reactions. Alternatively, the interfering RNA can be transcribed from a polynucleotide that encodes it. Thus, an isolated polynucleotide encoding any of the interfering RNAs of the present invention is provided herein.
[0194] [0194] Also provided here is an isolated polynucleotide selected from the group consisting of (1) a polynucleotide comprising at least 21, preferably at least 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 , 45, 50, 55, 60, 70, 80, 90, 100, 110, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600, 700, 800, 900 , 1000, 1100, 1200, 1300, 1400, 1500, 2000 or 3000 contiguous nucleotides of a nucleotide sequence represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 up to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 until
[0195] [0195] In preferred embodiments, the isolated polynucleotide is part of an interfering RNA molecule, typically part of the silencing element, comprising at least one double strand region comprising a hybridized sense RNA strand, by pairing complementary bases, with a strand antisense RNA, wherein the sense strand of the dsRNA molecule comprises a nucleotide sequence complementary to a nucleotide sequence located in the RNA transcript of the target gene. As a result, the dsRNA sense strand is able to hybridize to the RNA transcript and direct the RNA for degradation in the RNAi or RISC-induced silencing complex.
[0196] [0196] The polynucleotides of the invention can be inserted, via routine molecular cloning techniques, into DNA constructs or vectors known in the art. Accordingly, according to one embodiment, a DNA construct comprising any of the polynucleotides of the present invention is provided. Preferably, a DNA construct comprising a polynucleotide encoding at least one of the interfering RNAs of the present invention is provided here. The DNA construct can be a recombinant DNA vector, for example, a bacterial, viral or yeast vector. In a preferred embodiment of the invention, the DNA construct is an expression construct and the polynucleotide is operably linked to at least one regulatory sequence capable of driving expression of the polynucleotide sequence. The term 'regulatory sequence! ” it must be taken in a broad context and is intended - to refer to any nucleotide sequence capable of expressing polynucleotides to which it is operably linked, including but not limited to promoters, enhancers and other elements that activate naturally occurring transcription or synthetic. The regulatory sequence can be located at the 5º or 3 ”end of the polynucleotide sequence. the term * operably linked ”refers to a functional link between the regulatory sequence and the polynucleotide sequence so that the regulatory sequence leads to the expression of the polynucleotide. Operably linked elements can be contiguous or non-contiguous.
[0197] [0197] Preferably, the regulatory sequence is a promoter selected from the group comprising but not limited to constitutive promoters, inducible promoters, tissue-specific promoters and stage-specific growth / development promoters. In one embodiment, the polynucleotide is placed under the control of a strong constitutive promoter, such as anyone selected from the group comprising the CaMV35S promoter, duplicated CaMV35S promoter, ubiquitin promoter, actin promoter, rubisco promoter, GOS2 promoter, promoter of the mosaic virus of Escrofulária 348.
[0198] [0198] Optionally, one or more transcription termination sequences can be incorporated into the expression construct of the invention. The term 'transcription termination sequence' encompasses a control sequence at the end of a transcription unit that signals transcription termination, 3 'processing and polyadenylation of a primary transcript. Additional regulatory sequences, including but not limited to transcription or translation enhancers, can be incorporated into the expression construct, for example, as with the enhanced CaMV35S double promoter.
[0199] [0199] The present invention also encompasses a method for generating any of the interfering RNAs of the invention, which comprises the steps of (i) contacting a polynucleotide encoding said interfering RNA or a DNA construct comprising components devoid of cells; or (ii) introducing (for example, by transformation, transfection or injection) a polynucleotide encoding said interfering RNA or a DNA construct comprising it in a cell.
[0200] [0200] Thus, the invention also relates to any double-stranded ribonucleotide produced from the expression of a polynucleotide described here.
[0201] [0201] Accordingly, a host cell transformed with any of the polynucleotides described here is also provided here. The present invention also encompasses host cells comprising any of the interfering RNA's of the present invention, any of the polynucleotides of the present invention or a DNA construct comprising them. The host cell can be a prokaryotic cell, including but not limited to gram-positive and gram-negative bacterial cells, or a eukaryotic cell, including but not limited to yeast cells or plant cells. Preferably, said host cell is a bacterial cell or a plant cell. The bacterial cell can be chosen from the group comprising but not limited to Gram positive and Gram negative cells comprising Escherichia spp.
[0202] [0202] Preferably, the interfering RNAs of the invention are expressed in host cells of a plant. Preferred plants of interest include but are not limited to cotton, potatoes, rice, tomatoes, canola, soy, sunflower, sorghum, millet, corn, alfalfa, strawberries, eggplant, pepper and tobacco.
[0203] [0203] In situations where the interfering RNA is expressed in a host cell and / or is used to prevent and / or control pest infestation of a host organism, it is preferred that the interfering RNA does not exhibit significant 'off-target' effects , that is, that the interfering RNA does not affect the expression of genes in the host. Preferably, the silencing element does not exhibit significant complementarity with nucleotide sequences other than the intended target nucleotide sequence of the target gene. In one embodiment of the invention, the silencing element exhibits less than 30%, more preferably less than 20%, more preferably less than 10% and even more preferably less than 5% sequence identity with any gene in the host cell or organism. If genomic sequence data is available for the host organism, it is possible to cross-check the identity with the silencing element using common bioinformatics tools. In one embodiment, there is no sequence identity between the silencing element and a host cell gene or host organism over a region of 17, more preferably over a region of 18 or 19, and most preferably over a region of 20 or 21 contiguous nucleotides.
[0204] [0204] In the practical application of the invention, the interfering RNAs of the invention can be used for the prevention and / or control of any insect pest belonging to the Orders Coleoptera, Lepidoptera, Diptera, Dichyoptera,
[0205] [0205] Furthermore, according to another aspect of the invention, a composition for preventing and / or controlling infestation by insect pests is provided here, comprising at least one interfering ribonucleic acid (RNA) and, optionally, at least one suitable carrier, excipient or diluent, in which the interfering RNA functions by uptake by the pest to negatively regulate the expression of a target gene in said pest. The interfering RNA can be any of those disclosed here elsewhere. Preferably, the interfering RNA comprises or consists of at least one silencing element, and said silencing element is a region of double-stranded RNA comprising complementary hybridized strands, wherein one such strand (the sense strand) comprises a sequence of nucleotides that it is at least partially complementary to a target nucleotide sequence in a target gene. The 'target gene' can be any of the target pest genes disclosed here elsewhere, including but not limited to genes involved in the regulation of pest survival, growth, development, reproduction and pathogenicity. Alternatively, the composition comprises at least one host cell comprising at least one interfering RNA molecule or DNA construct encoding it and, optionally, at least one suitable carrier, excipient or diluent, in which the interfering RNA acts by cell uptake host by the insect pest to negatively regulate the expression of a target gene in that pest.
[0206] [0206] In the practical application of the invention, the composition can be used for the prevention and / or control of any insect pest belonging to the Orders Coleoptera, Lepidoptera, Diptera, Dichyoptera, Orthoptera, Hemiptera and Siphonaptera. Accordingly, the composition can be in any form suitable for application to insect pests or for application to substrates and / or organisms, in particular plants, susceptible to infestation by said insect pest. In one embodiment, the composition is intended for use in the prevention and / or control of infestation, by pests, plants or plant propagation or reproductive material and, thus, is aimed at species of insect pests that infest plants. The composition of the present invention is particularly effective when the insect pest belongs to the category of 'chewing' insects, which cause considerable damage to plants by eating plant tissues, such as roots, leaves, flowers, buds, branches and the like. Examples of this large category of insects include beetles and their larvae.
[0207] [0207] The composition of the invention can be used to control insect pests at all stages of their life cycle, for example, the mature adult stage, the larvae and egg stages.
[0208] [0208] In the context of the composition of the invention, the interfering RNA can be produced from a DNA construct, in particular an expression construct, as described here elsewhere, comprising a polynucleotide that encodes it. In preferred embodiments, the interfering RNA can be produced within a host cell or organism engineered to express said interfering RNA from a polynucleotide encoding it.
[0209] [0209] Host organisms suitable for use in the compositions of the present invention include but are not limited to microorganisms known to colonize the environment on and / or around the plants or crops of interest, i.e., plants or crops susceptible to infestation by species of insect pests. Such microorganisms include, but are not limited to, those occupying the phylloplane (the surface of plant leaves) and / or the rhizosphere (the soil surrounding the plant roots). These microorganisms are selected in order to be able to successfully compete with any wild type organisms present in the plant environment. Microorganisms suitable for use as hosts include various species of bacteria, algae and fungi. Of course, the chosen microorganisms must not be toxic to plants. Such compositions applied to plants susceptible to infestation by species of insect pests will be ingested by insect pests feeding on the treated plants.
[0210] [0210] Host organisms that naturally do not colonize plants and / or their environment are also within the scope of the present invention. Such organisms can serve only as a means to generate the interfering RNA of the composition. For example, in one embodiment, the interfering RNA is fermented / produced in a bacterial host and the bacteria are subsequently inactivated / killed. The resulting bacteria can be processed and used as an insecticidal spray in the same way that strains of Bacillus thuringiensis have been used as an insecticide for spray application. In certain embodiments, an extract or bacterial lysate can be suitably purified to obtain an extract containing substantially pure interfering RNA, which is subsequently formulated into one of the compositions of the invention. Common extraction / purification techniques will be known to the practitioner.
[0211] [0211] The compositions of the invention can be in any physical form suitable for application to insects. For example, the composition can be in solid form (powder, pellet or bait), liquid form (including a form administered as an insecticidal spray) or gel form. In a specific embodiment, the composition can be a coating, paste or powder that can be applied to a substrate to protect that substrate from insect infestation. In this embodiment, the composition can be used to protect any substrate or material that is susceptible to infestation or damage caused by an insect.
[0212] [0212] The nature of the excipients and the physical form of the composition may vary, depending on the nature of the substrate that is desired to be treated. For example, the composition can be a liquid that is brushed or sprayed on or printed on the material or substrate to be treated, or a coating or powder that is applied to the material or substrate to be treated.
[0213] [0213] In one embodiment, the composition is in the form of a bait. The bait is designed to trick the insect into contact with the composition. Upon contact, the composition is then internalized by the insect, through ingestion, for example, and mediates RNAi to thereby kill the insect. Such bait may comprise a food substance, such as a protein-based food, for example, fish meal. Boric acid can also be used as bait. The bait may depend on the species to be approached. A decoy can also be used. The decoy can be a pheromone, such as a male or female pheromone, for example. As an example, the pheromones described in the book "Insect Pheremones and their use in Pest Management" (Howse et al, Chapman and Hall, 1998) can be used in the invention. The decoy acts to elude the insect into the bait, and can be designed for a particular insect or can attract a whole range of insects. The bait can be in any suitable form, such as a solid, paste, pellet or powder form.
[0214] [0214] The bait can also be taken by the insect back to the colony. The bait can then act as a food source for other members of the colony, thereby providing effective control of a large number of insects and potentially an entire insect pest colony. This is an advantage associated with the use of the double-stranded RNA of the invention, since the delayed action of RNAi-mediated effects on pests allows the bait to be transported back to the colony, thereby providing maximum impact in terms of exposure to insects .
[0215] [0215] Additionally, compositions that come into contact with insects can remain on the insect's cuticle. During cleaning procedures, from an individual insect cleaning itself or insects cleaning each other, the compositions can be ingested and thus can mediate their effects on the insect. This requires that the composition be sufficiently stable so that the interfering RNA remains intact and capable of mediating RNAi even when exposed to external environmental conditions for a period of time, which can be a period of days, for example.
[0216] [0216] The baits can be provided in a suitable "compartment" or "trap". Such compartments and traps are available on the market, and existing traps can be adapted to include the compositions of the invention. Any compartment or trap that can attract an insect to enter it is included in the scope of the invention. The compartment or trap can be shaped like a box, for example, and can be provided in a preformed state or can be formed of folding cardboard, for example. Suitable materials for a compartment or trap include plastics and cardboard, particularly corrugated cardboard. Suitable dimensions for this compartment or trap are, for example, 77-15 cm wide, 15-20 cm long and 1-5 cm high. The internal surfaces of the traps can be coated with a sticky substance, to restrict the movement of the insect after being inside the trap. The compartment or trap can contain a suitable depression whose interior can keep the bait in place. A trap is distinct from a compartment in that the insect cannot easily abandon a trap once it has entered, whereas a compartment acts as a "nutrition station" that endows the insect with a preferred environment where it can feed and feel be safe from predators.
[0217] [0217] Accordingly, in another aspect, the invention provides an insect compartment or trap that contains a composition of the invention, which can incorporate any of the characteristics of the composition described here.
[0218] [0218] In another alternative embodiment, the composition can be provided in the form of a spray. Thus, a human user can spray the pest directly with the composition. The composition is then internalized by the insect, from where it can mediate RNA interference, thereby controlling the insect. Preferably, the spray is a pressurized / aerosolized spray or a pump spray. The particles can be of a suitable size in order to adhere to the insect, for example, to the exoskeleton, and can be absorbed therefrom. The particle size can be measured by known means, such as using a Mastersizer, which is a commercially available device.
[0219] [0219] In yet another modality, the carrier is a powder or particle with an electrostatic charge that adheres to the insect. Suitable powders and particles that are able to adhere to an insect and thus distribute the RNA constructs of the invention are described in detail in WO 94/00980 and WO 97/33472, both of which are incorporated herein by reference.
[0220] [0220] Alternatively, the carrier may comprise magnetic particles that adhere to the insect's cuticle. Suitable magnetic particles that are able to adhere to an insect and thus distribute the RNA constructs of the invention are described in detail in WO 00/01236, the reference of which is incorporated herein.
[0221] [0221] In yet another embodiment, the carrier of the composition comprises metallic particles that are not initially magnetized but that can be magnetically polarized when subjected to the electric field provided by the insect's body. This mode of action is described in detail in WO 2004/049807 and is incorporated herein by reference.
[0222] [0222] Preferably, the composition incorporates a carrier that increases the uptake of interfering RNA by the insect pest. Such a carrier may be a lipid-based carrier, preferably comprising one or more of oil-in-water emulsions, mycelia, cholesterol, lipopolyamines and liposomes. Other agents that promote uptake of the constructs of the invention are well known to those skilled in the art and include polycations, dextrans and cationic lipids (tris), such as CS096, CS102, etc. Liposomes available on the market include LIPOFECTINO and CELLFECTINGO, etc. Some suitable carriers are listed in the section "Transfection promoting agent" in WO 03/004644, and each of the examples provided is incorporated herein by reference.
[0223] [0223] In another preferred embodiment, the carrier is a nucleic acid condensing agent. Preferably, the nucleic acid condensing agent comprises spermidine or protamine sulfate or a derivative thereof.
[0224] [0224] When the composition of the invention is intended for use in preventing and / or controlling infestation of a plant by pests, the composition may contain an agriculturally suitable carrier. Such a carrier can be any material that the plant to be treated can tolerate, which does not cause undue damage to the environment or other organisms present there and which allows the interfering RNA to remain effective against insect pest species. In particular, the compositions of the invention can be formulated for distribution to plants in accordance with routine agricultural practices used in the bioinsecticide industry. The composition may contain other components capable of performing other functions, including but not limited to (1) enhancing or promoting uptake of interfering RNA by pest cells and (ii) stabilizing the active components of the composition. Specific examples of these additional “components contained in the composition comprising the interfering RNA are yeast tRNA or total yeast RNA.
[0225] [0225] The compositions can be formulated for direct application or in the form of a concentration of a primary composition that requires dilution before use. Alternatively, the composition may be provided in the form of a kit comprising the interfering RNA, or the host cell comprising or expressing it, in a container and the suitable diluent or carrier for the RNA or host cell in a separate container. In the practical application of the invention, the composition can be applied to a plant or any part of a plant at any stage of the plant's development. In one embodiment, the composition is applied to the aerial parts of a plant, for example, when growing plant crops in a field. In another embodiment, the composition is applied to the seeds of a plant while they are stored or as soon as they are planted in the soil. It is generally important to obtain good pest control in the early stages of plant growth, as this is the time when the plant can be most severely damaged by pest species.
[0226] [0226] The composition can be applied to the environment of an insect pest by various techniques, including but not limited to spraying, atomizing, dusty, spreading, spilling, seed coating, seed treatment, introduction into the soil, and introduction into irrigation water. In the treatment of plants susceptible to infestation by pests, the composition can be distributed on the plant or part of a plant before the appearance of the pest (for preventive purposes), or after signs of infestation by the pest have begun to appear (for the purpose of control the pest).
[0227] [0227] In another embodiment of the invention, the compositions of the invention can be formulated so as to contain at least one other active agent. Thus, the composition may be provided in the form of a "kit consisting of parts", comprising the composition containing the interfering RNA in a container and one or more suitable active ingredients, for example, a chemical or biological pesticide, in a separate container . Alternatively, the compositions can be provided in the form of mixtures that are stable and intended to be used in conjunction with each other.
[0228] [0228] Suitable active ingredients that can act in a complementary manner with the interfering RNA molecules of the present invention include but are not limited to the following: Chlorpyrifos, Alethrin, Resmethrin, Tetrabromoethyl, Dimethol-cyclopropane carboxylic acid (which are generally included in compositions net); and Hydramethylnon, Avermectin, Chlorpyrides, Sulfuramide, Hydroprene, Fipronil (GABA receptor), Isopropylphenyl methyl carbide, Indoxacarb (PARA), Noviflumuron (inhibitor of chitin synthesis), Imiprotine (PARA), Abamutin-dependent Glamutine ), Imidacloprid (Acetylcholine receptor) (which are usually included in bait compositions).
[0229] [0229] In a preferred embodiment, it is known that the active ingredient is a preferred insecticide in terms of health and environmental considerations, such as, for example,
[0230] [0230] In another embodiment of the invention, the composition is formulated to contain at least one other agronomic agent, for example, an additional herbicide or pesticide. As used herein, a 'second pesticide' or 'additional pesticide' refers to a pesticide other than the original first interfering RNA molecule or molecule of the composition. Alternatively, the composition of the invention can be delivered in combination with at least another agent agronomic, for example, a herbicide or a second pesticide In one embodiment, the composition is provided in combination with a herbicide selected from anyone known in the art, for example glyphosate, imidazolinone, sulfonylurea and bromoxynil. is provided in combination with at least one additional pesticide The additional pesticide may be selected from any pesticides known in the art and / or may comprise an interfering ribonucleic acid that functions by pest uptake to downregulate the expression of a target gene in said In one embodiment, the target pest is a species of insect pest and the interfering RNA is selected from any of the interfering RNAs described here. In another embodiment, the additional pesticide comprises an interfering RNA that works to downregulate the expression of a known gene in any target pest species, not limited to insect pests.
[0231] [0231] The different components of the combinations described here can be administered, for example, to a host organism susceptible to infestation by a pest, in any order. The components can be distributed simultaneously or sequentially in the area or organism to be treated.
[0232] [0232] A method of preventing and / or controlling infestation by pests is also provided here, comprising contacting a species of insect pest with an effective amount of at least one interfering RNA, in which the RNA functions by capturing the said pest to down-regulate the expression of an essential target gene of the pest. The essential target gene can be any pest gene involved in regulating an essential biological process required by the pest to initiate or maintain infestation, including but not limited to survival,
[0233] [0233] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides of any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297 or 310 to 313 , or its complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran or dipteran insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi
[0234] [0234] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297 or 310 to 313 , or its complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran or dipteran insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi
[0235] [0235] wherein the orthologous genes encode a protein having an amino acid sequence that is at least 85%, 90%, 92%, 94%, 96%, 98%, 99% identical to the amino acid sequence shown in any of the SEQ ID NOs 79, 349, 405, 352 or 356 (when said encoded proteins are optimally aligned).
[0236] [0236] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 141, 11, 12, 47 through 50, or their complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral insect , lepidopteran or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm).
[0237] [0237] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 141, 11, 12, 47 through 50, or their complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral insect , lepidopteran or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm), where orthologous genes encode a protein having an amino acid sequence that is at least 85%, 90%, 92%, 94%, 96%, 98%, 99% identical to the amino acids shown in either SEQ ID NOs 328 or 84 (when said encoded proteins are optimally aligned).
[0238] [0238] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 17 18, 59 through 62, or their complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm).
[0239] [0239] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 17, 18, 59 to 62, or its complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran insect or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle),
[0240] [0240] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 19, 20, 63 to 66, or its complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran insect or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm).
[0241] [0241] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 19, 20, 63 to 66, or its complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran insect or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm), where orthologous genes encode a protein having an amino acid sequence that is at least 85%, 90%, 92%, 94%, 96%, 98%, 99% identical to the amino acids shown in SEQ ID NO 88 (when said encoded proteins are optimally aligned).
[0242] [0242] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 165, 167, 166, 270 through 273, or their complement, can be used to downregulate the expression of the orthologous target gene in a coleopteran, hemipteral insect , lepidopteran or diptera chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (e.g., D.
[0243] [0243] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, or their complement, can be used to negatively regulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran or dipteran insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm).
[0244] [0244] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that is complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, or their complement, can be used to negatively regulate the expression of the orthologous target gene in a coleopteran, hemipteral, lepidopteran or dipteran insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm),
[0245] [0245] wherein the orthologous genes encode a protein having an amino acid sequence that is at least 85%, 90%, 92%, 94%, 96%, 98%, 99% identical to the amino acid sequence shown in any of the
[0246] [0246] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, or their complement, can be used to downregulate expression of the orthologous target gene in a coleopteran, hemiptera, lepidopteran or diptera insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm).
[0247] [0247] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, or their complement, can be used to downregulate expression of the orthologous target gene in a coleopteran, hemiptera, lepidopteran or diptera insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. Vvirgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae
[0248] [0248] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, one of which strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 128, 149, 184, 137, 185, 234 through 237, 302 through 305, or their complement, can be used to downregulate gene expression orthologous target in a coleopteran, hemipteral, lepidopteran or diptera insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae
[0249] [0249] In the methods described here to downregulate the expression of a target gene in a species of insect pest, double-stranded RNA molecules comprising at least 21 base pairs, where one of these strands comprises or consists of a sequence of nucleotides that are complementary to at least 21 contiguous nucleotides in any of SEQ ID NOs 128, 149, 184, 137, 185, 234 through 237, 302 through 305, or their complement, can be used to downregulate gene expression orthologous target in a coleopteran, hemipteral, lepidopteran or diptera insect chosen from the group comprising but not limited to Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm) or D. virgifera zeae ( Mexico's corn rootworm), where orthologous genes encode a protein having an amino acid sequence that is at least 85%, 90%, 92%, 94%, 96%, 98%, 99% identical to the amino acids shown in any of SEQ ID NOs 337 or 354 (when said encoded proteins are optimally aligned).
[0250] [0250] Furthermore, a method is provided here to prevent and / or control infestation by insect pests in a field of crop plants, wherein said method comprises expressing in said plants an effective amount of an interfering RNA as described herein .
[0251] [0251] When the method is intended to control pest infestation, the phrase 'effective amount! extends to the amount or concentration of interfering RNA required to produce a phenotypic effect on the pest, so that the number of pest organisms that infest a host organism is reduced and / or the amount of damage caused by the pest is reduced. In one embodiment, the phenotypic effect is death from the pest and the interfering RNA is used to reach at least 20%, 30%, 40%, preferably at least 50%, 60%, 70%, more preferably at least
[0252] [0252] As used here, the term 'plant' can include any reproductive or propagating material for a plant. The reference to a plant may also include plant cells, plant protoplasts, plant tissue cultures, plant calluses, plant strains and plant cells that are intact in plants or parts of plants, such as embryos, pollen, eggs, seeds, leaves,
[0253] [0253] The use of interfering ribonucleic acid (RNA) as described herein is also provided here or the construction of DNA as described here for the prevention and / or control of insect pest infestation, preferably plant pest infestation.
[0254] [0254] The invention will be further understood with reference to the following non-limiting examples.
[0255] [0255] Example 1 Identification of target genes in insect pest species
[0256] [0256] Nucleic acids were isolated from Lygus hesperus nymphs at different stages of life, including newborn nymphs, 2, 4, 6 and 9 day old nymphs and adults. A cDNA library was prepared using the SMARTer PCR cDNA Synthesis Kit, following the manufacturer's instructions (Clontech Catalog No. 634925). The cDNA library was standardized using the Trimmer kit (Evrogen Catalog No. NKOO01) and was cloned into PCR4- vector
[0257] [0257] To generate the dsRNA, fragments of sense and antisense DNA, containing the T7 promoter sequence, were generated by PCR. In summary, per clone, 1 μl of bacterial suspension was distributed on multi-well PCR plates containing REDTag & (Sigma Catalog No. D4309) and primers oGCC2738 (SEQ ID NO 93: AAGCAGTGGTATCAACGCAG) and oGCC2739 (SEQ ID NO 94: GCGTAATACGACTCAGGGGA ) based on the sequences M2 and T7-M2, respectively. The PCR reaction was followed by in vitro transcription, in which, per clone, 6 ul of PCR product was added to 9 ul of T7 RiboMAX Large Scale RNA Production System "(Promega Catalog No. P1300) and the system was incubated overnight at 37 º C. The final dsRNA solution was diluted 2 times in L. hesperus sucrose diet, containing 15% sucrose and 5 ug / npL of yeast tRNA (Invitrogen Catalog No. 15401-029), and was used for screening The dsRNA corresponding to the positive control clone Lh423 is SEQ ID NO 101 and the one corresponding to the negative control clone FP is SEQ ID NO 104 (see Table 4).
[0258] [0258] A new screening test has been developed for potent targets of Lygus hesperus. The assay set up was as follows: each well on a 96-well plate houses a one-day-old L. hesperus nymph exposed to a paraffin sachet containing sucrose diet, which includes test dsRNA or control dsRNA in the presence of tRNA. Each plate contained dsRNA from 90 different clones, 3 x Lh423 (positive control) and 3 x FP (fluorescent protein; negative control). Each clone (test dsRNA) was replicated on three plates. After three days of exposure, the number of surviving nymphs was recorded and the diet was replaced by a fresh (complex) production diet in the absence of dsRNA. Mortality was assessed on days 4, 6 and 8. An identical set-up was used for the first and second round confirmation tests, with 8 and 20 insects, respectively, with one nymph per well.
[0259] [0259] The assay system was validated using dsRNA corresponding to the Lh423 target as a positive control and a fluorescent protein dsRNA as a negative control: more than 90% were true positives and less than 5% were false positives, respectively.
[0260] [0260] Twenty 96-well plates, called Lh00l1 to Lh020 (see the bottom line in Figures 1 and 2), were tested, containing 1800 individual clones. 205 candidates were identified and tested in a first confirmation trial. Setting the limit at exhibiting 250% mortality, 41 independent clones were identified and moved on to a second confirmation round. In the assay, the clones were compared with the positive controls Lh423 (RpLl19) and Lhl05.2 (Sec23) and the negative control Pt (encoding a coral fluorescent protein). The dsRNA corresponding to the positive control clone (Lh423) is SEQ ID NO 101, the one corresponding to the positive control clone Lhl105.2 is SEQ ID NO 102 and the one corresponding to the negative control clone (Pt) is SEQ
[0261] [0261] Second round confirmatory assays, testing 20 test insects / dsRNA, were initiated for all test dsRNAs exhibiting 250% mortality at first confirmation (Figures l1 and 2). Target candidates corresponding to confirmed test dsRNAs were assigned an “Lhxxx number” (see Table 1). Using the same limit at 250% mortality, 15 targets were confirmed at the first screening.
[0262] [0262] A second scan was performed to identify more targets of Lygus hesperus. The results of the second round confirmatory assays are shown in Figure 12. Using the same limit at 250% mortality, several targets were confirmed in the second screening (see Table 1 C).
[0263] [0263] Parallel to the insect confirmation assays, the inserts corresponding to the positive clones were sequenced and searches for BlastX were used against the Drosophila and Tribolium protein databases to confirm the targets' identity. Table 1 provides a summary of the bioinformatics analysis and current annotation of the sequences of the new L. hesperus targets identified.
[0264] [0264] Fifteen new L. hesperus targets were identified in the first scan and 11 new L. Hesperus targets were identified in the second scan. All targets exhibited high potency against L. hesperus nymphs indicating that cDNAs encoding double-stranded RNAs contained therein are essential for pest survival and thus represent target genes of interest for the purpose of pest control. Therefore, the DNA sequences and deduced amino acid sequences from these target genes have been determined and are provided in Tables 2 and 3, respectively.
[0265] [0265] Lh594, the orthogon of Lygus hesperus of troponin I of Drosophila, involved in muscle contraction - and consequently absent in plants -, represents a new class of targets belonging to a specific physiological pathway of animals not yet explored for GM-RNAi. In the fruit fly, troponin I is described as a haplo-insufficient gene, exhibiting a mutant phenotype in the heterozygous state. Such genes can be particularly susceptible to reduced levels of mRNA expression and, as such, can be considered ideal targets for RNAi.
[0266] [0266] In this Lh594 path, eight targets were selected (see Table 1B). For each target, up to 4 pairs of degenerate PCR primers were planned based on the sequence alignments of various insects, including bee, Tribolium and aphid. Primers are used to amplify target fragments of Lygus hesperus. The DNA sequences and amino acid sequences deduced from these target genes have been determined and are provided in Tables 2 and 3, respectively.
[0267] [0267] Table 1: New targets of Lygus hesperus classified as% of mortality according to the results of the second confirmation test (first screening).
[0268] [0268] Table 1B: New targets of Lygus hesperus in the Lh594 path. Best (s) Target ID | SYMBOL lacquer (s) Drosophila troponina T | up Lh619 | cG7107 Ciupheld ") Lh620 | cG17927 heavy chain a and myosin Lh621 CG4843 2 (Tm2) cytoplasmic of | Mlc-c Lh622 CcG3201 myosin light chain Lh623 CcG3595 "spaguetti squash" Lh624 [ce15792 * CG2981, CG7930 Lh625, CG9073, CG6514 | troponin C, CG12408 * CG9073, CG7T940 C 8, CG6514
[0269] [0269] * not clear: multiple hits in the family - classified according to value and
[0270] [0270] Table 1C: New targets of Lygus hesperus classified as% of mortality according to the results of the second confirmation test (second screening).
[0271] [0271] To clone the complete cDNA, starting from a known clone of the internal fragment of the most potent targets, the 5/3 ”RACE kit (Roche, Catalog No. 1 734 792; based on Sambrook, J. and Russell, DM) was used . Followed
[0272] [0272] Complete CcDNAS sequences corresponding to the targets were assembled in VectorNTi, a fully integrated sequence analysis software package for DNA sequence analysis (Invitrogen).
[0273] [0273] Example 2 In vitro production of double stranded RNAs for genetic silencing
[0274] [0274] Double-stranded RNA was synthesized in milligram quantities. First, two separate models of T7 5 'RNA polymerase promoters (a sense model and an antisense model) were generated by PCR. The PCRs were designed and performed in order to produce sense and antisense model polynucleotides, each with the T7 promoter in a different orientation relative to the target sequence to be transcribed.
[0275] [0275] For each of the target genes, the sense model was generated using a direct T7 primer specific to the target and a reverse primer specific to the target. The antisense models were generated using target specific forward primers and target specific reverse T7 primers. The sequences of the respective primers to amplify the sense and antisense models via PCR for each of the target genes are provided in Table 4. The PCR products were analyzed by agarose gel electrophoresis and were purified. The resulting sense and antisense T7 models were mixed and transcribed by the addition of T7 RNA polymerase. The single-stranded RNAs produced by transcription of the models were allowed to hybridize, were treated with DNase and RNase, and were purified by precipitation. The sense strand of the resulting dsRNA produced from each of the target genes is provided in Table 4.
[0276] [0276] To allow classification according to potency, in vitro dsRNAs corresponding to the new targets were synthesized and applied to L. hesperus in 10-day survival analysis bioassays. In summary, one-day-old L. hesperus nymphs were placed in 96-well plates with sucrose seals containing 0.5 nvg / pL of target dsRNA, supplemented with 5 µg / puL of yeast tRNA. The plates were incubated for 3 days under normal conditions of Lygus production. On days 3, 6 and 8, the diet seals were refreshed with seals containing only Lygus diet. Lh423 (RpLl19) was used as a positive control and GFP dsRNA and sucrose diet were used as negative controls.
[0277] [0277] The results of the survival analyzes confirmed the data from the first and second confirmatory tests. Lh594 was established as a highly potent target, with activity and killing speed stronger than the strong control Lh423.
[0278] [0278] To date, Lygus screening for new targets has identified new targets with higher activity or those in the Lh423 positive control range, these include Lh429, Lh594, Lh609, Lh610, Lh611, Lh617 and Lh618. The mortality induced by these targets is shown in Figures 3 and 4.
[0279] [0279] To allow a more precise classification of targets according to their activity, dose-response concentration analyzes were performed. The new targets were tested in in vitro assays, with concentrations ranging from 0.4 to 0.025 vg / pL. As a condition, 24 day-old nymphs were tested in 96-well plate assembly, on a sucrose diet supplemented with dsRNA and tRNA transporter. The results are presented as% of survival over a 10-day experiment (Figures 5 to 9) and are summarized in Table 5.
[0280] [0280] Based on the analysis of the concentration curves, the targets were classified by comparison with the reference controls Lh423 and Lh105 (Table 5).
[0281] [0281] Table 5: Classification of new Lygus targets according to CRDs and compared with reference targets Lh423 and Lhl05.
[0282] [0282] The power of Lh594 was additionally confirmed. The effect of this target is clearly observed at least one day before the other targets and the positive reference controls Lhl105 and Lh423. Since Lh594 was highly potent, LD50 was not achieved in the common CRD experiment, with the concentration ranging from 0.4 to 0.025 unug / puLl of dsRNA (Figure 6); thus, the Lh594 experiment was repeated, including lower concentrations ranging from 0.05 to 0.001 µg / yuL of dsRNA (Figure 10). In conclusion, Lh594 activity was observed at a concentration as low as 0.0025 ug / nL and approximately 90% of deaths (corresponding to about 10% survival) were obtained on day 6 with 0.025 pg of dsRNA.
[0283] [0283] To further explore the potency of Lh594 and the role of the tRNA transporter in the RNAi response in Lygus hesperus, additional in vitro nutrition assays were set up in the absence of tRNA transporter. dsRNAs of Lh594, Lh423 (reference control) and GFP (negative control) were produced in vitro, using the standard method. The dsRNAs were purified and tested at 5 µg / µL in the absence of tRNA (Figure 11 A).
[0284] [0284] In the absence of tRNA, targets Lh594 and Lh423 induced high lethality in Lygus nymphs. Since then, the results of this experiment have been reproduced. Target dsRNA was able to induce RNAi-by-nutrition effects in Lygus nymphs in the absence of tRNA.
[0285] [0285] To search for dsRNA activity at lower concentrations in the absence of transporter tRNA, additional experiments were set up using decreasing amounts of dsRNA (Figure 11 B).
[0286] [0286] A similar approach was followed for the Lygus targets that were identified in the second scan. To allow a classification of targets according to their activity, dose-response concentration analyzes were performed. The new targets were tested in in vitro assays, with concentrations ranging from 0.5 to 0.05 unug / uL. As a condition, 24 day-old nymphs were tested in 96-well plate assembly, on a sucrose diet supplemented with dsRNA and tRNA transporter. The results are presented as% of survival over a 9-day experiment (Figures 15 A-D). Lh594 and Lh423 were included in the trial as reference targets. The results are summarized in Table 6. Based on the analysis of the concentration curves, the targets were classified by comparison with the reference control Lh423.
[0287] [0287] Table 6: Classification of new Lygus targets from the second screening according to CRDs and and compared with the reference targets Lh423 and Lh594.
[0288] [0288] Example 3 Troponin pathway screening
[0289] [0289] In order to test the targets of the Troponin pathway, dsRNAs produced in vitro corresponding to Lh619, Lh620, Lh621, Lh622, Lh623, Lh624, Lh625 and Lh626 were synthesized and applied in L. hesperus in 10-year survival analysis bioassays. days. In summary, one-day-old L. hesperus nymphs were placed in 96-well plates with sucrose seals containing 0.5 vg / pL of target dsRNA, supplemented with 5 ug / pL of yeast tRNA. The plates were incubated for 3 days under normal conditions of Lygus production. On days 3, 6 and 8, the diet seals were refreshed with seals containing only Lygus diet. Lh594 (Troponin LI) was used as a positive control and GFP dsRNA and sucrose diet were used as negative controls (Figure 13). Four targets were then included in dose-response curve analyzes in an in vitro assay, with concentrations ranging from 0.4 to 0.025 ug / puL. As a condition, 24 day-old nymphs were tested in 96-well plate assembly, on a sucrose diet supplemented with dsRNA and tRNA transporter. the results are presented as% of survival over a 10-day experiment (Figures 14 A-B).
[0290] [0290] Example 4 Identification of target genes in Leptinotarsa decemlineata 4.1. Leptinotarsa decemlineata standardized cDNA library and preparation of dsRNAs in multiple well plates for screening assays
[0291] [0291] Nucleic acids were isolated from Leptinotarsa decemlineata larvae from different stages. A cDNA library was prepared using the cCcDNA Synthesis Kit by SMARTer PCR "following the manufacturer's instructions (Clontech Catalog No. 634925). The CDNA library was standardized using the Trimmer kit (Evrogen Catalog No. NKO01) and was cloned into PCRO-BLUNTII-TOPOS vector
[0292] [0292] To generate the O dsRNA, fragments of sense and antisense DNA, containing the T7 promoter sequence, were generated by PCR. In summary, per clone, 1 μl of bacterial suspension was distributed on multi-well PCR plates containing REDTag & (Sigma Catalog No. D4309) and primers oGCC2738 (SEQ ID NO 93: AAGCAGTGGTATCAACGCAG) and oGCC2739 (SEQ ID NO 94: GCGTAATACGACTCAGGGGA ) based on the sequences M2 and T7-M2, respectively. The PCR reaction was followed by in vitro transcription, in which, per clone, 6 µl of PCR product was used in a reaction volume of 20 nvVLl containing the transcription reagents provided by the Large-Scale RNA Production System kit - T7 RiboMAX "(Promega Catalog No. P1300) and the system was incubated overnight at 37 ºC. The final dsRNA solution was diluted in sterile Milli-Q water and used for screening. The dsRNA corresponding to the positive control clone Ld513 is SEQ ID NO 400 (see Table 9) and the one corresponding to the negative control clone FP is SEQ ID NO 104 (see Table 4).
[0293] [0293] Each well on a 48-well plate contained 0.5 mL of pretreated artificial diet with a topical coverage of 25 µL (or 1 µg) of the test or control dsRNA. One L2 larva was placed in each well and 3 larvae were tested per clone. BBC survival numbers were assessed on days 4, 7 and 10.
[0294] [0294] In a second bioassay, BBC larvae were fed on a diet treated with topically applied test dsRNA generated from clones derived from a standardized cDNA library. A larva was placed in a well of a 48-well multiplate containing 0.5 mL of pre-diet.
[0295] [0295] The new target sequences of the screening in 5.2. and the target sequences corresponding to the targets of the troponin pathway, orthologous to the Lygus Lh594, Lh619 and Lh620 sequences, were identified in L. decemlineata. The primers that provided relevant cDNA fragments for Ld594 are listed in Table 17. The cDNA sequences and deduced amino acid sequences from these target genes were determined and are provided in Tables T and 9, respectively.
[0296] [0296] dAsRNA was synthesized using the primers provided in Table 9. The sense strand of the resulting dsRNA produced from the target genes is provided in Table 9.
[0297] [0297] synthetic dAsRNAs were produced for the 3 targets, Ld594, Ld619 and Ld620, and were tested in a BBC larval nutrition assay (see Figure 16). A 10-day trial was performed on 48-well plates, on an artificial diet (based on Gelman et al, J Ins Sc, 1: 7, 1-10: "Artificial diets for rearing the Colorado Potato Beetle") supplemented with 1 ug dsRNA / well, with 12 larvae per condition.
[0298] [0298] It was possible to observe a clear effect on the development of the larvae. A second trial was set up to investigate the effect of these dsRNAs during pupation and metamorphosis (see pupation trial below).
[0299] [0299] A BBC pupation trial was set up to investigate the effect of Ld594, Ld619 and Ld620 RNAi silencing during pupation and metamorphosis. Fourth instar larvae were fed with 1 µg of in vitro synthesized dsRNA distributed on a potato leaf disk and then transferred to a box containing fresh untreated potato leaves. Four days later, the surviving insects were placed in vermiculite to allow pupation. The insects treated with Lh594 were slow, smaller and mainly failed to pass the pupation phase. The hatching of pupae was evaluated at the end of the experiment. For the untreated control, 24 larvae became pupae and all hatched in healthy adults. For Ld620, a decrease in the number of larvae progressing to pupation was observed. For the three targets tested, none of the larvae became healthy pupae and none emerged as adults. The dead insects recovered from the vermiculite exhibited varying degrees of deformation (Figure 17).
[0300] [0300] Ld594, Ld619 and Ld620 first appeared to be non-lethal targets in the BBC larvae assay, although a reduction in vitality was clearly observed in insects treated with dsRNA. On the other hand, in the pupation test, the 3 targets induced strong effects and inhibited entry into the pupation and / or metamorphosis phase.
[0301] [0301] To evaluate the activity of Ld594, Ld619 and Ld620 in BBC adults, a leaf disc assay was set up. A potato leaf disk (1.7 cm in diameter) was painted with dsRNA or controls and placed in a 3.5 cm petri dish with an adult beetle. The following day, a freshly treated leaf disk was provided to the insects. On the third day, the adults were transferred to a box containing sufficient fresh, untreated potato leaves to allow the untreated controls to survive. Per treatment, 6 adults were tested and the numbers of surviving and dying insects were counted at regular intervals from day 6 to day
[0302] [0302] Despite the relatively high level of background in the negative control in this particular assay, clear effects were observed for insects that had been exposed to Ld594 or Ld619 dsRNAs (Figure 18).
[0303] [0303] Example 5 Identification of target genes in Nilaparvata lugens
[0304] [0304] New target sequences, corresponding to targets of the Troponin pathway and called N1594 (Troponin IT), N1I619 (Troponin T) and Nl626 (Troponin C), were identified in brown cicadela, Nilaparvata lugens. Orthologous sequences of the Lygus genes, called N1594 (Troponin 1), Nl619 (Troponin T) and Nl625 / 626 (Troponin C), were cloned by PCR with degenerate primers, using CM cDNA as a model. In addition, complete CDNA was identified for N1594, using RACE (see above for method). The PCR system was used
[0305] [0305] The DNA sequences and deduced amino acid sequences from these target genes and from another target gene (N1537) have been determined and are provided in Tables and 11, respectively.
[0306] [0306] dAsRNA was synthesized using the primers provided in Table 12. The sense strand of the resulting dsRNA produced from each of the target genes is provided in Table 12.
[0307] [0307] dAsRNAsS were synthesized and tested in RNAi assays by previously optimized CM nutrition, in the presence of the CHAPSO zwiterionic detergent at 0.1% final concentration. The dsRNAs were tested at 0.5 µg / µL of final concentration. N1537, a potent target in the CM assays, was used as a reference target in the assay. Insect survival was assessed over 9 days.
[0308] [0308] The results of the bioassay showed that, in CM, N1594, N1I619 and Nl626 were also potent targets for RNAi in CM (Figure 19).
[0309] [0309] Example 6 Identification of target genes in Acyrthosiphon pisum
[0310] [0310] New target sequences were identified in aphids and were called Ap423, Ap537, Ap560 and Ap594, following the same nomenclature: "Apxxx", where "AP" corresponds to Acyrthosiphon pisum and "xxx" to the target ID. Primers were planned based on genetic prediction from the public domain in AphidBase (ref: http://www.aphidbase.com/) (Table 13).
[0311] [0311] The DNA sequences and deduced amino acid sequences from these target genes have been determined and are provided in Tables 14 and 15, respectively.
[0312] [0312] dAsRNA was synthesized using the primers provided in Table 16. The sense strand of the resulting dsRNA produced from each of the target genes is provided in Table 16.
[0313] [0313] RNAi for nutrition was tested on Acyrthosiphon pisum (pea aphid) with 4 targets Ap594, Ap423, Ap560, Ap537. The sequences were amplified by PCR using primers designed based on sequence information from the public domain (http://www.aphidbase.com), and CcDNA was prepared from aphids. The synthetic dsRNAs were prepared and tested at a final concentration of 0.5 uvg / uLl in the presence of 5 ug / puL of yeast tRNA in a sucrose diet. Ten neonatal pea aphid nymphs were placed in a small petri dish (32 mm). Fifty microliters of diet (with tRNA and dsRNA) were pipetted over the first layer of parafilm. A second layer of parafilm covered the diet and created a sachet of nutrition where aphids could feed. As a target, five replicates of 10 neonatal nymphs were used. GFP dsRNA was used as a negative control. The diet was refreshed on days 4 and 7 of the trials and survival was assessed (Figure 20).
[0314] [0314] Table 2 Lh594 SEQ IDNO1 Lh610 SEQ ID NO 5 Lh611 SEQ ID NO 7 Lh611 (b) SEQ ID NO 140 Lh598 SEQ ID NO 25 Lh619 (b) SEQ ID NO 142 Lh620 SEQ ID NO 122 Lh620 (b) SEQ ID NO 144 Lh623 (b) SEQ ID NO 146
[0315] [0315] Table 3 Target ID Corresponding amino acid sequence of the cDNA clone represented in Table 2 Lh610 (b) SEQ ID NO 326 Lh618 (b) SEQ ID NO 328 Lh429 (b) SEQ ID NO 329 Lh560 SEQ ID NO 86 Lh620 SEQ ID NO 331 Lh623 SEQ ID NO 334
[0316] [0316] Table 4 dsRNA "Primers" ID: Reverse Direct Target Sense Tape represented by 5723 5723 Equivalent DNA Sequence 523 Lh594 SEQ ID NO 27 | SEQ ID NO | SEQ ID NO 2 SEQ ID NO 29 | 28
[0317] [0317] Table 7 Target ID cDNA sequence (sense strand) 572 3 Ld594 SEQ ID NO 174 Ld594 (b SEQ ID NO 404) Ld619 SEQ ID NO 176 Ld620 SEQ ID NO 178 Ld583 SEQ ID NO 386 Ld584 SEQ ID NO 387 Ld586 SEQ ID NO 388 Ld588 SEQ ID NO 389 Ld513 SEQ ID NO 394
[0318] [0318] Table 8 Target ID Corresponding amino acid sequence of the CcDNA clone represented in Table 9 Ld594 SEQ ID NO 349 Ld594 (b SEQ ID NO 405) Ld619 SEQ ID NO 350 Ld620 SEQ ID NO 351 Ld583 SEQ ID NO 390 Ld584 SEQ ID NO 391 Ld586 SEQ ID NO 392 Ld588 SEQ ID NO 393 Ld513 SEQ ID NO 395
[0319] [0319] Table 9 ID "Primer |" Primers "dsRNA: Reverse sense s" Target represented by Direct Sequences | 5 '- 3' of DNA equivalent 5º 23 5723 Ld594 | SEQ IDISEQ ID NO | SEQ ID NO 175 NO 282 283
[0320] [0320] Table 10 Target ID cDNA sequence (sense strand) 5 '= 3 N1594 SEQ ID NO 180 N1619 SEQ ID NO 182 N1626 SEQ ID NO 184 N1537 SEQ ID NO 186
[0321] [0321] Table 11 Target ID Corresponding amino acid sequence of the cDNA clone represented in Table 12 N1594 SEQ ID NO 352 N1619 SEQ ID NO 353 N1626 SEQ ID NO 354 N1537 SEQ ID NO 355
[0322] [0322] Table 12 dsRNA "Primers" ID: Reverse Direct Target Sense Tape Represented by 5º 3 5723 Equivalent DNA Sequence 5º 23 N1594 SEQ ID NOJSEQ ID NO | SEQ ID NO 181 294 295
[0323] [0323] Table 13 Target | Sequence of | Direct reverse primer sequence
[0324] [0324] Table 14
[0325] [0325] Table 15 Target ID Corresponding amino acid sequence of the cDNA clone represented in Table 16
[0326] [0326] Table 16 ID "Primers" "Primers" dsRNA: Reverse Direct Target Sense Tape represented by 523 5th 43 equivalent DNA sequence 5723 Ap594 SEQ ID NO] | SEQ ID NO | SEG ID NO 189 310 311 SEQ ID NO | SEQ ID NO 312 313 Ap423 SEQ ID NO | SEQ ID NO | SEQ ID NO 201 314 315 SEQ ID NO | SEQ ID NO 316 317 Ap537 SEQ ID NO | SEQ ID NO | SEG ID NO 203 318 319 SEQ ID NO | SEQ ID NO 320 321 Ap560 SEQ ID NO | SFEQ ID NO | SEG ID NO 205 322 323 SEQ ID NO | SEQ ID NO 324 325
[0327] [0327] Table 17
[0328] [0328] Table 18 Target. . Reverse primer Direct primer N1594 seq id no 379 seq id no 380 N1619 seq id no 381 seq id no 382 N1626 seq id no 383 seq id no 384
[0329] [0329] Table 19 Target ID | Best hit SYMBOL of Drosophila Ld583 CG4759 Ribosomal RpL27 protein L27 Ld584 CG 17331 Proteasome, beta-type subunit TLA586 - | cG13704 | aesconnecido ——— [| Ld588 CG4157 Rpn12 [o
[0330] [0330] Table 20 ID Best SYMBOL hit Drosophila Target N1594 "wings up"
[0331] [0331] * not clear: multiple hits in the family
[0332] [0332] Table 21 Target ID | Best hit Drosophila SYMBOL
[0333] [0333] It will be appreciated by professionals that numerous variations and / or modifications can be made in the tests mentioned above without departing from the spirit or scope of that test, as generically described. Professionals will recognize, or be able to determine, using no more than routine experimentation, many equivalents of the specific examples, and such equivalents are intended to be encompassed by the present invention. Consequently, the present example must be considered, in all respects, illustrative and not restrictive.

权利要求:
Claims (20)
[1]
1. Interfering ribonucleic acid (RNA) characterized by the fact that it works by uptake by a species of insect pest to negatively regulate the expression of a target gene in that insect pest, in which the RNA comprises at least one silencing element, wherein the silencing element is a double-stranded RNA region comprising hybridized complementary strands, where one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22 , 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145 , 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221,
146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245
152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 through 273, 168, 170, 169, 274 through 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or its complement, or having a nucleotide sequence so that when the two sequences are optimally aligned and compared, it is at least 75% identical to any of the SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 12 3, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154,
155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(ii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21 , 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301 , 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126 , 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245 , 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170,
169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement , or having a nucleotide sequence such that when said gene comprising said fragment is optimally aligned and compared to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189 , 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 up to 46, 141, 11, 12, 47 up to 50, 13, 14, 51 up to 54, 15, 204, 16, 205, 55 up to 58, 322 up to 325, 17, 18, 59 up to 62, 19, 20, 63 up to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289 , 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225 , 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 until 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence is at least 75% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 until 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(iii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141,
11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 through 273, 168, 170, 169, 274 through 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or its complement, and where when said fragment is optimally aligned and compared with the corresponding fragment in any of SEQ I D NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58 , 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142 , 176, 182, 130, 177, 183, 206 to 209, 286 to 289,
298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 until 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence of said fragment is at least 75% identical to said corresponding fragment of any one of SEQ ID NOs 1, 174, 404, 180, 188, 2 , 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42 , 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58 , 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142 , 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217 , 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 through 229, 127, 148, 136, 230 through 233, 128, 149, 184, 137, 185, 234 up to 237, 302 up to 305,
129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 until 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement, or
(iv) is an insect pest orthologist of a gene having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285 , 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12 , 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 up to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122 , 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153 , 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167 , 166, 270 through 273, 168, 170, 169, 274 through 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or its complement, in which the sequences of the two ortholog genes are similar to a degree that, when the two genes are optimally aligned and compared, the orthologist has a sequence that is at least 75% identical to any of the sequences represented by SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34 , 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204 , 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 up to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 up to 209
286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to
321, 386, 387, 388, 389, or
(v) is selected from the group of genes having a nucleotide sequence encoding an amino acid sequence which, when the two amino acid sequences are optimally aligned and compared, is at least 85% identical to the amino acid sequence encoded by either SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6 , 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121 , 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185 , 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 until 309, 318 to 321, 386, 387, 388, 389.
[2]
Interfering RNA according to claim 1, characterized in that the silencing element comprises or consists of a sequence of at least 21 contiguous nucleotides that is complementary or at least partially complementary to a target nucleotide sequence in the target gene.
[3]
Interfering RNA according to claim 1 or claim 2, characterized in that the RNA comprises at least two silencing elements, wherein each silencing element comprises or consists of a sequence of nucleotides that is at least partially complementary to one sequence of target nucleotides in a target gene.
[4]
4, interfering RNA according to claim 3, characterized in that each of the silencing elements comprises or consists of a different nucleotide sequence that is complementary to a different target nucleotide sequence.
[5]
Interfering RNA according to any one of claims 1 to 4, characterized in that the insect pest that attacks plants is selected from the group consisting of Leptinotarsa spp. (for example, L. decemlineata (Colorado potato beetle), L. juncta (fake potato beetle), or L. texana (fake Texas potato beetle)); Nilaparvata spp. (for example, N. lugens (brown cicada)); Lygus spp. (for example, L. lineolaris (spotted bug) or L. hesperus (western spotted bug)); Myzus Spp. (for example, M. persicae (green aphid)); Diabrotica spp. (for example, D. virgifera virgifera (western corn rootworm), D. barberi (northern corn rootworm), D. undecimpunctata howardi (southern corn rootworm), D. virgifera zeae ( Mexico's corn rootworm).
[6]
Interfering RNA according to any one of claims 1 to 5, characterized in that the target gene encodes an insect protein chosen from the group comprising (1) a protein of the troponin / myofilament complex chosen from the group comprising troponin I (for example, a CG7178 Dm insect orthologist), the upheld protein (for example, a CG7107 Dm insect orthologist), the tropomyosin 1 protein (for example, a CG4898 Dm insect orthologist) ), the tropomyosin 2 protein (for example, a CG4843 Dm insect orthologist), the myosin heavy chain (for example, a CG17927 Dm protein insect orthologist), the cytoplasmic myosin light chain protein (for example , a CG3201 Dm protein insect orthologist), the spaghetti squash protein (for example, a CG3595 Dm insect orthologist), the zipper protein (for example, a CG15792 Dm insect orthologist), a troponin C (for example, an or protein insect tologue CG2981, CcG7930, CG9073, CG6514, CG12408, CG9073, CG7930, CG2981, CG12408 or CG6514 Dm); (ii) a ribosomal insect protein chosen from the group comprising the ribosomal protein S3A (for example, an insect ortholog of the CG2168 Dm protein), the ribosomal protein LPl (for example, an insect ortholog of the CG4087 Dm protein), the protein ribosomal S3 (for example, an insect ortholog of the CG6779 Dm protein), the ribosomal protein L10Ab (for example, an insect ortholog of the CG7283 Dm protein), the ribosomal protein S18 (for example, an insect ortholog of the CG8900 Dm protein ), the L4 ribosomal protein (for example, a CG5502 Dm protein insect orthologist), the S27 ribosomal protein (for example, a CG10423 Dm insect orthologist), the L6 ribosomal protein (for example, an insect orthologist of the CGl11522 Dm protein), the S13 ribosomal protein (for example, a CG13389 DM protein insect orthologist), and the L12 ribosomal protein (for example, a CG3195 Dm insect orthologist), the L26 ribosomal protein (for example , an insect orthologist from the CG6846 Dm protein), the L21 ribosomal protein (for example, a CG12775 Dm insect orthologist), the S12 ribosomal protein (for example, a CGl1271 Dm insect orthologist), the S28b ribosomal protein (for example, a CG2998 Dm insect orthologist), the L13 ribosomal protein (eg, a CG4651 Dm insect orthologist), the L10 ribosomal protein (eg, a CGl17521 Dm insect orthologist), the L5 ribosomal protein (for example, a CG17489 Dm insect orthologist), the S15Aa ribosomal protein (for example, a CG2033 Dm insect orthologist), the L19 ribosomal protein (for example, a CG2746 Dm insect orthologist), the L27 ribosomal protein (for example, an insect ortholog of the CG4759 Dm protein); and (iii) the mitochondrial cytochrome c oxidase II subunit protein (for example, an insect ortholog of the CG34069 Dm protein); (iv) the ATP synthase-y chain (for example, a CG7610 DM protein insect orthologist); (v) ubiquitin 5E (for example, an insect ortholog of the CG32744 Dm protein); (vi) the proteasome beta-type subunit (for example, an insect orthologist of the CG17331 Dm protein), (vii) the protein that is an insect orthologist of the CG13704 Dm protein; and (viii) the Rpnl2 protein (e.g., an insect ortholog of the CG4157 Dm protein).
[7]
7. Polynucleotide characterized by the fact that it comprises a nucleotide sequence that encodes the interfering RNA as defined in any one of claims 1 to 6.
[8]
8. Host cell characterized by the fact that it comprises an interfering RNA as defined in any one of claims 1 to 6 or a polynucleotide as defined in claim 7.
[9]
9. Host cell according to claim 8, characterized by the fact that the host cell is a bacterial cell.
[10]
10. Composition for prevention and / or control of insect pest infestation characterized by the fact that it comprises at least one interfering ribonucleic acid (RNA) and at least one suitable transporter, excipient or diluent, in which the interfering RNA functions by uptake by pest to negatively regulate the expression of a target gene in said pest, where the RNA comprises at least one silencing element, where the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, wherein one of those strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and in which the target gene
(i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297 , 310 to 313, 3, 4, 31 to 34, 139 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46 141, 11, 12, 47 to 50, 13 , 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24 , 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131 , 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148 , 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 16 8, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, or having a nucleotide sequence so that when the two sequences are optimally aligned and compared, it is at least 75% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297,
310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(ii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21 , 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301 , 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126 , 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245 , 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement, or having a nucleotide sequence so that when said gene comprising said fragment is optimally aligned and compared with any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139 , 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16 , 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78 , 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to
301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, 123, 132, 214 through 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 through 321, 386, 387, 388, 389, said nucleotide sequence is at least 75% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 through 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to
253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(iii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, 123, 132, 214 through 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 26 5, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to
317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, and where when said fragment is optimally aligned and compared with the corresponding fragment in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, up to 38, 140, 7, 8, 39 through 42, 9, 10, 43 through 46, 141, 11, 12, 47 through 50, 13, 14, 51 through 54, 15, 204, 16, 205 , 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143
121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence of said fragment is at least 75% identical to said corresponding fragment of any of SEQ ID NOs 1, 174, 404,
180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 until 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 until 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, or
(iv) is an insect pest orthologist of a gene having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285 , 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12 , 47 to 50, 13, 14, 51 to 54,
15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, in that the sequences of the two orthologous genes are similar to such an extent that when the two genes are optimally aligned and compared, the orthologist has a sequence that it is at least 75% identical to any of the sequences represented by SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or
(v) is selected from the group of genes having a nucleotide sequence encoding an amino acid sequence which, when the two amino acid sequences are optimally aligned and compared, is at least 85% identical to the amino acid sequence encoded by either SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6 , 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121 , 142, 176, 182, 130, 177, 183, 206 to
209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 until 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389.
[11]
11. Composition according to claim 10, characterized by the fact that it comprises a host cell that expresses or is capable of expressing the interfering RNA.
[12]
12. Composition according to claim 11, characterized by the fact that the host cell is a bacterial cell.
[13]
13. Composition according to any one of claims 10 to 12, characterized in that the composition is formulated as an insecticidal spray and in which the spray is a pressurized / aerosolized spray and / or a pump spray.
[14]
14. Composition according to any one of claims 10 to 13, characterized in that the composition also comprises at least one pesticidal agent selected from the group consisting of a chemical insecticide, a patatin, an insecticidal protein from Bacillus thuringiensis, a protein Xenorhabdus insecticide, a Photorhabdus insecticidal protein, a Bacillus laterosporus insecticidal protein, and a Bacillus sphaericus insecticidal protein.
[15]
15. Composition according to claim 14, characterized by the fact that said insecticidal protein from Bacillus thuringiensis is selected from the group consisting of a Cryl, a Cry3, a TIC851, a CryET170, a Cry22, a TIC901, a TIC201, a TIC407, a TIC417, a binary insecticidal protein CryET80 and CryET76, a binary insecticidal protein TIC1I00 and TICI01l, a combination of an insecticidal protein ET29 or ET37 with an insecticidal protein TIC810 or TIC812, and a binary insecticidal protein PS149B1l.
[16]
16. Combination to prevent and / or control pest infestation characterized by the fact that it comprises the composition as defined in any one of claims 10 to 15 and at least one other active agent.
[17]
17. Combination according to claim 16, characterized by the fact that the herbicide is selected from a glyphosate insensitive version of a 5-
enolpiruvilshiquimato-3-phosphate synthase (EPSPS), a catabolic enzyme that is capable of degrading dicamba, such as dicamba monooxygenase, or a phosphinothricin acetyl transferase gene that is capable of catabolizing ammonium glufosinate.
[18]
18. Method to negatively regulate the expression of a target gene in a species of insect pest to prevent and / or control infestation by pests characterized by the fact that it comprises contacting said species of pest with an effective amount of at least one ribonucleic acid Interfering (RNA) as defined in any one of claims 1 to 6, wherein the interfering RNA functions by uptake by the pest to negatively regulate the expression of a target gene in said pest, wherein the RNA comprises at least one silencing element, in that the silencing element is a region of double-stranded RNA comprising complementary hybridized strands, where one of these strands comprises or consists of a nucleotide sequence that is at least partially complementary to a target nucleotide sequence in the target gene, and where the target gene (i) is selected from the group of genes having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 40 4, 180, 188, 2, 175, 181, 189, 27 to 30,
282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139
5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46
141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, 123, 132, 214 through 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245
152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 through 273, 168, 170
169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement , or having a nucleotide sequence so that when the two sequences are optimally aligned and compared, it is at least 75% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17,
18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 until 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 until 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, or
(ii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 until
289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, or having a nucleotide sequence so that when said gene comprising said fragment is optimally aligned and compared with any of the SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6 , 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence is at least 75% identical to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 29 4 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25
26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281,
200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement, or
(iii) is selected from the group of genes having a nucleotide sequence comprising a fragment of at least 21 contiguous nucleotides from any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, 123, 132, 214 through 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 26 5, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, and where when said fragment is optimally aligned and compared with the corresponding fragment in any of the SEQs ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58 , 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142 , 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217 , 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 through 229, 127, 148, 136, 230 through 233, 128, 149, 184, 137, 185, 234 at is 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159 , 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281 , 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence of said fragment is at least 75% identical to said fragment corresponding to any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to
50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293, 123, 132, 214 through 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 through 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 through 273, 168, 170, 169, 274 through 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or its complement, or
(iv) is an insect pest orthologist of a gene having a nucleotide sequence comprising any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285 , 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12 , 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 up to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122 , 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153 , 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167 , 166, 270 through 273, 168, 170, 169, 274 through 277, 172, 173, 278 through 281, 200, 201, 314 through 317, 186, 202, 187, 203, 306 through 309, 318 through 321, 386, 387, 388, 389, or its complement, in which the sequences of the two ortholog genes are similar to a degree that, when the two genes are optimally aligned and compared, the orthologist has a sequence that is at least 75% identical to any of the sequences represented by SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34 , 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204 , 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 up to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 through 209, 286 through 289, 298 through 301, 145, 122, 144, 178, 131, 179, 210 through 213, 290 through 293 , 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 14 7, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 until 309, 318 through 321, 386, 387, 388, 389, or
(v) is selected from the group of genes having a nucleotide sequence encoding an amino acid sequence which, when the two amino acid sequences are optimally aligned and compared, is at least 85% identical to the amino acid sequence encoded by either SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6 , 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121 , 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185 , 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 until 309, 318 to 321, 386, 387, 388, 389.
[19]
19. Method, according to claim 18, characterized by the fact that the plant is chosen from the group comprising cotton, potato, rice, canola, sunflower, sorghum, millet, corn, strawberries, soy, alfalfa, tomato, eggplant, pepper and tobacco.
[20]
20. Isolated polynucleotide characterized by the fact that it is selected from the group comprising: (i) a polynucleotide comprising at least 21 contiguous nucleotides from a nucleotide sequence represented by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142,
176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 through 221, 146, 125, 134, 222 through 225, 147, 126, 135, 226 through 229, 127, 148, 136, 230 through 233, 128, 149, 184, 137, 185, 234 through 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or their complement, or
(1i) a polynucleotide comprising at least 21 contiguous nucleotides of a nucleotide sequence represented in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285 , 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12 , 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 up to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122 , 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134,
222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, so that when the two sequences are optimally aligned and compared, said polynucleotide is at least 75% identical to any one of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5 , 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205 , 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 2 6, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253,
156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(iii) a polynucleotide comprising a fragment of at least 21 contiguous nucleotides from a nucleotide sequence represented in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, up to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11 , 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22 , 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 16 2, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317,
186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, or its complement, and wherein said fragment or said complement has a nucleotide sequence that, when said fragment is optimally aligned and compared to the corresponding fragment in any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313 , 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14 , 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 up to 74, 25, 26, 75 through 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 through 209, 286 through 289, 298 through 301, 145, 122, 144, 178, 131, 179 , 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150 , 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157
254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389, said nucleotide sequence is at least 75% identical to said corresponding fragment of any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189, 27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137
185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 to 309, 318 to 321, 386, 387, 388, 389 or its complement, or
(iv) a polynucleotide encoding an amino acid sequence which, when the two amino acid sequences are optimally aligned and compared, is at least 85% identical to the amino acid sequence encoded by any of SEQ ID NOs 1, 174, 404, 180, 188, 2, 175, 181, 189,
27 to 30, 282 to 285, 294 to 297, 310 to 313, 3, 4, 31 to 34, 139, 5, 6, 35 to 38, 140, 7, 8, 39 to 42, 9, 10, 43 to 46, 141, 11, 12, 47 to 50, 13, 14, 51 to 54, 15, 204, 16, 205, 55 to 58, 322 to 325, 17, 18, 59 to 62, 19, 20, 63 to 66, 21, 22, 67 to 70, 23, 24, 71 to 74, 25, 26, 75 to 78, 143, 121, 142, 176, 182, 130, 177, 183, 206 to 209, 286 to 289, 298 to 301, 145, 122, 144, 178, 131, 179, 210 to 213, 290 to 293, 123, 132, 214 to 217, 124, 133, 218 to 221, 146, 125, 134, 222 to 225, 147, 126, 135, 226 to 229, 127, 148, 136, 230 to 233, 128, 149, 184, 137, 185, 234 to 237, 302 to 305, 129, 138, 238 to 241, 150, 151, 242 to 245, 152, 153, 246 to 249, 154, 155, 250 to 253, 156, 157, 254 to 257, 158, 159, 258 to 261, 160, 161, 262 to 265, 163, 162, 164, 266 to 269, 165, 167, 166, 270 to 273, 168, 170, 169, 274 to 277, 172, 173, 278 to 281, 200, 201, 314 to 317, 186, 202, 187, 203, 306 until 309, 318 to 321, 386, 387, 388, 389, and where the reference the polynucleotide has no more than 10,000 nucleotides.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10329565B2|2019-06-25|Down-regulating gene expression in insect pests

---

ES2670620T3|2018-05-31|Regulation for decreased gene expression in insect pests

同族专利:

---

公开号 | 公开日

---

CN103687952B|2018-05-08|

---

ES2670620T3|2018-05-31|

---

AU2017203438A1|2017-06-08|

---

RU2014105823A|2015-08-27|

---

CN103687951A|2014-03-26|

---

RU2725953C2|2020-07-07|

---

EP2734623B1|2018-04-04|

---

AU2012286176A1|2014-03-06|

---

RU2665549C1|2018-08-30|

---

AU2017200024A1|2017-02-02|

---

EP3739052A1|2020-11-18|

---

EP2734624A1|2014-05-28|

---

CN108531505A|2018-09-14|

---

EP2734624B1|2018-03-14|

---

MX2014000595A|2014-02-27|

---

EP2734623A1|2014-05-28|

---

CA2840925A1|2013-01-24|

---

AU2019200376A1|2019-02-07|

---

MX2019011967A|2019-11-18|

---

BR112014001396A2|2017-02-21|

---

RU2017127761A3|2019-02-01|

---

MX348179B|2017-06-02|

---

CA2840934A1|2013-01-24|

---

AU2012286176B2|2016-10-20|

---

RU2014105825A|2015-08-27|

---

WO2013010691A1|2013-01-24|

---

MX352786B|2017-12-08|

---

AU2017203438B2|2018-11-08|

---

RU2619219C2|2017-05-12|

---

ZA201400081B|2017-09-27|

---

RU2018130096A3|2020-02-20|

---

MX368573B|2019-10-08|

---

WO2013010690A1|2013-01-24|

---

AU2019200377A1|2019-02-07|

---

AU2017200024B2|2018-11-08|

---

RU2691697C2|2019-06-17|

---

RU2018130096A|2020-02-20|

---

RU2017127761A|2019-02-01|

---

PT2734624T|2018-05-24|

---

MX2014000707A|2014-02-20|

---

CN103687952A|2014-03-26|

---

EP3369822A1|2018-09-05|

---

AU2012286177B2|2017-03-09|

---

CN103687951B|2019-08-02|

---

AU2012286177A1|2014-03-06|

---

EP3363905A1|2018-08-22|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

GB9214956D0|1992-07-14|1992-08-26|Univ Southampton|A method of trapping and/or killing insects|

---

GB9605203D0|1996-03-12|1996-05-15|Univ Southampton|Control agent|

---

GB9814507D0|1998-07-03|1998-09-02|Univ Southampton|A method and apparatus for controlling pests|

---

AUPR621501A0|2001-07-06|2001-08-02|Commonwealth Scientific And Industrial Research Organisation|Delivery of ds rna|

---

GB0228421D0|2002-12-05|2003-01-08|Exosect Ltd|Lipid carriers|

---

BRPI0408254A|2003-03-12|2006-03-01|Ishihara Sangyo Kaisha|plant cells and plant bodies with modified cell growth, development and differentiation|

---

MXPA06002216A|2003-08-28|2006-04-27|Novartis Ag|INTERFERING RNA DUPLEX HAVING BLUNT-ENDS AND 3aCO-MODIFICATIONS.|

---

AT526407T|2003-11-17|2011-10-15|Commw Scient Ind Res Org|INSECT RESISTANCE THROUGH INHIBITION OF GENE EXPRESSION|

---

CA2562022C|2004-04-09|2016-01-26|Monsanto Technology Llc|Compositions and methods for control of insect infestations in plants|

---

EP2330203A3|2004-10-25|2011-10-05|Devgen NV|Rna constructs|

---

SG166097A1|2005-09-16|2010-11-29|Monsanto Technology Llc|Methods for genetic control of insect infestations in plants and compositions thereof|

---

PT2295584E|2005-09-16|2015-09-22|Devgen Nv|Transgenic plant-based methods for plant pests using rnai|

---

WO2007080126A2|2006-01-12|2007-07-19|Devgen N.V.|Dsrna as insect control agent|

---

CN101370940A|2006-01-12|2009-02-18|德福根有限公司|DsRNA as insect control agent|

---

KR101362681B1|2006-03-31|2014-02-13|알닐람 파마슈티칼스 인코포레이티드|Compositions and methods for inhibiting expression of Eg5 gene|

---

US8809625B2|2008-01-17|2014-08-19|Pioneer Hi-Bred International, Inc.|Compositions and methods for the suppression of target polynucleotides from Lygus|

---

WO2010025320A1|2008-08-29|2010-03-04|Monsanto Technology Llc|Novel hemipteran and coleopteran active toxin proteins from bacillus thuringiensis|

---

MX349997B|2011-04-20|2017-08-23|Devgen Nv|Plants resistant to insect pests.|US8097712B2|2007-11-07|2012-01-17|Beelogics Inc.|Compositions for conferring tolerance to viral disease in social insects, and the use thereof|

---

US8962584B2|2009-10-14|2015-02-24|Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd.|Compositions for controlling Varroa mites in bees|

---

BR112012022570A2|2010-03-08|2015-10-06|Monsato Technology Llc|polynucleotide molecules for gene regulation in plants.|

---

US10760086B2|2011-09-13|2020-09-01|Monsanto Technology Llc|Methods and compositions for weed control|

---

US9840715B1|2011-09-13|2017-12-12|Monsanto Technology Llc|Methods and compositions for delaying senescence and improving disease tolerance and yield in plants|

---

WO2013040033A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and compositions for weed control|

---

UA116089C2|2011-09-13|2018-02-12|Монсанто Текнолоджи Ллс|Methods and compositios for weed control|

---

US10806146B2|2011-09-13|2020-10-20|Monsanto Technology Llc|Methods and compositions for weed control|

---

CA2848695A1|2011-09-13|2013-03-21|Monsanto Technology Llc|Methods and composition for weed control comprising inhibiting ppg oxidase|

---

US10829828B2|2011-09-13|2020-11-10|Monsanto Technology Llc|Methods and compositions for weed control|

---

UA115535C2|2011-09-13|2017-11-27|Монсанто Текнолоджи Ллс|Methods and compositions for weed control|

---

US9920326B1|2011-09-14|2018-03-20|Monsanto Technology Llc|Methods and compositions for increasing invertase activity in plants|

---

US10240161B2|2012-05-24|2019-03-26|A.B. Seeds Ltd.|Compositions and methods for silencing gene expression|

---

EP2908620A4|2012-10-18|2016-07-27|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

US10683505B2|2013-01-01|2020-06-16|Monsanto Technology Llc|Methods of introducing dsRNA to plant seeds for modulating gene expression|

---

US10041068B2|2013-01-01|2018-08-07|A. B. Seeds Ltd.|Isolated dsRNA molecules and methods of using same for silencing target molecules of interest|

---

US10000767B2|2013-01-28|2018-06-19|Monsanto Technology Llc|Methods and compositions for plant pest control|

---

EP2971185A4|2013-03-13|2017-03-08|Monsanto Technology LLC|Methods and compositions for weed control|

---

CA2905104A1|2013-03-13|2014-10-09|Monsanto Technology Llc|Control of lolium species by topical application of herbicidal composition comprising dsrna|

---

US20140283211A1|2013-03-14|2014-09-18|Monsanto Technology Llc|Methods and Compositions for Plant Pest Control|

---

US10568328B2|2013-03-15|2020-02-25|Monsanto Technology Llc|Methods and compositions for weed control|

---

CA2918387C|2013-07-19|2021-11-02|Monsanto Technology Llc|Compositions and methods for controlling leptinotarsa|

---

US9850496B2|2013-07-19|2017-12-26|Monsanto Technology Llc|Compositions and methods for controlling Leptinotarsa|

---

AR098295A1|2013-11-04|2016-05-26|Monsanto Technology Llc|COMPOSITIONS AND METHODS TO CONTROL INFESTATIONS OF PESTS AND PARASITES OF THE ARTHROPODS|

---

WO2015089078A1|2013-12-10|2015-06-18|Beeologics, Inc.|Compositions and methods for virus control in varroa mite and bees|

---

EP3116303B1|2014-01-15|2020-07-22|Monsanto Technology LLC|Methods and compositions for weed control using epsps polynucleotides|

---

US11091770B2|2014-04-01|2021-08-17|Monsanto Technology Llc|Compositions and methods for controlling insect pests|

---

US10988764B2|2014-06-23|2021-04-27|Monsanto Technology Llc|Compositions and methods for regulating gene expression via RNA interference|

---

RU2021123470A|2014-07-29|2021-09-06|Монсанто Текнолоджи Ллс|COMPOSITIONS AND METHODS FOR COMBATING PESTS|

---

US20170247719A1|2014-09-17|2017-08-31|Pioneer Hi-Bred International, Inc.|Compositions and methods to control insect pests|

---

CN104450775B|2014-12-04|2018-04-27|中国农业科学院作物科学研究所|Resistance glyphosate genetically engineered soybean and preparation method and application|

---

EP3256589B1|2015-01-22|2021-12-22|Monsanto Technology LLC|Compositions and methods for controlling leptinotarsa|

---

WO2016138106A1|2015-02-27|2016-09-01|Pioneer Hi Bred International Inc|Compositions and methods to control insect pests|

---

AU2016270595A1|2015-05-29|2017-11-30|Dow Agrosciences Llc|SPT6 nucleic acid molecules to control insect pests|

---

CN107750125A|2015-06-02|2018-03-02|孟山都技术有限公司|For by the composition and method in delivery of polynucleotides to plant|

---

EP3302030A4|2015-06-03|2019-04-24|Monsanto Technology LLC|Methods and compositions for introducing nucleic acids into plants|

---

CN105165502B|2015-07-21|2017-11-07|中国水稻研究所|A kind of method of half field evaluation paddy rice Adult plant whitebacked planthopper-resistance|

---

CA3001162A1|2015-10-12|2017-04-20|Dow Agrosciences Llc|Wupa nucleic acid molecules that confer resistance to coleopteran and hemipteran pests|

---

EP3389361A4|2015-12-18|2019-09-11|Dow Agrosciences LLC|Ribosomal protein L40NUCLEIC ACID MOLECULES THAT CONFER RESISTANCE TO COLEOPTERAN AND HEMIPTERAN PESTS|

---

CN109486812B|2016-01-04|2021-04-30|北京大北农生物技术有限公司|Nucleotide sequences and methods for controlling insect infestation|

---

AR109844A1|2016-10-27|2019-01-30|Syngenta Participations Ag|INSECTED PROTEINS|

---

EP3555119A1|2016-12-15|2019-10-23|Pioneer Hi-Bred International Inc.|Compositions and methods to control insect pests|

---

CN106591336B|2016-12-21|2019-06-11|东北林业大学|For preventing and treating ATP synthase gene and primer and the application of aphelenchoides besseyi|

---

CN107858405B|2017-10-12|2021-09-24|华南农业大学|Method for determining toxic influence of exogenous dsRNA on ladybug|

---

CN111034736B|2019-12-13|2021-04-06|西北农林科技大学|Insecticidal composition and application thereof|

法律状态:
2020-12-08| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-03-23| B11B| Dismissal acc. art. 36, par 1 of ipl - no reply within 90 days to fullfil the necessary requirements|

---

2021-06-01| B350| Update of information on the portal [chapter 15.35 patent gazette]|

---

2021-12-07| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161508826P| true| 2011-07-18|2011-07-18|

---

US61/508,826|2011-07-18|

---

PCT/EP2012/057332|WO2012143542A1|2011-04-20|2012-04-20|Down-regulating gene expression in insect pests|

---

EPPCT/EP2012/057332|2012-04-20|

---

PCT/EP2012/058037|WO2013010690A1|2011-07-18|2012-05-02|Down regulating gene expression in insect pests|

---