MICRO-ORGANISM AND METHOD FOR THE PRODUCTION OF METHIONINE WITH STRONG GLUCOSE IMPORT

专利摘要:
microorganism for the production of methionine with accentuated glucose import. the present invention relates to a recombinant microorganism for improved methionine production comprising modifications to produce methionine from glucose as the main carbon source by fermentation, and modifications to improve glucose import, wherein glucose import is improved by modifying the expression of at least one gene selected from ptsg, sgrt sgrs and dgsa. the invention is also related to a method for the fermentative production of methionine or methionine derivatives comprising the steps of: - cultivating the recombinant microorganism, as described above in an appropriate culture medium, comprising a fermentable source of carbon containing glucose and a source of sulfur, and - recovering the methionine or methionine derivatives from the culture medium.
公开号:BR112013033675B1
申请号:R112013033675-7
申请日:2012-06-29
公开日:2021-06-29
发明作者:Wanda Dischert；Rainer Figge
申请人:Evonik Operations Gmbh；
IPC主号:

专利说明:

FIELD OF THE INVENTION
The present invention relates to an improved microorganism for the production of methionine and a process for the preparation of methionine. In particular, the present invention relates to a microorganism for the production of methionine with improved glucose import comprising the modified expression of at least one gene selected from ptsG, sgrS, sgrT or dgsA. PRIOR ART
Sulfur-containing compounds such as cysteine, homocysteine, methionine and S-adenosylmethionine are critical for cell metabolism and are industrially produced to be used as food or feed additives and pharmaceuticals. In particular, methionine, an essential amino acid that cannot be synthesized by animals, plays an important role in many functions in the body. In addition to its role in protein biosynthesis, methionine is involved in the transmethylation and bioavailability of selenium and zinc. Methionine is also used directly as a treatment for disorders such as allergy and rheumatic fever. However, most of the methionine that is produced is added to animal feed.
With the diminished use of animal proteins as a result of BSE and avian flu, the demand for pure methionine has increased. Commonly, D,L-methionine is chemically produced from acrolein, methyl mercaptan and hydrogen cyanide. However, the racemic mixture does not perform as well as pure L-methionine (Saunderson, C.L., 1985). Furthermore, although pure L-methionine can be produced from racemic methionine, for example, through treatment with N-acetyl-D acylase, L-methionine, this considerably increases production costs. Thus, the increasing demand for pure L-methionine, coupled with environmental concerns makes microbial production of methionine an attractive prospect.
Optimizing the production of a chemical from a microorganism typically involves overexpression of proteins involved in the biosynthesis pathway, attenuating proteins involved in repressing the biosynthesis pathway or attenuating proteins involved in the production of undesirable by-products. All of these approaches for optimizing L-methionine production in microorganisms have been described previously (see, for example, US Patent 7,790,424, US Patent 7,611,873, patent applications WO 2002/10209, WO 2006/008097 and WO 2005 /059093), however, the industrial production of L-methionine from microorganisms requires improvement. Typically, L-methionine was produced by microorganisms grown on glucose as a major carbon source in a fermentation process. In bacteria, external glucose is transported into the cell and phosphorylated by phosphoenolpyruvate: sugar phosphotransferase (PTS) system (Meadow et al. 1990; Rohwer et al. 1996; Tchieu et al. 2001). PTS consists of two common cytoplasmic proteins, enzyme I and HPr, and a series of sugar-specific enzyme II complexes (IIE). The PTS enzyme IICBGlc, encoded by ptsG in E. coli, transports and concomitantly phosphorylates glucose to glucose-6-phosphate (G6P). While G6P is an essential intermediary in glucose metabolism, its intracellular accumulation causes the phenomenon of sugar-phosphate toxicity, also called "phosphosugar stress". In fact, glucose accumulation has been reported to be very toxic to bacteria, giving rise to glycation, DNA mutagenesis, and growth inhibition (Lee and Cerami, 1987; Kadner et al. 1992).
Recent studies have shown that in E. coli the ptsG gene encoding IICBGlc is highly regulated in a rather intriguing way, both at the transcriptional and post-transcriptional levels, depending on physiological conditions (Plumbridge, 1998; Kimata et al. 1998; Plumbridge et al. 1998; Plumbridge et al. al. 2002; Morita and Aiba, 2007; Gôrke and Vogei, 2008). Specifically, several levels of regulation have been identified: regulation of ptsG gene expression by many different regulators (ArcA, Fis, Crp) and, in particular, repression by dgsA, a transcriptional regulator formerly called Mlc (Making larger colonies); destabilization of ptsG mRNA by small sgrS RNA (Sugar transport-related sRNA) by an antisense mechanism; control of PtsG activity by sgrT small polypeptide by a still unknown mechanism, and regulation of sgrS/sgrT expression by transcriptional regulator SgrR.
Due to the toxicity of G6P and the highly regulated and complex nature of the system, manipulation of the glucose transport system in microorganisms is very difficult. Until now, several attempts have been made to improve the production of amino acids and, in particular, the production of threonine, increasing the import of glucose through the manipulation of ptsG or dgsA genes (W003004675 and W003004670 by Degussa; US2004229320 by Ajinomoto and WO0281721 by Degussa ). However, there is no example of improving methionine production by increasing the bacteria's glucose import. SUMMARY OF THE INVENTION
The inventors of the present invention were able to overcome the difficulties discussed above for improving the production of L-methionine by a microorganism by enhancing glucose import. Thus, in a first aspect, the present invention provides a recombinant microorganism for production of improved methionine, comprising a) modifications to produce methionine from glucose as the main carbon source by fermentation, and b) modifications to improve glucose import, in that glucose import is improved by modifying the expression of at least one gene selected from ptsG, sgrT, sgrS or dgsA (mlc).
The inventors showed by modifying the expression of genes involved in glucose import, the glucose import in the microorganism is improved and the methionine production by the microorganism is accentuated. Furthermore, the inventors found that modifying the expression of genes involved in glucose import decreases the production of ketomethylvalerate (KMV) and homolanthionine (HLA) by-products, thus improving the purity of the methionine product. In one embodiment, expression of the ptsG gene encoding IICBGlc is marked. While ptsG expression can be enhanced by any means known in the art, in one embodiment, the ptsG gene is overexpressed under the control of an inducible or constitutive promoter. In another embodiment, the ptsG gene does not contain the binding site sequence for small sgrS RNA.
In other embodiments, expression of the sgrS, sgrT or dgsA genes is attenuated. Methods of attenuating gene expression are well known to those of skill in the art. In one embodiment, the sgrS gene is deleted. In another embodiment, the sgrT gene is deleted. In another embodiment of the invention, the dgsA gene is deleted.
Furthermore, glucose import can be improved through a combination of the modifications discussed above. In one embodiment, expression of the ptsG gene is enhanced and expression of the sgrS gene is attenuated. In another embodiment, expression of the ptsG gene is enhanced and expression of the sgrT gene is attenuated. In another embodiment, the expression of the ptsG gene is enhanced and the expression of the sgrS and sgrT genes is attenuated. In another embodiment, expression of the ptsG gene is enhanced and expression of the dgsA gene is attenuated.
The microorganism of the present invention is modified to produce methionine. While it will be understood that the microorganism may comprise any modification known in the art to promote methionine production in a microorganism, in one embodiment, the expression of at least one of the following genes is enhanced: pyc, pntAB, cysP, cysU , cysW, cysA, cysM, cysJ, cysl, cysH, gcvT, gcvH, gcvP, Ipd, serA, serB, serC, cysE, metF, metH, thrA, an allele of metA encoding an enzyme with reduced feedback sensitivity to S - adenosylmethionine and/or methionine (MetA*), or a thrA allele coding for an enzyme with reduced feedback inhibition for threonine (thrA*). In one embodiment, at least one gene is under the control of an inducible promoter. In another embodiment, expression of at least one of the following genes is attenuated: metJ, pykA, pykF, purU, yncA, or udhA.
In a particularly preferred embodiment, expression of the metJ gene is attenuated. In another embodiment, expression of the metJ gene is attenuated and expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced. In another embodiment, expression of the metJ gene is attenuated, expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced; and expression of a thrA allele encoding an enzyme with reduced feedback inhibition for threonine (thrA*) is marked. In yet another embodiment, expression of the metJ gene is attenuated, expression of an allele encoding metA for an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is accentuated, expression of an allele thrA coding for an enzyme with reduced feedback inhibition to threonine (thrA*) is marked; and the expression of the cysE gene is accentuated. In yet another embodiment, expression of the metJ gene is attenuated; expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is marked; expression of a thrA allele encoding an enzyme with reduced feedback inhibition for threonine (thrA*) is marked; cysE gene expression is accentuated; and the expression of the metF and/or metH genes is accentuated. In a particular embodiment, the present invention comprises a microorganism, wherein: a) the pstG gene is overexpressed and/or does not contain the sgrS binding site of sRNA and/or the sgrS gene is deleted and/or the sgrT gene is deleted and/or the dgsA gene is deleted; b) the expression of the genes metA*, metH, cysPUWAM, cysJIH, gcvTHP, metF, serA, serB, serC, cysE, thrA* and pyc are accentuated; and c) the expression of metJ, pykA, pykF, purU and yncA genes are attenuated.
The microorganism of the present invention produces less ketomethylvalerate (KMV) and homolanthionine (HLA) and as such produces methionine of improved purity. In one embodiment, the methionine produced has increased purity. In one embodiment, a method for the fermentative production of methionine of increased purity is provided comprising the steps of: a) culturing the recombinant microorganism described above, in an appropriate culture medium, comprising a fermentable carbon source containing glucose and a sulfur source, and b) recovering the methionine or methionine derivatives from the culture medium.
In a second aspect, the present invention provides a method for the fermentative production of methionine of increased purity comprising the steps of: a) cultivating the recombinant microorganism in an appropriate culture medium, comprising a fermentable source of carbon containing glucose and a source of sulfur, wherein said microorganism comprises: i) modifications to produce methionine from glucose as the main carbon source by fermentation, and ii) modifications to improve glucose import, wherein glucose import is improved by modifying the expression of at least one gene selected from ptsG, sgrT, sgrS or dgsA, and b) recovering the methionine or methionine derivatives from the culture medium.
It will be appreciated that the present invention also relates to a method of producing methionine or methionine derivatives. In one embodiment, a method for the fermentative production of methionine or methionine derivatives is provided comprising the steps of: a) culturing the recombinant microorganism described above in an appropriate culture medium comprising a fermentable carbon source containing glucose and a sulfur source, and b) recovering methionine or methionine derivatives from the culture medium.
In a third aspect, the present invention provides a method for the fermentative production of methionine or methionine derivatives comprising the steps of: a) cultivating the recombinant microorganism in an appropriate culture medium comprising a fermentable source of carbon containing glucose and a source of sulfur, wherein said microorganism comprises: i) modifications to produce methionine from glucose as the main carbon source by fermentation, and ii) modifications to improve glucose import, wherein glucose import is improved by modifying the expression of at least one gene selected from ptsG, sgrT, sgrS or dgsA and b) recovering methionine or methionine derivatives from the culture medium. DETAILED DESCRIPTION OF THE INVENTION
Before describing the present invention in detail, it is to be understood that this invention is not limited to particularly exemplified methods and may, of course, vary. It is also understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting, as it will be limited only by the appended claims.
All publications, patents, and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. However, the publications mentioned herein are cited for the purpose of describing and disclosing the protocols, reagents and vectors which are reported in the publications and which may be used in connection with the invention. Nothing contained herein should be construed as an admission that the invention is not entitled to anticipate this description by virtue of prior invention.
Furthermore, the practice of the present invention employs, unless otherwise indicated, conventional microbiological and molecular biology techniques within the skill of the art. Such techniques are well known to the skilled person, and are fully explained in the literature. See, for example, Prescott et al. (1999); and Sambrook et al., (1989) (2001).
It should be noted that as used herein and in the appended claims, the singular forms of "a", "an", and "the", "a" include plural references unless the context clearly indicates otherwise. Thus, for example, a reference to "a microorganism" includes a plurality of such microorganisms, and a reference to "an enzyme" is a reference to one or more enzymes, and so on. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. While all materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, preferred materials and methods are now described. As used herein, the following terms may be used to interpret the claims and descriptive report.
In the following claims and in the preceding description of the invention, unless otherwise stated, due to the necessary language of expression or implication, the word "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e., to specify the presence of exposed features, but not to exclude the presence or addition of new feature features, in various embodiments of the invention.
In describing the present invention, genes and proteins are identified using the names of the corresponding genes in E. coli. However, unless otherwise specified, the use of these designations has a more general meaning according to the invention and encompasses all corresponding genes and proteins in other organisms, more particularly microorganisms. PFAM (Database of Protein Families and Markov Hidden Models and Alignments; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, assess distribution among organisms, access other databases and visualize the structures of known proteins. COGs (groupings of orthologous groups of proteins; http://www.ncbi.nlm.nih.gov/COG/ are obtained by comparing protein sequences from 66 fully sequenced genomes representing 38 major phylogenetic lineages. Each COG is defined from, at least three lineages, which allows the identification of previous conserved domains.
Means of identifying homologous sequences and their percent homologies are well known to those skilled in the art, and include, in particular, the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov /BLAST/ with the default default parameters indicated on the website. The obtained sequences can then be explored (eg aligned), using, for example, the CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://multalin.toulouse.inra) programs .fr/multalin /), with the default default parameters indicated on these sites.
Using the references given in GenBank to known genes, those skilled in the art are able to determine equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is done, advantageously, using consensus sequences which can be determined by performing sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene from another organism. These routine molecular biology methods are well known to those skilled in the art, and are claimed, for example, in Sambrook et al. (1989).
The present invention relates to a recombinant microorganism for the production of methionine. Specifically, the present invention relates to improving the production of methionine in a microorganism by increasing the import of glucose.
The term "improved methionine production" refers to an increased methionine productivity and/or an increased methionine titer and/or an increased methionine/carbon source yield and/or an increased carbon source purity" defines amount of methionine obtained during fermentation divided by the amount of glucose that was consumed. It can be expressed as a percentage of g methionine/g glucose or mol methionine/mol glucose. The term "increased" in this context describes an increase measurable compared to the microorganism without the specified modifications. In preferred embodiments, the increase is at least about 7%, preferably at least about 15%, preferably at least about 25%, more preferably at least about 25% about 30%. The total yield of methionine/glucose is preferably at least about 7% g/g, preferably at least about 15% g/g, preferably at least about 20% g/g, more preferably at least about 24% g/g.
Methods for determining the amount of glucose consumed and methionine produced are well known to those skilled in the art and are discussed elsewhere herein.
The terms "increased purity of methionine" or "increased purity methionine" refer to the amount of ketomethylvalerate (KMV) and/or homolanthionine (HLA) obtained during fermentation compared to the amount of methionine produced. In this context, the ratio of the amount of KMV and HLA compared to the amount of methionine is improved in the microorganism of the invention. This ratio can be improved either by decreasing the amount of KLV and HLA produced or by improving the amount of methionine produced while the concentration of KMV and HLA remains constant, or both. Advantageously, it also refers to the amount of glucose remaining in the fermentation broth at the end of the culture compared to the amount of methionine produced. In that invention, the ratio of glucose remaining in the fermentation broth compared to the amount of methionine produced is decreased in the microorganism of the invention. This relationship can be improved either by decreasing the amount of glucose remaining in the fermentation broth or by improving the amount of methionine produced while the total amount of glucose injected into the fermenter remains constant, or both.
Methods for determining the amount of methionine, NAM, KMV, HLA and glucose contained in the medium are well known to those skilled in the art. For example, the amount of L-methionine can be measured by HPLC after OPA/Fmoc derivatization using L-methionine (Fluka, Ref. 64319) as a standard.
As discussed above, external glucose is transported to bacterial cells and phosphorylated by the phosphoenolpyruvate:sugar phosphotransferase (PTS) system (Meadow et al. 1990; Rohwer et al. 1996; Tchieu et al. 2001) Phosphorylated glucose is toxic to cells at high concentrations and as such the PTS system is highly regulated. This, combined with the fact that the system is complex, makes manipulating the system very difficult. However, as described below, the present inventors have produced a recombinant microorganism with greater glucose import.
The term "recombinant microorganism", as used herein, refers to a bacterium, yeast or fungus that is not found in nature and is genetically different from equivalent microorganisms found in nature. According to the invention, the term "modifications" means any genetic alteration introduced or induced in the microorganism. The microorganism can be modified through any introduction or deletion of new genetic elements. Furthermore, a microorganism can be modified by forcing the development and evolution of new metabolic pathways through the combination of directed mutagenesis and evolution under specific selection pressure (see, for example, WO 2004/076659). Preferably, the microorganism is selected from the group comprising Enterobacteriaceae, Clostridiaceae, Bacillaceae, Streptomycetaceae, Corynebacteriaceae and Saccharomyceteceae.
More preferably the microorganism is a species of Enterobacteriaceae or Corynebacteriaceae or Saccharomyces cerevisiae. In one embodiment, the microorganism is Escherichia coli (E. coli).
In particular, the examples show the modified E. coli strains, but these modifications can easily be carried out in other microorganisms of the same family. E. coli belongs to the family of Enterobacteriaceae, which comprises members that are Gram-negative, rod-shaped, non-spore-forming, and are typically 1-5 µm in length. Most members have scourges used to move around, but some genders are not mobile. Many members of this family are a normal part of the intestinal flora found in the intestines of humans and other animals, while others are found in water or soil, or are parasites on a variety of different animals and plants. E. coli is one of the most important model organisms, but other important members of the Enterobacteriaceae family include Klebsiella, in particular Klebsiella pneumoniae, and Salmonella.
The term "improving glucose import", "improved glucose import", and its grammatical equivalents, as used herein, refer to an increased rate of glucose absorption. The term "increased glucose absorption rate" refers to the amount of glucose consumed during fermentation divided by the biomass concentration. Specifically, the glucose uptake rate can be defined as described below: rs qs = — x , where rs is the glucose uptake rate and X is the biomass concentration. The glucose absorption rate dS rS =— can be described as: dt , where S is the amount of glucose consumed at time t. For fed-batch fermentation, the amount of glucose consumed during the culture corresponds to the glucose present in the batch culture, plus the glucose added to the inoculum plus the glucose injected during the fed-batch phase minus the residual glucose at the end of the experiment is subtracted . Other techniques can be used and described in the literature: - The use of fluorescent glucose analogue (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose or 2-NBDG) for measuring glucose uptake rates (Natarajan A. and Srienc F. (1999) Metabolic engineering, vol 1, number 4, 320-333), - Measurement of PtsG activity (Kornberg HL and Reeves RE Biochem. J (1972) 128, 1339-1344; Rungrassamee et al., Erch Microbiol (2008) 190:41-49), - qRT-PCR (quantitative real-time polymerase chain reaction) profiles that are used to quantify a specific target as ptsG mRNA and confirm a marked expression of the corresponding gene.
The term "increased" in this context describes a measurable increase compared to the microorganism without the specified modifications.
According to the present invention, glucose import is improved by modifying the expression of at least one gene selected from ptsG, sgrT, sgrS or dgsA. Furthermore, the enhancement of glucose import by overexpression of ptsG or through increased activity of PtsG in the microorganism can be measured by several techniques known to those skilled in the art.
The term "modifying expression", as used herein, indicates that the expression of a gene is increased or decreased through the introduction or deletion of genetic elements. Typically, gene expression is increased or decreased compared to an equivalent microorganism that has not been modified, i.e. a microorganism that does not comprise the introduction or deletion of genetic elements to improve glucose transport. Methods for determining whether expression of a gene is increased or decreased in reference to a pattern are well known in the art and are discussed below.
Glucose import is improved in accordance with the present invention by enhancing the expression of the ptsG gene. The ptsG gene encodes the enzyme PTS IICBG1C (synonyms-EC 2.7.1.69; protein N-(pi)-phosphohistidine-sugar phosphotransferase; enzyme II of the phosphotransferase system; enzyme PEP-sugar phosphotransferase II; PTS permease) in E.coli . The nucleotide sequence of the ptsG gene is shown in SEQ ID NO: 18.
The term "stressed", "stressed" and its grammatical equivalents, as used herein, refers to a modification that increases or upregulates the expression of a gene compared to an equivalent microorganism that has not been modified. The terms "accented expression", "augmented expression" or "overexpression" are used interchangeably in the text and have a similar meaning.
Various means of increasing the expression of a gene in a microorganism are known to those skilled in the art and include, for example, increasing messenger RNA stability, increasing gene copy number, using a stronger promoter, removing regulatory elements, or using an allele with the increased activity, or possibly through a combination of such measures. Furthermore, the expression of a gene can be increased through chromosomal or extrachromosomal means. For example, multiple copies of the gene can be introduced into the microorganism's genome by recombination methods. Alternatively, genes can be carried by different types of plasmids that differ with respect to their origin of replication and thus their copy number in the cell. Genes can be present in 1-5 copies, about 20 or even 500 copies, corresponding to low copy plasmids with firm replication (pSC101, RK2), low copy plasmids (pACYC, pRSF101O) or high plasmids number of copies (PSK bluescript II). Regulatory elements are important for controlling gene expression. For example, genes can be expressed using promoters of different potencies, which, moreover, can be inducible. These promoters can be homologous or heterologous. It is well within the ability of one of skill in the art to select appropriate promoters, however, for example, the Ptrc, Ptac, Plac or lambda cl promoters are widely used. In one embodiment, expression of the ptsG gene is enhanced by placing the gene under the control of an inducible or a constitutive promoter.
In another embodiment, expression of the ptsG gene is enhanced by removal of the sequence encoding the small sgrS RNA binding site.
The term "remove the coding sequence for the small sgrS RNA binding site" means that the small sgrS RNA binding site (SEQ ID NO:19) is deleted totally or partially, so as to prevent the binding of small sgrS RNA about the ptsG gene.
Glucose import is also improved by attenuating the expression of the sgrS gene and/or the sgrT gene and/or the dgsA gene. The sgrS gene encodes sRNA related to small RNA sugar transport in E.coli. The nucleotide sequence of the sgrS gene is shown in SEQ ID NO: 20. The sgrT gene encodes the small polypeptide sgrT in E.coli. The nucleotide sequence of the sgrT gene is shown in SEQ ID NO: 21. The dgsA gene encodes a global regulator acting as a transcriptional repressor for several genes, especially E. coli ptsG gene and ptsHIcrr operon. The nucleotide sequence of the dgsA gene is shown in SEQ ID NO: 22.
The term "attenuated", as used herein, refers to the partial or complete suppression of the expression of a gene. This expression suppression can be either an inhibition of gene expression, a deletion of all or part of the promoter region necessary for gene expression, a deletion in the coding region of the gene, and/or a switch from wild-type promoter to a weaker natural or synthetic promoter. Preferably, the attenuation of a gene is essentially the complete deletion of that gene, which can be replaced by a selectable marker gene that facilitates the identification, isolation and purification of the strains according to the invention. For example, suppression of gene expression can be achieved through the homologous recombination technique (Datsenko and Wanner, 2000). In one embodiment, glucose import is improved by deletion of the sgrS gene. In another embodiment, glucose import is improved by deletion of the sgrT gene. In another embodiment, glucose import is improved by deletion of the dgsA gene.
In another embodiment, glucose import is improved through a combination of the modifications discussed above. For example, in the microorganism of the invention, glucose import can be improved by: o enhancing the expression of the ptsG gene and attenuating the expression of the sgrS gene; o enhance the expression of the ptsG gene and attenuate the expression of the sgrT gene; o enhance the expression of the ptsG gene and attenuate the expression of the dgsA gene; o increase the expression of the ptsG gene and attenuate the expression of the sgrS gene and the sgrT gene, o increase the expression of the ptsG gene and attenuate the expression of the dgsA gene and the sgrS gene, o increase the expression of the ptsG gene and attenuate the expression of dgsA gene and the sgrT gene, o enhancing the expression of the ptsG gene and attenuating the expression of the dgsA gene and the sgrT and sgrS genes, o attenuating the expression of the dgsA gene and attenuating the expression of the sgrS and/or sgrT genes.
In a preferred embodiment of the invention, glucose import is improved by enhancing the expression of the ptsG gene and attenuating the expression of the sgrS gene and the sgrT gene.
In another preferred embodiment of the invention, glucose import is improved by enhancing ptsG gene expression and attenuating dgsA gene expression.
More preferably, glucose import is improved by enhancing the expression of the ptsG gene and attenuating the expression of the dgsA gene and the sgrT and sgrS genes.
Modifications to improve glucose transport in order to improve methionine production are not done alone, but in combination with modifications that promote the fermentative production of methionine by a microorganism from glucose as a major carbon source. Modifications that promote the production of methionine in a microorganism are well known to those skilled in the art. In one embodiment, expression of at least one of the following genes is enhanced: pyc, pntAB, cysP, cysU, cysW, cysA, cysM, cysJ, cysl, cysH, gcvT, gcvH, gcvP, Ipd, serA, serB, serC, cysE, metF, metH, thrA, a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*), or a thrA allele encoding an enzyme with reduced feedback inhibition to threonine (thrA*). In a particular embodiment of the invention, at least one of these genes may be under the control of an inducible promoter. In a preferred embodiment of the invention, the thrA* gene is expressed under an inducible promoter.
In another embodiment, expression of at least one of the following genes is attenuated: metJ, pykA, pykF, purU, yncA, or udhA. Methods of modifying gene expression in a microorganism are well known to those of skill in the art and are discussed, supra and infra.
Additionally, fermentative production of methionine by a microorganism from glucose as a major carbon source can be achieved through a combination of the above-discussed modifications, for example: > the expression of the metJ gene is attenuated and the expression of a metA allele coding for an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is accentuated; > the expression of the metJ gene is attenuated; expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is marked; and expression of a thrA allele encoding an enzyme with reduced feedback inhibition for threonine (thrA*) is marked; > the expression of the metJ gene is attenuated; expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is marked; expression of a thrA allele encoding an enzyme with reduced feedback inhibition for threonine (thrA*) is marked; and cysE gene expression is accentuated; > the expression of the metJ gene is attenuated; expression of a metA allele encoding an enzyme with reduced feedback sensitivity to S-adenosylmethionine and/or methionine (MetA*) is marked; expression of a thrA allele encoding an enzyme with reduced feedback inhibition for threonine (thrA*) is marked; cysE gene expression is accentuated; and the expression of the metF and/or metH genes is accentuated.
In a specific embodiment of the invention, the recombinant microorganism comprises the following genetic modifications: a) the pstG gene is overexpressed and/or does not contain the sgrS binding site of sRNA and/or the sgrS gene is deleted and/or the sgrT gene is deleted and/or dgsA gene is deleted; b) the expression of the genes metA*, metH, cysPUWAM, cysJIH, gcvTHP, metF, serA, serB, serC, cysE, thrA* and pyc is accentuated; and c) the expression of metJ, pykA, pykF, purU and yncA genes is attenuated.
The present invention also relates to a method of producing methionine or methionine derivatives, comprising culturing the above-described microorganism in an appropriate culture medium comprising a fermentable carbon source containing glucose and a sulfur source, and recovering methionine or methionine derivatives from the culture medium.
Those skilled in the art are able to define culture conditions for microorganisms in accordance with the present invention. Preferably, the microorganisms are fermented at a temperature between 20°C and 55°C, preferably between 25°C and 40°C, and more specifically about 37°C for E. coli.
Fermentation is generally conducted in fermenters with an inorganic culture medium of a known defined composition, adapted to the microorganism being used, containing at least a simple carbon source, and, if necessary, a necessary co-substrate for production of the metabolite. In particular, the inorganic culture medium for E. coli can be of identical or similar composition to an M9 medium (Anderson, 1946), an M63 medium (Miller, 1992) or a medium as defined by Schaefer et al. (1999, Anal Biochem 270: 88-96).
The term "fermentable carbon source" refers to any carbon source capable of being metabolized by a microorganism, wherein the substrate contains at least one carbon atom. In a particular embodiment of the invention, the carbon source is derived from renewable power load. The renewable feed load is defined as the raw material required for certain industrial processes, which can be regenerated in a short period of time and in sufficient quantity to allow its transformation into the desired product.
In accordance with the present invention, the carbon source contains glucose.
After fermentation, methionine or methionine derivatives can be recovered from the culture medium and, if necessary, purified. Methods of recovering and purifying a compound such as methionine and methionine derivatives from culture media are well known to those skilled in the art.
Methionine derivatives originate from methionine transformation pathways and/or degradation pathways. In particular, these products are S-adenosyl-methionine (SAM) and N-acetylmethionine (NAM). In particular, NAM is an easily recoverable methionine derivative that can be isolated and transformed into methionine by deacylation. Thus, the phrase "recovering methionine or methionine derivatives from the culture medium" refers to the action of recovering methionine, SAM, NAM and all other derivatives that may be usable. DRAWINGS
Figure 1: concentration of residual glucose in g/L, during the culture of strains 1 and 2. (♦): strain 1 called strain Ref; (▲) : strain 2 under 20/20 IPTG concentration conditions and (•) : strain 2 under 20/80 IPTG concentration conditions. EXAMPLES PROTOCOLS
Several protocols were used to construct methionine producing strains described in the following examples.
Protocol 1: Chromosomal modifications by homologous recombination and selection of recombinants (Datsenko &Wanner, (2000) .
Allelic replacement or gene disruption at a specified chromosomal locus was performed by homologous recombination, as described by Datsenko &Wanner (2000). The chloramphenicol resistance cat (Cm), or kanamycin resistance kan (Km), flanked by Flp recognition sites, were amplified by PCR using plasmids pKD3 or pKD4 as a template, respectively. The resulting PCR products were used to transform the recipient strain of E. coli harboring plasmid pKD46 which expresses X Red (y, β, exo) recombinase. Antibiotic resistant transformants were then selected chromosomal of the changed locus and verified by PCR analysis as the appropriate primers listed in Table 1 below.
The cat resistance gene can be changed by the kan resistance gene using plasmid pCP20 which carries the gene encoding Flp recombinase as described by Datsenko &Wanner (2000) and the plasmid pKD4 which carries the kan gene. Plasmids pCP20 and pKD4 were introduced into the appropriate strain and transformants were spread in LB supplemented with kanamycin at 37°C in order to express the flp gene and growing clones were then verified by PCR using oligonucleotides listed in Table 1.
Resistance genes were removed using plasmid pCP20 as described by Datsenko. &Wanner (2000) . Briefly, clones harboring plasmid pCP20 were grown at 37°C in LB and then tested for loss of antibiotic resistance at 30°C. Antibiotic sensitive clones were then verified by PCR using primers listed in Table 1.
Protocol 2: PI phage transduction Chromosomal modifications were transferred to a given recipient strain of E. coli by PI transduction. The Protocol consists of 2 steps: (i) preparation of the phage lysate in a donor strain containing the chromosomal modification associated with the resistance associated with the resistance and (ii) infection of the recipient strain by this phage lysate. Phage Lysate Preparation
Inoculate 100 μl of an overnight culture of the MG1655 strain with the chromosomal modification of interest in 10 ml of LB + Cm 30μg/ml or Km 50μg/ml + glucose 0.2% + CaC12 5 μm. Incubate 30 min at 37°C with shaking.
Add 100 µl of PI phage lysate prepared in donor strain MG1655 (approximately 1 x 109 phage/ml). Stir at 37°C for 3 hours until complete cell lysis. Add 200 μl of chloroform, and vortex Centrifuge 10 min at 4500 g to eliminate cell debris. Transfer supernatant to a sterile tube. Store lysate at 4°C. transduction
Centrifuge 10 min at 1500 g 5 ml of an overnight culture of a recipient strain of E. coli grown in LB medium. Suspend the cell pellet in 2.5 ml of 10 µm MgSO4, 5 µm CaClz.
Infect 100 μl of cells with 100 μl of PI phage from strain MG1655 with the modification on the chromosome (test tube 5) and as control tubes 100 μl of cells without PI phage and 100 μl of cells without PI phage.
Incubate 30 min at 30°C without shaking.
Add 100 μl of 1 M sodium citrate to each tube and vortex. - Add 1 ml of LB. Incubate 1 hour at 37°C with shaking. Centrifuge 3 min at 7000 rpm. Place on LB + Cm plate 30 μg/ml or Km 50 μg/ml. Incubate at 37°C overnight. Table 1: Oligonucleotides used in the following examples.


EXAMPLE 1: Construction of strain 2 1. Strain producing methionine 1
MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36- 5 mRNAstl7 -metF PtrcOl -serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA-TTAr-Plamb-*lpl-; : TTO 2-TTadc-PlambdaR* (-35) -RBS01 -thrA* 1 -cysE- PgapA-metA*ll ΔuxaCA::TT07-TTadc-PlambdaR*(-35)-RBS01- thrA*l-cysE-PgapA- metA*ll ΔCP4-6:;TT02-TTadc-PlambdaR*(-35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM:;TT02-TTadc- PlambdaR*(-35)-RBS01-thrA* -cysE-PgapA-metA*ll ΔtreBC: -TT02-serA-serC (pCL1920-PgapA-pycre-TT07) has been described in patent application PCT/FR2010/052937 which is incorporated by reference into this application. 2. Construction of strain 2
To increase the importation of glucose into the cell, PtsG (IICG1C), the glucose-specific PTS permease of the glucose phosphotransferase system was overproduced from a bacterial artificial chromosome and the use of an artificial inducible trc promoter.
Plasmid pCClBAC-PlacTq-lacT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07 is derived from plasmids pCClBAC-PlacIq-lacJ-TT02-Ptrc01/OP01/RBS01*2-GfpTurboOpt-TT07 (described below) and thus from the bacterial artificial chromosome pCCIBAC (Epicentre). For the construction of plasmid pCClBAC-PlacIq-lad-TT02-Ptrc01/OP01/RBS01*2-GfpTurboGpt-TT07, the fragment PlacTq-lacJ-TT02-Ptrc01/0P01/RBS01*2-GfpTurboGpt-TT07 was obtained by overlap PCR . First, the Placlq-2acT-TT02 region was PCR amplified from plasmid Ptrc99A (Stratagene) using the following oligonucleotides, Ome2070-EcoRI-PlacIq-F and Ome2071-NheI-TT02-lacIq-R, and the Ptrc01/OP01 region /RBS01*2-GfpTurboOpt-TTOI was amplified by PCR from plasmid pCR4BluntTOPO-TTadc-CT857*- PlambdaR*(-35)-RBS01-GfpTurboOpt-TT07 (synthesized by Geneart and described below) using the following oligonucleotides, 0me207TurboOpt -RBSO1*2-Avril-OPOL- Ptrc01-NheI-TT02-F and Ome2073-EcoRI-SfiI-Pad-TT07-R. Then, the overlap PCR was cycled using the PlacIq-lacI-TT02 and Ptrc01/GP01/RBS01*2-GfpTurboOpt-TT07 PCR products which have an overlapping region as a template, and the oligonucleotides Ome2070-EcoRI-PlacIq-F and Ome2073 -EcoRI-SfiI-PacI-TT07-R. The final PCR product PlacIq-lacI-TT02-Ptrc01/GP01/RBS01*2-GfpTurboOpt-TT07 was digested by restriction enzymes EcoRI and SfiT and cloned into the EcoRT/SfiT sites of the pCCIBAC vector. Recombinant plasmid was verified by DNA sequencing, giving plasmid pCCIBAC-PlacIq-lacI-TT02-Ptrc01/GP01/RBS01*2-GfpTurboOpt-TT07. Ome2070-EcoRI-PlacIq-F (SEQ ID NO 1) ccggaattc CATTTACGTTGACACCATCGAATGG com - lowercase sequence for EcoRI restriction site and extrabases, uppercase sequence homologous to the modified Placlq version of the lacl gene promoter, carried by the Ptrc99A (2967) vector -2991, reference sequence at http://www.ncbi.nlm.nih.gov/nuccore/M22744.1) Ome2071-NheI-TT02-lacIq-R (SEQ ID NO 2) GATTAATTGTCAACAGCTCcgtagctagcAACAGATAAAACGAAGGGCCCAGTC TTTCGACTGAGCCTTTAGTCTCTCTTg bold homologous to the trc artificial promoter, PtrcOl (Meynial-Salles et al. 2005) lowercase sequence for Nhel restriction site and extrabases, uppercase italic sequence for E. coli rrnB gene Ti transcription terminator (Orosz et al. .1991), reference sequence on the website http://ecogene.org/), called TT02 sequence in capital letters homologous to the lacl gene (4118-4137, reference sequence on the website http://www.ncbi.nlm.nih .g ov/nuccore/M22744.1, or 365652-365671, reference sequence at http://ecogene.org/) - underlined sequence showing overlapping region required for overlapping PCR step Ome2072-GfpTurboOpt-RBS01*2 -AvrII-OP01-Ptrc01-NheI-TT02-F (SEQ ID NO 3) CGTTITATCTGTTgctagctacgGAGCTGTTGACAATTAATCATCCGGCTCGTA TAATGTGTGGAATTGTGAGCGGATAAC AATT tcacctaggt aaggaggttataaATGGA ATCTGA et al. 1991), reference sequence on the website http://ecogene.org/), called TT02 - sequence in lowercase for restriction site Nhel or Avril and extrabases, - sequence in bold capital letter homologous to the artificial promoter trc, PtrcOl and operator , OPOl (Meynial- Salles et al. 2005) - bold italic lowercase sequence for ribosome binding site sequence, called RBS01*2 - capital letter sequence homologous to the modified form of the gfp gene, meaning optimized for codon usage from E. coli, called GfpTurboOpt underlined sequence showing overlapping region required for overlapping PCR step Ome2073-EcoRI-SfiI-Pad-TT07-R (SEQ ID NO 4) ccagaattcggcccgggcggccttaattaaGCAGAAAGGCCCACCCGAAG with lowercase sequence for EcoRI restriction sites , SfiT, Pad eextrabases capital italic sequence for T7Te transcription terminator sequence (Harrington et al. 2001), called TT07 region GfpTurboOpt-TT07 present in plasmid p CR4BluntTOPO-TTadc -PlambdaR-CI857 * * (- 35) -RBS01- GfpTurboOpt-TT07 synthesized by Geneart Company (SEQ ID NO 17): taaggaggttataaatggaatctgatgaaagcggtctgcctgcaatggaaattg aatgtcgtattaccggcaccctgaatggtgttgaatttgaactggttggtggtggtgaa ggtacaccggaacagggtcgtatgaccaataaaatgaaaagcaccaaaggtgcactgac ctttagcccgtatctgctgtctcatgttatgggctatggcttttatcattttggcacct atccgagcggttatgaaaatccgtttctgcatgccattaataatggtggctataccaat acccgcattgaaaaatatgaagatggtggtgttctgcatgttagctttagctatcgtta tgaagccggtcgtgtgattggtgattttaaagttatgggcaccggttttccggaagata gcgtgatttttaccgataaaattattcgcagcaatgccaccgttgaacatctgcacccg atgggtgataatgatctggatggtagctttacccgtacctttagcctgcgtgatggtgg ttattatagcagcgttgtggatagccatatgcattttaaaagcgccattcatccgagca ttctgcagaacggtggtccgatgtttgcatttcgtcgtgtggaagaagatcatagcaat accgaactgggcattgttgaatatcagcatgcctttaaaacaccggatgcagatgccgg t gaagaat with aaGTATACtcacactggctcaccttcgggtgggcctttctgc - sequence bold italic lowercase letter for ribosome binding site, called RBS01*2 - sequence in lowercase letter homologous to the GfpTurbo gene (Evrogene) optimized for E. coli, called GfpTurboOpt - capital letter sequence for BstZ17I restriction site - underlined letter sequence for T7Te transcription terminator sequence (Harrington et al. 2001), called TT07.
To exchange the GfpTurboOpt gene for the ptsG gene in the vector pCCIBAC-PlacIg-lacI-TT02-Ptrc01/OP01/RBS01*2-GfpTurboOpt-TT07 to obtain plasmid pCClBAC-PlacTq-2acT-TT02-Ptrc01/OP01/RBS01*2-pt -TT07, pCClBAC-P2acJq-lacT-TT02-Ptrc01/OP01/RBS01*2-GfpTurboOpt-TTOl was first partially digested by restriction enzymes AvrII and BstZ17I. Then, the ptsG region was PCR amplified from genomic DNA of E. coli strain MG1655 using the following oligonucleotides, Ome2115-AvrII-RBS01*2-ptsG-F and Ome2116-BstZ17I-ptsG-R and the resulting PCR product was digested by Avr11 and BstZ17I restriction enzymes and cloned into the AvrII/SstZ17I sites of the pCClBAC-P2acIq-2acT-TT02-Ptrc01/OP01/RBS01*2-GfpTurboOpt-TTQ7 vector. The recombinant plasmid was verified by DNA sequencing, giving plasmid pCClBAC-P2acTq-2ac∑-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07. Ome2115-AvrII-RBS01*2-ptsG-F (SEQ ID NO 5) ccaaggaaaagcggccgccc t aggTAAGGAGGTTATAAATGTTTAAGAATGCAT TTGCTAACC with lowercase sequence for restriction sites Notl,Avril and extrabases bold uppercase sequence for ribosome binding site RBS01*2 capital letter sequence homologous to the ptsG gene (1157092-1157116, reference sequence at http://ecogene.org/) Ome2116-BstZ17I-ptsG-R (SEQ ID NO 6) gac gtat ac TTAGTGGTTACGGATGTACTCATC with sequence in lowercase letter for BstZ17I restriction site and extrabases capital letter sequence homologous to the ptsG gene (1158502-1158525, reference sequence at http://ecogene.org/) Finally, the resulting plasmid pCClBAC-PlacTq- lad-TT02-Ptrc01 /OP01/RBS01*2-ptsG-TT07 was introduced into strain 1 giving rise to strain MG1655 2, MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7 -metF PtΔBΔPUF ΔyncA ΔmalS:;TTadc-CT857-PlambdaR* (-35)-thrA*l-cysE ΔpgaABCD: TT02-TTadc-PlambdaR* (-35) -RBS01 -thrA* 1 -cysE- PgapA-metA*ll ΔuxaCA: ;TT07-TTadc-PlambdaR* (-35) - RBS01- thrA*l-cysE-PgapA-metA* 11 ΔCP4-6: .-TT02-TTadc-PlambdaR* (- 35) -RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM: .-TT02-TTadc - PlambdaR* (-35)-RBS01-thrA*1-cysE-PgapA-metA*ll ΔtreBC: .-TT02-serA-serC (pCL1920-PgapA-pycre-TT07) (pCClBAC-PlacIq-lacT-TT02-Ptrc01/ OP01/RBS01*2-ptsG-TT07).
In this construct pCClBAC-PlacTq-lad-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07, the natural promoter as well as the small sgrS RNA binding site is replaced by a strong artificial promoter. Consequently, ptsG is overexpressed and its mRNA is no longer regulated and triggered for degradation by sgrS.
The overexpression of ptsG in the strain cultivated under inducible conditions (+IPTG in the culture) was verified by qPCR. EXAMPLE 2: Construction of strain 4 1. Strain producing methionine 3
MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36- mRNAstl7-metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA-TtAmbda:*PlAmbda:*35: : TT02-TTadc-PlambdaR* (-35) -RBS01-thrA*l-cysE- PgapA-metA*ll ΔuxaCA:: TT07-TTadc-PlambdaR*(-35)-RBS01- thrA* 1-cysE-PgapA-metA * 11 ΔCP4-6::TT02-TTadc-PlambdaR* (- 35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM::TT02-TTadc- PlambdaR* (-35)-RBS01-thrA*l -cysE-PgapA-metA*ll ΔtreBC::TT02-serA-serC Ptrc30-pntAB::Cm ΔudhA (pCL1920-PgapA-pycre-TT07) has been described in patent application WO2012/055798 which is incorporated by reference in this application. 2. Construction of strain 4
In order to overproduce PtsG in a strain producing modified methionine in its NADPH production pathway (UdhA and PntAB transhydrogenases), applicants modified the antibiotic resistance cassette of pCCIBAC-PlacTq-lacT-TT02-Ptrc01/OP01/RBS01*2 - ptsG-TT07 (described in example 1) . Applicants modified the chloramphenicol resistance gene from pCClBAC-P2acTq-2acJ-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07 by a gentamicin resistance gene, giving plasmid pCClBACVB01-P2acIq-2ac∑-TT02-Ptrc01 /θP01/RBS01*2-ptsG-TT07. To proceed with this antibiotic resistance gene change, Applicants used a procedure based on the Red system loaded by the pKD46 vector (Genebridges). For this purpose, 2 oligonucleotides were used: Ome2127-RHamont-pCClBAC-Gt-F (SEQ ID NO 7) CCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAAGGGCACCAATA ACTGCCTTAAAAAAAATTAGGTGGCGGTACTTGGGTCGATATCAAAGGTCTACACTTCC vector sequence homologous sequence of the gene CCGCTTGATCACTTCCA gene sequence homologous sequence CCGACTGACCTCCA TCGA's gene sequence homologous CCTGTATCACTTC capital homologous to the gentamicin resistance gene carried by the p34S-Gm vector (Dennis & Zyltra, 1998) (735-805, reference sequence on the website http://www.ncbi.nlm.nih,gov/nuccore/AF062079.1 ) and Ome2128-RHaval-pCCIBAC-Gt-R (SEQ ID NO 8) TGAAATAAGATCACTACCGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGC TAAGGAAGCTAAAATGTTACGCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTA AAACAAAGTTAGGTGGl gene resistance to the gene's resistance to the gene's gene's resistance to the gene's gene's resistance to the gene's gene's resistance to the gene's gene pclolologue in capital letter's gene's resistance to the gene's gene's resistance to the gene's gene pclolologue in uppercase 5 TAGGTGG gene's resistance to the gene's gene's resistance to the gene's underline gene pclolologue TTAGGTGG loaded by p34S-Gm vector (Dennis & Zyltr a, 1998) (272-344, reference sequence on the website http://www.ncbi.nlm.nih.gov/nuccore/AF062079.1) Oligonucleotides Ome2127-RHamont-pCClBAC-Gt-F and Ome2128-RHaval- pCClBAC-Gt-R were used to amplify the gentamicin resistance cassette from plasmid p34S-Gm (Dennis & Zyltra, 1998). The PCR product obtained was then introduced by electroporation into the DHSalpha strain (pCCIBAC-PlacIq-lacI-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07) (pKD46) in which the enzyme Red recombinase allows for homologous recombination. Gentamicin-resistant and chloramphenicol-sensitive transformants were then selected and the insertion of the resistance cassette was verified by restriction profile analysis. Finally, the recombinant plasmid pCClBACVBOl-PlacIq-lacI-TT02-Ptrc01/OP01/RBS01*2 -ptsG-TT07 was verified by DNA sequencing and introduced into strain 3 giving strain MG1655 4 MG1655 metA*11 Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA ΔmalS::TTadc-CT857-PlambdaR* (-35)-PlambdaR* (-35) -Tsdad*l-PlambdaR*(-35)-Tsdad*l- )-RBSO1-thrA*1-cysE-PgapA-metA*11 ΔuxaCA::TT07-TTadc-PlambdaR*(-35)-RBSO1-thrA*1-cysE-PgapA-metA*ll ΔCP4-6::TT02-TTadc -PlambdaR*(-35)-RBS01-thrA*l- cysE-PgapA-metA*ll ΔwcaM::TT02-TTadc-PlambdaR*(-35)-RBS01- thrA*1-cysE-PgapA-metA*11 ΔtreBC: :TT02-serA-serC Ptrc30-pntAB::rCm ΔudhA (pCL1920 -PgapA-pycre-TTO7) (pCClBACVBOl-PlacIq-lacI-TT02-Ptrc01/QP01/RBS01*2 -ptsG-TT07) . In this construct pCClBACVB01-P2acTq-2ac∑-TT02-Ptrc01/GP01/RBS01*2-ptsG-TT07, the natural promoter as well as the small sgrS RNA binding site is replaced by a strong artificial promoter. Consequently, ptsG is overexpressed and its mRNA is no longer regulated and triggered for degradation by sgrS. The overexpression of ptsG in the strain grown under inducible conditions (+IPTG in the culture) was verified by qPCR. EXAMPLE 3: Construction of strain 5
To avoid any regulation in the ptsG transcript and in the PtsG protein, the applicants deleted the sgrT gene, which encodes a small peptide regulating PtsG activity and the part of the sgrS gene that codes for the small sgrS RNA that interferes with the ptsG mRNA.
The sgrS/T genes are the first genes of the sgrS/T-setA operon. In order to delete the sgrS/T genes without abolishing the expression of the downstream setA gene, we deleted sgrS/T and at the same time moved the set A gene downstream of the operon promoter. To this end, Applicants used the homologous recombination strategy described in Protocol 1. The Escherichia coli strain BW25113 ΔsetA::Km (pKD46) the Keio mutant collection (Baba et al., 2006) was used to insert a resistance cassette to chloramphenicol while deleting the sgrS/T genes and restoring the setA gene downstream of the operon promoter.
Specifically, the fragment "sgrR-PsgrR-PsgrrS-RBSsetA-setA-FRT-Cm-FRT-leuD" (fragment 4), needed to delete the sgrS/T genes was amplified by overlap PCR. First fragments 1, 2 and 3 that serve as a template for the final overlap PCR were amplified; each of these fragments has at least 48 nucleotides in the homologous region straddling the 3' and 5' ends that allow for the overlap PCR step. Fragment 1, "sgrR-PsgrR-PsgrS-RBSsetA-setA", was amplified from genomic DNA of Escherichia coli MG1655 using oligonucleotides Ome2371-DsgrrS-Fl and Ome2372-DsgrS-Rl; fragment 2, "PsgrR-PsgrS-RBSsetA-setA", was amplified from genomic DNA of Escherichia coli MG1655 using oligonucleotides Ome2373-DsgrS-F2 and Ome2374-DsgrS-R2; fragment 3, "FRT-Cm-FRT-leuD", was amplified by PCR from plasmid pKD3, using oligonucleotides Ome2375-DsgrS-F3 and Ome2376-DsgrS-R3. Finally, fragment 4 was amplified by PCR from a mixture of fragments 1, 2 and 3 used as a template and using oligonucleotides Ome2371-DsgrS-Fl and Ome2376-DsgrS-R3. Ome2371-DsgrS-Fl (SEQ ID NO 9) GGACGCAAAAAGAAACGCCAGTG homologous to the sgrR gene (76743-76765, reference sequence on the website http://ecogene.org/) Ome2372-DsgrS-Rl (SEQ ID NO 10) GTCATTATCCAGATCATACGTTCCCTTTGGACACTGACCCAT with sequence capital letter homologous to sgrR and sgrS promoter region (77379-77398, reference sequence at http://ecogene.org/) bold capital letter homologous to setA region (77637-77607, reference sequence at website http:// /ecogene.org/) - underlined letter sequence showing overlap region required for overlap PCR step Ome2373-DsgrS-F2 (SEQ ID NO 11) GAAGCAAGGGGGTGCCCCATGCGTCAGTTTAAAAAGGGAACGTATGATCTGGAT AATGAC with capital letter sequence homologous to desgrR promoter and region sgrS(77370-77398, reference sequence on the website http://ecogene.org/) sequence in bold capital letters homologous to the setA region (77637-77607, reference sequence on the website http://ecogene.org/) - sequence in underlined letter mos translating the overlap region required for the overlapping PCR step Ome2374-DsgrS-R2 (SEQ ID NO 12) GGAATAGGAACTAAGGAGGATATTCATATGTCAAACGTCTTTAACCTTTGCGG with sequence in capital italic for the amplification of the chloramphenicol resistance cassette (reference sequence in Dannertsenko) & sequence in bold capital letter homologous to the setA region (78799-78777, reference sequence at http://ecogene.org/) - sequence in underlined letter showing the overlap region required for the overlap PCR step Ome2375-DsgrS- F3 (SEQ ID NO 13) GCATTATTTTTAACCGCAAAGGTTAAAGACGTTTGACATATGAATATCCTCCTT AGTTCCT com - sequence in bold capital letters homologous to the setA region (78764-78799, reference sequence at http://ecogene.org/) - sequence in capital letters in italics for amplification of the cassette cassette chloramphenicol resistance (reference sequence in Datsenko &Wanner, 2000) - sequence in underlined letter showing overlap region required section for overlapping PCR step Ome2376-DsgrS-R3 (SEQ ID NO 14) ATTGGGCTTACCTTGCAGCACGACGACGCCATTGCCGCTTATGAAGCAAAACAA CCTGCGTTTATGAATTAATCCCCTTGCCCGGTCAAATGACCGGGCTTTCCGCTATCGTC read CACGTCATGTAGGCTGGE78% site with reference sequence in capital letter CACGTCATGTAGGCTGG78 ,org/) - sequence in italic capital letters for the amplification of the chloramphenicol resistance cassette (reference sequence in Datsenko &Wanner, 2000) . The resulting PCR product, corresponding to fragment 4, was then introduced by electroporation into the BW25113 ΔsetA::Km (pKD46) strain, in which the Red recombinase enzyme allowed homologous recombination. Chloramphenicol resistant transformants were then selected and the insertion of the resistance cassette is verified by a PCR analysis with the oligonucleotides Ome2378-DsgrS-Fseq and Ome2377-DsgrS-Rseq defined below and verified by DNA sequencing. The selected strain was named BW25113 ΔsgrS::Cm. As the sgrT open reading frame overlaps with the sgrS sequence encoding the short RNA, the sgrS deletion results in the sgrT deletion. Thus, the sgrS/T deletion was called ΔsgrS. Ome2378-DsgrS-Fseq (SEQ ID NO 15) GATGGGATGGCTGGCAAAGT homologous to the sgrR gene (76502-76521, reference sequence at http://ecogene.org/) Ome2377-DsgrS-Rseq (SEQ ID NO 16) CGAGTTTTGCTGACATCTTCTACG homologous to the gene leuD (79143-79120, reference sequence at http://ecogene.org/)
The sgrS/T deletion was transferred by PI phage transduction from strain BW25113 ΔsgrS: : Cm to strain 1. Chloramphenicol resistant transformants were then selected and the insertion of the resistance cassette was verified by PCR analysis with oligonucleotides Ome2378-DsgrS-Fseq and Ome2377-DsgrS-Rseq. The resulting strain was called Strain 5, MG1655 metA*11 Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAst 17-metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA ncT7-DrAmbSmAmy )-thrA*l-cysE ΔpgaABCD:;TT02-TTadc-PlambdaR*(-35)-RBSO1-thrA*1-cysE- PgapA-metA*ll ΔuxaCA: .-TT0 7-TTadc-PlambdaR* (-35) - RBS01- thrA*1-cysE-PgapA-metA*11 ΔCP4-6:;TT02-TTadc-PlambdaR*(- 35)-RBSO1-thrA*1-cysE-PgapA-metA*11 ΔwcaM::TT02-TTadc-PlambdaR * (-35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔtreBC: .-TT02 -serA-serC ΔsgrS: :Cm (pCL1920-PgapA-pycre-TT07). EXAMPLE 4: Construction of strain 6
In order to overcome PtsG regulations in a strain modified by methionine in its NADPH production pathway (UdhA and PntAB transhydrogenases), the sgrS/T genes were deleted in strain 3.
To this end, the chloramphenicol resistance cassette of the ΔsgrS::Cm deletion was first exchanged for a kanamycin resistance cassette. For this, plasmids pCP20 and pKD4 were introduced in strain BW25113 'sgrS'.: Cm and after spreading the transformants on LB supplemented with kanamycin at 37°C, the growing clones were verified by PCR using oligonucleotides Ome2378-DsgrS-Fseq and Ome2377-DsgrS-Rseq. Then, the ΔsgrS-.:Km deletion was transferred by phage Pl transduction from strain BW25113 ΔsgrS-.:Km to strain 3. Kanamycin resistant transformants were then selected and the insertion of the resistance cassette was verified by a PCR analysis with oligonucleotides Ome2378-DsgrS-Fseq and Ome2377-DsgrS-Rseq. The resulting strain was called strain 6, MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcOl-serB ΔmetJ ΔpykF ΔpykA-cysJIH Ptrc09-gcvTHP -thrA*l-cysE ΔpgaABCD: ,-TTO 2-TTadc-PlambdaR* (- 35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔuxaCA:;TT07-TTadc- PlambdaR*(-35)-RBSO1 -thrA*1-cysE-PgapA-metA*11 ΔCP4-6: :TT02-TTadc-PlambdaR* (-35) -RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM: .-TT02-TTadc-PlambdaR * (-35) -RBSO 1 -thrA* 1 -cysE- PgapA-metA*ll ΔtreBC: .-TT02-serA-serC Ptrc30 -pntAB::Cm ΔudhA ΔsgrS::Km (pCL1920-PgapA-pycre-TT07). EXAMPLE 5: Construction of strain 7
In order to drastically increase glucose import into strain 2 that already overexpresses ptsG from pCClBACVB01-Pladq-lacI-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07, applicants deleted sgrS/T genes in this strain.
For this purpose, the ΔsgrS deletion was transferred by transduction of Phage Pl from strain BW25113 ΔsgrS-.Km to strain 2. Chloramphenicol resistant transformants were then selected and the insertion of the resistance cassette was verified by PCR analysis with the oligonucleotides Ome2378-DsgrS-Fseq and Ome2377-DsgrS-Rseq. The resulting strain was called strain 7, MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36 -mRNAstl7 -metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA nc 35) -thrA* 1 -cysE ΔpgaABCD: .-TT02-TTadc-PlambdaR* (-35) -RBS01 -thrA* 1 -cysE- PgapA-metA*ll ΔuxaCA: .-TTO 7-TTadc-PlambdaR* (-35) ) -RBS01- thrA*l-cysE-PgapA-metA*ll ΔCP4-6: .-TT02-TTadc-PlambdaR* (- 35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM::TTO2- TTadc- PlambdaR* (-35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔtreBC: .-TT02-serA-serC ΔsgrS::Cm (pCL1920-PgapA- pycre-TT07) (pCClBACVB01-Plac -TT02- Ptrc01/OP01/RBS01*2-ptsG-TT07).
The overexpression of ptsG in the strain grown under inducible conditions (+IPTG in the culture) was verified by qPCR. EXAMPLE 6: Construction of strain 15
1. Strain 8 Strain producing methionine 8 has been described in patent application WO2012/055798 which is incorporated by reference into this application. The strain 8 genotype is as follows MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36 -mRNAstl7 -metF PtrcO7-serB ΔmetJ ΔpykF ΔpykΔclambnda purU -thrA*1-cysE ΔpgaABCD::TT02-TTadc-PlambdaR*(-35) -RBS01-thrA*1-cysE- PgapA-metA*ll ΔuxaCA:;TT07-TTadc-PlambdaR*(-35)-RBS01- thrA *l -cysE-PgapA-metA*ll ΔCP4-6: .-TT02-TTadc-PlambdaR* (- 35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM:;TT02-TTadc-PlambdaR*( -35)-RBS01-thrA*1-cysE-PgapA-metA*ll ΔtreBC;;TT02-serA-serC.
2. Construction of strains 9, 10, 11 and 12 In order to overexpress the pyruvate carboxylase gene from Rhizobium etli, called pycre, one copy of this gene was integrated twice on the chromosome at the melB and purU loci. In the melB locus, the pycre gene was expressed by the addition of a synthetic Ptrc promoter sequence, an mRNA stabilization sequence, and an optimized ribosome binding site integrated upstream of the pycre gene translational start site. The construct was annotated ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07. At the purU locus, pycre gene was expressed by addition of PL1*1 (mutation in the -10 box of phage lambda promoter PÀL1) and an optimized ribosome binding site integrated upstream of the translational start site of the pycre gene. The construct was annotated ΔpurU::RN/PLl*l/RBS01*2-pycre-TT07. All descriptions of genetic integrations at different loci on the chromosome presented below are constructed according to the same method; 1) construction of the duplication vector containing homologous sequences upstream and downstream of the locus of interest, the DNA fragment and a resistance cassette 2) Integration of the modification of interest into the minimal strain (MG1655 metA*11 pKD46) by homologous recombination and 3 ) transduction of the modification of interest in the complex strain (MG1655 already containing several modifications).
2.1. Construction of strains 9 and 10 To delete the melBe gene and replace it with the Ptrc01/ARN01/RBS01*2-pycre-TT07 region, the homologous recombination strategy described by Datsenko &Wanner (2000) was used. This strategy allows the insertion of a chloramphenicol or kanamycin resistance cassette but also an additional DNA, while deleting most of the genes in question. For this purpose, the following plasmid was constructed, pUC18-ΔmelB::TT02-Ptrc01/ARN01/RBS01*2-pycre-TT07::Km. This plasmid pUC18-ΔmelB::TT02-Ptrc01/ARN01/RBS01*2-pycre-TT07::Km is derived from the pUC18 vector (Norrander et al., Gene 26 (1983), 101-106) and harbors the resistance cassette kanamycin linked to the Ptrc01/RNA01/RBS01*2-pycre-TT07 fragment, both cloned between the upstream and downstream regions of melB. For the construction of pUC18-ΔmelB::TT02-Ptrc01/ARN01/RBS01*2-pycre-TT07::Km, first plasmid pUC18-ΔmelB::TT02-SMC was constructed. This plasmid carries the upstream and downstream regions of melB that are separated by a transcriptional terminator (Ti from E. coli rrnB gene, called TT02) and a multiple cloning site (composed of restriction sites BstZ17I, HindIII, Pad, Avril, Apal, Smal, BamHI, called SMC) . This last region was amplified by PCR from genomic DNA using the following oligonucleotides: melBup-F (SEQ ID NO 23) cgtaggcgccggtaccGACCTCAATATCGACCCAGCTACGC with - a region (lowercase letter) for SfoT and Kpnl restriction site and extra-bases, - a region (capital letter) homologous to the sequence (4340489-4340513) of the melB region (reference sequence on the website http;//www.ecogene.org/). melBup-R (SEQ ID NO 24) gcttgtatacAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGT TTTATTTGATGCATTGAAATGCTCATAGGGTATCGGGTCGC with - a region (lower case letter) from the BstZ17I restriction site and part of the HindIII restriction site from the black transcript site) (upper letter stop transcription, - upper case transcription cloning region) Ti of the E. coli rrríB gene gene (Orosz et al.1991), - a region (capital letter) homologous to the sequence (4341377-4341406) of the melB region (reference sequence on the website http://www.ecogene.org /). melBdown-F (SEQ ID NO 25) AGACTGGGCCTTTCGTTTTATCTGTTgtatacaagcttaattaacctagggccc gggcggatccGTGAGTGATGTGAAAGCCTGACGTGG with - a region (bold letter) for part of the Ti transcription terminator of the E. coli rrnB gene (Orosz et al. 1991) - a region for upper case (Orosz et al.). the complete multiple cloning site, - a region (capital letter) homologous to the sequence (4342793-4342818) of the melB region (reference sequence on the website http://www.ecogene.org/). melBdown-R (SEQ ID NO 26) cgtaggcgccggtaccCGAACTGCACTAAGTAACCTCTTCGG with - a region (lowercase letter) for the SfoI and Kpnl and extra-base restriction sites, - a region (uppercase letter) homologous to the sequence (4343694-4343719) of the melB region ( reference sequence at http://www.ecogene.org/). First, the "upMelB" and "downMelB" fragments were PCR amplified from MG1655 genomic DNA using oligonucleotides melBup-F/melBup-R and melBdown-F/melBdown-R, respectively. Second, the "upMelB-downMelB" fragment was amplified from the "upMelB" and "downMelB" PCR fragments (which have an overlap region composed of a part of the E. coli rrnB gene Ti transcription terminator and a part of the E. coli rrnB gene multiple cloning site) using melBup-F/melBdown-R oligonucleotides. The "upMelB-downMelB PCR fragment" was cut with the EcoRI/HindIIIpUC18 enzyme, giving plasmid pUC18-ΔmelB::TT02-SMC.
Then, the kanamycin resistance cassette was PCR amplified from the pKD4 vector using the following oligonucleotides: Km-F (SEQ ID NO 27) TCCCCCGGGGTATACcatatgaatatcctccttag with - a region (lower case) for amplification of the kanamycin resistance cassette (sequence reference in Datsenko &Wanner (2000), a region (upper letter) for restriction sites Smal and BstZ17I and extra bases. Km-R (SEQ ID NO 28) GCCCAAGCTTtgtaggctggagctgcttcg with - a region (lower letter) for cassette amplification of kanamycin resistance (reference sequence in Datsenko &Wanner (2000)), a region (capital letter) for the HindIII restriction site and extra-bases.
The PCR fragment was cut with the restriction enzymes BstZ17I and HindIII and cloned into the BstZ17T/HindIII sites of plasmid pUC18-ΔmelB::TT02-SMC, giving plasmid pUC18-ΔmelB::TT02-SMC::Km.
Finally, the Ptrc01/ARN01/RBS01*2-pycre-TT07 fragment was amplified by PCR with primers Ptrc01/ARN01/RBS01*2-pycre-F and pycre-TT07-R from plasmid pCL1920-PgapA-pycre-TT07, described in patent application WO2012/055798. The PCR fragment was cut with Avril and Pad restriction enzymes and cloned into the AvrII/Pacl sites of plasmid pUC18-ΔmelB::TT02-SMC::Km, giving plasmid pUC18-ΔmelB::TT02-Ptrc01/ARN01/RBS01 *2-pycre-TT07::Km.
Recombinant plasmids were verified by DNA sequencing. Ptrc01/ARN01/RBS01*2-pycre-F (SEQ ID NO 29) cgtagttaacttaattaaGAGCTGTTGACAATTAATCATCCGGCTCGTATAATG TGTGGAAGGTGGAGTTATCTCGAGTGAGATATTGTTGACGTAAGGAGGTTATAAATGCC CATATCCAAGATACTCGTTGCCA artificial inducible trc promoter, - a region (underlined capital letter) homologous to the sequence that stabilized mRNA (Meynial-Salles et al. 2005), - a region (capital italic letter) homologous to the optimized ribosome binding site, - a region ( capital letter) homologous to the beginning of the pyc gene of Rhizobium etli (1-32). pycre-TT07-R (SEQ ID NO 30) cgacccgggcctaggGCAGAAAGGCCCACCCGAAGGTGAGCCAGTGTGAgcggc cgcTCATCCGCCGTAAACCGCCAGCAGG with - a region (lower case) for restriction sites Smal, Avrile Not!e, extra-bases, - a region (capital letter terminated) parametrical sequence (capital letter) (Harrington et al. 2001), called TT07, - a region (capital letter) homologous to the end of the pyc gene of Rhizobium etli (3441-3465).
Second, the fragment ΔmelB::TT02-Ptrc01/ARN01/RBS01*2-pycre-TT07::Km was obtained by cutting plasmid pUC18-ΔmelB::TT02-Ptrc01/ARN01/RBS01*2-pycre-TT07::Km with restriction enzyme KpnI and was then introduced by electroporation into a strain MG1655 metA*11 pKD46, according to Protocol 1. The kanamycin resistant transformants were then selected, and the insertion of the fragment ΔmelB::TT02-Ptrc01/ARN01/RBS01 *2-pycre-TT07::Km was verified by PCR analysis with the oligonucleotides melB-pycre-F and melB-pycre-R. The strain verified and selected was called MG1655 metA*ll pKD46 ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07::Km. melB-pycre-F (SEQ ID NO 31) gccgattttgtcgtggtggc homologous to melB region sequence (4340168-4340187) (reference sequence on website http://www.ecogene.org/) melB-pycre-R (SEQ ID NO 32 ) gccggttatccatcaggttcac homologous to the sequence (4344044-4344065) of the melB region (reference sequence on the website http://www.ecogene.org/)
Third, the chromosomal modification ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07::Km was transduced into strain 8, with a PI phage lysate from strain MG1655 metA*ll pKD46 ΔmelB::RN/ Ptrc01/ARN01/RBS01*2-pycre-TT07::Km described above, according to Protocol 2. Kanamycin-resistant transductants were selected and the presence of chromosomal modification ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre -TT07::Km was verified by PCR with melB-pycre-F and melB-pycre-R primers. The resulting strain MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36- mRNAstl7 -metFPtrc07 -serB ΔmetJ ΔpykF ΔpykA ΔpurU Δync-Ttl7 malS: ΔpgaABCD: TTO 2-TTadc-PlambdaR* (-35) -RBS01-thrA*1-cysE- PgapA-metA*ll ΔuxaCA: .-TT07-TTadc-PlambdaR* (-35) -RBS01- thrA*l-cysE- PgapA-metA*11 ΔCP4-6::TTO2-TTadc-PlambdaR*(- 35) -RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM: :TT02-TTadc- PlambdaR*(-35)-RBSO1- thrA*1-cysE-PgapA-metA*ll ΔtreBC: .-TTO2-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07::Km was called strain 9. The kanamycin resistance cassette was then eliminated. Plasmid pCP20, carrying FLP recombinase acting on the FRT sites of the kanamycin resistance cassette, was introduced into strain 9. After a series of cultures at 37°C, the loss of the kanamycin resistance cassette was verified by PCR analysis with the same. oligonucleotides as used previously, melB-pycre-F/melB-pycre-R. The resulting strain is MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔCT-Ambla*7-SerB metJ ΔpykF ΔpykA ΔpurU ΔCT-Ambla*7-SyncA- cysE ΔpgaABCD: ;TTO2-TTadc-PlambdaR* (-35) -RBSO 1 -thrA* 1 -cysE- PgapA-metA*ll ΔuxaCA::TT07-TTadc-PlambdaR*(-35)-RBS01- ΔCP4-6: . -TT02-TTadc-PlambdaR* (- 35) -RBSOl - thrA*l -cysE-PgapA-metA*ll ΔwcaM: .-TT02-TTadc- PlambdaR* (-35)-RBSOl-thrA*l-cysE-PgapA- metA*ll ΔtreBC:;TT02-serA-serC ΔmelB:: RN/Ptrc01/ARN01/RBS01*2 -pycre-TT07 was called strain 10.
2.2. Construction of strains 11 and 12 To delete the purU gene and replace it with the PL1*1/RBS01*2-pycre-TT07 region, the homologous recombination strategy described by Datsenko &Wanner (2000) was used. For this purpose, the following plasmid was constructed, pUC18-ΔpurU::TT02-PL1*1/RBSOl*2-pycre-TT07::Km. This plasmid pUC18-ΔpurCJ::TT02-PL1*1/RBS01*2-pycre-TT07::Km is derived from the pUC18 vector (Norrander et al., Gene 26 (1983), 101-106) and harbors the resistance cassette kanamycin linked to the PL1*1/RBS01*2-pycre-TT07 fragment, both cloned between the upstream and downstream regions of purU.
For construction of pUC18-ΔpurU::TT02-PL1*1/RBS01*2-pycre-TT07::Km, first plasmid pUC18-ΔpurU::TT02-SMC was constructed. This plasmid carries regions upstream and downstream of purU that are separated by a transcriptional terminator (Ti of the E. coli rrnB gene, called TT02) and a multiple cloning site (composed of restriction sites BstZ17I, HindITT, Pad, Avr11 , Apal, Smal, Bantil, called SMC). This last region was amplified by PCR from genomic DNA using the following oligonucleotides: purUup-F (SEQ ID NO 33) ctgaggcctatgcatGGAATGCAATCGTAGCCACATCGC with - a region (lowercase letter) for the StuI and Nsil restriction sites and extra-bases, - a region (capital letter) homologous to the sequence (1288424-1288447) of the purU region (reference sequence on the website http://www.ecogene.org/). purUup-R (SEQ ID NO 34) gcttgtatacAACAGATAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGT TTTATTTGATGGCTGGAAAAACCTTGTTGAGAGTGTTTGC with - a region (lower case letter) for the BstZ17I restriction site and part of the HindIII restriction site, capitalized bold - a region terminated for multiple cloning Ti transcription of the E. coli rrnB gene (Orosz et al. 1991), - a region (capital letter) homologous to the sequence (1287849-1287877) of the purU region (reference sequence on the website http://www.ecogene.org /). purUdown-F (SEQ ID NO 35) AGACTGGGCCTTTCGTTTTATCTGTTgtatacaagcttaattaacctaggggcc ctcgcccgggcggatccGGTAATCGAACGATTATTCTTTAATCGCC with - a region (bold capital letter) for part of the Ti transcription terminator of the rrnBz gene from E. coli ( 1991), - a lower region for E. coli rrnBz gene ( 1991). the complete multiple cloning site, - a region (capital letter) homologous to the sequence (1287000-1287028) of the purU region (reference sequence on the website http://www.ecogene.org/). purUdown-R (SEQ ID NO 36) ctgaggccatgcatGCGGATTCGTTGGGAAGTTCAGGG with - a region (lower case) for the StuI and Nsil and extra-base restriction sites, - a region (uppercase letter) homologous to the sequence (1286429-1286452) of the purU region ( reference sequence at http://www.ecogene.org/).
First, the "upPurU" and "downPurU" fragments were PCR amplified from MG1655 genomic DNA using oligonucleotides purUup-F/purUup-R and purUdown-F/purUdown-R, respectively. Second, the "upPurU-downPurU" fragment was amplified from the "upPurü" and "downPurU" PCR fragments (which have an overlap region composed of a part of the E. coli rrnB gene Ti transcription terminator and part of the E. coli rrnB gene multiple cloning site) using purUup-F/purUdown-R oligonucleotides. The PCR fragment "upPurU-downPurU" was cut with the restriction enzyme StuI and cloned into the blind EcoRI/HindIII sites of the pUC18 vector, giving plasmid pUC18-ΔpurU::TT02-SMC.
Then, the kanamycin resistance cassette was PCR amplified from the pKD4 vector using the Km-F and Km-R oligonucleotides (described above). The PCR fragment was cut with the restriction enzymes BstZ17I and HindIII and cloned into the BstZ17I/HindIII sites of plasmid pUC18-ΔpurU::TT02-SMC, giving plasmid pUC18-ΔpurU::TT02-SMC::Km.
Finally, the PL1*1/RBS01*2-pycre-TT07::Km fragment was amplified by PCR with primers PL1*1/RBSO1*2-pycre-F and pycre-TT07-R2 from plasmid pCL1920-PgapA-pycre -TT07, described in patent application WO2012/055798. The PCR fragment was cut with the restriction enzymes SpeI and SmaI and cloned into the AvrII/SmaI sites of plasmid pUC18-ΔpurU::TT02-SMC::Km, giving plasmid pUC18-ΔpurU::TT02-PL1*1/RBS01 *2-pycre-TT07: :Km.
Recombinant plasmids were verified by DNA sequencing. PL1*1/RBSO1*2-pycre-F (SEQ ID NO 37) ctct agaac t ag tTTATCTCTGGCGGTGTTGACATAAATAC CACTGGCGGTTAT ACTGAGCACAgtcgacgttaacacgcgtTAAGGAGGTTATAAATGCCCATATCCAAGAT ACTCGTTGCCAATCG ACTCGTTGCCAATCG with a single, extra-lower and lower-sealed Sail region, extra-segment and base-Lu restriction. region (bold capital letter) homologous to the short form of the PL promoter of bacteriophage lambda (PLi Giladi et al. 1995) and harboring the mutation in the -10 box (G12T, bold underlined letter) described in Kincade & deHaseth (1991). This promoter is called PL1*1, - a region (capital letter italic) homologous to an optimized ribosome binding site, - a region (capital letter) homologous to the 5' start of the pyc gene of Rhizobiuni etli (1-32) . pycre-TT07-R2 (SEQ ID NO 38) tcgagcccgggGCAGAAAGGCCCACCCGAAGGTGAGCCAGtacgtaagtacttt aattaaTCATCCGCCGTAAACCGCCAG with - one region (lower case) for restriction sites Smal, PacI, Seal, SnaBIe, extra-base lettering, -one region (lowercase letter) for restriction sites Smal, PacI, Seal, SnaBIe, extra-base lettering, -a region terminated transcriptional T7te (Harrington et al. 2001), - a region (capital letter) homologous to the 5' end of the pyc gene of Rhizobium etli (3445-3465).
Second, the fragment ΔpurU::TT02-PL1*1/RBS01*2-pycre-TT07::Km was obtained by cutting plasmid pUC18-ΔpurU::TT02-PL1*1/RBSO1*2-pycre-TT07::Km with restriction enzyme Nsil and was then introduced by electroporation, 10 according to Protocol 1, in strain MG1655 metA*ll pKD46. Kanamycin resistant transformants were then selected, and the insertion of the fragment ΔpurU::TT02-PL1*1/RBS01*2-pycre-TT07::Km was verified by PCR analysis with oligonucleotides purU-pycre-F and purU-pycre -R. The 15 strain verified and selected was called MG1655 metA*ll pKD46 ΔpurU::RN/PLl*l/RBS01*2-pycre-TT07: :Km. purU-pycre-F (SEQ ID NO 39) GCCCACCAGCGAACCAATTG homologous to the sequence (1288589-1288608) of the purU region 20 (reference sequence on the website http://www.ecogene.org/) purU-pycre-R (SEQ ID NO 40) GTAAACGTGGTGCCATCGGG homologous to the sequence (1285868-1285887) of the purU region (reference sequence on the website http://ww.ecogene.org/). Third, the chromosomal modification ΔpurU-.:RN/PLl*l/RBS01*2-pycre-TT07: : Km was transduced into strain 10, with a PI phage lysate from strain MG1655 metA*ll pKD46 ΔpurU: :RN /PLl*l/RBS01*2-pycre-TT07: :Km described above, according to Protocol 2. Kanamycin-resistant transductants were selected and the presence of chromosomal modification ΔpurU::RN/PLl*l/RBS01*2-pycre - TT07::Km was verified by PCR with purU-pycre-F and purU-pycre-R primers. The resulting strain is MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIHPtrc09-gcvTHP Ptrc36-mRNAstl7 -metF Ptrc07-serB ΔmetJ ΔpykF ΔpykA ΔpurU Δync-*l- malS(TTP)- -cysE ΔpgaABCD:;TT02-TTadc-PlambdaR*(-35)-RBSO1-thrA*1-cysE- PgapA-metA*ll ΔuxaCA: .-TT07-TTadc-PlambdaR* (-35) -RBSO1-thrA*1- cysE-PgapA-metA*11 ΔCP4-6::TT02-TTadc-PlambdaR*(- 35)-RBS01-thrA*1-cysE-PgapA-metA*11 ΔwcaM::TT02-TTadc- PlambdaR*(-35)- RBS01-thrA*l-cysE-PgapA-metA*ll ΔtreBC::TT02-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU::RN/PLl*l/RBS01*2- pycre-TT07::Km was called strain 11.
The kanamycin resistance cassette was then discarded. Plasmid pCP20, carrying FLP recombinase acting on the FRT sites of the kanamycin resistance cassette, was introduced into strain 11. After a series of cultures at 37°C, the loss of the kanamycin resistance cassette was verified by PCR analysis with the same. previously used oligonucleotides, purU-pycre-F/purU-pycre-R. The resulting strain MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcOI-serB ΔmetJ ΔpykF ΔpykA ΔpurU Δcv-lnc-*malda mal-*malda -* malda -* -cysE ΔpgaABCD:;TT02-TTadc-PlambdaR*(-35)-RBSO1-thrA*1-cysE- PgapA-metA*ll ΔuxaCA: .-TT07-TTadc-PlambdaR* (-35) -RBSO1-thrA*l- cysE-PgapA-metA*ll ΔCP4-6: .-TT02-TTadc-PlambdaR* (35) -RBS01-thrA*1-cysE-PgapA-metA*11 ΔwcaM: .-TT02-TTadc-PlambdaR* (-35) -RBS01-thrA*1-cysE-PgapA- metA*ll ΔtreBC: .-TT02-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU::RN/PLl*l/RBS01* 2-pycre-TT07 was called strain 12.
3. Construction of strains 13 and 14 To increase the assembly of methylene-tetrahydrofolate in the cell, the glycine cleavage complex coformed by the gcvTHP operon was overproduced by adding a copy of this operon onto the chromosome at the yjbl locus. This additional copy of gcvTHP was expressed. using an inducible artificial trc promoter and an optimized ribosome binding site, giving chromosomal integration Δyjbl:;RN/Ptrc01/RBS01-gcvTHP-TT07::Km, described in patent application PCT/FR2012 /051361.
The chromosomal modification ΔyjjbT: .-RN/PtrcOl/RBSOl-gcvTHP-TT07:: Km was transduced into strain 12, with a phage Pl lysate from strain MG1655 metA*ll pKD46 Δyjbl:;RN/Ptrc01/RBS01-gcvT -TTO 7::Km, described in patent application PCT/FR2012 /051361, according to Protocol 2. Kanamycin-resistant transductants were selected and the presence of chromosomal modification Δyjbl: .-RN/PtrcOl/RBSOl-gcvTHP-TT07 : : Km was verified by PCR with primers yjbl-gcvTHP-F and yjbl-gcvTHP-R, described in patent application PCT/FR2012 /051361. The resulting strain MG1655 metA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF Ptrc07-serB ΔmetJ ΔpykF ΔpykA ΔpurU Δct-l7-stl7-metF Ptrc07-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔCT-mbla-Sync-Ttml-Ptml-ml-mtml-m; cysE ΔpgaABCD:;TT02-TTadc-PlambdaR*(-35)-RBS01- thrA*l-cysE-PgapA-metA*ll ΔuxaCA: .-TTO 7-TTadc-PlambdaR* (-35)-RBSOL-thrA*1- cysE-PgapA-metA*11 ΔCP4-6::TTO2-TTadc-
PlambdaR* (-35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM::TT02-TTadc-PlambdaR*(-35)-RBSOl-thrA*l-cysE-PgapA-metA*ll ΔtreBC: . -TTO2-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU: : RN/PLl*l/RBS01*2-pycre-TT07 Δyjbl: :RN/Ptrc01/RBS01- gcvTHP-TT07 ::Km was called strain 13.
The kanamycin resistance cassette was then discarded. Plasmid pCP20, carrying FLP recombinase acting on the FRT sites of the kanamycin resistance cassette, was introduced into strain 13. After a series of cultures at 37°C, the loss of the kanamycin resistance cassette was verified by PCR analysis with the same. previously used oligonucleotides, yjbl-gcvTHP-F and yjbl-gcvTHP-R. The resulting strain is MG1655 metA*ll Ptrc-metH PtrcF- cysPUWAM PtrcF-cysJIH PtrcOθ-gcvTHP Ptrc36-mRNAstl7-metF PtrcO7-serB ΔmetJ ΔpykF ΔpykA ΔpurUth-c-damb-SyncA PtrcOθ-gcvTHP cysE ΔpgaABCD::TT02-TTadc- PlambdaR*(-35)-RBSO1-thrA*1-cysE-PgapA-metA*11 ΔuxaCA: .-TT07-TTadc-PlambdaR* (-35) -RBSO 1-thrA* 1- cysE-PgapA-metA*ll ΔCP4-6: .-TT02-TTadc-PlambdaR* (-35) -RBS01-thrA*l- cysE-PgapA-metA*11 ΔwcaM: .-TTO2-TTadc-PlambdaR* (-35 ) -RBS01- thrA*l-cysE-PgapA-metA* 11 ΔtreBC:.-TT02 -serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU::RN/PLl*l/RBS01 *2-pycre-TT07 Δyjbl:;RN/Ptrc01/RBS01- gcvTHP-TT07 was called strain 14.
4. Construction of strain 15 To increase flux in the serine pathway the plasmid pCClBAC-TT02-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBSO1-serA-TTadcca, described in patent application PCT/FR2012 /051361, was introduced into strain 14, giving the following strain MG1655 metA*11 Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcOl-serB ΔmetJ ΔpykF ΔpykA cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF PtrcOl-serB ΔmetJ ΔpykF ΔpykA ncdamb- PlApurU -thrA*l-cysE ΔpgaABCD::TT02-TTadc-PlambdaR*(-35)-RBSO1-thrA*1-cysE- PgapA-metA*ll ΔuxaCA:;TT07-TTadc-PlambdaR*(-35)-RBS01-thrA * 1-cysE-PgapA-metA* 11 ΔCP4-6: .-TTO2-TTadc-PlambdaR* (- 35) -RBS01-thrA*l-cysE-PgapA-metA*ll ΔwcaM: :TT02-TTadc- PlambdaR* ( -35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔtreBC::TT02-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU: :RN/PLl*l/ RBS01*2-pycre-TT07 Δyjbl: .-RN/PtrcOl/RBSOl-gcvTHP-TTOl (pCClBAC-TT02-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca), called strain 15. EXAMPLE 7: Construction of strains 16 and 17
1. Construction of Strain 16 To increase the import of glucose into the cell, the dgsA (or mlc) gene coding for a double transcriptional regulator that controls the expression of a number of genes encoding enzymes of the sugar-dependent phosphotransferase system (PTS) Escherichia coli PEP has been deleted. To delete the dgsA gene, applicants used the Escherichia coli BW25113 ΔdgsA::Km strain from the Keio mutant collection (Baba et al., 2006). The ΔdgsA:: Km deletion was transferred by PI phage transduction (according to Protocol 2) from strain BW25113 ΔdgsA::Km to strain 14. Kanamycin-resistant transductants were selected and the presence of chromosomal ΔdgsA::Km deletion was verified by PCR with dgsA-F and dgsA-R primers defined below.sss
The retained strain MG1655 Ptrc-META * ll meth PtrcF-cysPUWAM PtrcF-cysJIH, gcvTHP Ptrc09-Ptrc36-mRNAstl7 metformin Ptrc07-SERB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA ΔmalS:; TTadc-CT857- PlambdaR * (-35) * L -thrA cysE ΔpgaABCD: .-TT02-TTadc-PlambdaR* (- 35)-RBSOl-thrA*1-cysE-PgapA-metA*11 ΔuxaCA::TT07-TTadc- PlambdaR*(-35)-RBSOl-thrA*l-cysE -PgapA-metA*ll ΔCP4-6: .-TT02-TTadc-PlambdaR* (-35) -RBSOl-thrA*l-cysE-PgapA- metA*ll ΔwcaM: :TT02-TTadc-PlambdaR*(-35) - RBSOl-thrA*1-cysE- PgapA-metA*ll ΔtreBC::TTO2-serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU::RN/PLl*l/RBS01*2- pycre-TT07 Δyjbl:;RN/PtrcO 1 /RBSOl-gcvTHP-TT07 ΔdgsA::Km was called strain 16. dgsA-F (SEQ ID NO 41) CCTGGCAAATAACCCGAATG homologous to the sequence (1667067-1667086) of the dgsA region (reference sequence on the website http://ww,ecogene.org/) dgsA-R (SEQ ID NO 42) CCCATTCAGAGAGTGGACGC homologous to the sequence (1664853-1664872) of the dgsA region (reference sequence on the website http://www.ecogene.org/ ).
2. Strain Construction Another way to increase glucose import into the cell is through the overproduction of PtsG (IIC010), the transmembrane partner of the glucose phosphotransfer system.
In order to overexpress ptsG in strain 15 background, the following plasmid was constructed, pCClBACVBOl-Plac∑q-lacT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07-Ptrc30/RBS01-serC-TTO 7 * 2 - P trc3 0/RBS 01-serA-TTadcca.
Plasmid pCClBACVB01-PlacTq-lacT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca is derived from plasmid pCClBACVBq-TT02-TlacT02 -Ptrc01/OP01/RBS01*2-ptsG-TT07 (described above in Example 1, construction of strain 2) and from plasmid pCClBAC-TT02-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca , described in patent application PCT/FR2012/051361. The Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca fragment was cut with the restriction enzymes SnaBI and Avril from plasmid pCClBAC-TT02-P trc30/RBS01-serC-TTO7 *2 -P trc30 /RBS01-serA-TTadcca and cloned into the Pad blind site of plasmid pCClBACVBOl-PlacTq-2acI-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07, giving plasmid pCClBACVB01-P2acTq-2ac∑-TT02-Ptrc01/OP RBS01*2-ptsG-TT07- P trc3 0/RBS 01-serC-TTO 7 * 2 -P trc3 0/RBS 01-serA-TTadcca.
Then, plasmid pCClBACVB01-P2acTq-2acT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca was introduced into strain 16, giving the following strain MG1655 n etA*ll Ptrc-metH PtrcF-cysPUWAM PtrcF-cysJIH Ptrc09-gcvTHP Ptrc36-mRNAstl7-metF Ptrc07-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA-*lbda malS:* cysE ΔpgaABCD: .-TT02-TTadc-PlambdaR* (- 35) -RBS01-thrA*l-cysE-PgapA-metA*ll ΔuxaCA.- .-TT07-TTadc- PlambdaR*(-35)-RBSO1-thrA*1 -cysE-PgapA-metA*11 ΔCP4-6: .-TT02-TTadc-PlambdaR* (-35) -RBS01 -thrA*l-cysE-PgapA- metA*ll ΔwcaM: .-TT02-TTadc-PlambdaR* (- 35) -RBS01 -thrA*l-cysE- PgapA-metA*ll ΔtreBC: .-TTO2 -serA-serC ΔmelB::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 ΔpurU::RN/PLl*l/ RBS01*2-pycre-TT07 Δyjbl::RN/Ptrc01/RBS01- gcvTHP-TT07 ΔdgsA::Km (pCClBACVB01-P2acTq-2acT-TT02- Ptrc01/OP01/RBS01*2-ptsG-TT07-Ptrc-ser-RBS01 TT07*2- Ptrc30/RBS01-serA-TTadcca), called strain 17. In this plasmid pCClBACVB01-P2ac∑q-2ac∑-TT02- Ptrc01/OP01/RBS01*2-ptsG- TT07, the natural promoter of ptsG gene as well as the small sgrS RNA binding site is replaced by a strong artificial promoter (construction described in example 1 above). Consequently, ptsG is overexpressed and its mRNA is no longer regulated and triggered for degradation by sgrS.
The overexpression of the ptsG gene in strain 17 cultivated under inducible conditions (+IPTG in the culture) was verified by qPCR. EXAMPLE 8: Construction of strain 18
Strain 18 harbors the modified version of plasmid pCCIBAC-TTO 2 -P trc30/RBS 01-serC-TTO 7 * 2 -P trc3 0/RBS 01-serA-TTadcca (which was described in patent application PCT/FR2012 /051361 ), meaning that Applicants exchanged the chloramphenicol resistance gene of pCClBAC-TTO2 -Ptrc30/RBS01-serC-TTO7 *2 -Ptrc30/RBS01-ser A-HTadcca with a gentamicin resistance gene, giving plasmid pCClBACVB01-TT02 -Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca.
To exchange the antibiotic resistance gene from plasmid pCCIBAC-TTO 2-P trc30/RBS 01-serC-TTO 7 * 2 - Ptrc30/RBS01-serA-TTadcca, applicants used the same procedure as described above for the construction of the plasmid pCClBACVB01-P2acTq-lacT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07. Then, plasmid pCClBACVB01-TT02-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca was introduced into strain 16 giving strain MG1655 metA*11 Ptrc-metH PtrcF-cysPUWAM PtrcF36 Ptrc-cysJ -mRNAstl7-metF Ptrc07-serB ΔmetJ ΔpykF ΔpykA ΔpurU ΔyncA ΔmalS:;TTadc-CI857-PlambdaR*(-35)- thrA*l-cysE ΔpgaABCD: ;TT02-TTadc-l35-Plambda*-RRB* -cysE-PgapA-metA*11 ΔuxaCA;;TT07-TTadc-PlambdaR*(- 35)-RBS01-thrA*l-cysE-PgapA-metA*ll ΔCP4-6::TT02-TTadc- PlambdaR*(-35) -RBS01-thrA*1-cysE-PgapA-metA*11 ΔwcaM: ;TT02-TTadc-PlambdaR*(-35)-RBS01-thrA*l-cysE-PgapA- metA*ll ΔtreBC::TT02-serA-serC ΔmelB ::RN/Ptrc01/ARN01/RBS01*2-pycre-TT07 purU: :RN/PLl*l/RBS01*2-pycre-TT07 Δyjbl:;RN/Ptrc01/RBS01- gcvTHP-TTGl ΔdgsA::Km (pCClBACVB01- TT02-Ptrc30/RBS01-serC-TT07*2-Ptrc30/RBS01-serA-TTadcca), called strain 18. EXAMPLE 9: Production of L-methionine by fermentation in shake flasks
Strain production was evaluated in small Erlenmeyer flasks. A 5.5 ml preculture was grown at 30°C for 21 hours in a mixed medium (10% LB medium (Sigma 25%) with 2.5 g.L'1 glucose and 90% PCI minimal medium). It was used to inoculate a 50 ml culture of PCI medium (Table 2) to an ODsoo of 0.2. When necessary. Antibiotics were added at a concentration of 50 mg.L'1 for spectinomycin, at a concentration of 30 mg.L'1 for chloramphenicol and at a concentration of 10 mg.L'1 for gentamicin. IPTG was added to cultures with different concentrations indicated in each example. Culture temperature was 37°C. When the culture reached an ODgoo of 5 to 7, extracellular amino acids were quantified by HPLC after derivatization of OPA/Fmoc and other relevant 5 metabolites were analyzed using HPLC with refractometric detection (organic acids and glucose) and GC-MS after silylation. For each strain, several repetitions were made. The methionine yield was expressed as follows:
Table 2: Composition of minimal medium (PCI).


Effect of ptsG overexpression on methionine production in different strains Table 3: Yields of methionine, ketomethylvalerate and homolanthionine (YMet, YKMV, YHLA) in % g product/g glucose, produced in batch culture per strain 2.
For precise definition of methionine/glucose yield see above. For each condition, two repetitions were performed. HLA and KMV concentrations were measured for one vial only. IPTG (short for Isopropyl β-D-1-thiogalactopyranoside) induces transcription from the lac promoter of plasmid pCClBACVB01-P2ac2g-2acT-TT02-Ptrc01/OP01/RBS01*2-ptsG-TT07 loaded by strain 2 (see genotype in Example 1 ).

As can be seen in table 3, the yield of methionine production increases significantly when ptsG is overexpressed. The best ptsG induction is obtained with 20μM IPTG (verified by qPCR, data not shown) and the best methionine production is also obtained under these conditions. Furthermore, overexpression of ptsG allows to decrease the accumulation of ketomethylvalerate in the culture.
As information, control strain 1 grown in flasks gives a methionine production yield equivalent to the yield obtained with strain 2 without IPTG. Table 4: Yields of methionine, ketomethylvalerate and homolanthionine (YMet, YKMV, YHLA) in % g product/g glucose produced in batch culture for strains 3 and 4. For precise definition of yields, see above. The number of repetitions is indicated in parentheses. Strain 4 was cultured with 20 µM IPTG to induce ptsG expression.

The overexpression of ptsG in strain 4, which has a modified transhydrogenase expression (pntAB overexpression and udhA deletion) allows a reduction in the production of homolanthionine and ketomethylvalerate. On such a background, overexpression of ptsG does not enhance the yield of methionine production but clearly improves the purity of the final product.
This shows that it was not easy to predict the effect of increased glucose import on methionine producing strains.
Effect of a sgrS and sgrT deletion on methionine production Table 5: Yields of methionine, ketomethylvalerate and homolanthionine (Ymet, YKMV, YHLA) in % g product/g glucose produced in batch culture by strains 1 and 5. For precise definition of income, see above. The number of repetitions is indicated in parentheses.

As can be seen in table 5 above, methionine yield increases significantly upon deletion of the sgrS and sgrT genes. sgrS inhibits the translation of ptsG mRNA both directly and indirectly. The 5' end of sgrS contains a 43 amino acid open reading frame, sgrT, which regulates PtsG activity.
In strain 5 both the sgrS and sgrT genes are deleted and the effect on methionine production is positive and similar to the effect obtained with an overexpression of ptsG (see Table 3). Example 10: L-methionine production by fermentation in bioreactors with strains 1 and 2
Strains that produced substantial amounts of metabolites of interest in vials were further tested under production conditions in 2.5 L fermentors (Pierre Guerin) using a fed-batch process.
A 24-hour culture grown in 10 mL of LB medium with 2.5 gL’1 glucose was used to inoculate a 24-hour preculture of minimal medium (Bla). These incubations were carried out in 500 ml vials with shields containing 50 ml of minimal medium (Bla) on a rotary shaker (200 RPM). The first preculture was grown at a temperature of 30°C, the second at a temperature of 34°C.
A third pre-culture step was carried out in bioreactors (Sixfors) filled with 200 ml of minimal medium (Blb) inoculated with a biomass concentration of 1.2 gL-1 with 5 ml of concentrated pre-culture. The preculture temperature was kept constant at 34°C and the pH was automatically adjusted to a value of 6.8 using a 10% NH4OH solution. The dissolved oxygen concentration was continuously adjusted to a value of 30% of the partial air pressure saturation with air supply and/or agitation. After depletion of glucose from the batch medium, the fed batch medium was started with an initial flow rate of 0.7 mL.h-1 and increased exponentially over 24 hours with a growth rate of 0.13 h-1, at in order to obtain a final cell concentration of about 20 g.L'1. Table 6: Composition of batch mineral pre-culture medium (Bla and Blb).

Table 7: Composition of feedbatch preculture mineral medium (Fl)
Table 8 - Composition of batch mineral culture medium (B2)

Table 9: Composition of fed batch culture medium (F2).
Subsequently, 2.5 L fermentors (Pierre Guerin) were loaded with 600 ml of minimal medium (B2) and were inoculated with a biomass concentration of 2.1 gL'1 with a pre-culture volume in the range between 55 to 70 ml.
The culture temperature was kept constant at 37°C and the pH was kept at the working value (6.8) by automatic addition of NH 4 OH solutions (10% NH 4 OH for 9 hours and 28% until the end of the culture). The initial agitation rate was 200 rpm during the batch phase and was increased to 1000 rpm during the fed batch phase. The initial airflow rate was 40 nL.h'1 during the batch phase and was increased to 100 nL.h'1 at the start of the fed batch phase. The dissolved oxygen concentration was maintained at values between 20 and 40%, preferably 30% saturation by increasing agitation.
When the cell mass reached a concentration of about 5 gL'1, the fed batch phase was started with an initial flow rate of 5 mL.h'1. Feed solution was injected for 14 hours with a sigmoid profile with an increasing flow rate that reached 27 mL.h -1 after 26 hours. Precise feeding conditions were calculated by the following equation:
where Q(t) is the feed flow rate in mL.h' 1 for a discontinuous volume of 600 mL.
For 14 hours, the parameters were pl = 1.80, p2 = 22.40, p3 = 0.27, P4 = 6.50 and then from 14 h to 26 hours, the parameters were pl = 2.00, p2 = 25.00, p3 = 0.40, P4 = 9.00.
After 26 hours of fed batch culture, the feed solution pump was stopped and the culture was stopped after exhaustion of glucose.
Extracellular amino acids were quantified by HPLC after OPA/Fmoc derivatization and other relevant metabolites were analyzed using HPLC with refractometric detection (organic acids and glucose) and GC-MS after silylation. Table 10; Yields of methionine (YMet) in % g of methionine per g of glucose produced in the batch culture fed by strain 2 and strain 1. Strain 2 was cultivated with different concentrations of IPTG. For definition of methionine/glucose yield see below. SD indicates the standard deviation for yields that were calculated based on multiple replicates (N = number of replicates).


As can be seen in table 10, regardless of the concentration of IPTG applied during the culture of strain 2, overexpression of ptsG significantly improves methionine production. Constitutive overexpression of the ptsG gene in strain 2 (induction conditions: 20 μm IPTG in batch medium - 20 μm IPTG in fed medium) is the best condition to increase methionine production.
Induction of ptsG expression was verified by qPCR. Levels of ptsG mRNA were much higher in samples 2 and 3 with IPTG than in the control strain 1. See results in Figure 1.
Due to the overexpression of ptsG strain 2, it does not accumulate glucose during the culture or at the end of it. In contrast, strain 1, which has a wild-type glucose import, shows a strong glucose build-up after 25h of growth. The residual glucose concentration reaches more than 10 g/L for strain 1 and less than 3 g/L with a strain of 2.
Improved glucose import not only improves methionine production but also improves product purity.
The reactor volume was calculated by adding the initial volume to the amount of solutions added to regulate the pH and to feed the culture and subtracting the volume used for sampling and evaporation loss.
The batch fed volume was followed by continuously weighing the feed load. The amount of injected glucose was then calculated from the injected weight, the solution density and the glucose concentration determined by the Brix method ([Glucose]). Yield of methionine was expressed as follows:

The maximum yield obtained during the culture was presented for each strain. With Methionine and Methionine, respectively, the initial and final concentrations of methionine and Voe Vt the instantaneous t volumes.
The glucose consumed was calculated as follows:
Injected glucose = fed volume* [Glucose] Consumed glucose = [Glucose]o * Vo + Injected glucose - [Glucose] residual * Vt with [Glucose] o, [Glucose], [Glucose] residual respectively the concentrations of initial, fed glucose and residual. EXAMPLE 11
Production of L-methionine by fermentation in a bioreactor, with strains 15, 17 and 18 Pre-culture conditions were described above (Example 10).
Subsequently, 2.5 L fermentors (Pierre Guerin) were loaded with 600 ml of minimal medium (B2) and were inoculated with a biomass concentration of 2.1 gL'1 with a preculture volume in the range between 55 to 70 ml. The final phosphate concentration in the B2 batch medium was adjusted to a value ranging from 0 to 20 µm.
The culture temperature was kept constant at 37°C and the pH was kept at the working value (6.8) by automatic addition of NH 4 OH solutions (10% NH 4 OH for 9 hours and 28% until the end of the culture). The initial agitation rate was set at 200 rpm during the batch phase and was increased to 1000 rpm during the fed batch phase. The initial airflow rate was 40 nL.h'1 during the batch phase and was increased to 100 nL.h'1 at the beginning of the fed batch phase. The dissolved oxygen concentration was maintained at values between 20 and 40%, preferably 30% saturation by increasing agitation. IPTG was added to continuous and fed batch media as needed to a final concentration of 20 µM. When required antibiotics were added at a concentration of 50 mg L-1 for kanamycin, 30 mg L-1 for chloramphenicol and 10 mg L-1 for gentamicin.
When the cell mass reached a concentration close to 5 gL'1, fed-batch phase was started with an initial flow rate of 5 mL.h'1. The final phosphate concentration of the F2 medium was adjusted to a value comprised between 5 and 30 mM to achieve a phosphate limitation during the culture. Feed solution was injected with a sigmoid profile with an increasing flow rate that reached 27 mL.h'1 after 26 hours. Precise feeding conditions were calculated by the equation:
where Q(t) is the feed flow rate in mL.h' 1 for a discontinuous volume of 600 mL with pl = 1.80, p2 = 22.4, P3 = 0.27, P4 = 6.50. This flow rate was increased from 10 to 50%, preferably from 30% throughout the entire culture.
After 26 hours of fed batch culture, the feed solution pump was stopped and the culture stopped after exhaustion of glucose.
Extracellular amino acids were quantified by HPLC after OPA/Fmoc derivatization and other relevant metabolites were analyzed using HPLC with refractometric detection (organic acids and glucose) and GC-MS after silylation. Table 11: Specific glucose consumption rate (qs), 10 maximum and final methionine yields produced in batch culture fed by strains 17 and 18. Strains performances are compared to reference strain 15. The symbol ~ indicates an increase of the parameter less than 5%, while the + symbol indicates an improvement greater than 5%.

The specific glucose consumption rate (qs) was increased after deletion of the dgsA gene associated or not with overexpression of ptsG. Furthermore, methionine production yields (both maximum yields) were increased with these genetic modifications.
For definition of methionine yields, see example 10 above.
The specific glucose consumption rate (qs) was calculated as follows:
; where [X] is the cell concentration at time t. REFERENCES: 1. Plumbridge J (1998), Mol Microbiol.29: 1053-1063 2. Kimata K, Inada T, Tagami H, Aiba H (1998), Mol Microbiol.29: 1509-1519 3. Rungrassamee W, Liu X , Pomposiello PJ (2008), Arch Microbiol.190: 41-49 4. Anderson EH (1946), Proc. Natl. Academic Sci. USA 32:120-128 5. Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H (2006), Mol Syst Biol. 2: 2006.0008 6. Datsenko KA, Wanner BL (2000), Proc Natl Acad Sci US A. 97: 6640-6645 7. Dennis JJ, Zylstra GJ (1998), Appl Environ Microbiol.64: 2710-2715 8. Giladi H , Goldenberg D, Koby S, Oppenheim AB (1995), FEMS Microbiol Rev.17: 135-140 9. Görke B, Vogel J (2008), Genes Dev. 22:2914-25 10. Harrington KJ, Laughlin RB, Liang S (2001), Proc Natl Acad Sci USA. 98: 5019-5024 11. Kadner RJ, Murphy GP, Stephens CM (1992), J Gen Microbiol.138: 2007-2014 12. Kincade JM, deHaseth PL (1991), Gene. 97: 7-12 13. Kornberg HL, Reeves RE (1972), Biochem J. 128: 1339-1344 14. Lee AT, Cerami A (1987), Proc Natl Acad Sci US A. 84: 8311-8314 15. Meadow ND, Fox DK, Roseman S (1990), Annu Rev Biochem. 59: 497-542 16. Meynial-Salles I, Cervin MA, Soucaille P (2005), Appl Environ Microbiol. 71: 2140-2144 17. Miller (1992), A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 18. Morita T, Aiba H (2007), Proc Natl Acad Sci US A. 104: 20149-20150 19. Natarajan A, Srienc F (1999), Metab Eng. 1: 320-20. Orosz A, Boros I, Venetianer P (1991), Eur J Biochem. 201: 653-659 21. Plumbridge J (2002), Curr Opin Microbiol. 5: 187193 5 22. Prescott et al. (1999), "Microbiology"4*. ed, WCB McGraw-Hill 23. Rohwer JM, Jensen PR, Shinohara Y, Postma PW, Westerhoff HV (1996), Eur J Biochem. 235:225-30 24. Sambrook et al. (1989) (2001), "Molecular 10 Cloning: A Laboratory Manual" 2a. and 3rd. eds., Cold Spring Harbor Laboratory Press 25. Sauderson CL (1985), Br J Nutr. 54: 621-633 26. Tchieu JH, Norris V, Edwards JS, Saier MH Jr (2001), J Mol Microbiol Biotechnol. 3: 329-346

权利要求:
Claims (15)
[0001]
1. Recombinant microorganism for improved methionine production characterized by comprising: a) at least one modification to produce methionine from glucose as the main carbon source by fermentation, and b) at least one modification to improve glucose import, in which the import of glucose is increased compared to the microorganism without the modifications specified by the overexpression of the ptsG gene encoding the PTS IICBGlc enzyme and deletion of the dgsA gene encoding a transcriptional regulator, and in which the expression of at least one of the following genes is attenuated: metJ, pykA, pykF, purU, yncA or udhA, and wherein said microorganism is Escherichia coli.
[0002]
2. Microorganism according to claim 1, characterized in that the ptsG gene is overexpressed under the control of an inducible and/or constitutive promoter.
[0003]
Microorganism according to claim 1, characterized in that the ptsG gene does not contain a binding site sequence for a small sgrS RNA, which is SEQ ID NO:19.
[0004]
4. Microorganism according to claim 1, characterized in that the expression of the sgrS and/or sgrT gene is attenuated.
[0005]
5. Microorganism according to claim 4, characterized in that the sgrS and/or sgrT gene is excluded.
[0006]
6. Microorganism according to claim 1, characterized in that the expression of at least one of the following genes is improved: pyc, pntAB, cysP, cysU, cysW, cysA, cysM, cysJ, cysI, cysH, gcvT, gcvH, gcvP , lpd, serA, serB, serC, cysE, metF, metH or thrA.
[0007]
7. Microorganism according to claim 6, characterized in that at least one gene is under the control of an inducible promoter.
[0008]
8. Microorganism according to claim 1, characterized in that: a) the pstG gene does not contain a sgrS sRNA binding site and/or the grS genes are excluded and/or the sgrT gene is excluded, b) the expression of the genes metH, cysPUWAM, cysJIH, gcvTHP, metF, serA, serB, serC, cysE and pyc be enhanced; and c) the expression of the metJ, pykA, pykF, purU and yncA genes is attenuated.
[0009]
Method for the fermentative production of methionine and/or methionine derivative characterized in that it comprises a) cultivating the recombinant microorganism, according to claim 1, in an appropriate culture medium comprising a fermentable carbon source comprising glucose and a source of sulfur, and b) recovering methionine and/or methionine derivative from the culture medium.
[0010]
Method according to claim 9, characterized in that the ptsG gene does not contain a binding site sequence for a small sgrS RNA, which is SEQ ID NO:19.
[0011]
Method according to claim 9, characterized in that the expression of the sgrS and/or sgrT gene is attenuated.
[0012]
Method according to claim 9, characterized in that the sgrS and/or sgrT gene is excluded.
[0013]
Method according to claim 9, characterized in that the expression of at least one of the following genes is improved: pyc, pntAB, cysP, cysU, cysW, cysA, cysM, cysJ, cysI, cysH, gcvT, gcvH, gcvP, lpd, serA , serB, serC, cysE, metF, metH or thrA.
[0014]
14. Method according to claim 13, characterized in that at least one gene is under the control of an inducible promoter.
[0015]
Method according to claim 9, characterized in that the expression of at least one of the following genes is attenuated: metJ, pykA, pykF, purU, yncA or udhA.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013033675B1|2021-06-29|MICRO-ORGANISM AND METHOD FOR THE PRODUCTION OF METHIONINE WITH STRONG GLUCOSE IMPORT

---

JP5944323B2|2016-07-05|Use of inducible promoters in the production of methionine.

---

JP6100370B2|2017-03-22|Recombinant microorganism for fermentative production of methionine

---

KR101636662B1|2016-07-05|Increasing methionine yield

---

JP2017169576A|2017-09-28|Increase supply of NADPH for methionine production

---

BRPI0620880A2|2012-09-18|method for the production of methionine, its derivatives, or precursors by culturing a microorganism, and, microorganism

---

EP2486123B1|2016-03-09|A METHOD FOR PRODUCING AN L-CYSTEINE, L-CYSTINE, A DERIVATIVE OR PRECURSOR THEREOF OR A MIXTURE THEREOF USING A BACTERIUM OF Enterobacteriaceae FAMILY

---

JP5922036B2|2016-05-24|Strains and methods for the production of methionine

---

RU2678757C2|2019-01-31|Microorganism for methionine production with enhanced methionine efflux

---

WO2015028674A1|2015-03-05|Microorganism for methionine production with improved methionine synthase activity and methionine efflux

---

RU2723714C2|2020-06-17|Method and microorganism for enzymatic production of methionine with improved output of methionine

---

Ben-Zvi et al.2019|mRNA dynamics and alternative conformations adopted under low and high arginine concentrations control polyamine biosynthesis in Salmonella

---

BR102018004985A2|2019-10-01|Transgenic recombinant coli lineage microorganism for L-methionine production

同族专利:

---

公开号 | 公开日

---

AR086790A1|2014-01-22|

---

BR112013033675A2|2018-06-19|

---

ES2654589T3|2018-02-14|

---

KR20140043804A|2014-04-10|

---

MX347843B|2017-05-16|

---

CN103781913A|2014-05-07|

---

JP2014522642A|2014-09-08|

---

US20140134680A1|2014-05-15|

---

EP2726626B1|2017-11-15|

---

MY166543A|2018-07-16|

---

CN103781913B|2016-02-24|

---

WO2013001055A1|2013-01-03|

---

KR102029819B1|2019-10-08|

---

PL2726626T3|2018-05-30|

---

MX2013015202A|2014-02-17|

---

EP2726626A1|2014-05-07|

---

US9506092B2|2016-11-29|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

JP4110641B2|1998-11-17|2008-07-02|味の素株式会社|Method for producing L-methionine by fermentation|

---

JP2000157267A|1998-11-24|2000-06-13|Ajinomoto Co Inc|VARIATION TYPE metJ GENE AND PRODUCTION OF L-METHIONINE|

---

AU8584401A|2000-08-02|2002-02-13|Degussa|Nucleotide sequences which code for the meth gene|

---

DE10116518A1|2001-04-03|2002-10-17|Degussa|Process for the fermentative production of L-amino acids using strains of the Enterobacteriaceae family|

---

WO2003004665A2|2001-07-06|2003-01-16|Degussa Ag|Process for the preparation of l-amino acids using strains of the enterobacteriaceae family|

---

RU2245919C2|2002-09-06|2005-02-10|Закрытое акционерное общество "Научно-исследовательский институт Аджиномото-Генетика"|Method for producing l-amino acid, strain escherichia coli tdh7δmlc::cat/pprt614 as producer of l-threonine|

---

DE10303571A1|2003-01-30|2004-08-12|Degussa Ag|Process for the fermentative production of L-amino acids using strains of the Enterobacteriaceae family|

---

JP2006517796A|2003-02-18|2006-08-03|メタボリックエクスプローラー|Method for producing an evolved microorganism capable of generating or modifying a metabolic pathway|

---

DE10314618A1|2003-04-01|2004-10-14|Degussa Ag|Process for the preparation of L-amino acids using strains of the family Enterobacteriaceae|

---

DE10359594A1|2003-12-18|2005-07-28|Basf Ag|PEF TU-expression units|

---

DE102004003411A1|2004-01-23|2005-09-01|Degussa Ag|Process for the preparation of L-amino acids using strains of the family Enterobacteriaceae|

---

DE102004005836A1|2004-02-06|2005-09-15|Degussa Ag|Process for the preparation of L-amino acids using strains of the family Enterobacteriaceae|

---

KR100651220B1|2004-06-29|2006-11-29|씨제이 주식회사|- - L-methionine producing microorganism and method of producing L-methionine using the microorganism|

---

DE102004035065A1|2004-07-20|2006-02-16|Basf Ag|P-ET-TS expression units|

---

JP5172697B2|2006-01-04|2013-03-27|メタボリックエクスプローラー|Method for producing methionine and its precursor homoserine or succinyl homoserine using microorganisms with enhanced sulfate permease expression|

---

WO2007119576A1|2006-03-23|2007-10-25|Ajinomoto Co., Inc.|A method for producing an l-amino acid using a bacterium of the enterobacteriaceae family|

---

WO2009043372A1|2007-10-02|2009-04-09|Metabolic Explorer|Increasing methionine yield|

---

AU2008339217A1|2007-12-18|2009-06-25|Korea Advanced Institute Of Science And Technology|Recombinant microorganism having an ability of using sucrose as a carbon source|

---

WO2010020290A1|2008-08-22|2010-02-25|Metabolic Explorer|Producing methionine without n-acetyl methionine|

---

AR083468A1|2010-10-25|2013-02-27|Metabolic Explorer Sa|INCREASING NADPH'S AVAILABILITY FOR METIONIN PRODUCTION|

---

WO2012090021A1|2010-12-30|2012-07-05|Metabolic Explorer|Recombinant microorganism for the fermentative production of methionine|AU2012383221A1|2012-06-18|2015-01-15|Evonik Degussa Gmbh|Recombinant microorganism for the fermentative production of methionine|

---

CN105658803B|2013-08-30|2020-06-23|赢创运营有限公司|Microorganisms for methionine production with improved methionine synthase activity and methionine efflux|

---

BR112016004371A2|2013-08-30|2017-10-17|Metabolic Explorer Sa|microorganism for methionine production with increased methionine efflux|

---

EP3189150A1|2014-09-01|2017-07-12|Metabolic Explorer|Method and microorganism for methionine production by fermentation with improved methionine efflux|

---

EP3050970B1|2015-01-28|2019-09-18|Metabolic Explorer|Modified microorganism for optimized production of 1,4-butanediol|

---

EP3271467A1|2015-03-18|2018-01-24|Basf Se|Recombinant microorganism for improved production of fine chemicals|

---

ES2811337T3|2015-04-07|2021-03-11|Metabolic Explorer Sa|Modified microorganism for optimized 2,4-dihydroxybutyrate production with increased 2,4-dihydroxybutyrate efflux|

---

BR112017021255A2|2015-04-07|2018-06-26|Metabolic Explorer Sa|modified microorganism for optimized production of 2,4-dihydroxybutyrate|

---

BR112018002048A2|2015-08-07|2018-09-18|Evonik Degussa Gmbh|Genetically modified microorganism and method for the fermentative production of methionine|

---

KR20180086240A|2015-11-27|2018-07-30|에보닉 데구사 게엠베하|Method for producing L-methionine|

---

BR112018013873A2|2016-01-08|2018-12-18|Evonik Degussa Gmbh|Method for the fermentative production of l-methionine and / or its derivatives|

---

KR101853961B1|2016-04-19|2018-06-20|휴맥스|Apparatus and method of providing media service|

---

EP3296404A1|2016-09-15|2018-03-21|Evonik Degussa GmbH|Modified microorganism for production of methionine|

---

EP3354742A1|2017-01-26|2018-08-01|Metabolic Explorer|Methods and microorganisms for the production of glycolic acid and/or glyoxylic acid|

---

EP3652319A1|2017-07-11|2020-05-20|Adisseo France S.A.S.|Methionine-producing yeast|

---

EP3470512A1|2017-10-10|2019-04-17|Metabolic Explorer|Mutant phosphoserine aminotransferase for the conversion of homoserine into 4-hydroxy-2-ketobutyrate|

---

KR102221040B1|2019-05-09|2021-03-03|씨제이제일제당 주식회사|Microorganism producing L-amino acid and method of producing Method of L-amino acid using thereof|

法律状态:
2018-10-02| B25A| Requested transfer of rights approved|Owner name: EVONIK DEGUSSA GMBH (DE) |

---

2019-07-09| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-02-18| B07A| Technical examination (opinion): publication of technical examination (opinion) [chapter 7.1 patent gazette]|

---

2020-12-29| B25D| Requested change of name of applicant approved|Owner name: EVONIK OPERATIONS GMBH (DE) |

---

2021-02-02| B06G| Technical and formal requirements: other requirements [chapter 6.7 patent gazette]|

---

2021-05-04| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-06-29| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 29/06/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161502528P| true| 2011-06-29|2011-06-29|

---

US61/502,528|2011-06-29|

---

EP11305829.1|2011-06-29|

---

EP11305829|2011-06-29|

---

PCT/EP2012/062674|WO2013001055A1|2011-06-29|2012-06-29|A microorganism for methionine production with enhanced glucose import|

---