ALPHA-AMYLASE VARIANT, INSULATED POLYNUCLEOTIDE, EXPRESSION VECTOR, HOST CELL, METHODS OF PRODUCING

专利摘要:
alpha-amylase variant, isolated polynucleotide, nucleic acid construction, expression vector, host cell, methods of producing a variant of alpha-amylase, to produce a fermentation product from a material containing starch, and, for the production an enzymatically modified starch derivative. the present invention relates to alpha-amylase variants. the present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising polynucleotides; and methods of using the variants.
公开号:BR112014000143B1
申请号:R112014000143-0
申请日:2012-07-06
公开日:2021-04-06
发明作者:Tomoko Matsui；Aki Tomiki；Guillermo Coward-Kelly
申请人:Novozymes A/S；Novozymes North America, Inc；
IPC主号:

专利说明:

[0001] [001] This application contains a Sequence Listing in computer readable format, which is incorporated by reference. Background of the Invention Field of the Invention
[0002] [002] The present invention relates to variants of an alpha-amylase, the polynucleotides encoding the variants, the methods of producing the variants, and methods of using the variants. Description of the Related Art
[0003] [003] The present invention provides variants of a parent alpha-amylase with improved properties compared to its parent. Alpha-amylases (1,4-a-D-glucan glucanhydrolase, EC 3.2.1.1) constitute a group of enzymes that catalyze the hydrolysis of starch and other 1,4 linear and branched glucosidic oligo- and polysaccharides.
[0004] [004] There is a very extensive body of patents and scientific literature related to this class of enzymes which is industrially very important. A number of alpha-amylases referred to as "Termamyl®-type alpha-amylases, and variants thereof, are known from, for example, WO 90/11352, WO 95/10603, WO 95/26397, WO 96/23873 and WO 96/23874. The alpha-amylases of the Termamyl® type are very thermostable and, therefore, suitable for processes carried out at elevated temperatures, such as liquefaction of starch in dextrose production processes.
[0005] [005] Alpha-amylases from another group are referred to as "alpha-amylases of the type Fungamyl ™ '', which are related alpha-amylases or homologous to alpha-amylases derived from Aspergillus oryzae. Alpha-amylases of the Fungamyl type have a relatively low thermostability, for example, the commercial product sold under the trade name Fungamyl ™ by Novozymes A / S, Denmark, has an optimal value at around 55 ° C, and is not suitable for processes conducted at high temperatures. Alpha-amylases of the Fungamyl® type are used today to make syrups for, for example, the brewing industry.
[0006] [006] An alpha-amylase with increased thermostability, preferably at acidic pH, was previously successfully isolated. WO 2004/055178 discloses a Rhizomucor pusillus gene encoding an alpha-amylase denoted AM782. Characterization of this amylase has been shown to be a highly thermoacidophilic alpha-amylase that has a very interesting activity, as demonstrated by the sugar profile from hydrolysis of maltodextrin by amylase AM782. AM782 amylase can work at a very high temperature, at least up to 70 ° C. However, this alpha amylase has poor storage stability, if stored without refrigeration. It is an object of the present invention to provide stable storage variants of AM782 such as SEQ ID NO: 3 (mature polypeptide), which have retained good hydrolysis activity of raw starch. Summary of the Invention
[0007] [007] The present invention relates to variants of alpha-amylase, comprising a substitution, in one or more positions corresponding to positions 128, 143, 141, 192, 20, 76, 123, 136, 142, 165, 219, 224, 265, 383, and 410 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has an alpha-amylase activity.
[0008] [008] The present invention also relates to isolated polynucleotides encoding the variants; nucleic acid constructs, vectors and host cells comprising polynucleotides, and methods of producing variants.
[0009] [009] The present invention also relates to methods of producing a fermentation product from a material containing starch using the variants of the invention. Detailed Description of the Invention
[0010] [0010] The present invention relates to variants of a parental alpha-amylase, comprising a substitution of one or more (several) positions corresponding to positions 128, 143, 141, 192, 20, 76, 123, 136, 142, 165, 219, 224, 265, 383, and 410 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has an alpha-amylase activity. Definitions
[0011] [0011] Alpha-amylase activity: The term 'alpha-amylase activity' means a 1,4-alpha D-glucan glucanhydrolase, EC. 3.2.1.1, which catalyzes the hydrolysis of starch and other oligo and polysaccharides 1, 4 linear and branched glucosides For the purposes of the present invention, alpha-amylase activity can be determined using an alpha-amylase assay kit, for example, available from Kikkoman Biochemifa Company, Catalog Number 60213. See Materials section and method for details. 1U = μmol CNP released / min at 30 ° C, pH 4.0 Other methods suitable for determining alpha-amylase activity may be used instead.
[0012] The polypeptide variants of the present invention are at least 20%, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least at least 95%, and at least 100% of the alpha amylase activity of the mature parental alpha-amylase polypeptide contained in SEQ ID NO: 2. In one embodiment, the mature alpha-amylase consists of SEQ ID NO: 3 .
[0013] [0013] Variant: The term "variant" means that a polypeptide with alpha-amylase activity comprising a change, that is, a substitution, insertion and / or deletion, in one or more (several) positions. A substitution means a substitution of an amino acid occupying a position with a different amino acid, a deletion means the removal of an amino acid occupying a position, and an insertion means that the addition of one or more, for example, 1-3, the adjacent amino acids u an amino acid occupying a position. Preferably, the change is a replacement. The variant polypeptides of the present invention are at least 20%, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, and at least 100% of the alpha-amylase activity of the mature parental alpha-amylase polypeptide, for example, SEQ ID NO: 3.
[0014] [0014] Mutant: The term "mutant" designates a polynucleotide encoding a variant.
[0015] [0015] Wild-type enzyme: The term "wild-type" alpha-amylase means an alpha-amylase expressed by a naturally occurring micro-organism, such as bacteria, yeast, filamentous fungi found in nature.
[0016] [0016] Parental or parental alpha amylase: The term "parental" or "alpha-amylase-parental" means an alpha-amylase in which a change is made to produce the enzyme variants of the present invention. The parent may be a naturally occurring polypeptide (wild type) or a variant thereof.
[0017] [0017] Isolated: The term "isolated" means a substance in a form or medium that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance, including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide, or cofactor, which is at least partially removed from one or more or all naturally occurring constituents with which it is associated in nature, (3) any substance modified by the hand of man in relation to the substance found in nature, or (4) any modified substance, increasing the amount of the substance with respect to other components with which it is naturally associated (for example, multiple copies of a gene encoding the substance, using a stronger promoter than the promoter naturally associated with the gene encoding the substance). An isolated substance may be present in a fermentation broth sample.
[0018] [0018] Substantially pure variant: The term "substantially pure variant" means a preparation that contains a maximum of 10%, a maximum of 8%, a maximum of 6%, a maximum of 5%, a maximum of 4%, a maximum of 3% , at most 2%, at most 1%, and at most 0.5% by weight of other polypeptide material with which it is associated natively or recombinantly. Preferably, the variant is at least 92% pure, for example, at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, at least minus 99.5% pure, or 100% pure by weight, of the total polypeptide material present in the preparation. The variants of the present invention are preferably in a substantially pure form. This can be achieved, for example, by preparing the variant by well-known recombinant methods or by classical purification methods.
[0019] [0019] Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form after translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one embodiment, the mature polypeptide consists of amino acids 34 to 471 of SEQ ID NO: 2, based on the SignalP program (Nielsen et al., 1997, Protein Engineering 10: 1-6) which provides that amino acids 1 to 21 of SEQ ID NO: 2 are a signal peptide, amino acids 22 to 33 are a pro-peptide. The mature polypeptide is disclosed as SEQ ID NO: 3.
[0020] [0020] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide encoding a mature polypeptide having alpha-amylase activity. In one aspect, the mature polypeptide coding sequence is 100- 1416 (including stop codon) of SEQ ID NO: 1 based on SignalP (Nielsen et al., 1997, Protein Engineering 10: 16) predicting that nucleotides 1 and 63 of SEQ ID NO: 1 encode a signal peptide and nucleotides 64-99 encode a propeptide.
[0021] [0021] Identity sequence: The relationship between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For the purposes of the present invention, the degree of sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the program Needle of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably in version 5.0.0 or later. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the replacement matrix EBLOSUM62 (EMBOSS version of BLOSUM62). The output of Needle output labeled "longest identity" (obtained using the -nobrief option) is used as the percentage of identity and is calculated as follows:
[0022] [0022] (identical residues x 100) / (alignment length - total number of spaces in alignment)
[0023] [0023] For the purposes of the present invention, the degree of sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably in version 5.0.0 or later. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL replacement matrix (EMBOSS version of NCBI NUC4.4). The output of Needle output labeled "longest identity" (obtained using the nobrief option) is used as the percentage of identity and is calculated as follows:
[0024] [0024] (identical deoxyribonucleotides x 100) / (alignment length - total number of spaces in alignment)
[0025] [0025] Fragment: The term "fragment" means a polypeptide having one or more (several) amino acids deleted from the amino and / or carboxyl terminus of a mature polypeptide, in which the fragment has an alpha-amylase activity.
[0026] [0026] Allelic variant: The term "allelic variant" designates any one of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and can result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides having the amino acid sequences altered. An allele variant of a polypeptide is a polypeptide encoded by an allele variant of a gene.
[0027] [0027] Substantially pure polynucleotide: The term "substantially pure polynucleotide" means a preparation of polynucleotides free of other foreign or unwanted nucleotides and in a form suitable for use in genetically engineered polypeptide production systems. Thus, a substantially pure polynucleotide contains a maximum of 10%, a maximum of 8%, a maximum of 6%, a maximum of 5%, a maximum of 4%, a maximum of 3%, a maximum of 2%, a maximum of 1%, or, at most, 0.5%, by weight, of other polynucleotide material with which it is associated natively or recombinantly. A substantially pure polynucleotide may, however, include naturally occurring 5 'and 3' untranslated regions, such as promoters and terminators. It is preferable that the substantially pure polynucleotide is at least 90% pure, for example, at least 92% pure, at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98 % pure, at least 99% pure, or at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form.
[0028] [0028] Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of your polypeptide product. The limits of the coding sequence are generally determined by an open reading frame, which usually starts with the ATG starting codon or alternative starting codons such as GTG and TTG and ends with a TAA codon, such as, TAG, TGA, and The coding sequence can be a synthetic polynucleotide, or recombinant, DNA or cDNA.
[0029] [0029] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced mRNA molecule, obtained from a eukaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The main initial transcript is a precursor of mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
[0030] [0030] Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, whether single or double stranded, which is isolated from a naturally occurring gene, or is modified to contain segments of nucleic acids in a way that would not otherwise exist in nature or that is synthetic. The expression nucleic acid construct is synonymous with the term "expression cassette" when the nucleic acid construct contains the control sequences necessary for the expression of a coding sequence of the present invention.
[0031] [0031] Control sequences: The term "control sequences" means all the components necessary for the expression of a polynucleotide encoding a variant of the present invention. Each control sequence can be native or foreign to the polynucleotide encoding the variant or native or foreign to the other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter, and stop transcription and translation signals. The control sequences can be provided with linkers in order to introduce specific restriction sites facilitating the connection of the control sequences with the polynucleotide coding region encoding a variant.
[0032] [0032] Operatively linked: The term "operably linked" means a configuration in which a control sequence is placed in an appropriate position with respect to the coding sequence of a polynucleotide so that the control sequence directs the expression of the coding sequence.
[0033] [0033] Expression: The term "expression" includes any step involved in the production of the variant, including, but not limited to, transcription, post-transcription modification, translation, post-translation modification, and secretion.
[0034] [0034] Expression vector: The term "expression vector" designates a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to the additional nucleotides that provide its expression.
[0035] [0035] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, and the like, with a nucleic acid builder expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parental cell that is not identical to the parental cell due to mutations that occur during replication.
[0036] [0036] Improved property: The term "improved property" means a characteristic associated with a variant that is improved in relation to the parental. These improved properties include, but are not limited to, thermal activity, thermostability, pH activity, pH stability, substrate / cofactor specificity, improved surface properties, product specificity, increased stability, improved stability under storage conditions, and chemical stability.
[0037] [0037] Improved thermostability: The term "improved thermostability" means a variant showing an improved residual alpha-amylase activity after an incubation period at elevated temperature in relation to the parent, or in a buffer, or under conditions such as those that exist , during product storage / transport or conditions similar to those that exist during industrial use of the variant. A variant may or may not exhibit an altered thermal activity profile in relation to the parent. For example, a variant may or may not have a better ability to reduplicate after incubation at a high temperature compared to the parent. A variant according to the present invention exhibits improved residual activity compared to the Rhizomucor pusilus parental alpha-amylase, described as the mature polypeptide of SEQ ID NO: 2, after incubation for 1 hour at 65 ° C at pH 3, 5. Residual activity was measured as described in the examples.
[0038] [0038] In one aspect, the thermostability of the variant having alpha-amylase activity is at least 1.05 times, for example, at least 1.1 times, at least 1.5 times, at least 1, 8 times, at least 2 times, at least 5 times, at least 10 times, at least 15 times, at least 20 times, or at least 25 times more thermostable than parental when residual activity is compared using, for example, example, the amylase activity kit available from Kikkoman Biochemifa Company, Cat. 60213). Other appropriate amylase assays can also be used.
[0039] [0039] Improved pH stability: The term "improved pH stability" means a variant, which shows the retention of alpha-amylase activity, after an incubation period, at a specific pH, which reduces the enzymatic activity of the parent . The variants according to the present invention may have improved tolerance at a pH below 4.7, such as below 4.5, in particular below 4.0, more particularly below 3.8, such as pH 3, 5.
[0040] [0040] Improved storage stability: The term "improved storage stability" means a variant showing an improved residual alpha-amylase activity over a parental alpha-amylase after incubation for a period of time at a specific pH and temperature . The conditions tested were: pH 4.0, at 40 ° C for 3 to 10 days. Variant designation conventions
[0041] [0041] For the purposes of the present invention, the mature polypeptide comprised in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another alpha-amylase. In a particular embodiment, the mature polypeptide consists of polypeptide of SEQ ID NO: 3 and the specific positions substituted according to the invention refer to the positions of SEQ ID NO 3. The amino acid sequence of another alpha-amylase is therefore, aligned with the mature polypeptide comprised in SEQ ID NO: 2, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide comprised in SEQ ID NO: 2 is determined using the Needleman-Wunsch (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet 16: 276-277), preferably in version 5.0.0 or later.
[0042] [0042] Identification of the corresponding amino acid residue in another alpha-amylase can be confirmed by aligning multiple polypeptide sequences using various computer programs, including, but not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3 , 5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900) , and EMBOSS EMMA employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22: 46734680), using their respective default default parameters.
[0043] [0043] When the other enzyme diverged from the mature polypeptide of SEQ ID NO: 2 so that the traditional comparison based on the sequence of failure to detect its relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613 -615), other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence-based search can be achieved using search programs that use probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative search process in databases and is capable of detecting remote counterparts (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs like GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881) use information from a variety of sources (PSI-BLAST, prediction of secondary structure, structural alignment profiles, and solvation potentials) as input to a neural network that provides for structural duplication for a query sequence. Likewise, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919 can be used to align a sequence of unknown structure with the models of the superfamily present in the SCOP database. These alignments in turn can be used to generate homology models for the polypeptide, and such models can be evaluated for accuracy using a variety of tools developed for this purpose.
[0044] [0044] For proteins of known structure, several tools and resources are available to recover and generate structural alignments. For example, SCOP protein superfamilies have been structurally aligned, and these alignments are accessible and can be downloaded. Two or more protein structures can be aligned using a variety of algorithms, such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 11: 739-747), and implementations of these algorithms can also be used to query structure databases with a structure of interest, in order to discover possible structural counterparts (for example, Holm and Park, 2000, Bioinformatics 16: 566-567) .
[0045] [0045] In describing the alpha-amylase variants of the present invention, the nomenclature described below is adapted for ease of reference. Abbreviations accepted by single letter or three letter amino acid IUPAC are used.
[0046] [0046] Substitutions. For an amino acid substitution, the following nomenclature is used: original amino acid, position, substituted amino acid. Thus, the substitution of threonine for alanine at position 226 is designated as "Thr226Ala" or "T226A". Several substitutions are separated by addition marks (“+”), for example, “Gly205Arg + Ser411Phe” or “G205R + S411F”, representing the substitutions in positions 205 and 411 of glycine (G) with arginine (R) and serine ( S) by phenylalanine (F), respectively.
[0047] [0047] Deletions. For an amino acid deletion, the following nomenclature is used: original amino acid, position *. Therefore, the glycine deletion at position 195 is designated as “Gly195 *” or “G195 *”. Several deletions are separated by addition marks (“+”), for example, “Gly195 * + Ser411 *” or “G195 * + S411 *”.
[0048] [0048] Insertions. For an amino acid insertion, the following nomenclature is used: original amino acid, position, original amino acid, inserted amino acid. Thus, the insertion of lysine after glycine at position 195 is called “Gly195GlyLys” or “G195GK”. A multiple amino acid insert is called [original amino acid, position, original amino acid, inserted amino acid # 1, inserted amino acid # 2; etc]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as “Gly195GlyLysAla” or “G195GKA”.
[0049] [0049] In such cases, the inserted amino acid residue (s) are numbered by adding lower case letters to the position number of the amino acid residue preceding the residue (s) ( of inserted amino acid (s). In the example above, the sequence would look like this:
[0050] [0050] Multiple amendments. Variants comprising multiple changes are separated by addition marks (“+”), for example, “Arg170Tyr + Gly195Glu” or “R170Y + G195E” which represents a substitution of tyrosine and glutamic acid for arginine and glycine at positions 170 and 195, respectively.
[0051] [0051] Different substitutions. Where different substitutions can be entered in one position, different substitutions are separated by a comma, for example, "Arg170Tyr, Glu" represents a substitution of arginine for tyrosine or glutamic acid at position 170. Thus, "Tyr167Gly, Ala + Arg170Gly, Ala "designates the following variants:" Tyr167Gly + Arg170Gly "," Tyr167Gly + Arg170Ala "," Tyr167Ala + Arg170Gly ", and" Tyr167Ala + Arg170Ala ". Parental alpha amylase
[0052] The parent alpha-amylase can be (a) a polypeptide with at least 60% sequence identity with the mature polypeptide of SEQ ID NO: 2, (b) a polypeptide encoded by a polynucleotide with at least 60% sequence identity to the coding sequence of the mature polypeptide of SEQ ID NO: 1, or (c) a fragment of the mature polypeptide of SEQ ID NO: 2, which has alpha-amylase activity.
[0053] [0053] In one embodiment, the parent has a sequence identity for the mature polypeptide of SEQ ID NO: 2 of at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which has alpha activity amylase. In one aspect, the parental amino acid sequence differs by no more than ten amino acids, for example, by five amino acids, by four amino acids, by three amino acids, by two amino acids, and / or by an amino acid of the mature polypeptide of SEQ ID NO : 2. The parent preferably comprises or consists of the amino acid sequence of SEQ ID NO: 2. In another aspect, the parent comprises or consists of the mature polypeptide of SEQ ID NO: 2. In another aspect, the parent comprises or consists of the amino acids 34-471 of SEQ ID NO: 2. Amino acids 34-471 of SEQ ID NO: 2 are also described herein as SEQ ID NO: 3.
[0054] [0054] In another embodiment, the parental is an allelic variant of the mature polypeptide of SEQ ID NO: 2.
[0055] [0055] In another embodiment, the parent is encoded by a polynucleotide with the sequence identity for the coding sequence of the mature polypeptide of SEQ ID NO: 1 of at least 60%, for example, at least 65%, at least at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, encoding a polypeptide containing alpha-amylase activity. In one aspect, the mature polypeptide coding sequence is nucleotides 100-1413 of SEQ ID NO: 1. In one embodiment, the parent is encoded by a polynucleotide that comprises or consists of nucleotides 100 to 1413 of SEQ ID NO: 1.
[0056] [0056] The parent can be obtained from microorganisms of any gender. For the purposes of the present invention, the term "obtained from", as used herein in connection with a given source must mean that the parent encoded by a polynucleotide is produced by the source or by a cell in which the polynucleotide from the source In one aspect, the parent is secreted extracellularly.
[0057] [0057] The parent may be a fungal alpha-amylase. For example, the parent may be a filamentous fungus alpha-amylase, such as a Rhizomucor alpha-amylase.
[0058] [0058] In another aspect, the parent is an alpha-amylase from Rhizomucor pusillus, for example, the alpha-amylase from SEQ ID NO: 2 or its mature polypeptide. In another embodiment, the parental is the coding sequence for mature alpha amylase polypeptide deposited in DSM 15334.
[0059] [0059] It should be understood that for the species mentioned above, the invention covers both perfect and imperfect states, and other taxonomic equivalents, for example, anamorphic, regardless of the name by which the species are known. Those skilled in the art will readily recognize the identity of appropriate equivalents.
[0060] [0060] Strains of these species are readily accessible to the public in a number of crop collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von und Mikroorganismen Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS) and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL).
[0061] [0061] The parent can be identified and obtained from other sources, including microorganisms isolated from nature (for example, soil, compound fertilizers, water, etc.), or DNA samples obtained directly from natural materials (for example, example, soil, compound fertilizers, water, etc.) using the aforementioned probes. Techniques for isolating microorganisms and DNA directly from natural habitats are well known in the art. The polynucleotide encoding a parent can then be obtained by sorting similarly from a genomic library or from the cDNA of another microorganism or a mixed DNA sample. Once a polynucleotide encoding a parent with a probe (s) has been detected, the polynucleotide can be isolated or cloned using techniques that are known to those skilled in the art (see, for example, Sambrook, Fritsch, and Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor, New York).
[0062] [0062] The parent may be a hybrid polypeptide in which a portion of a polypeptide is fused at the N-terminal and / or C-terminal of a portion of another polypeptide (s).
[0063] [0063] The parent may also be a fused polypeptide or cleavable fusion polypeptide, wherein a polypeptide is fused at the N-terminal and / or C-terminal of another polypeptide (s). A fused polypeptide can be produced by fusing a polynucleotide encoding a polypeptide to a polynucleotide encoding another polypeptide. Techniques for producing fusion polypeptides are known in the art, and include linking the coding sequences encoding the polypeptides so that they are in frame and that the expression of the fusion polypeptide is under the control of the same (s) ) promoter (s) and terminator. Fusion polypeptides can also be constructed using intein technology in which fusions are created in a post-translational manner (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776 -779).
[0064] [0064] A fusion polypeptide may further comprise a cleavage site between the two polypeptides. After secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites described in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240248; and Stevens, 2003, Drug Discovery World 4: 35-48.
[0065] [0065] In a more particular embodiment, the hybrid polypeptide of the invention is a variant of the alpha amylase of the invention connected to a carbohydrate binding module (CBM), via a linker. These hybrids, comprising a polypeptide having alpha-amylase activity and a carbohydrate binding module, having mainly affinity for starch, have the advantage over existing alpha-amylases that by selecting a catalytic domain with desired properties, for example the profile pH, temperature profile, oxidation resistance, calcium stability, substrate affinity or product profile can be combined with a carbohydrate binding module with stronger or weaker binding affinities, such as example, specific affinities for amylose, specific affinities for amylopectin or affinities for specific structure in carbohydrate. Connector string
[0066] The linker sequence can be any appropriate linker sequence, for example, a linker sequence derived from an alpha-amylase or a glucoamylase (GA) (also referred to as an amyloglucosidase (AMG)). The linker may be a bond, or a short bond group, comprising from about 2 to about 100 carbon atoms, in particular from 2 to 40 carbon atoms. However, the linker is preferably a sequence of about 2 to about 100 amino acid residues, more preferably 4 to 40 amino acid residues, such as 6 to 15 amino acid residues.
[0067] [0067] Preferably, a hybrid polypeptide comprises a linker sequence derived from any species selected from the group consisting of Acremonium, Aspergillus, Athelia, Coniochaeta, Leucopaxillus, Meripilus, Pachykytospora, Penicillium, Sublispora, Trametes, Trichophaea, and Valsaria. The linker can also be derived from a bacterium, for example, from a strain within Bacillus sp. More preferably, the linker is derived from a species selected from the group consisting of Acremonium sp., Coniochaeta sp., Meripilus giganteus, Penicillium sp., Sublispora provurvata, Trametes corrugata, Trichophaea saccata, Valsaria rubricosa, Valsario spartii, Aspergillus kawachii niger, Athelia rolfsii, Leucopaxillus gigantus, Pachykytospora papayracea, Trametes cingulata and Bacillus flavothermus.
[0068] [0068] Even more preferably, the linker is a linker of a glucoamylase selected from the group consisting of Pachykytospora papayracea (eg SEQ ID NO: 8), Trametes cingulata (eg SEQ ID NO: 9), Leucopaxillus gigantus (eg SEQ ID NO: 10), Athelia rolfsii (eg SEQ ID NO: 19), Aspergillus kawachii (eg SEQ ID NO: 20), Aspergillus niger (eg SEQ ID NO: 21) or an alpha-amylase linker selected from the group consisting of Sublispora provurvata (for example SEQ ID NO: 12), Valsaria rubricosa (for example SEQ ID NO: 13), Acremonium sp. (for example SEQ ID NO: 14), Meripilus giganteus (for example SEQ ID NO: 15), Bacillus flavothermus (for example SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 18), Coniochaeta sp. AM603 (for example SEQ ID NO: 22), Coniochaeta sp. (for example SEQ ID NO: 23), Trametes corrugata (for example SEQ ID NO: 24), Valsario spartii (for example SEQ ID NO: 25), Penicillium sp. (for example SEQ ID NO: 26), Trichophaea saccata (for example SEQ ID NO: 11).
[0069] Also preferred for the invention is any amino acid linker sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% identity with any selected sequence from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26.
[0070] [0070] In another preferred embodiment, the hybrid polypeptide has a linker sequence that is different from an amino acid sequences selected from the group consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 in no more than 10 positions, not more than 9 positions, not more than 8 positions, not more than 7 positions, not more than 6 positions, not more than 5 positions, not more than 4 positions, not more than 3 positions, not more than than two positions, or even no more than one position.
[0071] [0071] For more details on the DNA encoding of these linkers see WO 06/069290. Carbohydrate binding modules
[0072] [0072] A carbohydrate binding module (CBM), or as frequently referred to, a carbohydrate binding domain (CDB), is a sequence of amino acids from the polypeptide that binds preferentially to a poly- or oligosaccharide (carbohydrates), often - but not necessarily exclusively - in a water-insoluble form (including crystalline).
[0073] [0073] CBMs derived from starch degrading enzymes are often referred to as starch binding modules (SBM) or starch binding domains (SBD). CBMs can occur in certain amylolytic enzymes, such as certain glucoamylases (GA), or in enzymes such as cyclodextrin glucanotransferases, or in alpha-amylases. Likewise, other CBMS subcasses would include, for example, cellulose binding modules (CBMs from cellulolytic enzymes), chitin binding modules (CBMs that typically occur in chitinases), chitin binding modules (CBMs that typically occur in xylanases), mannan-binding modules (CBMs that typically occur in mannanases). SBMs are often referred to as SBDs (starch-binding domains).
[0074] [0074] CBMs are found as integral parts of large polypeptides or proteins consisting of two or more regions of amino acid sequences of the polypeptide, especially hydrolytic enzymes (hydrolases) that typically comprise a catalyst module containing the active site for the substrate hydrolysis and a carbohydrate binding module (CBM) for bonding with the carbohydrate substrate in question. Such enzymes may comprise more than one catalyst module and one, two or three CBMs and, optionally, further comprise one or more regions of the polypeptide amino acid sequence linking the CBM (s) with the catalyst module (s) ), a region of the latter type being generally denoted as a "linker". Examples of hydrolytic enzymes that comprise CBM - some of which have already been mentioned above - are cellulases, xylanases, mannanases, arabinofuranosidases, acetylesterases and chitinases. CBMs have also been found in algae, for example, in red Porphyra purpurea algae in the form of a non-hydrolytic polysaccharide binding protein.
[0075] [0075] In proteins / polypeptides in which CBMs occur (for example, enzymes, typically hydrolytic enzymes), CBM can be located at the N-terminal or C-terminal or in an internal position.
[0076] [0076] That part of a polypeptide or protein (for example, hydrolytic enzyme), which constitutes CBM on its own typically consists of more than about 30 and less than about 250 amino acid residues.
[0077] [0077] The "Family 20 carbohydrate binding module" or CBM-20 module is in the context of the present invention defined as a sequence of approximately 100 amino acids having at least 45% identity with the carbohydrate binding module (CBM) of the polypeptide represented in Figure 1 by Joergensen et al., 1997, Biotechnol. Lett. 19: 1027-1031. CBM comprises the last 102 amino acids of the polypeptide, that is, the subsequence of amino acid 582 to amino acid 683. The numbering of the glycoside hydrolase families follows the concept of Coutinho, PM & Henrissat, B. (1999) CAZy - Carbohydrate-Active enzymes server a URL: afmb.cnrs-mrs.fr/~cazy/CAZY/index.html or alternatively Coutinho & Henrissat, 1999, The modular structure of cellulases and other carbohydrate-active enzymes: an integrated database approach. In “Genetics, Biochemistry and Ecology of Cellulose Degradation", K. Ohmiya, K. Hayashi, K. Sakka, Y. Kobayashi, S. Karita and T. Kimura eds., Uni Publishers Co., Tokyo, pp. 15-23 and Bourne and Henrissat, 2001, Glycoside hydrolases and glycosyltransferases: families and functional modules, Current Opinion in Structural Biology 11: 593-600.
[0078] [0078] Examples of enzymes that comprise a CBM suitable for use in the context of the invention, are alpha-amylases, maltogenic alpha-amylases, cellulases, xylanases, mannases, arabinofuranosidases, acetylesterases and chitinases. Other CBMs of interest in relation to the present invention include CBMs derived from glucoamylases (EC 3.2.1.3) or from CGTases (EC 2.4.1.19).
[0079] [0079] CBMs derived from fungal, bacterial or plant sources will generally be suitable for use in the hybrid of the invention. Preferred are CBMs of fungal origin. In this context, appropriate techniques for the isolation of relevant genes are well known in the art.
[0080] [0080] Hybrids comprising a Family 20, 21 or 25 carbohydrate binding module CBM are preferred. The Family 20 carbohydrate binding module CBMs suitable for the present invention which can be derived from Aspergillus awamori glucoamylases ( SWISSPROT Q12537), Aspergillus kawachii (SWISSPROT P23176), Aspergillus niger (SWISSPROT P04064), Aspergillus oryzae (SWISSPROT P36914), from Aspergillus kawachii (EMBL: # AB17 of beta-amylases from Bacillus cereus (SWISSPROT P36924), from CGTases from Bacillus circulans (SWISSPROT P43379).
[0081] [0081] Preferably, the hybrid comprises a CBM that is derived from any family or species selected from the group consisting of Acremonium, Aspergillus, Athelia, Coniochaeta, Cryptosporiopsis, Dichotomocladium, Dinemasporium, Diplodia, Gliocladium, Leucopaxillus, Malbranchea, Meripilus, Nectria, Pachykytospora, Penicillium, Rhizomucor, Rhizomucor pusillus, Streptomyces, Subulispora, Thermomyces, Trametes, Trichophaea saccata and Valsaria. CBM can also be derived from a plant, for example, from corn (for example, Zea mays) or a bacterium, for example, Bacillus. More preferably, the hybrid comprises a CBM, derived from any species selected from the group consisting of Acremonium sp., Aspergillus kawachii, Aspergillus niger, Aspergillus oryzae, Athelia rolfsii, Bacillus flavothermus, Coniochaeta sp., Cryptosporiopsis sp. sp., Diplodia sp., Gliocladium sp., Leucopaxillus gigantus, Malbranchea sp., Meripilus giganteus, Nectria sp., Pachykytospora papayracea, Penicillium sp. corrugata, Trichophaea saccata, Valsaria rubricosa, Valsario spartii and Zea mays.
[0082] [0082] More preferably, the hybrid comprises a CBM of a glucoamylase selected from the group consisting of Pachykytospora papayracea (SEQ ID NO: 28), Trametes cingulata (SEQ ID NO: 29), Leucopaxillus gigantus (SEQ ID NO: 30), Athelia rolfsii (SEQ ID NO: 36), Aspergillus kawachii (SEQ ID NO: 37), Aspergillus niger (SEQ ID NO: 38) or from an alpha-amylase selected from the group consisting of Trichopheraea saccata (SEQ ID NO: 27), Subulispora provurvata (SEQ ID NO: 31), Valsaria rubricosa (SEQ ID NO: 32), Acremonium sp. (SEQ ID NO: 33), Meripilus giganteus (SEQ ID NO: 34), Bacillus flavothermus (SEQ ID NO: 35), Coniochaeta sp. (SEQ ID NO: 39), Zea mays (SEQ ID NO: 40), Coniochaeta sp. (SEQ ID NO: 41), Trametes corrugata (SEQ ID NO: 42), Valsario spartii (SEQ ID NO: 43) and Penicillium sp. (SEQ ID NO: 44).
[0083] [0083] In another preferred embodiment, the hybrid enzyme has a CBM sequence that differs from an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO : 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44 in no more than 10 positions, no more than 9 positions, not more than 8 positions, not more than 7 positions, not more than 6 positions, not more than 5 positions, not more than 4 positions, not more than 3 positions, not more than two positions, or even no more than a position.
[0084] [0084] Also preferred are CBMs having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% identity with any selected sequence from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44.
[0085] [0085] In a particularly preferred embodiment, the alpha amylase variant of the invention is fused with Athelia rolfsii AMG (glucoamylase) linker (SEQ ID NO: 19) and CBM (SEQ ID NO: 36). This construct is shown in SEQ ID No. 5, except that the catalytic core included in SEQ ID No. 5 has none of the substitutions according to the invention and is therefore identical to that of the parent alpha-amylase shown as SEQ ID NO. : 2. The DNA encoding SEQ ID NO: 5 is described herein as SEQ ID NO: 4. More particularly, the alpha-amylase variant of the invention, is condensed with a linker and CBM having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% identity with the linker and CBM comprised in SEQ ID NO: 5.
[0086] In another particularly preferred embodiment, the alpha amylase variant of the invention is fused to the Aspergillus niger AMG (SEQ ID NO: 38) and CBM (SEQ ID NO: 38) linker. This construct is presented in SEQ ID NO: 7, except that the catalytic nucleus included in SEQ ID NO: 7 does not have any of the substitutions according to the invention and is therefore identical to that of the parent alpha-amylase shown as SEQ ID NO: 2. The DNA sequence encoding the SEQ ID NO: 7 polypeptide is described herein as SEQ ID NO: 6. More particularly, the alpha-amylase variant of the invention is condensed with a linker and CBM having at least at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or even at least 95% identity with the linker and CBM comprised in SEQ ID NO: 7.
[0087] [0087] For more details on DNA encoding CBMs see WO 06/069290. Preparation of Variants
[0088] [0088] Site-directed mutagenesis is a technique in which one or more (several) mutations are created at one or more sites defined in a polynucleotide encoding the parental.
[0089] [0089] Site-directed mutagenesis can be performed in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving cleavage by a restriction enzyme at a site on the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation into the polynucleotide. Generally, the restriction enzyme that digests the plasmid and oligonucleotide is the same, allowing the sticky ends of the plasmid and the insert to not bind together. See, for example, Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
[0090] [0090] Site-directed mutagenesis can also be performed in vivo, by methods known in the art. See, for example, US Patent Application Publication 2004/0171154; Storici et al., 2001, Nature Biotechnol. 19: 773776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.
[0091] [0091] Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.
[0092] [0092] Construction of the synthetic gene involves the in vitro synthesis of a polynucleotide molecule designed to encode a polypeptide of interest. Gene synthesis can be performed using a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies in which oligonucleotides are synthesized and mounted on photo-programmable microfluidic chips.
[0093] [0093] Single or multiple amino acid substitutions, deletions and / or insertions can be made and tested using known methods of mutagenesis, recombination and / or shuffling, followed by a relevant screening process, such as those revealed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (for example, Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent No. 5,223,409; WO 92/06204) and site-site mutagenesis directed (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).
[0094] [0094] Mutagenesis / scrambling methods can be combined with automated high-throughput screening methods to detect the activity of cloned mutagenized polypeptides, expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and quickly sequenced using standard methods in the art. These methods allow for the rapid determination of the importance of individual amino acid residues in a polypeptide.
[0095] [0095] Construction of the semi-synthetic gene can be achieved by combining aspects of the construction of the synthetic gene, and / or site-directed mutagenesis, and / or random mutagenesis and / or shuffling. Semi-synthetic construction can be typified by a process of using polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes can thus be synthesized again, while other regions can be amplified using site-specific mutagenic primers, while still other regions can be subjected to amplification of error-prone or non-error-prone PCR . Polynucleotide sequences can then be shuffled. Variants
[0096] [0096] The present invention provides alpha-amylase variants comprising a change in one (more) positions corresponding to positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265 , 383, and 410 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has alpha-amylase activity. In particular, the change is a replacement. In addition, the variant can be selected from the group consisting of:
[0097] A) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2;
[0098] [0098] b) a polypeptide encoded by a polynucleotide that hybridizes under conditions of low severity to (i) the coding sequence of the mature polypeptide of SEQ ID NO: 1, or (ii) the full length complementary filament of (i) ;
[0099] [0099] c) a polypeptide encoded by a polynucleotide with at least 60% identity to the coding sequence of the mature polypeptide of SEQ ID NO: 1; or
[0100] [00100] d) a fragment of the mature polypeptide of SEQ ID NO: 2, which has alpha-amylase activity.
[0101] [00101] In one embodiment, the variant has at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and / or at least 99%, but less than 100%, sequence identity with the mature polypeptide of SEQ ID NO: 2. In one aspect, the number of substitutions in the variants of the present invention is 1-20, for example, 1-10 and 1-5, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions .
[0102] [00102] In another embodiment, the variant is encoded by a polynucleotide having the sequence identity of at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, for the polypeptide coding sequence mature of SEQ ID NO: 1.
[0103] [00103] In another embodiment, the variant is encoded by a polynucleotide that hybridizes under conditions of very low severity, conditions of low severity, conditions of medium severity, conditions of medium-high severity, conditions of high severity, or conditions of very high severity with (i) the coding sequence for the mature polypeptide of SEQ ID NO: 1, or (ii) the full length complementary filament of (i) (Sambrook, Fritsch, and Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2nd ed, Cold Spring Harbor, New York).
[0104] [00104] The polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, can be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art. In particular, these probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene in it. Such probes can be considerably shorter than the complete sequence, but they must be at least 14, for example, at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, for example, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for the detection of the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
[0105] [00105] A genomic DNA or cDNA library prepared from such other organisms can be screened for DNA that hybridizes to the probes described above and encodes a parent. Genomic or other DNA from such other organisms can be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA can be transferred and immobilized on nitrocellulose or other appropriate carrier material. In order to identify a clone or DNA that is homologous with SEQ ID NO: 1 or a subsequence thereof, the carrier material is used in a Southern blot.
[0106] [00106] For the purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a probe labeled nucleotide corresponding to the polynucleotide shown in SEQ ID NO: 1, its complementary filament, or a subsequence thereof, under very low to very high conditions severity. Molecules to which the probe hybridizes can be detected using, for example, X-ray film or any other means of detection known in the art.
[0107] [00107] In one aspect, the nucleic acid probe is the coding sequence for the mature polypeptide of SEQ ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 100 to 1413 of SEQ ID NO: 1. In another aspect, the nucleic acid probe is a polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO: 1.
[0108] [00108] For long probes of at least 100 nucleotides in length, conditions from very low to very high severity are defined as prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / ml of DNA of sheared and denatured salmon sperm, and either 25% formamide for very low and low severity, 35% formamide for medium and medium-high severity, or 50% formamide for high and very high severity, following standard Southern blotting procedures for 12 to 24 hours optimally. The material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45 ° C (very low severity), 50 ° C (low severity), 55 ° C (medium severity), 60 ° C (medium severity) -high), 65 ° C (high severity), or 70 ° C (very high severity).
[0109] [00109] For short probes that are about 15 nucleotides to about 70 nucleotides in length, severity conditions are defined as prehybridization and hybridization at about 5 ° C to about 10 ° C below the calculated Tm using the calculation accordingly with Bolton and McCarthy (1962, Proc. Natl. Acad. Sci. USA 48: 1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP- 40, 1X Denhardt solution, 1 mM sodium pyrophosphate, 1 mM monobasic sodium phosphate, 0.1 mM ATP, and 0.2 mg yeast RNA per ml following standard Southern blotting procedures for 12 to 24 hours so excellent. The vehicle material is finally washed once in 6X SSC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5 ° C to 10 ° C below the calculated Tm.
[0110] [00110] In another embodiment the variant is a fragment of the mature polypeptide of SEQ ID NO: 2 having a substitution in one or more positions corresponding to positions 128, 143, 141, 192, 20, 76, 123, 136, 142 , 165, 219, 224, 265, 383 and 410, which has alpha-amylase activity containing for example at least 435 amino acid residues, for example, at least 433 or for example at least 431 amino acid residues.
[0111] [00111] In one aspect, a variant comprises a substitution in one or more (several) positions corresponding to the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265 , 383, and 410. In another aspect, a variant comprises a substitution in two positions corresponding to any of the positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in three positions corresponding to any of the positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224 , 265, 383, and 410. In another aspect, a variant comprises a substitution in four positions corresponding to any of the 2 positions selected from 0, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219 , 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in five positions corresponding to any of the selected positions in tre 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a six-position substitution corresponding to any of the positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a seven-position substitution corresponding to any of the positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises an eight-position substitution corresponding to any one of the positions selected from among 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in nine positions corresponding to any one of the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in ten positions corresponding to any of the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in eleven positions corresponding to any of the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in twelve positions corresponding to any of the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in thirteen positions corresponding to any of the selected positions from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in fourteen positions corresponding to any of the positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410. In another aspect, a variant comprises a substitution in each position corresponding to positions selected from 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410 .
[0112] [00112] In a particular embodiment the variant comprises substitutions in positions 128 and 143. In another particular embodiment the variant comprises substitutions in positions 128 and 141. In another particular embodiment the variant comprises substitutions in positions 141 and 143 .
[0113] [00113] In a particular embodiment the variant comprises substitutions in positions 128, 141, and 143. In another particular embodiment the variant comprises substitutions in positions 128, 141, and 192. In another particular embodiment the variant comprises substitutions in positions 128, 143 and 192. In another particular embodiment the variant comprises substitutions in positions 141, 143 and 192.
[0114] [00114] In another particular embodiment the variant comprises substitutions in positions 128, 141, 143 and 192.
[0115] [00115] In one aspect, the variant comprises a substitution in one position corresponding to position 20. In another aspect, the amino acid in a position corresponding to position 20 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ser.
[0116] [00116] In one aspect, the variant comprises a substitution in one position corresponding to position 76. In another aspect, the amino acid in a position corresponding to position 76 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly.
[0117] [00117] In one aspect, the variant comprises a substitution in one position corresponding to position 123. In another aspect, the amino acid in a position corresponding to position 123 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with His.
[0118] [00118] In one aspect, the variant comprises a substitution in one position corresponding to position 128. In another aspect, the amino acid in a position corresponding to position 128 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp.
[0119] [00119] In one aspect, the variant comprises a substitution in one position corresponding to position 136. In another aspect, the amino acid in a position corresponding to position 136 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Phe.
[0120] [00120] In another aspect, the variant comprises a substitution in a position corresponding to position 141. In another aspect, the amino acid in a position corresponding to position 141 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Trp.
[0121] [00121] In one aspect, the variant comprises a substitution in one position corresponding to position 141. In another aspect, the amino acid in a position corresponding to position 141 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg.
[0122] [00122] In another aspect, the variant comprises a substitution in a position corresponding to position 142. In another aspect, the amino acid in a position corresponding to position 142 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp.
[0123] [00123] In another aspect, the variant comprises a substitution in a position corresponding to position 143. In another aspect, the amino acid in a position corresponding to position 143 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asn.
[0124] [00124] In one aspect, the variant comprises a substitution in one position corresponding to position 165. In another aspect, the amino acid in a position corresponding to position 165 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Met.
[0125] [00125] In another aspect, the variant comprises a substitution in one position corresponding to position 192. In another aspect, the amino acid in a position corresponding to position 192 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg.
[0126] [00126] In another aspect, the variant comprises a substitution in one position corresponding to position 219. In another aspect, the amino acid in a position corresponding to position 219 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys.
[0127] [00127] In one aspect, the variant comprises a substitution in one position corresponding to position 224. In another aspect, the amino acid in a position corresponding to position 224 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
[0128] [00128] In one aspect, the variant comprises a substitution in one position corresponding to position 224. In another aspect, the amino acid in a position corresponding to position 224 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg.
[0129] [00129] In one aspect, the variant comprises a substitution in one position corresponding to position 265. In another aspect, the amino acid in a position corresponding to position 265 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Cys.
[0130] [00130] In one aspect, the variant comprises a substitution in one position corresponding to position 383. In another aspect, the amino acid in a position corresponding to position 383 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Arg.
[0131] [00131] In another aspect, the variant comprises a substitution in a position corresponding to position 410. In another aspect, the amino acid in a position corresponding to position 410 is replaced with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Ala.
[0132] [00132] In another aspect, the variant comprises the G20S substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A76G substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the S123H substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the G128D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the K136F substitution of the mature polypeptide of SEQ ID NO: : 2. In another aspect, the variant comprises the Y141W substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the Y141R substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the N142D substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the D143N substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the D165M substitution of the mature polypeptide d and SEQ ID NO: 2. In another aspect, the variant comprises the K192R substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the P219C substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect , the variant comprises the P224A substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the P224R substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the A265C substitution of the mature polypeptide. of SEQ ID NO: 2. In another aspect, the variant comprises the N383R substitution of the mature polypeptide of SEQ ID NO: 2. In another aspect, the variant comprises the V410A substitution of the mature polypeptide of SEQ ID NO: 2.
[0133] [00133] In another aspect, the variant comprises the Y141W substitution of the mature polypeptide of SEQ ID NO: 2.
[0134] [00134] In another aspect, the variant comprises the Y141R substitution of the mature polypeptide of SEQ ID NO: 2.
[0135] [00135] In another aspect, the variant comprises the K136F substitution of the mature polypeptide of SEQ ID NO: 2.
[0136] [00136] In another aspect, the variant comprises the K192R substitution of the mature polypeptide of SEQ ID NO: 2.
[0137] [00137] In another aspect, the variant comprises the P224A substitution of the mature polypeptide of SEQ ID NO: 2.
[0138] [00138] In another aspect, the variant comprises the P224R substitution of the mature polypeptide of SEQ ID NO: 2.
[0139] [00139] In another aspect, the variant comprises the S123H + Y141W substitutions of the mature polypeptide of SEQ ID NO: 2.
[0140] [00140] In another aspect, the variant comprises the G20S + Y141W substitutions of the mature polypeptide of SEQ ID NO: 2.
[0141] [00141] In another aspect, the variant comprises the A76G + Y141W substitutions of the mature polypeptide of SEQ ID NO: 2.
[0142] [00142] In another aspect, the variant comprises the G128D + Y141W substitutions of the mature polypeptide of SEQ ID NO: 2.
[0143] [00143] In another aspect, the variant comprises the G128D + D143N substitutions of the mature polypeptide of SEQ ID NO: 2.
[0144] [00144] In another aspect, the variant comprises the Y141W + D143N substitutions of the mature polypeptide of SEQ ID NO: 2.
[0145] [00145] In another aspect, the variant comprises the Y141W + K192R substitutions of the mature polypeptide of SEQ ID NO: 2.
[0146] [00146] In another aspect, the variant comprises the Y141W + P219C substitutions of the mature polypeptide of SEQ ID NO: 2.
[0147] [00147] In another aspect, the variant comprises the Y141W + N383R substitutions of the mature polypeptide of SEQ ID NO: 2.
[0148] [00148] In another aspect, the variant comprises the N142D + D143N substitutions of the mature polypeptide of SEQ ID NO: 2.
[0149] [00149] In another aspect, the variant comprises the G128D + Y141W + D143N substitutions of the mature polypeptide of SEQ ID NO: 2.
[0150] [00150] In another aspect, the variant comprises the Y141W + N142D + D143N substitutions of the mature polypeptide of SEQ ID NO: 2.
[0151] [00151] In another aspect, the variant comprises the Y141W + D143N + K192R substitutions of the mature polypeptide of SEQ ID NO: 2.
[0152] [00152] In another aspect, the variant comprises the Y141W + D143N + P219C substitutions of the mature polypeptide of SEQ ID NO: 2.
[0153] [00153] In another aspect, the variant comprises the Y141W + K192R + V410A substitutions of the mature polypeptide of SEQ ID NO: 2.
[0154] [00154] In another aspect, the variant comprises the Y141W + P219C + A265C substitutions of the mature polypeptide of SEQ ID NO: 2.
[0155] [00155] In another aspect, the variant comprises the G128D + D143N + K192R substitutions of the mature polypeptide of SEQ ID NO: 2.
[0156] [00156] In another aspect, the variant comprises the G128D + Y141W + D143N + K192R substitutions of the mature polypeptide of SEQ ID NO: 2.
[0157] [00157] In another aspect, the variant comprises the G128D + D143N + K192R + P219C + Y141W substitutions of the mature polypeptide of SEQ ID NO: 2.
[0158] [00158] In another aspect, the variant comprises the Y141W + D143N + K192R + P219C substitutions of the mature polypeptide of SEQ ID NO: 2.
[0159] [00159] The variants can also comprise one or more additional changes in one or more (for example, several) other positions.
[0160] [00160] Amino acid changes may be of a small nature, that is, conservative amino acid substitutions, deletions or insertions that do not significantly affect protein duplication and / or activity; small deletions, typically 1-30 amino acids; small extensions of amino- or carboxyl-terminal, such as an amino-terminal methionine residue; a small binding peptide of up to 20-25 residues; or a small extension that facilitates purification by changing a liquid charge or other function, such as a polyhistidine tract, an antigenic epitope or a binding domain.
[0161] [00161] Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly.
[0162] [00162] The essential amino acids in a parent can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scan mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, single alanine mutations are introduced into each residue in the molecule, and the resulting mutant molecules are tested for alpha-amylase activity to identify amino acid residues that are critical to the molecule's activity. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of alpha-amylase or other biological interaction can also be determined by physical analysis of the structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photo-affinity labeling in conjunction with contact site amino acid mutation putative. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identities of essential amino acids can also be deduced from the analysis of identities with polypeptides that are related to the parent.
[0163] [00163] In one embodiment, the variant has improved pH stability compared to the parental enzyme.
[0164] [00164] In one embodiment, the variant has improved storage stability compared to the parental enzyme.
[0165] [00165] In one embodiment, the variant has improved thermostability compared to the parental enzyme.
[0166] [00166] Polynucleotides
[0167] The present invention also relates to isolated polynucleotides encoding any of the variants of the present invention.
[0168] [00168] Nucleic acid constructs
[0169] The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more (several) control sequences that direct expression of the coding sequence in an appropriate host cell under compatible conditions with the control sequences.
[0170] [00170] A polynucleotide can be manipulated in several ways to provide expression of a variant. Manipulation of the polynucleotide before insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.
[0171] The control sequence can be a promoter sequence, which is recognized by a host cell for expression of the polynucleotide. The promoter sequence contains transcriptional control sequences that measure the expression of the variant. The promoter can be any nucleic acid sequence that shows transcriptional activity in the host cell including mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides or homologous or heterologous to the host cell.
[0172] [00172] Examples of promoters suitable for directing the transcription of the nucleic acid constructs of the present invention in a bacterial host cell are the promoters obtained from the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase gene ( amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus subtilis levansucrase (sacB) gene, Bacillus subtilis xylA and xylB genes, E. coli lac operon, gene agarase and agarase gene (dagA), and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc Natl. Acad. Sci. USA 80: 21-25). Other promoters are described in "Useful proteins from recombinant bacteria” in Gilbert et al., 1980, Scientific American 242: 74-94; and in Sambrook et al., 1989, supra.
[0173] [00173] Examples of promoters suitable for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are the promoters obtained from the Aspergillus nidulans acetamidase genes, neutral Aspergillus niger alpha-amylase acid-stable in Aspergillus niger, glucoamylase in Aspergillus niger or Aspergillus awamori (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose isomeric oxide oxide oxide oxide oxide oxide oxide 7 types yeast type 7 in Fusarium venenatum (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, celobiohydrolase I Trichoderma reesei, cellobiohydrolase II in Trichoderma reesei, endoglucanase I in Trichoderma reesei, endoglucanase II of Trichoderma reese i, endoglucanase III in Trichoderma reesei, endoglucanase IV sw Trichoderma reesei, endoglucanase V from Trichoderma reesei, xylanase I in Trichoderma reesei, xylanase II from Trichoderma reesei, beta-xylidasidase from Trichoderma reesei, as well as the promoter NA (as a promoter NA2) including a gene encoding a neutral alpha-amylase in Aspergilli in which the untranslated leader has been replaced by an untranslated leader from a gene encoding triose phosphate isomerase in Aspergilli; non-limiting examples include modified promoters including the gene encoding neutral alpha-amylase in Aspergillus niger in which the untranslated leader has been replaced by an untranslated leader from the gene encoding triose phosphate isomerase in Aspergillus nidulans or Aspergillus oryzae); and mutant, truncated, and hybrid promoters thereof.
[0174] [00174] In a yeast host, usable promoters are obtained from the genes for enolase in Saccharomyces cerevisiae (ENO-1), galactokinase in Saccharomyces cerevisiae (GAL1), alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase in ADH , ADH2 / GAP), triose phosphate isomerase in Saccharomyces cerevisiae (TPI), metallothionein in Saccharomyces cerevisiae (CUP1), and 3-phosphoglycerate kinase in Saccharomyces cerevisiae. Other promoters usable for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
[0175] [00175] The control sequence can also be a transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3'-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell can be used.
[0176] [00176] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, Aspergillus niger glucoamylase, TAKA amylase of Aspergillus oryzae, and protease type tryporin.
[0177] Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other terminators for yeast host cells are described by Romanos et al., 1992, supra.
[0178] [00178] The control sequence can also be an appropriate leader sequence, an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5'-terminus of the polynucleotide encoding the variant. Any leader sequence that is functional in the host cell can be used.
[0179] [00179] The preferred leaders for filamentous fungal host cells are obtained from the Aspergillus oryzae TAKA amylase genes and Aspergillus nidulans phosphate isomerase triose.
[0180] [00180] Leaders suitable for yeast host cells are obtained from Saccharomyces cerevisiae enolase (ENO-1) genes, Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and dehydrogenase / glyceraldehyde-3 alcohol -phosphate dehydrogenase (ADH2 / GAP) from Saccharomyces cerevisiae.
[0181] The control sequence can also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the sequence encoding the variant and, when transcribed, is recognized by the host cell as a signal to add the polyadenosine residues to the mRNA transcribed. Any polyadenylation sequence that is functional in the host cell can be used.
[0182] [00182] The preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, TAKA amylase from Aspergillus oryzae protease and trypane protease and tyrosine tyrosine protease oxysporum.
[0183] [00183] The polyadenylation sequences usable for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.
[0184] [00184] The control sequence can also be a signal peptide coding region encoding a signal peptide attached to the N-terminus of a variant and directs the variant into the cell's secretory pathway. The 5 'end of the polynucleotide coding sequence can inherently contain a naturally occurring signal peptide coding region in the translation reading frame with the coding region segment encoding the variant Alternatively, the 5' end of the coding sequence can contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the coding region of the foreign signal peptide can simply replace the coding region of the natural signal peptide in order to enhance secretion of the variant. However, any signal peptide coding region that drives a variant expressed in the secretory pathway of a host cell can be used.
[0185] [00185] The effective signal peptide coding sequences for bacterial host cells are the signal peptide coding sequences obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase , alpha-amylase from Bacillus stearothermophilus, neutral proteases from Bacillus stearothermophilus (nprT, nprS, nprM), and Bacillus subtilis prsA. Other signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57: 109-137.
[0186] [00186] The effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the Aspergillus niger neutral amylase genes, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, cellulase Humicola insolens, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
[0187] [00187] The signal peptides usable for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other usable signal peptide coding sequences are described by Romanos et al., 1992, supra.
[0188] [00188] The control sequence can also be a propeptide coding region encoding a propeptide positioned at the N-terminus of a variant. The resulting polypeptide is known as a proenzyme or propolypeptide (a zimogene in some cases). A propolipeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolipeptide. The coding region of the propeptide can be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and alpha-factor of Saccharomyces cerevisiae.
[0189] [00189] Where both the signal peptide and propeptide regions are present at the N-terminus of a variant, the propeptide region is positioned close to the N-terminus of a variant and the signal peptide region is positioned close to the N- end of the propeptide region.
[0190] [00190] It may also be desirable to add regulatory sequences that allow regulation of the expression of a variant relative to the growth of the host cell. Examples of regulatory systems are those that cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or the GAL1 system can be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter can be used. Other examples of regulatory sequences are those that allow the amplification of the gene. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the variant must be operably linked with the regulatory sequence. Expression Vectors
[0191] [00191] The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translation stop signals. The various nucleotides and control sequences can be joined together to form a recombinant expression vector that can include one or more (several) convenient restriction sites to allow insertion or replacement of the polynucleotide encoding a variant at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide in an appropriate vector for expression. When creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
[0192] [00192] The recombinant expression vector can be any vector (for example, a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can cause polynucleotide expression. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.
[0193] [00193] The vector can be an autonomous replication vector, that is, a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a minichromosome, or artificial chromosome. The vector can contain any means to ensure self-replication. Alternatively, the vector can be one that, when introduced into the host cell, is integrated into the genome and replicated along with the chromosome (s) into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the host cell's genome, or a transposon, can be used.
[0194] [00194] The vector preferably contains one or more (several) selectable markers that allow easy selection of transformed, transfected, transduced, or similar cells. A selectable marker is a gene whose product provides biocidal or viral resistance, resistance to heavy metals, prototrophy for auxotrophs and the like.
[0195] [00195] Examples of selectable bacterial markers are genes dal of Bacillus licheniformis or Bacillus subtilis, or markers that confer resistance to antibiotics such as resistance to ampicillin, chloramphenicol, kanamycin, or tetracycline. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in filamentous fungal host cells include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (oryrine) -5'-phosphate decarboxylase), sC (adenyltransferase sulfate), and trpC (anthranylate synthase), as well as their equivalents. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus.
[0196] [00196] The vector preferably contains element (s) that allows integration of the vector in the genome of the host cell or autonomous replication of that in the cell independent of the genome.
[0197] [00197] For integration into the host cell genome, the vector can be based on the sequence of the polynucleotide encoding the variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional nucleotide sequences to direct integration by homologous recombination into the host cell genome at a precise location (s) on the chromosome (s). To increase the possibility of integration in a precise location, the integrational elements should count a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and / or 800 to 10,000 base pairs, which have a high degree of identity for the corresponding target sequence to accentuate the likelihood of homologous recombination. The integrational elements can be any sequence that is homologous to the target sequence in the host cell genome. In addition, the integrational elements can be nucleotide sequences not coding or coding. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.
[0198] [00198] For autonomous replication, the vector can also comprise a source of replication allowing the vector to replicate autonomously in the host cell in question. The source of replication can be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicate" means a nucleotide sequence that allows a plasmid or vector to replicate in vivo.
[0199] [00199] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 allowing replication in E. coli, and pUB110, pE194, pTA1060, and pAMB1 allowing replication in Bacillus.
[0200] [00200] Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.
[0201] [00201] Examples of origins of replication usable in a filamentous fungus cell are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acid Res.15: 9163-9175 WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be obtained according to methods described in WO 00/24883.
[0202] [00202] More than one copy of a polynucleotide of the present invention can be inserted into the host cell to increase the production of a variant. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of a sequence into the genome of the host cell or by including a selectable marker from an amplifiable gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected by culturing the cells in the presence of the appropriate selectable agent.
[0203] [00203] The procedures used to link the elements described above to construct the recombinant expression vectors of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., 1989, supra) in order to obtain the substantially pure variants. Host cells
[0204] The present invention also relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more (several) control sequences that direct the production of a variant of the present invention. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integral or as self-replicating the extrachromosomal vector, as described above. The term "host cell" encompasses any progeny of a parental cell that is not identical to a parental cell due to mutations that occur during replication. The choice of a host cell will, to a large extent, depend on the gene encoding the variant and its source.
[0205] The host cell can be any cell usable in the recombinant production of a variant, for example, a prokaryote or a eukaryote.
[0206] [00206] The prokaryotic host cell can be any gram-positive or gram-negative bacteria. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.
[0207] [00207] The bacterial host cell can be any Bacillus cell, including, but not limited to, Bacillus alkalophilus cells, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lentus, Bacillus lentus , Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis.
[0208] The bacterial host cell can also be any Streptococcus cell, including, but not limited to, Streptococcus equisimilis cells, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp. Zooepidemicus.
[0209] The bacterial host cell can also be any Streptomyces cell, including, but not limited to, Streptomyces achromogenes cells, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans.
[0210] [00210] The introduction of DNA into a Bacillus cell can, for example, be carried out by transformation of the chloroplast (see, for example, Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), using cells competent (see, for example, Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), by electroporation (see, for example, Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, for example, Koehler and Thorne, 1987, J. Bacteriol. 169: 5271-5278). The introduction of DNA into an E. coli cell can, for example, be carried out by protoplast transformation (see, for example, Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, for example , Dower et al., 1988, Nucleic Acid Res. 16: 6127-6145). The introduction of DNA into a Streptomyces cell can, for example, be carried out by protoplast transformation and electroporation (see, for example, Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), by conjugation (see, for example, Mazodier et al., 1989, J. Bacteriol. 171: 35833585), or by transduction (see, for example, Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289 -6294). The introduction of DNA into a Pseudomonas cell can, for example, be carried out by electroporation (see, for example, Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or by conjugation (see, for example , Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71: 51-57). The introduction of DNA into a Streptococcus cell can, for example, be carried out by natural competence (see, for example, Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), by protoplast transformation (see, for example, example, Catt and Jollick, 1991, Microbios 68: 1892070, by electroporation (see, for example, Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804) or by conjugation (see, for example, Clewell , 1981, Microbiol Rev. 45: 409-436) However, any method known in the art for introducing DNA into a host cell can be used.
[0211] [00211] The host cell can also be a eukaryote, such as a mammalian cell, insect, plant or fungus.
[0212] [00212] The host cell can be a fungus cell. "Fungi" as used here include the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as Oomycota and all the mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th. Ed, 1995, CAB International, University Press, Cambridge, UK).
[0213] [00213] The fungal host cell can be a yeast cell. "Yeast" as used here includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to Fungi Imperfecti (Blastomycetes). Because the classification of yeast may change in the future, for the purposes of this invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, SM, and Davenport, RR, eds, Soc. App. Bacteriol Symposium Series No. 9, 1980).
[0214] [00214] The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell like the Kluyveromyces lactis cell, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomcesyces, kysyromycesy, diastatic norbensis, Saccharomyces oviformis, or Yarrowia lipolytica.
[0215] [00215] The fungal host cell can be a filamentous fungal cell. “Filamentous fungi” include all filamentous forms in the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by stretching the hyphae and carbon catabolism is mandatory aerobic. In contrast, vegetative growth by yeasts like Saccharomyces cerevisiae is by formation of shoots from a single-celled stalk and carbon catabolism can be fermentative.
[0216] [00216] The filamentous fungal host cells can be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucoric, Pyramid, Pyramid, Pyramid, Pyro, , Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.
[0217] [00217] For example, the filamentous fungal host cells may be a cell of Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Cerioriporisis, Cerierkipera, Ceri pannocinta, rivulose Ceriporiopsis, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, lucknowense Chrysosporium, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum cinereus Coprinus, Coriolus hirsutus, Fusarium bactridioides, cerealis Fusarium Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium arium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotielusyon, terrestrial, terrarium, terrarium , Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.
[0218] [00218] Fungal cells can be transformed by a process involving the formation of protoplasts, the transformation of protoplasts, and regeneration of the cell wall in a manner known per se. Appropriate procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023 and Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474. Appropriate methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Yeast can be transformed using the procedures described by Becker and Guarente, In Abelson, JN and Simon, MI, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc. , New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920. Production methods
[0219] The present invention also relates to methods of producing a variant, comprising: (a) culturing a host cell of the present invention under conditions suitable for expression of the variant; and (b) recover the variant.
[0220] [00220] Host cells are cultured in an appropriate nutrient medium for the production of a variant using methods known in the art. For example, the cell can be grown by shaking flask cultivation, or small or large scale fermentation (including continuous, batch, batch fed or solid fermentation) in laboratory or industrial fermenters carried out in an appropriate medium and under conditions allowing that the polypeptide is expressed and / or isolated. Cultivation takes place in an appropriate nutrient medium comprising sources of carbon and nitrogen and inorganic salts, using procedures known in the art. The appropriate media are available from commercial suppliers or can be prepared according to published compositions (for example, in the catalogs of the American Type Culture Collection). If a variant is secreted into the nutrient medium, a variant can be recovered directly from the medium. If a variant is not secreted, it can be recovered from cell lysates.
[0221] [00221] The variant can be detected using methods known in the art that are specific to the variants. These detection methods can include the use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme test can be used to determine the activity of the variant.
[0222] [00222] The variant can be recovered by methods known in the art. For example, the variant can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation.
[0223] [00223] The variant can be purified by various procedures known in the art including, but not limited to, chromatography (for example, ion exchange, affinity, hydrophobic, chromato-focusing and size exclusion), electrophoretic procedures (for example, preparative isoelectric focusing) , differential solubility (eg, ammonium sulfate precipitation), SDS-PAGE, or extraction (see, for example, Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989) obtain substantially pure variants.
[0224] [00224] In an alternative aspect, the variant is not recovered, but instead a host cell of the present invention expressing a variant is used as a source of the variant. Compositions
[0225] [00225] The present invention also relates to compositions comprising a variant of the present invention. Preferably, the compositions are enriched in such a variant. The term "enriched" means that the alpha-amylase activity of the composition has been increased, for example, with an enrichment factor of 1.1.
[0226] [00226] The composition may comprise a variant as the main enzyme component, for example, a one-component composition. Alternatively, the composition may comprise multiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidase, -glucosidase, haloperoxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase. In a particular embodiment the composition comprises an amylase variant according to the invention and one or more enzymes selected from the group consisting of a protease, a glucoamylase.
[0227] [00227] The additional enzyme (s) can be produced, for example, by a microorganism belonging to the genus Aspergillus, for example, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus , Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae; Fusarium, for example, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium arcochroum, Fusarium sulphureum, Fusarium sulphureum, Fusarium sulphureum Fusarium trichothecioides, or Fusarium venenatum; Humicola, for example, Humicola insolens or Humicola lanuginosa; or Trichoderma, for example, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.
[0228] [00228] The compositions can be prepared according to methods known in the art and can be in the form of a liquid or dry composition. For example, the composition can be in the form of a granulate or a microgranulate. The variant can be stabilized according to methods known in the art. Plants
[0229] [00229] The present invention also relates to plants, for example, a transgenic plant, plant part, or plant cell, comprising a polynucleotide of the present invention in order to express and produce a variant in recoverable amounts. The variant can be recovered from the plant or plant part. Alternatively, the plant or plant part containing a variant can be used as such to improve the quality of a food or feed, for example, by improving the nutritional value, palatability, and rheological properties, or to destroy an anti-nutritive factor.
[0230] [00230] The transgenic plant can be dicotyledonous (dicot) or monocotyledonous (monocot). Examples of monocotyledonous plants are grasses, such as meadow grass (blue grass, Poa), forage grass like Festuca, Lolium, temperate grass, like Agrostis, and cereals, for example, wheat, oats, rye, barley, rice, sorghum and maize (maize).
[0231] [00231] Examples of dicotyledonous plants are tobacco, vegetables such as lupines, potatoes, sugar beets, peas, beans and soybeans, and cruciferous plants (Brassicaceae family), such as cauliflower, rapeseed and the closely related model organism Arabidopsis thaliana.
[0232] [00232] Examples of plant parts are trunk, callus, leaves, root, fruits, seeds and tubers, as well as individual tissues, these parts comprising, for example, epidermis, mesophile, parenchyma, vascular tissues, meristems. The compartments of specific plant cells are chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes, and cytoplasm are also considered to be a part of the plant. In addition, any plant cell, whatever the origin of the tissue, is considered to be a part of the plant. Likewise, plant parts of specific tissues and cells isolated to facilitate the use of the invention are also considered to be plant parts, for example, embryos, endosperm, aleurone and seed covers.
[0233] [00233] Also included within the scope of the present invention is the progeny of such plants, plant parts, and plant cells.
[0234] [00234] The transgenic plant or plant cell expressing a variant can be constructed according to methods known in the art. In summary, the plant or plant cell is constructed by incorporating or more (several) expression constructs encoding a variant in the host genome of the plant or chloroplast genome and propagating the resulting modified plant or plant cell into a transgenic plant or plant cell .
[0235] The expression construct is conveniently a nucleic acid construct comprising a polynucleotide encoding an operably linked variant with appropriate regulatory sequences required for expression of the polynucleotide in the plant or plant part of choice. In addition, the expression construct may comprise a selectable marker usable to identify the plant cells in which the expression construct has been integrated and DNA sequences necessary for the introduction of the construct into the plant in question (the latter including the method of introducing the DNA to be used).
[0236] [00236] The choice of regulatory sequences, such as promoter and terminator sequences and optionally signal or traffic sequences, is determined, for example, based on when, where and how a variant is desired to be expressed. For example, expression of the gene encoding a variant may be constitutive or inducible, or it may be specific to the development, stage or tissue, and the gene product may be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiol. 86: 506.
[0237] [00237] For constitutive expression, 35S-CaMV, maize ubiquitin 1, and rice actin 1 promoter can be used (Franck et al., 1980, Cell 21: 285-294; Christensen et al., 1992, Plant Mol. Biol. 18: 675689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters can be, for example, a promoter of storage immersion tissues such as seeds, potato tubers, and fruits (Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or metabolic immersion tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863878), a specific seed promoter such as glutelin, prolamine, globulin, or rice albumin (Wu et al., 1998, Plant Cell Physiol. 39: 885-889), a Vicia faba promoter of legumin B4 and the unknown seed protein gene of Vicia faba (Conrad et al., 1998, J. Plant Physiol. 152: 708-711), a seed oil body protein promoter (Chen et al., 1998, Plant Cell Physiol. 39: 935-941), BrassA napus storage protein napA promoter, or any other specific seed promoter known in the art, for example, as described in WO 91/14772. In addition, the promoter may be a leaf-specific promoter such as the rbcs rice or tomato promoter (Kyozuka et al., 1993, Plant Physiol. 102: 991-1000), the promoter of the cholera virus adenine methyltransferase gene ( Mitra and Higgins, 1994, Plant Mol. Biol. 26: 8593), the promoter of the rice aldP gene (Kagaya et al., 1995, Mol. Gen. Genet. 248: 668-674), or a wound-inducible promoter as the potato pin2 promoter (Xu et al., 1993, Plant Mol. Biol. 22: 573-588). Likewise, the promoter may be inducible by abiotic treatments such as temperature, drought, or changes in salinity or induced by exogenously applied substances that activate the promoter, for example, ethanol, estrogen, plant hormones such as ethylene, abscisic acid and gibberellic acid , and heavy metals.
[0238] [00238] An enhancer element of the promoter can also be used to achieve greater expression of a variant in the plant. For example, the enhancer element of the promoter may be an intron that is placed between the promoter and the polynucleotide encoding a variant. For example, Xu et al., 1993, supra, describe the use of the first intron of the rice actin 1 gene to improve expression.
[0239] [00239] The selectable marker of the gene and any other parts of the expression construct can be chosen from those known in the art.
[0240] [00240] The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biological transformation and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio / Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
[0241] [00241] Currently, gene transfer mediated by Agrobacterium tumefaciens is the method of choice for generating transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Mol. Biol. 19: 15-38) and can also be used for transform monocots, although other transformation methods are often used for these plants. Currently, the method of choice for generating transgenic monocots is the bombardment of particles (microscopic gold or tungsten particles coated with transforming DNA) from embryonic calluses or developing embryos (Christou, 1992, Plant J. 2: 275-281; Shimamoto, 1994, Curr. Opin. Biotechnol. 5: 158-162; Vasil et al., 1992, Bio / Technology 10: 667-674). An alternative method for the transformation of monocots is based on transformation of protoplasts as described by Omirulleh et al., 1993, Plant Mol. Biol. 21: 415-428. Additional transformation methods for use in accordance with the present description include those described in US Patent Nos. 6,395,966 and 7,151,204 (both of which are incorporated herein by reference in their entirety).
[0242] [00242] Following the transformation, the transformants having incorporated the expression construct are selected and regenerated in complete plants according to methods well known in the art. Since the transformation procedure is designed for the selective elimination of selection genes either during regeneration or in subsequent generations using, for example, co-transformation with two separate T-DNA constructs, the site-specific excision of the selection gene by a specific recombinase.
[0243] [00243] In addition to directing the transformation to a particular plant genotype with a construct prepared in accordance with the present invention, transgenic plants can be made by crossing one plant having the construct to a second plant lacking the construct. For example, a construct encoding a variant can be introduced into a particular plant variety by crossing, without the need to directly transform a plant of the given variety each time. Thus, the present invention encompasses not only a plant directly regenerated from cells that have been transformed in accordance with the present invention, but also the progeny of such plants. As used here, the progeny can refer to the offspring of any generation of a parent plant prepared in accordance with the present invention. This progeny can include a DNA construct prepared in accordance with the present invention, or a portion of a DNA construct prepared in accordance with the present invention. The results of crossing the introduction of a transgene into a plant line by cross-pollinating a starting line with a donor plant line. Non-limiting examples of such steps are further articulated in US Patent No. 7,151,204.
[0244] [00244] Plants can be generated from a backcross conversion process. For example, plants include plants referred to as the backcrossed converted, lineage, congenital, or hybrid genotype.
[0245] [00245] Genetic markers can be used to assist in the introgression of one or more transgenes of the invention from one genetic background in the other. Marker-assisted selection offers advantages over conventional crossover in that it can be used to avoid errors caused by phenotypic variations. In addition, genetic markers can provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait that would otherwise have a non-agronomically desirable genetic background is crossed with an elite parent, genetic markers can be used to select the progeny that not only have the trait of interest, but also has a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits in a particular genetic background is minimized.
[0246] The present invention also relates to methods of producing a variant of the present invention comprising: (a) cultivating a transgenic plant or the plant cell comprising a polynucleotide encoding the variant under conditions leading to the production of the variant; and (b) recover the variant. Uses
[0247] [00247] The present invention is also directed to processes / methods using the polypeptides having alpha-amylase activity of the invention.
[0248] [00248] Uses according to the invention include conversion of starch into, for example, syrup and fermentation products, including ethanol and beverages. Examples of processes in which an alpha-amylase of the invention can be used include those described below and other processes for producing ethanol known in the art that require hydrolysis of the starch-containing material. Production of fermentation products Process for producing fermentation products from material containing gelatinized starch
[0249] [00249] In this respect the present invention relates to a process for producing a fermentation product, especially ethanol, from material containing starch, the process of which includes a liquefaction and saccharification step carried out sequentially or simultaneously and the fermentation steps.
[0250] [00250] The invention relates to a method for producing a fermentation product from material containing starch comprising the steps of:
[0251] [00251] (a) liquefy material containing starch using an alpha-amylase of the invention;
[0252] [00252] (b) saccharify the liquefied material obtained in step (a) using a glucoamylase; and
[0253] [00253] (c) ferment the saccharified material using a fermentation organism.
[0254] [00254] The fermentation product, as especially ethanol, can optionally be recovered after fermentation, for example, by distillation. The appropriate starch-containing starting materials are listed in the “starch-containing materials” section below. The contemplated enzymes are listed in the "enzymes" section below. Liquefaction is preferably carried out in the presence of an alpha-amylase. Fermentation is preferably carried out in the presence of yeast, preferably a strain of Saccharomyces. The appropriate fermentation organisms are listed in the "fermentation organisms" section below. In preferred embodiments, step (b) and (c) are carried out sequentially or simultaneously (i.e., as an SSF process).
[0255] [00255] In a particular embodiment, the process of the invention still comprises, before step (a), the steps of:
[0256] [00256] x) reducing the particle size of the starch-containing material, preferably by grinding; and
[0257] [00257] y) forming a suspension comprising the material containing starch and water.
[0258] [00258] The aqueous suspension may contain 10-40% by weight, preferably 25-35% by weight of material containing starch. The suspension is heated above its gelatinization temperature and alpha-amylase, preferably bacterial and / or fungal acid-amylase, can be added to initiate liquefaction (dilution). The slurry can in one embodiment be baked to further gelatinize the slurry before being subjected to an alpha-amylase in step (a) of the invention.
[0259] [00259] More specifically, liquefaction can be performed as a three-stage hot suspension process. The suspension is heated to 60-95 ° C, preferably 80-85 ° C, and alpha-amylase is added to initiate liquefaction (dilution). Then the suspension can be cooked quickly at a temperature between 95-140 ° C, preferably 105-125 ° C, for 1-15 minutes, preferably for 3-10 minutes, especially around 5 minutes. The suspension is cooled to 60-95 ° C and more alpha-amylase is added to complete hydrolysis (secondary liquefaction). The liquefaction process is generally carried out at pH 4.5-6.5, in particular, at a pH between 5 and 6. The whole ground and liquefied grains are known as mash-type stew bran.
[0260] [00260] Saccharification in step (b) can be performed using conditions well known in the art. For example, a complete saccharification process can take from about 24 to about 72 hours, however, it is only common to do a pre-saccharification of typically 4090 minutes at a temperature between 30-65 ° C, typically around 60 ° C, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically performed at temperatures of 30-65 ° C, typically around 60 ° C, and at a pH between 4 and 5, usually at about pH 4.5.
[0261] [00261] The process most widely used in the production of the fermentation product, especially ethanol, is the simultaneous saccharification and fermentation process (SSF), in which there is no retention stage for saccharification, meaning that the fermentation organism , such as yeast, and enzyme (s) can be added together. SSF can typically be performed at a temperature between 25 ° C and 40 ° C, as between 29 ° C and 35 ° C, as between 30 ° C and 34 ° C, as around 32 ° C. According to the invention, the temperature can be adjusted up or down during fermentation.
[0262] [00262] According to the present invention the fermentation step (c) can include, without limitation, fermentation processes used to produce alcohols (for example, ethanol, methanol, butanol); organic acids (for example, citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (for example, acetone); amino acids (for example, glutamic acid); gases (for example, H2 and CO2); antibiotics (for example, penicillin and tetracycline); enzymes; vitamins (for example, riboflavin, B12, beta-carotene); and hormones. Preferred fermentation processes include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art. Processes for producing fermentation products from non-gelatinized starch
[0263] [00263] In this aspect the invention relates to a process for producing a fermentation product from material containing starch without gelatinization of material containing starch (i.e., material containing uncooked starch). According to the invention the desired fermentation product, such as ethanol, can be produced without liquefying the aqueous suspension containing the material containing starch. In one embodiment a process of the invention includes saccharifying (milled) material containing starch, for example, granular starch, below its gelatinization temperature in the presence of an alpha-amylase of the invention to produce sugars that can be fermented in the desired fermentation product by an appropriate fermentation organism. In another embodiment, a glucoamylase and an alpha-amylase of the invention are used during saccharification and fermentation. Particularly the glucoamylase is Trametes cingulata AMG and the alpha amylase is the amylase of the invention preferably including a linker and a CBD. In yet another embodiment, protease, an alpha-amylase and a debranching enzyme (for example, a pullulanase or a glucoamylase) are used before saccharification and fermentation.
[0264] [00264] Consequently, in one aspect the invention relates to a method for producing a fermentation product from starch-containing material comprising:
[0265] [00265] (a) saccharify material containing starch with a glucoamylase and an alpha-amylase according to the invention, at a temperature below the initial gelatinization temperature of said material containing starch,
[0266] [00266] (b) ferment using a fermentation organism.
[0267] [00267] Steps (a) and (b) of the process of the invention can be carried out sequentially or simultaneously. In one embodiment, a suspension comprising water and material containing starch, is prepared before step (a).
[0268] [00268] The fermentation process can be carried out over a period of 1 to 250 hours, preferably from 25 to 190 hours, more preferably from 30 to 180 hours, more preferably from 40 to 170 hours, even more preferably from 50 to 160 hours , even more preferably from 60 to 150 hours, and even more preferably from 70 to 140 hours, and most preferably from 80 to 130 hours.
[0269] [00269] The term "initial gelatinization temperature" means that the lowest temperature at which the starch gelatinization begins. Starch heated in water begins to gelatinize between 50 ° C and 75 ° C; the exact temperature of gelatinization depends on the specific starch, and can be readily determined by the skilled person. Thus, the initial gelatinization temperature can vary according to the plant species from which the starch-containing material is obtained, as well as the growing conditions. In the context of this invention, the initial gelatinization temperature of a given material containing starch is the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein and Lii, 1992, Starch / Stãrke 44 (12): 461-466.
[0270] [00270] Before step (a) a suspension of material containing starch, such as granular starch, having 10-55% by weight of dry solids, preferably 25-40% by weight of dry solids, more preferably 30-35 % by weight of dry solids of material containing starch can be prepared. The suspension may include water and / or process water, such as grain residues (debris), water purifier, evaporator or distillate condensate, side extractor distillation water, or other process water from the fermentation product facility. Because the process of the invention is carried out below the gelatinization temperature and thus there is no significant increase in viscosity, high levels of grain residues can be used if desired. In one embodiment, the aqueous suspension contains from about 1 to about 70 vol. % of grain residues, preferably 15-60% vol. % of grain residues, especially about 30 to 50 vol. % of grain residues.
[0271] [00271] The starch-containing material can be prepared by reducing the particle size, preferably by wet or dry grinding, to 0.05 to 3.0 mm, preferably 0.1-0.5 mm. After undergoing a process of the invention at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or preferably at least 99% of the dry solids of the starch-containing material is converted to a soluble starch hydrolyzate.
[0272] [00272] The process of the invention is conducted at a temperature below the initial gelatinization temperature. Preferably the temperature at which step (a) is carried out is between 30-75 ° C, preferably between 45-60 ° C.
[0273] [00273] In a preferred embodiment, step (a) and step (b) are carried out as a sequential or simultaneous saccharification and fermentation process. In such a preferred embodiment the process is typically carried out at a temperature between 25 ° C and 40 ° C, as between 29 ° C and 35 ° C, as between 30 ° C and 34 ° C, as around 32 ° C . According to the invention, the temperature can be adjusted up or down during fermentation.
[0274] [00274] In one embodiment, simultaneous saccharification and fermentation are carried out so that the sugar level, like the glucose level, is kept as low as below 6% by weight, preferably below about 3% by weight, preferably below about 2% by weight, more preferred below about 1% by weight, even more preferred below about 0.5% by weight, or even more preferred 0.25% by weight , as below about 0.1% by weight. Such low levels of sugar can be obtained simply by using adjusted amounts of enzyme and fermentation organism. One skilled in the art can easily determine what amounts of enzyme and fermentation organism to use. The amounts of enzyme employed and fermentation organism can also be selected to maintain low concentrations of maltose in the fermentation broth. For example, the level of maltose can be kept below about 0.5% by weight or below about 0.2% by weight.
[0275] [00275] The process of the invention can be carried out at a pH in the range between 3 and 7, preferably at pH 3.5 to 6, or more preferably pH 4 to 5. Starch-containing materials
[0276] [00276] Any suitable starch-containing starting material, including granular starch, can be used in accordance with the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing starting materials, suitable for use in a process of the present invention, include tubers, roots, stems, whole grains, corn, ears, wheat, barley, rye, milo, sago, cassava, tapioca, sorghum, peas, rice, beans, or sweet potatoes, or mixtures thereof, or cereals, raw materials containing sugar, such as molasses, fruit materials, sugar cane or sugar beet, potatoes, and materials containing cellulose, such as wood or plant waste , or mixtures thereof. Contemplated are both waxy and non-waxy types of corn and barley.
[0277] [00277] The term "granular starch" means uncooked starch, that is, starch in its natural form found in cereals, tubers or grains. Starch is formed within plant cells as fine water-insoluble granules. When placed in cold water, the starch granules can absorb a small amount of the liquid and swell. At temperatures up to 50 ° C to 75 ° C the swelling can be reversible. However, with higher temperatures an irreversible swelling called "gelatinization" begins. Granular starch to be processed can be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure, or it can be a crude starch-containing material comprising ground whole grain including non-starch fractions such as germ and fiber residues. The raw material, as a whole grain, is milled in order to open the structure and allow for further processing. Two milling processes are preferred according to the invention: wet and dry milling. In dry grinding whole cores are ground and used. Wet grinding provides good separation of germ and flour (granules of starch and protein) and is often applied in places where the starch hydrolyzate is used in the production of syrups. Both dry and wet milling are well known in the starch processing technique and are also contemplated for the process of the invention.
[0278] [00278] The material containing starch is reduced in particle size, preferably by dry or wet grinding, in order to expose more surface area. In one embodiment the particle size is between 0.05 to 3.0 mm, preferably 0.1-0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70 %, even more preferably at least 90% of the starch-containing material passes through a sieve with a 0.05 to 3.0 mm screen, preferably a 0.1-0.5 mm screen. Fermentation products
[0279] [00279] The term "fermentation product" means a product produced by a process including a fermentation step using a fermentation organism. Fermentation products contemplated according to the invention include alcohols (for example, ethanol, methanol, butanol); organic acids (for example, citric acid, acetic acid, itaconic acid, lactic acid, gluconic acid); ketones (for example, acetone); amino acids (for example, glutamic acid); gases (for example, H2 and CO2); antibiotics (for example, penicillin and tetracycline); enzymes; vitamins (for example, riboflavin, B12, beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, for example, fuel ethanol; ethanol for beverages, that is, potable neutral alcohol; or industrial ethanol or products used in the consumable alcohol industry (eg beer and wine), dairy industry (eg fermented dairy products), leather industry and tobacco industry. Preferred types of beer include ales, stouts, porters, lagers, bitters, malt liqueurs, happoushu, beer with high alcohol content, beer with low alcohol content, low calorie beer or light beer. Preferred fermentation processes used include alcohol fermentation processes, as are well known in the art. Preferred fermentation processes are anaerobic fermentation processes, as are well known in the art. Fermentation organisms
[0280] [00280] "Fermentation organism" refers to any organism, including bacterial and fungal organisms, suitable for use in a fermentation process and capable of producing a desired fermentation product. Especially the appropriate fermentation organisms are capable of fermenting, that is, converting, sugars, such as glucose or maltose, directly or indirectly into the desired fermentation product. Examples of fermentation organisms include fungal organisms, such as yeast. Preferred yeast includes strains of Saccharomyces spp., In particular, Saccharomyces cerevisiae. Commercially available yeast includes, for example, Red Star ™ / Lesaffre Ethanol Red (available from Red Star / Lesaffre, USA) FALI (available from Fleischmann's Yeast, a division of Burns Philp Food Inc., USA), SUPERSTART (available from Alltech) , GERT STRAND (available from Gert Strand AB, Sweden) and FERMIOL (available from DSM Specialties). ENZYMES Glucoamylases
[0281] [00281] The term “glucoamylase” (1,4-alpha-D-glucan glucohydrolase, EC 3.2.1.3) is an enzyme, which catalyzes the release of D-glucose from the non-reducing ends of starch or oligo- and related polysaccharides.
[0282] [00282] Glucoamylase can be derived from any suitable source, for example, derived from a microorganism or a plant. The preferred glucoamylases are those of fungal or bacterial origin. Examples of suitable glucoamylases include Aspergillus glucoamylases, in particular Aspergillus niger G1 or G2 glucoamylase (Boel et al., 1984, EMBO J. 3 (5): 1097-1102), or a variant thereof, as described in WO 92/00381 , WO 00/04136 and WO 01/04273 (from Novozymes, Denmark); the glucoamylase from A. awamori described in WO 84/02921, glucoamylase from Aspergillus oryzae (Hata et al., 1991, Agric. Biol. Chem. 55 (4): 941-949), or variants or fragments thereof. Other variants of Aspergillus glucoamylase include variants with improved thermostability: G137A and G139A (Chen et al., 1996, Prot. Eng. 9: 499-505); D257E and D293E / Q (Chen et al., 1995, Prot. Eng. 8: 575-582); N182 (Chen et al., 1994, Biochem. J. 301: 275-281); disulfide bonds, A246C (Fierobe et al., 1996, Biochemistry 35: 8698-8704; and introduction of pro residues at positions A435 and S436 (Li et al., 1997, Prot. Eng. 10: 1199-1204.
[0283] [00283] Other glucoamylases include Athelia rolfsii (previously denoted Corticium rolfsii glucoamylase) (see US patent No. 4,727,026 and Nagasaka et al., 1998, Appl. Microbiol. Biotechnol. 50: 323-330), Talaromyces glucoamylases, in particular derived from Talaromyces duponti, Talaromyces emersonii (WO 99/28448), Talaromyces leycettanus (US patent No. Re. 32,153), and Talaromyces thermophilus (US patent No. 4,587,215), Trametes cingulata, Pachykytospora papyracea, and all Leopaxus, giant described in WO 2006/069289; or Peniophora rufomarginata described in PCT / US2007 / 066618; or a mixture of them.
[0284] [00284] Commercially available glucoamylase compositions include AMG 200L; AMG 300L; SUPER SAN ™, SAN ™ EXTRA L, SPIRIZYME ™ PLUS, SPIRIZYME ™ FUEL, SPIRIZYME ™ B4U, SPIRIZYME ULTRA ™, and AMG ™ E (from Novozymes A / S, Denmark); OPTIDEX ™ 300, GC480 ™ and GC147 ™ (from Genencor Int., USA); AMIGASE ™ and AMIGASE ™ PLUS (from DSM); G-ZYME ™ G900, G-ZYME ™ and G990 ZR (by Genencor Int.). Alpha-Amylases
[0285] [00285] The alpha-amylase variant according to the invention has been described in detail above. Other alpha-amylases of fungal or bacterial origin may also be relevant in combination with the alpha-amylase of the invention.
[0286] [00286] In a preferred embodiment, an additional alpha-amylase is an acid alpha-amylase, for example, fungal acid alpha-amylase or bacterial acid alpha-amylase. The term "acid alpha-amylase" means an alpha-amylase (EC 3.2.1.1) that added in an effective amount has an optimal activity at pH in the range of 3 to 7, preferably from 3.5 to 6, or more preferably 4-5. Bacterial Alpha-Amylases
[0287] [00287] The bacterial alpha-amylase can preferably be derived from the genus Bacillus.
[0288] [00288] In a preferred embodiment, Bacillus alpha-amylase is derived from a strain of B. licheniformis, B. amyloliquefaciens, B. subtilis or B. stearothermophilus, but can also be derived from other Bacillus sp. Specific examples of contemplated alpha-amylases include Bacillus licheniformis alpha-amylase (BLA) shown in SEQ ID NO: 4 in WO 99/19467, Bacillus amyloliquefaciens (BAN) alpha-amylase shown in SEQ ID NO: 5 in WO 99/19467, and the Bacillus stearothermophilus alpha-amylase (BSG) shown in SEQ ID NO: 3 in WO 99/19467. In one embodiment of the invention, alpha-amylase is an enzyme having a degree of identity of at least 60%, preferably at least 70%, more preferred at least 80%, even more preferred at least 90%, such as at least 95 %, at least 96%, at least 97%, at least 98% or at least 99% identity of any of the sequences shown as SEQ ID NO: 1, 2, 3, 4, or 5, respectively in WO 99 / 19467.
[0289] [00289] Bacillus alpha-amylase can also be a variant and / or hybrid, especially one described in any of WO 96/23873, WO 96/23874, WO 97/41213, WO 99/19467, WO 00/60059 , and WO 02/10355 (all documents incorporated herein by reference). Alpha-amylase variants specifically contemplated are described in US Patent Nos. 6,093,562, 6,187,576, and 6,297,038 (incorporated herein by reference) and include variants of Bacillus stearothermophilus alpha-amylase (BSG alpha-amylase) having a deletion of one or two amino acids at position 179 to 182, preferably a double deletion described in WO 96/23873 - see, for example, pag. 20, lines 1-10 (incorporated herein by reference), preferably corresponding to delta (181-182) compared to the wild-type BSG alpha-amylase amino acid sequence specified in SEQ ID NO: 3 described in WO 99 / 19467 or deletion of amino acids 179 and 180 using SEQ ID NO: 3 in WO 99/19467 for numbering (the reference of which is incorporated herein by reference). Even more preferred are Bacillus alpha-amylases, especially Bacillus stearothermophilus alpha-amylase, which has a delta double deletion (181-182) and further comprises an N193F substitution (also denoted I181 * + G182 * + N193F) compared to the amino acid sequence of wild-type Bacillus stearothermophilus alpha-amylase specified in SEQ ID NO: 3 described in WO 99/19467.
[0290] [00290] Alpha-amylase can also be a maltogenic alpha-amylase. A “maltogenic alpha-amylase” (glucan 1,4-alpha-maltohydrolase, EC 3.2.1.133) is capable of hydrolyzing amylose and amylopectin to maltose in the alpha configuration. A maltogenic alpha-amylase from Bacillus stearothermophilus strain NCIB 11837 is commercially available from Novozymes A / S, Denmark. Maltogenic alpha-amylase is described in US Patent Nos. 4,598,048, 4,604,355 and 6,162,628, which are incorporated herein by reference. Bacterial hybrid alpha-amylases
[0291] A specific specifically contemplated alpha-amylase comprises 445 C-terminal amino acid residues from Bacillus licheniformis alpha-amylase (shown as SEQ ID NO: 3 in WO 99/19467) and the 37 N-terminal amino acid residues from the alpha -amylase derived from Bacillus amyloliquefaciens (shown as SEQ ID NO: 5 in WO 99/19467), with one or more, especially all of the following substitutions:
[0292] [00292] G48A + T49I + G107A + H156Y + A181T + N190F + I201F + A209V + Q264S (using Bacillus licheniformis numbering). Also preferred are variants having one or more of the following mutations (or corresponding mutations in other dorsal structures of Bacillus alpha-amylase): H154Y, A181T, N190F, A209V and Q264S and / or deletion of two residues between positions 176 and 179, preferably deletion of E178 and G179 (using SEQ ID NO: 5 numbering from WO 99/19467).
[0293] [00293] Bacterial alpha-amylase can be added in amounts that are well known in the art. Fungal alpha-amylases
[0294] [00294] Fungal acid alpha-amylases include acid alpha-amylases derived from a strain of the genus Aspergillus, such as alpha-amylases from Aspergillus oryzae, Aspergillus niger, or Aspergillus kawachii.
[0295] [00295] A preferred fungal acid alpha-amylase is the Fungamyl-type alpha-amylase which is preferably derived from a strain of Aspergillus oryzae. In the present description, the term "Fungamyl alpha-amylase" indicates an alpha-amylase that exhibits a high identity, ie, more than 70%, more than 75%, more than 80%, more than 85% more than than 90%, more than 95%, more than 96%, more than 97%, more than 98%, more than 99% or even 100% identity for the mature part of the amino acid sequence shown in SEQ ID NO: 10 in WO 96/23874.
[0296] [00296] Another preferred acid alpha-amylase is derived from a strain of Aspergillus niger. In a preferred embodiment, the fungal acid alpha-amylase is one of A. niger described as “AMYA_ASPNG” in the Swiss-prot / TrEMBL database under primary accession number P56271 and described in detail in WO 89/01969 (Example 3). The acid alpha-amylase from Aspergillus niger is also shown as SEQ ID NO: 1 in WO 2004/080923 (Novozymes) which is incorporated herein by reference. Also variants of said fungal acid amylase having at least 70% identity, such as at least 80% or even at least 90% identity, such as at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity for SEQ ID NO: 1 in WO 2004/080923 are contemplated.
[0297] [00297] In a preferred embodiment the alpha-amylase is derived from Aspergillus kawachii and described by Kaneko et al., 1996, J. Ferment. Bioeng. 81: 292-298, Molecular-cloning and determination of the nucleotide-sequence of a gene encoding an acid-stable alpha-amylase from Aspergillus kawachii ”and also as EMBL: # AB008370.
[0298] [00298] Fungal acid alpha-amylase can also be a wild-type enzyme comprising a carbohydrate-binding module (CBM) and a catalytic alpha-amylase domain (i.e., a non-hybrid), or a variant thereof. In one embodiment, the wild-type acid alpha-amylase is derived from a strain of Aspergillus kawachii. Hybrid fungal alpha-amylases
[0299] [00299] In a preferred embodiment the acidic fungal alpha-amylase is a hybrid alpha-amylase. Preferred examples of hybrid fungal alpha-amylases include those described in WO 2005/003311 or US application publication 2005/0054071 (Novozymes) or US patent application 60 / 638,614 (Novozymes) which is incorporated herein by reference. The hybrid alpha-amylase can comprise a catalytic alpha-amylase (CD) domain and a carbohydrate-binding domain / module - (CBM) and optional linker
[0300] [00300] Specific examples of contemplated hybrid alpha-amylases include those described in order US 60 / 638,614 including variant Fungamyl with catalytic domain JA118 and Athelia rolfsii SBD (SEQ ID NO: 100 in order US no. 60 / 638,614), alpha- Rhizomucor pusillus amylase with Athelia rolfsii AMG and SBD linker (SEQ ID NO: 101 in US order no. 60 / 638,614) and Meripilus giganteus alpha-amylase with glucoamylase linker Athelia rolfsii and SBD (SEQ ID NO: 102 in US order no. 60 / 638,614).
[0301] [00301] Other specific examples of contemplated hybrid alpha-amylases include those described in U.S. application publication no. 2005/0054071, including those described in Table 3 on page 15, as Aspergillus niger alpha-amylase with Aspergillus kawachii linker and starch binding domain. Commercial Alpha-Amylase Products
[0302] Preferred commercial compositions comprising alpha-amylase include MYCOLASE from DSM (Gist Brocades), BAN ™, TERMAMYL ™ SC, FUNGAMYL ™, LIQUOZYME ™ X and SAN ™ SUPER, SAN ™ EXTRA L (Novozymes A / S) and CLARASE ™ L-40,000, DEX-LO ™, SPEZYME ™ FRED, SPEZYME ™ AA, SPEZYME ™ Ethyl, GC358, GC980, SPEZYME ™ RSL, and SPEZYME ™ DELTA AA (Genencor Int.).
[0303] [00303] The invention described and claimed herein should not be limited in scope by the specific embodiments described here, because these embodiments are intended as illustrations of the various aspects of the invention. Any equivalent embodiments are intended to be within the scope of the invention. In fact, various modifications of the invention in addition to those shown and described here will be apparent to the skilled person from the above description. These modifications are also intended to be within the scope of the appended claims. In the event of a conflict, this description including definitions will serve as a control. List of preferred embodiments
[0304] [00304] 1. Alpha-amylase variant, comprising a substitution, in one or more positions corresponding to positions 128, 143, 141, 192, 20, 76, 123, 136, 142, 165, 219, 224, 265, 383 , and 410 of the mature polypeptide of SEQ ID NO: 2, wherein the variant has alpha-amylase activity.
[0305] [00305] 2. Variant according to claim 1, selected from the group consisting of:
[0306] A) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2;
[0307] [00307] b) a polypeptide encoded by a polynucleotide that hybridizes under conditions of low severity to (i) the coding sequence of the mature polypeptide of SEQ ID NO: 1, or (ii) the full length complementary strand of (i) ;
[0308] [00308] c) a polypeptide encoded by a polynucleotide with at least 60% identity to the coding sequence of the mature polypeptide of SEQ ID NO: 1; or
[0309] [00309] d) a fragment of the mature polypeptide of SEQ ID NO: 2, which has alpha-amylase activity.
[0310] [00310] 3. Embodiment variant 2, wherein the alpha-amylase variant is at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the mature polypeptide of SEQ ID NO: 2.
[0311] [00311] 4. The variant of any of embodiments 2-3, wherein the alpha-amylase variant is encoded by a polynucleotide that hybridizes under conditions of low severity, conditions of medium severity, conditions of medium-high severity , high severity conditions, or very high severity conditions with (i) the coding sequence for the mature polypeptide of SEQ ID NO: 1 or (ii) the full length complementary strand of (i).
[0312] [00312] 5. The variant of any of embodiments 2-4, wherein the alpha-amylase variant is encoded by a polynucleotide with at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the coding sequence for the mature polypeptide of SEQ ID NO: 1.
[0313] [00313] 6. The variant of any of embodiments 2-5, wherein the alpha-amylase variant consists of the mature polypeptide of SEQ ID NO: 2 having a substitution, in one or more positions corresponding to positions 128, 143, 141, 192, 20, 76, 123, 136, 142, 165, 219, 224, 265, 383, and 410 of the mature polypeptide of SEQ id: 2, and wherein the variant has alpha-amylase activity.
[0314] [00314] 7. The variant of any of embodiments 2-6, wherein the alpha-amylase variant is a fragment of the mature polypeptide of SEQ ID NO: 2, wherein the fragment has alpha-amylase activity.
[0315] [00315] 8. The variant of any of embodiments 1-7, which is a variant of a parental alpha-amylase selected from the group consisting of:
[0316] [00316] a) a polypeptide having at least 60% sequence identity to the mature polypeptide of SEQ ID NO: 2;
[0317] [00317] b) a polypeptide encoded by a polynucleotide with at least 60% identity to the coding sequence of the mature polypeptide of SEQ ID NO: 1; or
[0318] [00318] c) a fragment of the mature polypeptide of SEQ ID NO: 2, which has alpha-amylase activity.
[0319] [00319] 9. The variant of any of embodiments 2-8, wherein the parent alpha-amylase has at least 60%, for example, at least 65%, at least 70%, at least 75%, at least at least 80%, at least 85%, at least 90%, at least 95% identity, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, identity of sequence for the coding sequence for the mature polypeptide of SEQ ID NO: 1.
[0320] [00320] 10. The variant of any of embodiments 2-9, in which the parental has at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80% at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and / or at least 99%, but less than 100% sequence identity with the mature polypeptide of SEQ ID NO: 2.
[0321] [00321] 11. The variant of any of the preceding embodiments, wherein the mature polypeptide of SEQ ID NO: 2 is the polypeptide of SEQ ID NO: 3.
[0322] [00322] 12. The variant of any of embodiments 1-11, where the number of changes is 1-20, for example, 1-10 and / or 1-5, such as 1, 2, 3, 4 , 5, 6, 7, 8, 9 or 10 changes.
[0323] [00323] 13. The variant according to any of embodiments 1-12, wherein the variant further comprises a linker and a carbohydrate link module.
[0324] [00324] 14. The variant of any of embodiments 1-13, which comprises a substitution in a position corresponding to position 20.
[0325] [00325] 15. The variant of embodiment 14, in which the change is a substitution with Ser.
[0326] [00326] 16. The variant of any of embodiments 1-15, which comprises a substitution in a position corresponding to position 76.
[0327] [00327] 17. Embodiment variant 16, where the change is a replacement with Gly.
[0328] [00328] 18. The variant of any of embodiments 1-17, which comprises a substitution in a position corresponding to position 123.
[0329] [00329] 19. The variant of embodiment 18, in which the change is a substitution with His.
[0330] [00330] 20. The variant of any of embodiments 1-19, which comprises a substitution in a position corresponding to position 128.
[0331] [00331] 21. Embodiment variant 20, where the change is a replacement with Asp.
[0332] [00332] 22. The variant of any of embodiments 1-21, which comprises a substitution in a position corresponding to position 136.
[0333] [00333] 23. Embodiment variant 22, where the change is a substitution with Phe.
[0334] [00334] 24. The variant of any of embodiments 1-23, which comprises a substitution in a position corresponding to position 141.
[0335] [00335] 25. The variant of embodiment 24, where the change is a substitution with Trp or Arg.
[0336] [00336] 26. The variant of any of embodiments 1-25, which comprises a substitution in a position corresponding to position 142.
[0337] [00337] 27. Embodiment variant 26, where the change is a replacement with Asp.
[0338] [00338] 28. The variant of any one of embodiments 1-27, which comprises a substitution in a position corresponding to position 143.
[0339] [00339] 29. Embodiment variant 28, where the change is a substitution with Asn.
[0340] [00340] 30. The variant of any of embodiments 1-29, which comprises a substitution in a position corresponding to position 165.
[0341] [00341] 31. Embodiment variant 30, where the change is a substitution with Met.
[0342] [00342] 32. The variant of any one of embodiments 1-31, which comprises a substitution in a position corresponding to position 192.
[0343] [00343] 33. Embodiment variant 32, where the change is a substitution with Arg.
[0344] [00344] 34. The variant of any one of embodiments 1-33, which comprises a substitution in a position corresponding to position 219.
[0345] [00345] 35. Embodiment variant 34, where the change is a substitution with Cys.
[0346] [00346] 36. The variant of any one of embodiments 1-35, which comprises a substitution in a position corresponding to position 224.
[0347] [00347] 37. Embodiment variant 36, where the change is a substitution with Ala or Arg.
[0348] [00348] 38. The variant of any one of embodiments 1-37, which comprises a substitution in a position corresponding to position 265.
[0349] [00349] 39. Embodiment variant 38, where the change is a substitution with Cys.
[0350] [00350] 40. The variant of any one of embodiments 1-39, which comprises a substitution in a position corresponding to position 383.
[0351] [00351] 41. Embodiment variant 40, where the change is a substitution with Arg.
[0352] [00352] 42. The variant of any one of embodiments 1-41, which comprises a substitution in a position corresponding to position 410.
[0353] [00353] 43. Embodiment variant 42, where the change is a substitution with Ala.
[0354] [00354] 44. The variant of any one of embodiments 1-43, which comprises a substitution in two positions corresponding to any of the positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192 , 219, 224, 265, 383, and 410.
[0355] [00355] 45. The variant of any one of embodiments 1-44, which comprises a substitution in three positions corresponding to any of the positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192 , 219, 224, 265, 383, and 410.
[0356] [00356] 46. The variant of any one of embodiments 1-45, which comprises a substitution in four positions corresponding to any of the positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192 , 219, 224, 265, 383, and 410.
[0357] [00357] 47. The variant of any of embodiments 1-46, which comprises a substitution in five positions corresponding to any of positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192 , 219, 224, 265, 383, and 410.
[0358] [00358] 48. The variant of any of embodiments 1-47, which comprises a substitution in six positions corresponding to any of positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192 , 219, 224, 265, 383, and 410.
[0359] [00359] 49. The variant of any one of embodiments 1-48, which comprises a substitution in each position corresponding to positions 20, 76, 123, 128, 136, 141, 142, 143, 165, 192, 219, 224, 265, 383, and 410.
[0360] [00360] 50. The variant of any of embodiments 1-49, which comprises one or more (several) substitutions selected from the group consisting of G20S, A76G, S123H, G128D, K136F, Y141W, Y141R, N142D, D143N , D165M, K192R, P219C, P224A, P224R, A265C, N383R, and V410A.
[0361] [00361] 51. Embodiment variant 50, wherein the variant comprises at least one of the following substitutions or combinations of substitutions: D165M; or Y141W; or Y141R; or K136F; or K192R; or P224A; or P224R; or S123H + Y141W; or G20S + Y141W; or A76G + Y141W; or G128D + Y141W; or G128D + D143N; or 141W + P219C; or N142D + D143N; or Y141W + K192R; or Y141W + D143N; or Y141W + N383R; or Y141W + P219C + A265C; or Y141W + N142D + D143N; or Y141W + K192R + V410A; or G128D + Y141W + D143N; or Y141W + D143N + P219C; or Y141W + D143N + K192R; or G128D + D143N + K192R; or Y141W + D143N + K192R + P219C; or G128D + Y141W + D143N + K192R; or G128D + Y141W + D143N + K192R + P219C.
[0362] [00362] 52. The variant according to any one of embodiments 13-51, wherein the carbohydrate binding module is a polypeptide comprising an amino acid sequence that has at least 60% identity with a sequence selected from among group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 , SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44.
[0363] [00363] 53. The variant according to embodiment 52, in which the linker and CBM is from Athelia rolfsii for example, SEQ ID NO: 19 and SEQ ID NO: 36 or a sequence having 60% identity for the same .
[0364] [00364] 54. The variant according to embodiment 52, in which the linker and CBM is from Aspergillus niger for example, SEQ ID NO: 21 and SEQ ID NO: 38 or a sequence having 60% identity for the same .
[0365] [00365] 55. An isolated polynucleotide encoding the variant of any of embodiments 1-54.
[0366] [00366] 56. A nucleic acid construct comprising the polynucleotide of embodiment 55.
[0367] [00367] 57. An expression vector comprising the polynucleotide of embodiment 56.
[0368] [00368] 58. A host cell comprising the polynucleotide of embodiment 57.
[0369] [00369] 59. Method of producing a variant of alpha-amylase, comprising:
[0370] [00370] a) cultivating the host cell of embodiment 57 under conditions suitable for expression of the variant; and
[0371] [00371] b) recover the variant.
[0372] [00372] 60. A transgenic plant, part of a plant or plant cell comprising the embodiment polynucleotide 55.
[0373] [00373] 61. Method of producing a variant of any of embodiments 1-54, comprising:
[0374] [00374] a) cultivating a transgenic plant or the plant cell comprising a polynucleotide encoding the variant under conditions leading to the production of the variant; and
[0375] [00375] b) recover the variant.
[0376] [00376] 62. A method for producing a fermentation product from a material containing starch comprising the steps of:
[0377] [00377] (a) liquefy the starch-containing material using an alpha-amylase variant according to any of embodiments 1-54;
[0378] [00378] (b) saccharify the liquefied material obtained in step (a) using a glucoamylase; and
[0379] [00379] (c) ferment the saccharified material using a fermentation organism.
[0380] [00380] 63. A method for producing a fermentation product from a material containing starch comprising:
[0381] [00381] (a) saccharify material containing starch with an alpha-amylase variant according to any one of embodiments 1-54, and a glycoamylase at a temperature below the initial gelatinization temperature of said material containing starch,
[0382] [00382] (b) ferment using a fermentation organism.
[0383] [00383] 64. The method according to any of embodiments 62 and 63, wherein the fermentation organism is a yeast organism, particularly Saccharomyces spp, more particularly Saccharomyces cerevisiae.
[0384] [00384] 65. The method according to any of the embodiments 62-64, wherein the fermentation product is an alcohol, particularly ethanol.
[0385] [00385] 66. A method for the production of an enzymatically modified starch derivative, wherein a polypeptide having alpha-amylase activity according to any of embodiments 1-54 is used to liquefy and / or saccharify starch.
[0386] [00386] Several references are cited here, whose descriptions are incorporated here by reference in their entirety. The present invention is further described by the following examples which are not to be construed as limiting the scope of the invention. EXAMPLES Example 1: Preparation of variants, and test for thermostability Strains and plasmids
[0387] [00387] E. coli DH12S (available from Gibco BRL) was used to rescue yeast plasmid.
[0388] [00388] pLAV019 is a shuttle vector of S. cerevisiae and E. coli under the control of the TPI promoter, described in WO06069290, having the Aspergillus niger acid alpha-amylase signal sequence, the Rhizomucor pusilus alpha-amylase gene and Athelia rolfsii partial glucoamylase gene sequence comprising only the linker and CBM. The vector was used to build protein engineering libraries and site-directed variants.
[0389] [00389] Saccharomyces cerevisiae YNG318: MATa Dpep4 [cir +] ura3-52, leu2-D2, his 4-539 was used for expression of alpha-amylase variants. It is described in J. Biol. Chem. 272 (15): 9720-9727 (1997). Means and substrates
[0390] [00390] 10X Basal solution: amino acids w / o based on yeast nitrogen (DIFCO) 66.8 g / l, succinate 100 g / l, NaOH 60 g / l.
[0391] [00391] SC-glucose: 20% glucose (ie a final concentration of 2% = 2 g / 100 ml)) 100 ml / l, 5% threonine 4 ml / l, 1% tryptophan 10 ml / l , 20% casamino acids 25 ml / l, basal solution 10 X to 100 ml / l. The solution is sterilized using a 0.20 micrometer pore size filter. Agar and H2O (approximately 761 ml) are autoclaved together, and the separately sterilized SC-glucose solution is added to the agar solution.
[0392] [00392] SC-glucose + starch plate: 0.5-0.8% corn starch is added to the above SC-glucose medium containing 2% agar.
[0393] [00393] YPD: Bacto peptone 20 g / l, yeast extract 10 g / l, 20% glucose 100 ml / l. PEG / LiAc solution: 40% PEG4000 50 ml, 5 M lithium acetate 1 ml DNA manipulations
[0394] [00394] Unless otherwise stated, DNA manipulations and transformations were performed using standard molecular biology methods as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab. Cold Spring Harbor, NY. Yeast processing
[0395] [00395] Yeast transformation was carried out by lithium acetate method. Mix 0.5 microL of vector (digested by restriction endonucleases) and 1 microL of PCR fragments. Thaw competent YNG318 cells on ice. Mix 100 microL of the cells, the mixture of DNA and 10 microL of carrier DNA YEAST MAKER (Clontech) in 12 ml of polypropylene tubes (Falcon 2059). Add 0.6ml of PEG / LiAc solution and mix gently. Incubate for 30 min at 30 ° C, and 200 rpm. Incubate for 30 min at 42 ° C (heat shock). Transfer to a microcentrifuge tube and centrifuge for 5 sec. Remove the supernatant and resolve to 3 ml of YPD. Incubate the cell suspension for 45 min at 200 rpm at 30 ° C. Pour the suspension onto SC-glucose plates and incubate at 30 ° C for 3 days to make colonies. Total yeast DNA was extracted by Zymoprep Yeast Plasmid Miniprep Kit (ZYMO research). DNA sequencing
[0396] [00396] Transformation by E. coli for DNA sequencing was performed by electroporation (BIO-RAD Gene Pulser). DNA plasmids were prepared by an alkaline method (Molecular Cloning, Cold Spring Harbor, Sambrook et al., 1989, supra) or with the Qiagen® Plasmid kit. DNA fragments were recovered from agarose gel by the Qiagen gel extraction kit. PCR was performed using a PTC-200 DNA Engine. The ABI PRISMTM 310 genetic analyzer was used to determine all DNA sequences. Construction of yeast library and site-directed variants
[0397] [00397] Yeast libraries and site-directed variants were built using the SOE PCR method (Splicing Overlap Extension, see “PCR: A practical approach”, p. 207-209, Oxford University press, 1991, eds. McPherson, Quirke, Taylor ), followed by yeast in in vivo recombination.
[0398] [00398] The primers below are used to make fragments of DNA containing any fragments mutated by the SOE method together with degenerate primers (AM34 + reverse primer and AM35 + direct primer) or just to amplify a total amylase gene (AM34 + AM35). AM34 and AM35 are primers located upstream and downstream of the amylase gene. AM34 TAGGAGTTTAGTGAACTTGC (SEQ ID NO: 45) AM35 TTCGAGCGTCCCAAAACC (SEQ ID NO: 46)
[0399] [00399] DNA fragments were recovered from agarose gel by the Qiagen gel extraction kit. The resulting purified fragments were mixed with the vector digest. The mixed solution was introduced into Saccharomyces cerevisiae to build libraries or site-directed variants by in vivo recombination. Construction of amylase hybrids with another linker and CBM
[0400] [00400] Amylase hybrids comprising the catalytic nucleus of Rhizomucor pusilus fused with ligands and CBMs different from those of Athelia rolfsii glucoamylase were constructed by the SOE method using in vivo yeast recombination.
[0401] The partial sequence encoding the CBM region of Athelia rolfsii was removed from the variant plasmids having the glucoamylase linker of Athelia rolfsii and CBM by digestion with the restriction enzymes, SacI and NotI, and the resulting vector was mixed with the PCR fragment amplified using a pair of primers below from the Aspergillus niger glucoamylase gene. They were introduced in yeast to build hybrids with the linker and CBM from glucoamylase from Aspergillus niger. AN F linker CGGCTATCTTCACCTCTGCTACTGGCGGCACCACTACG (SEQ ID NO: 47) AN connector RCTAATTACATGATGCGGCCCGCGGCCGCCTACCGCCAGGTGTCA GTC (SEQ ID NO: 48) Expression of amylases with CBM in Aspergillus niger
[0402] [00402] Constructs comprising alpha-amylase variant genes including a linker and CBM were used to construct expression vectors. The parental plasmid, pAspV019, consists of an expression cassette based on the Aspergillus niger neutral amylase II promoter fused to the Aspergillus nidulans tr (Pna2 / tpi) untranslated triose phosphate isomerase (Pna2 / tpi) and the Aspergillus nyl amyloglycoside terminator (Tamg). Also present in the plasmid was the selective amdS marker of Aspergillus from Aspergillus nidulans allowing growth in acetamide as the only nitrogen source. The Aspergillus expression plasmids were transformed into Aspergillus as described in Lassen et al., 2001, Applied and Environmental Microbiology 67: 4701-4707. Transformants expressing V019 variants were isolated, purified and cultured in shaken flasks. Aspergillus niger fermentation culture broths expressing amylase with CBM were purified by affinity purification (Biochem. J. 372: 905-910 (2003)). Screening of engineered libraries and site-directed mutagenesis variants
[0403] [00403] Yeast clones in SC-glucose were re-inoculated on SC-glucose plates containing starch and clones showing clearance zones were inoculated in one well of a 24-well microtiter plate containing YPD medium, and cultured at 28 ° C for 3 days. 2 M sodium acetate buffer, pH 3.5, was added to the culture supernatants in the final concentration at 100 mM, and incubated at 4 and 65 ° C for 1 hour. Residual alpha-amylase activities were measured by an alpha-amylase test kit (Kikkoman Biochemifa Company, Catalog number 60213), according to the supplier's protocol. The test is based on the degradation of N3-G5-β-CNP (2 chloro-4 nitrophenyl 65 -azide-65-deoxy-b-maltopentoside) by alpha-amylase to release G3-β-CNP and G2-β-CNP , which are further degraded by glucoamylase and beta-glucosidase provided in the solutions in the kit for CNP. 1U of alpha-amylase activity was defined as 1 qmol CNP released / min at pH 4.0 and 30 ° C.
[0404] [00404] Unit / ml of each sample was calculated after incubating part of the sample 1 h at 4 ° C and another part of the sample after 1 h incubation at 65 ° C. In the table below the relationship between these two activities for each sample is shown as% residual activity. U / ml was calculated as: alpha-amylase activity = (Sample-Ebranco) X 0.179 X dilution factor, in which released CPN was detected by spectrophotometry at A400.
[0405] [00405] Clones with a higher activity ratio after incubating at 65oC / activity after incubating at 4oC than the parental variant were selected and the sequence was determined. Table 1. Residual alpha-amylase activity of variants
[0406] [00406] As seen from the table all tested variants showed improved thermostability compared to wild-type alpha amylase. Example 2: Stability of variant storage
[0407] [00407] One of the variants, PE16, was expressed in Aspergillus niger and the culture supernatants were purified by a three-step chromatographic procedure: anion exchange at pH 7.0 and pH 5.0 followed by size exclusion chromatography. Two fractions with amylase activity, with Mw at around 50kDa and 60kDa, which correspond to the molecules with CBM cleavage (part of the nucleus) and intact linker and CBM, were collected and tested for storage stability. The samples were incubated at pH 3.8, at 4 ° C and 40 ° C for 6 days and the remaining activities were measured each day. Table 2. Results are given as relative residual activity
[0408] [00408] The data demonstrate that the presence of a linker and CBM does not affect the improvements obtained by introducing the substitutions according to the invention in the region of the nucleus. Example 3. Thermostability at pH 3.5
[0409] [00409] The thermostability of fusions of selected variants including a linker and a CBD was assessed using the following conditions.
[0410] [00410] 1/20 (v / v) of 2 M sodium acetate buffer, pH 3.5, was added to the supernatants of yeast cultures of clones expressing the selected alpha-amylase variants and the samples were incubated at 4, 60, 65 and 70 ° C for 1 h.
[0411] [00411] Residual activities were measured by the alpha-amylase test kit (Kikkoman # 60123) as described above and the resulting residual activities are relative to the activity at 4 ° C. Table 3. Residual alpha amylase activity relative to samples at 4 ° C.
[0412] [00412] Under the conditions tested all variants showed improved thermostability. Example 4. Stability of storage of variants at pH 4.0
[0413] [00413] Variants of purified alpha-amylase expressed in Aspergillus oryzae were incubated at 40 ° C for 3 days and 10 days (4 ° C as a control) under the following conditions:
[0414] [00414] 50 mM NaOAc buffer (pH4.0)
[0415] [00415] 0.5 mM CaCl2
[0416] [00416] 0.005% Triton X-100
[0417] [00417] Residual activities were measured by the alpha-amylase test kit (Kikkoman # 60123) as described above. Table 4. Residual alpha amylase activity
[0418] [00418] Approximately 405 g yellow grain corn (obtained from several Midwestern corn for ethanol producers; crushed at the facility with a Turkish-type crushing configuration) was added to 595 g of spout water. This mixture was supplemented with 3 ppm of penicillin and 1000 ppm of urea. The suspension was adjusted to pH 4.5 with 40% H2SO4. Approximately 5 g of this suspension was added to 15 ml of tubes. Each tube was dosed with 0.0801 mg / gDS of Tramets cingulata glucoamylase and 0.0225mg / g alpha-amylase DS, followed by 200 μL of yeast propagate (0.024 g of Red Fermentis Ethanol yeast, incubated overnight at 32 ° C in 50 mL filtered corn / liquefied bran and 5.1 μL Sprizyme Plus AMG). Water was added to each tube to bring the total additional volume (enzyme + water) to 1.2% of the initial weight of the soaked bran.
[0419] [00419] Tubes were incubated at 32 ° C and six fermentations in duplicates of each treatment were performed. All tubes were vortexed at 24, 48 and 70 hours. A sample was sacrificed for HPLC analysis at 24 hours, two at 48 hours, and three at 70 hours. The HPLC preparation consisted of stopping the reaction by adding 50 μL of 40% H2SO4, centrifuging for 10 min at 1462xg, and filtering through a 0.45 μm filter. The samples were stored at 4 ° C. HPLC analysis for ethanol HPLC system - Agilent 1100/1200 series with Chem station software Degasser Quaternary bomb Auto-sampler Column compartment / with heater Refractive index (IR) detector Column - Bio-Rad HPX-87H ion exclusion column 300mm x 7.8mm parts # 125-0140 Bio-Rad guard cartridge cation H parts # 125-0129, support parts # 125-0131 Method - 0.005M of mobile phase H2OSO4 Flow rate 0.6 ml / min Column temperature - 65 ° C Detector temperature RI - 55 ° C Table 5. Relative ethanol yield.
[0420] [00420] The results show that all variants tested according to the invention retain their applicability in a process of hydrolysis of raw starch.
[0421] [00421] The invention described and claimed herein should not be limited in scope by the specific aspects described here, because these aspects are intended as illustrations of the various aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. In fact, various modifications of the invention in addition to those shown and described here will be apparent to the skilled person from the above description. These modifications are also intended to be within the scope of the appended claims. In the event of a conflict, this description including definitions will serve as a control.

权利要求:
Claims (13)
[0001]
Alpha-amylase variant of a parent alpha-amylase revealed as SEQ ID NO: 3, characterized by the fact that the variant has improved thermostability, measured as residual amylase activity after incubation for 1 hour at 65 ° C at pH 3, 5, compared to parental alpha-amylase, and the variant comprises a substitution in one position corresponding to position 143, and further comprising one or more substitutions in positions corresponding to positions 128, 141, 192, 20, 76, 123, 136, 142 , 165, 219, 224, 265, 383, and 410 of the polypeptide of SEQ ID NO: 3, and wherein the alpha-amylase variant or fragment thereof comprises at least one of the following combinations or substitutions: G128D + D143N; or N142D + D143N; or Y141W + D143N; or Y141W + N142D + D143N; or G128D + Y141W + D143N; or Y141W + D143N + P219C; or Y141W + D143N + K192R; or G128D + D143N + K192R; or Y141W + D143N + K192R + P219C; or G128D + Y141W + D143N + K192R; or G128D + Y141W + D143N + K192R + P219C.
[0002]
Variant according to claim 1, characterized in that the variant still comprises a linker and a carbohydrate linker module.
[0003]
Variant according to claim 2, characterized by the fact that the carbohydrate binding module is a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 , SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 44.
[0004]
Variant according to claim 3, characterized by the fact that the linker and CBM is from Athelia rolfsii for example, SEQ ID NO: 19 and SEQ ID NO: 36.
[0005]
Variant according to claim 3, characterized by the fact that the linker and CBM is from Aspergillus niger for example, SEQ ID NO: 21 and SEQ ID NO: 38.
[0006]
Isolated polynucleotide, characterized by the fact that it consists of SEQ ID NO: 6.
[0007]
Expression vector, characterized by the fact that it comprises the polynucleotide as defined in claim 6.
[0008]
Transgenic microorganism host cell, characterized by the fact that it comprises the polynucleotide as defined in claim 6.
[0009]
Method of producing a variant of alpha-amylase, characterized by the fact that it comprises: a) culturing the host cell as defined in claim 9 under conditions suitable for expression of the variant; and b) recover the variant.
[0010]
Method for producing a fermentation product from a material containing starch, characterized by the fact that it comprises the steps of: (a) liquefy the starch-containing material using a variant of alpha-amylase as defined in any one of claims 1 to 5; (b) saccharify the liquefied material obtained in step (a) using glucoamylase; and (c) fermenting the saccharified material using a fermentation organism.
[0011]
Method for producing a fermentation product from a material containing starch, characterized by the fact that it comprises: (a) saccharifying starch-containing material with an alpha-amylase variant as defined in any of claims 1 to 5, and a glycoamylase at a temperature below the initial gelatinization temperature of said starch-containing material, (b) ferment using a fermentation organism.
[0012]
Method according to claim 10 or 11, characterized in that the fermentation product is an alcohol, particularly ethanol.
[0013]
Method for producing an enzymatically modified starch derivative, characterized in that it comprises using a variant having alpha-amylase activity as defined in any one of claims 1 to 5 to liquefy and / or saccharify starch.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US9765316B2|2017-09-19|Alpha amylase variants and polynucleotides encoding same

---

EP2638154B1|2016-09-14|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

CA2782154C|2018-10-16|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

US8728768B2|2014-05-20|Polypeptides having isoamylase activity and methods of use

---

WO2013029496A1|2013-03-07|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

AU2010276470A1|2012-05-31|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

US8697412B2|2014-04-15|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

CA2822856A1|2012-05-18|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

US9650620B2|2017-05-16|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

US9567574B2|2017-02-14|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

WO2013034097A1|2013-03-14|Polypeptides having glucoamylase activity and polynucleotides encoding same

---

WO2021163011A2|2021-08-19|Alpha-amylase variants and polynucleotides encoding same

---

US20150125902A1|2015-05-07|Polypeptides having glucoamylase activity and polynucleotides encoding same

同族专利:

---

公开号 | 公开日

---

CN103781910A|2014-05-07|

---

MX337984B|2016-03-30|

---

DK2729572T3|2019-04-23|

---

EP2729572B1|2019-03-20|

---

CA2840962A1|2013-01-10|

---

BR112014000143A2|2017-02-07|

---

CA2840962C|2021-04-13|

---

WO2013006756A3|2013-05-02|

---

WO2013006756A2|2013-01-10|

---

EP2729572A2|2014-05-14|

---

US20140147893A1|2014-05-29|

---

CN103781910B|2019-04-23|

---

EA201490216A1|2014-07-30|

---

US9765316B2|2017-09-19|

---

MX2013014735A|2014-02-11|

---

US9267124B2|2016-02-23|

---

US20160130572A1|2016-05-12|

---

ES2729385T3|2019-11-04|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

JPS6155948B2|1978-09-01|1986-11-29|Shii Pii Intern Inc|

---

NO840200L|1983-01-28|1984-07-30|Cefus Corp|GLUCOAMYLASE CDNA.|

---

DK135983D0|1983-03-25|1983-03-25|Novo Industri As|THE AMYLASEENZYM SYMBOL PRODUCT AND PROCEDURE FOR ITS MANUFACTURING AND USING|

---

US4587215A|1984-06-25|1986-05-06|Uop Inc.|Highly thermostable amyloglucosidase|

---

JPH0568237B2|1985-11-26|1993-09-28|Godo Shusei Kk|

---

DK122686D0|1986-03-17|1986-03-17|Novo Industri As|PREPARATION OF PROTEINS|

---

DE3886221T3|1987-09-04|2000-12-21|Novo Nordisk As|METHOD FOR PRODUCING PROTEIN PRODUCTS IN -i AND PROMOTORS FOR USE IN -i .|

---

US5223409A|1988-09-02|1993-06-29|Protein Engineering Corp.|Directed evolution of novel binding proteins|

---

DE3909096A1|1989-03-20|1990-09-27|Garabed Antranikian|ALPHA AMYLASE|

---

PT97110B|1990-03-23|1998-11-30|Gist Brocades Nv|PROCESS FOR CATALYSING ACCELERABLE REACTIONS BY ENZYMES, BY ADDING TO THE REACTIONAL MEDIUM OF TRANSGENIC PLANTS SEEDS AND FOR OBTAINING THE REFERED SEEDS|

---

US6395966B1|1990-08-09|2002-05-28|Dekalb Genetics Corp.|Fertile transgenic maize plants containing a gene encoding the pat protein|

---

US5162210A|1990-06-29|1992-11-10|Iowa State University Research Foundation|Process for enzymatic hydrolysis of starch to glucose|

---

IL99552D0|1990-09-28|1992-08-18|Ixsys Inc|Compositions containing procaryotic cells,a kit for the preparation of vectors useful for the coexpression of two or more dna sequences and methods for the use thereof|

---

EP0651794B1|1992-07-23|2009-09-30|Novozymes A/S|MUTANT $g-AMYLASE, DETERGENT AND DISH WASHING AGENT|

---

CN1189558C|1993-10-08|2005-02-16|诺沃奇梅兹有限公司|Amylase variants|

---

DE4343591A1|1993-12-21|1995-06-22|Evotec Biosystems Gmbh|Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes|

---

US5605793A|1994-02-17|1997-02-25|Affymax Technologies N.V.|Methods for in vitro recombination|

---

MX196038B|1994-03-29|2000-04-14|Novo Nordisk As|Alkaline bacillus amylase.|

---

DE69523052T2|1994-06-03|2002-06-20|Novo Nordisk Biotech Inc|PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS CODING THEM|

---

EP0777737B1|1994-06-30|2005-05-04|Novozymes Biotech, Inc.|Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein|

---

US6093562A|1996-02-05|2000-07-25|Novo Nordisk A/S|Amylase variants|

---

ES2390901T3|1995-02-03|2012-11-19|Novozymes A/S|Method for designing alpha-amylase mutants with predetermined properties|

---

AR000862A1|1995-02-03|1997-08-06|Novozymes As|VARIANTS OF A MOTHER-AMYLASE, A METHOD TO PRODUCE THE SAME, A DNA STRUCTURE AND A VECTOR OF EXPRESSION, A CELL TRANSFORMED BY SUCH A DNA STRUCTURE AND VECTOR, A DETERGENT ADDITIVE, DETERGENT COMPOSITION, A COMPOSITION FOR AND A COMPOSITION FOR THE ELIMINATION OF|

---

DK0904360T3|1996-04-30|2013-10-14|Novozymes As|Alpha-amylasemutanter|

---

JP4358431B2|1997-10-13|2009-11-04|ノボザイムスアクティーゼルスカブ|α-Amylase mutant|

---

JP4718005B2|1997-11-26|2011-07-06|ノボザイムスアクティーゼルスカブ|Thermostable glucoamylase|

---

NZ505820A|1998-02-27|2002-10-25|Novozymes As|Enzyme variants based on the 3D structure of maltogenic alpha-amylase that have an altered pH optimum, thermostability, specific activity, cleavage pattern and ability to reduce the staling of bread|

---

CA2331340A1|1998-07-15|2000-01-27|Novozymes A/S|Glucoamylase variants|

---

DK1124949T3|1998-10-26|2006-11-06|Novozymes As|Construction and screening of a DNA library of interest in filamentous fungal cells|

---

JP4620253B2|1999-03-22|2011-01-26|ノボザイムス，インコーポレイティド|Promoter for gene expression in fungal cells|

---

EP1818396B1|1999-03-30|2014-06-18|Novozymes A/S|Alpha-amylase variants|

---

EP2009098A1|1999-07-09|2008-12-31|Novozymes A/S|Glucoamylase variant|

---

EP2298903A3|2000-08-01|2011-10-05|Novozymes A/S|Alpha-amylase mutants with altered properties|

---

US7151204B2|2001-01-09|2006-12-19|Monsanto Technology Llc|Maize chloroplast aldolase promoter compositions and methods for use thereof|

---

AU2002319696B2|2001-07-27|2007-11-01|The Government Of The United States Of America As Represented By The Secretary Of Health And Human Services|Systems for in vivo site-directed mutagenesis using oligonucleotides|

---

JP4550587B2|2002-12-17|2010-09-22|ノボザイムスアクティーゼルスカブ|Thermostable α-amylase|

---

DE602004024964D1|2003-03-10|2010-02-25|Novozymes As|PROCESS FOR THE PREPARATION OF ALCOHOL|

---

JP2007526748A|2003-06-25|2007-09-20|ノボザイムスアクティーゼルスカブ|Starch processing enzyme|

---

US8105801B2|2003-06-25|2012-01-31|Novozymes A/S|Starch process|

---

DK2365068T3|2004-12-22|2017-05-15|Novozymes As|ENZYMER FOR PROCESSING STARCH|

---

WO2009030728A2|2007-09-05|2009-03-12|Novozymes A/S|Enzyme compositions with stabilizing constituent|

---

MX337984B|2011-07-06|2016-03-30|Novozymes As|Alpha amylase variants and polynucleotides encoding same.|CN103608460B|2010-12-22|2017-08-29|诺维信北美公司|For the technique for producing tunning|

---

MX337984B|2011-07-06|2016-03-30|Novozymes As|Alpha amylase variants and polynucleotides encoding same.|

---

CN104334738B|2012-03-30|2019-01-29|诺维信北美公司|The method for producing tunning|

---

WO2014085439A1|2012-11-30|2014-06-05|Novozymes A/S|Processes for producing fermentation products|

---

CN105208869A|2013-04-05|2015-12-30|诺维信公司|Method of producing a baked product with alpha-amylase, lipase and phospholipase|

---

CA2915065A1|2013-06-24|2014-12-31|Novozymes A/S|Processes for recovering oil from fermentation product processes and processes for producing fermentation products|

---

CA2915336A1|2013-07-17|2015-01-22|Novozymes A/S|Pullulanase chimeras and polynucleotides encoding same|

---

DK3415624T3|2014-01-22|2021-11-08|Novozymes As|Pullulanase variants and polynucleotides that encode them|

---

WO2016062875A2|2014-10-23|2016-04-28|Novozymes A/S|Glucoamylase variants and polynucleotides encoding same|

---

WO2016138437A1|2015-02-27|2016-09-01|Novozymes A/S|Processes of producing ethanol using a fermenting organism|

---

WO2016196202A1|2015-05-29|2016-12-08|Novozymes A/S|Polypeptides having protease activity and polynucleotides encoding same|

---

US10676727B2|2015-06-18|2020-06-09|Novozymes A/S|Polypeptides having trehalase activity and the use thereof in process of producing fermentation products|

---

US20180208916A1|2015-07-23|2018-07-26|Novozymes A/S|Alpha-amylase variants and polynucleotides encoding same|

---

CA3007103A1|2015-12-22|2017-06-29|Novozymes A/S|Process of extracting oil from thin stillage|

---

WO2017144008A1|2016-02-26|2017-08-31|南京百斯杰生物工程有限公司|Αlpha amylase variant and use thereof|

---

WO2018015304A1|2016-07-21|2018-01-25|Novozymes A/S|Serine protease variants and polynucleotides encoding same|

---

CN109661465A|2016-07-21|2019-04-19|诺维信公司|Serine protease variants and the polynucleotides that it is encoded|

---

WO2018075430A1|2016-10-17|2018-04-26|Novozymes A/S|Methods of reducing foam during ethanol fermentation|

---

WO2018098381A1|2016-11-23|2018-05-31|Novozymes A/S|Improved yeast for ethanol production|

---

WO2018098124A1|2016-11-23|2018-05-31|Novozymes A/S|Polypeptides having protease activity and polynucleotides encoding same|

---

EP3548615A1|2016-11-29|2019-10-09|Novozymes A/S|Alpha-amylase variants and polynucleotides encoding same|

---

CN110651048A|2017-04-11|2020-01-03|诺维信公司|Glucoamylase variants and polynucleotides encoding same|

---

BR112019025391A2|2017-06-02|2020-07-07|Novozymes A/S|improved yeast for ethanol production|

---

DK3645555T3|2017-06-28|2022-03-07|Novozymes As|Polypeptides with trehalase activity and polynucleotides encoding them|

---

US11220679B2|2017-08-08|2022-01-11|Novozymes A/S|Polypeptides having trehalase activity|

---

WO2019046232A1|2017-08-30|2019-03-07|Novozymes A/S|Combined use of an endo-protease of the m35 family and an exo-protease of the s53 family in the fermentation of starch|

---

EP3692150A1|2017-10-04|2020-08-12|Novozymes A/S|Polypeptides having protease activity and polynucleotides encoding same|

---

EP3720955A1|2017-12-08|2020-10-14|Novozymes A/S|Alpha-amylase variants and polynucleotides encoding same|

---

EP3720956A1|2017-12-08|2020-10-14|Novozymes A/S|Alpha-amylase variants and polynucleotides encoding same|

---

CA3089135A1|2018-01-29|2019-08-01|Novozymes A/S|Microorganisms with improved nitrogen utilization for ethanol production|

---

EP3752626A1|2018-02-15|2020-12-23|Novozymes A/S|Improved yeast for ethanol production|

---

CA3096900A1|2018-04-09|2019-10-17|Novozymes A/S|Polypeptides having alpha-amylase activity and polynucleotides encoding same|

---

CN112166197A|2018-05-31|2021-01-01|诺维信公司|Method for enhancing yeast growth and productivity|

---

CA3104881A1|2018-07-11|2020-01-16|Novozymes A/S|Processes for producing fermentation products|

---

WO2020023411A1|2018-07-25|2020-01-30|Novozymes A/S|Enzyme-expressing yeast for ethanol production|

---

CN113286889A|2018-10-08|2021-08-20|诺维信公司|Enzyme-expressing yeast for producing ethanol|

---

EP3942033A1|2019-03-18|2022-01-26|Novozymes A/S|Polypeptides having pullulanase activity suitable for use in liquefaction|

---

WO2020206058A1|2019-04-02|2020-10-08|Novozymes A/S|Process for producing a fermentation product|

---

WO2021021458A1|2019-07-26|2021-02-04|Novozymes A/S|Microorganisms with improved nitrogen transport for ethanol production|

---

WO2021026201A1|2019-08-05|2021-02-11|Novozymes A/S|Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct|

---

WO2021055395A1|2019-09-16|2021-03-25|Novozymes A/S|Polypeptides having beta-glucanase activity and polynucleotides encoding same|

---

WO2021119304A1|2019-12-10|2021-06-17|Novozymes A/S|Microorganism for improved pentose fermentation|

---

WO2021163011A2|2020-02-10|2021-08-19|Novozymes A/S|Alpha-amylase variants and polynucleotides encoding same|

---

WO2021163030A2|2020-02-10|2021-08-19|Novozymes A/S|Polypeptides having alpha-amylase activity and polynucleotides encoding same|

---

WO2021163036A1|2020-02-10|2021-08-19|Novozymes A/S|Raw starch hydrolysis process for producing a fermentation product|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-09| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-08-25| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application [chapter 6.1 patent gazette]|

---

2021-02-23| B09A| Decision: intention to grant|

---

2021-04-06| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 06/07/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161504771P| true| 2011-07-06|2011-07-06|

---

US61/504771|2011-07-06|

---

US201161505192P| true| 2011-07-07|2011-07-07|

---

US61/505192|2011-07-07|

---

PCT/US2012/045670|WO2013006756A2|2011-07-06|2012-07-06|Alpha amylase variants and polynucleotides encoding same|

---