MONITORING OF RECOMBINASE POLYMERASE AMPLIFICATION MIXTURES

专利摘要:
monitoring of mixtures of recombinase polymerase amplification. a process that includes providing a mixture that includes a recombinase, a single-stranded binding protein, and one or more oligonucleotides; and detecting particles in the reaction mixture.
公开号:BR112013025758B1
申请号:R112013025758-0
申请日:2012-04-06
公开日:2021-04-06
发明作者:Niall A. Armes；Olaf Piepenburg；Catherine Jean Greenwood
申请人:Abbott Diagnostics Scarborough, Inc.；
IPC主号:

专利说明:

[0001] This disclosure relates to methods and compositions for nucleic acid detection, amplification and quantification. BACKGROUND
[0002] Certain isothermal amplification methods are capable of amplifying template (target) nucleic acid in a specific manner from traces at very high levels and detectable levels within a matter of minutes. Such isothermal methods, for example, Recombinase Polymerase Amplification (RPA), can expand the application of nucleic acid-based diagnostics in emerging areas, such as testing at the point of treatment, and field and consumer testing. The isothermal nature and wide temperature range of the technologies can allow users to avoid using complex power-demanding instrumentation. SUMMARY
[0003] This disclosure is based, at least in part, on the observation of particles within RPA mixtures. In some embodiments, these particles can include nucleic acids (e.g., oligonucleotides) and / or protein components of the RPA reaction. This discovery provides new methods of monitoring and detection related to RPA.
[0004] In one aspect, this description features processes that include: (a) providing a mixture that includes one or more of (for example, two or more, or all) a recombinase, a single-stranded DNA binding protein, and one or more nucleic acids (eg, oligonucleotides) (in any combination), and (b) detecting particles in the reaction mixture. In some embodiments, the mixture includes a binding agent, for example, one or more polyethylene glycol (for example, PEG1450, PEG3000, PEG8000, PEG 10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, compound PEG with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficol. In some embodiments, the agglomeration agent is present in the reaction mixture at a concentration between 1 to 12% by weight or volume of the reaction mixture, for example, between two concentration values chosen between 1.0%, 1, 5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6, 5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11, 5%, and 12.0%.
[0005] In some embodiments of all aspects, the recombinase includes a RecA or UvsX recombinase. In some embodiments of all aspects, the single-stranded DNA-binding protein includes a prokaryotic SSB protein or a gp32 protein. In some embodiments of all aspects, at least one of the one or more nucleic acids (e.g., oligonucleotides) includes a detectable marker.
[0006] In some embodiments of all aspects, the particles include one or more (e.g., two or more, or all) of a recombinase, a single-stranded binding protein, and at least one of the one or more acids nucleic (in any combination). In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTPs, ATP, a primer, and a template nucleic acid.
[0007] In some embodiments of all aspects, the mix includes one or more (for example, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all ) of a recombinase, a DNA polymerase, a single-stranded binding protein, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatino kinase, a nuclease (for example, an exonuclease III or endonuclease IV), a reverse transcriptase, a nucleic acid probe, a nucleic acid primer, and a template nucleic acid (in any combination).
[0008] In some embodiments of all aspects, the particles include a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a recombinase, a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a recombinase, a single-stranded binding protein, a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles include a polymerase, dNTP, and ATP, and one or more (for example, two, three, four, five, or six) additional agents selected from the group of a probe , a primer, a single-stranded binding protein, ddNTPs, a reducing agent, creatine kinase, a nuclease and a reverse transcriptase. In some embodiments of all aspects, the particles include a recombinase, a polymerase, a reverse transcriptase, dNTP, ATP, a primer, and a template nucleic acid.
[0009] In some embodiments of all aspects, the particles are about 0.5-20 μm in size, for example, between about any two sizes selected from 0.5, 1, 1.5, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (for example, about 1-10 μm in size).
[0010] In some embodiments of all aspects, approximately 10 to 5000 particles / nL, for example, between any two particle numbers selected from 10, 20, 50, 100, 200, 500, 1000, 2000 and 5000 particles per nL , are detected.
[0011] In some embodiments of all aspects, the detection of particles in the mixture includes the use of one or more microscopy, a microfluidic device, flow cytometry, and a chamber. In some embodiments of all aspects, the particles are detected using coupled charge detection (CCD).
[0012] In another aspect, the disclosure presents a process that includes: (a) providing an amplification reaction mixture with recombinase polymerase, (b) maintaining the reaction mixture under conditions that allow the production of nucleic acid amplification products in the mixture of reaction, and (c) detecting particles associated with the nucleic acid amplification products in the reaction mixture. In some embodiments, detection is performed within 10 minutes (for example, about 9, 8, 7, 6, 5, 4, 3, 2, 1.5, or 1 minute) from when it starts to maintenance.
[0013] In some embodiments of all aspects, the reaction mixture includes a binding agent, for example, one or more polyethylene glycol (for example, PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, the PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficol. In some embodiments, the reaction mixture contains polyethylene glycol as a binding agent (for example, any of the PEG compounds described herein or known in the art). In some embodiments, the reaction mixture contains polyvinyl alcohol as a binding agent. In some embodiments, the agglomeration agent is present in the reaction mixture at a concentration between 1 to 12% by weight or volume of the reaction mixture, for example, between two concentration values selected from 1.0%, 1.5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6.5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11, 0%, 11.5% and 12.0%. In some embodiments, the agglomerating agent is present in the reaction mixture at a concentration that is sufficient to increase the amount of amplification in the reaction mixture.
[0014] In some embodiments of all aspects, the particles include one or more (e.g., two or more or all) of the recombinase, the single-stranded binding protein, and at least one of the one or more nucleic acids ( in any combination).
[0015] In some embodiments of all aspects, the reaction mix includes one or more (e.g., two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a recombinase loading protein, ATP, dNTP or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease (for example, an exonuclease III or endonuclease IV), a protein binding single strand, a nucleic acid primer, a nucleic acid probe, reverse transcriptase, and a template nucleic acid (in any combination).
[0016] In some embodiments of all aspects, the reaction mixture contains a recombinase, a single-stranded binding protein, and one or more oligonucleotides. In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTP, ATP, a primer, and a template nucleic acid.
[0017] In some embodiments of all aspects, the reaction mixture includes a polymerase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a recombinase, a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a recombinase, a single-stranded binding protein, a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the reaction mixture includes a polymerase, dNTP, and ATP, and one or more (for example, two, three, four, five or six) additional agents selected from the group of a probe, a primer, a single-stranded binding protein, ddNTPs, a reducing agent, creatine kinase, a nuclease and a reverse transcriptase. In some embodiments of all aspects, the reaction mixture includes a recombinase, a polymerase, a reverse transcriptase, dNTPs, ATP, a primer, and a template nucleic acid. In some embodiments of all aspects, the particles are about 0.5-20 μm in size, for example, between about any two sizes selected from 0.5, 1, 1.5, 2, 2 , 5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (for example, about 1-10 μm in size).
[0018] In some embodiments of all aspects, approximately 10 to 5000 particles / nL, for example, between two particle numbers selected from 10, 20, 50, 100, 200, 500, 1000, 2000 and 5000 particles per nL, are detected.
[0019] In some embodiments of all aspects, the detection comprises determining a number or proportion of particles associated with the nucleic acid amplification products in the reaction mixture and, optionally, thereby determining or estimating the template nucleic acid concentration in the original mixture. In some embodiments, the detection comprises detecting individual particles associated with two or more distinct nucleic acid amplification products.
[0020] In another aspect, the disclosure features compositions that include (a) a first particle population, which includes a first recombinase, a first single-stranded DNA binding protein, and a first oligonucleotide, and (b) a second particle population which includes a second recombinase, a second single-stranded DNA binding protein, and a second oligonucleotide, in which the first and second oligonucleotides are different. In some embodiments, at least one of the first and second oligonucleotides includes a detectable marker. In some embodiments, the first and second oligonucleotides include the same or different detectable markers. The first and second single-stranded DNA binding proteins can be the same or different from each other. The first and second recombinases can be the same or different from each other.
[0021] In some embodiments of all aspects, the particles are about 0.5-20 μm in size, for example, between about any two sizes selected from 0.5, 1, 1.5, 2, 2 , 5, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, and 20 μm (for example, about 1-10 μm in size).
[0022] In some embodiments of all aspects, approximately 10 to 5000 particles / nL, for example, between two particle numbers selected from 1, 20, 50, 100, 200, 500, 1000, 2000 and 5000 particles per nL, are present in the compositions.
[0023] In some embodiments of all aspects, the compositions include a binding agent, for example, one or more of polyethylene glycol (for example, PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, or combinations thereof), polyvinyl alcohol, dextran and ficol. In some embodiments, the binding agent is present in the composition at a concentration between 1 and 12% by weight or volume of the reaction mixture, for example, between any two concentration values selected from 1.0%, 1, 5%, 2.0%, 2.5%, 3.0%, 3.5%, 4.0%, 4.5%, 5.0%, 5.5%, 6.0%, 6, 5%, 7.0%, 7.5%, 8.0%, 8.5%, 9.0%, 9.5%, 10.0%, 10.5%, 11.0%, 11, 5%, and 12.0%.
[0024] In some embodiments of all aspects, the compositions further include one or more (for example, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or all) of a DNA polymerase, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatinokinase, a nuclease (for example, an exonuclease III or endonuclease IV), a nucleic acid probe with and a template nucleic acid (in any combination).
[0025] In some respects, the disclosure features compositions that include one or more oligonucleotides described here and their variants. In some embodiments, oligonucleotides can be used as primers and / or probes for detecting nucleic acid amplification methods (for example, isothermal nucleic acid amplification, such as RPA). The oligonucleotides described herein can include one or more detectable markers. Where an oligonucleotide is disclosed to include one or more detectable markers, alternative markers can be used at the same positions, or at different positions within the oligonucleotide (for example, at a position within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 14, 15, 16, 17, 18, 19, 20, 25 or 30 bases 5 'or 3' from the disclosed position). In some embodiments, oligonucleotides may include one or more abasic mimetic sites. Where an oligonucleotide includes one or more abasic mimetic sites, alternative abasic mimetic sites can be included in the same position or in different positions within the oligonucleotide (for example, a position within 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or 30 bases 5 'or 3' from the disclosed position). In some embodiments, an oligonucleotide variant described herein has twelve or less (for example, eleven or less, ten or less, nine or less, eight or less, seven or less, six or less, five or less, four or less, three or less, two or less, or one or less), insertions, deletions, substitutions and / or additions in relation to the disclosed oligonucleotide sequence. In some embodiments, an oligonucleotide variant described herein has a sequence of at least 80% (for example, 85%, 90% or 95%), identical to the disclosed oligonucleotide sequence.
[0026] In some embodiments, the particles are detected using particle fluorescence.
[0027] In certain embodiments, the particles are detected without the use of particle fluorescence.
[0028] In some embodiments, the particles are detected using particle fluorescence, phase contrast microscopy, luminescent detection, spectral (color) detection, radioisotope detection, magnetic detection, and / or electrochemical detection. In some embodiments the particles can be detected using a combination of two of the more (for example, two, three or four) of particle fluorescence, phase contrast microscopy, luminescent detection, spectral detection (color), radioisotope detection , magnetic detection, and electrochemical detection.
[0029] In some embodiments, some of the particles are detected using fluorescence from those particles, and another of the particles are detected without using fluorescence from these other particles. For example, the particles include a first subset of particles and a second subset of particles. The first subset of particles is detected using the fluorescence of the first subset of particles, and the second subset of particles is detected without using fluorescence from the second subset of particles (e.g., phase contrast microscopy, luminescent detection, spectral detection ( color), magnetic detection, radioisotope detection and / or electrochemical detection).
[0030] In another aspect, the disclosure features a population of particles that includes a recombinase, a single-stranded DNA-binding protein, and an oligonucleotide, in which some of the particles are detected using the fluorescence of those particles, and others of the particles are detected without the fluorescence use of these other particles.
[0031] Kits are also provided including a recombinase, a single-stranded DNA binding protein, and an oligonucleotide for use in any of the methods described herein. Kits are also provided including any of the particles or compositions described herein and instructions for carrying out any of the methods described herein.
[0032] The processes and compositions described herein can be used for the detection of nucleic acids, for example, bacterial nucleic acids, mammalian nucleic acids, viral nucleic acids, fungal nucleic acids or protozoan nucleic acids, and for the diagnosis of associated disorders or diseases with such nucleic acids.
[0033] As used herein, the "size" of a particle refers to the largest cross-sectional dimension of the particle.
[0034] As used herein, an "oligonucleotide" refers to a nucleic acid polymer containing at least 10 (for example, at least 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90 or 100) base units. In some embodiments, the oligonucleotide contains a total of less than 1 kb, 900 base units, 800 base units, 700 base units, 600 base units, 500 base units, 400 base units, 300 base units base, 200 base units, or 100 base units. In some embodiments, an oligonucleotide can have 90 or less, 80 or less, 70 or less, 60 or less, 50 or less, 40 or less, 30 or less or 20 or less base units. In some embodiments, an oligonucleotide has at least 10, 12, 14, 16, 18 or 20 base units.
[0035] As used herein, "cytometry" refers to methods and compositions for detecting, visualizing and analyzing the properties of the particles. The term, as used here, does not denote the presence of cells. However, the methods and compositions used to detect, visualize and analyze the properties of the cells can be applied to the particles described here.
[0036] In some embodiments, the 1 'carbon of the sugar or modified sugar moiety is covalently linked to another carbon that is not at the base of a cyclic structure. In some embodiments, the 1 'carbon of the sugar or modified sugar moiety is covalently attached to a non-cyclic binder structure. In some embodiments, an abasic mimetic site is recognized by an enzyme that modifies and processes an abasic mimetic site due to the structural similarity to a non-basic site (i.e., lack of a bulky base group attached to sugar).
[0037] Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In the event of a conflict, this specification, including definitions, will control. In addition, the materials, methods and examples are illustrative only and are not intended to be limiting.
[0038] Other features and advantages of the invention will be evident from the following detailed description, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] FiG. 1A-1C are micrographs that describe a single field in a mixture including particles. The scale bar indicates 100 μm. AI, differential interference contrast (DIC). 1B, fluorescence. 1C, mix. FIG. 2A-2C are micrographs that describe a single field of a mixture including particles and a template nucleic acid. The scale bar indicates 100 μm. 2A, DIC. 2B, fluorescence. 2C, mixing. FIG. 3A-3H are fluorescence micrographs representing mixtures including the indicated concentrations of polyethylene glycol (PEG). FIG. 4A-4F are micrographs that describe mixtures including particles. 4A and 4B are a standard mix, 4C and 4D are the standard mix excluding UvsX. 4E and 4F are the standard mix excluding gp32. 4A, 4C, 4E, DIC. 4B, 4D, 4F, fluorescence. FIG. 5A-5H are micrographs that describe mixtures including particles. 5A and 5B are the standard mix as in 4A and 4B, but excluding UvsY. 5C and 5D are the standard mixture excluding polymerase. 5E and 5F are the standard mixture excluding creatine kinase. 5G and 5H are the standard mixture excluding exonuclease III. 5A, 5C, 5E, 5G, DIC. 5B, 5D, 5F, 5H, fluorescence. FIG. 6A-6C are a set of micrographs that describe mixtures. 6A, two fields showing complete mixing. 6B, two fields showing complete mixing excluding gp32 and UvsY. 6C, two fields showing complete mixing excluding gp32, UvsY and Emix (50 mM Phosphocreatine, 2.5 mM ATP). For each set: top, DIC; background, fluorescence. FIG. 7A to 7F are micrographs that describe a mixture including particles prepared with two labeled oligonucleotides. 7A, Texas red fluorescence. 7B, DIC and Texas red mixed. 7C, FAM fluorescence. 7D, DIC and FAM mixed. 7E, DIC. 7F, Texas red and FAM mixed. FIG. 8A-8F are micrographs that describe a mixture including two sets of particles with two labeled oligonucleotides prepared independently and then mixed. 8A, Texas red fluorescence. 8B, DIC and Texas red mixed. 8C, FAM fluorescence. 8D, DIC and FAM mixed. 8E, DIC. 8F, Texas red and FAM mixed. FIG. 9 is a time course of micrographs representing particles during an amplification reaction. FIG. 10 is a time course of micrographs representing particles during an amplification reaction. FIG. 11 is a time course of micrographs that describe the particles, during an amplification reaction, visualized by DIC / FAM and DIC / Texas red. FIG. 12A-12D are micrographs that describe sets of particles, including mixtures of 20X magnification. 12A, mix including T6 H66S UvsX and UvsY. 12B, mix including T6 H66S UvsX without UvsY. 12C, mix including T6 UvsX and UvsY. 12D, mix including T6 UvsX without UvsY. For each set: top, DIC; background, fluorescence. FIG. 13A-13D are micrographs that describe sets of particles, including mixtures of 40X magnification. 13 A, mix including T6 H66S UvsX and UvsY. 13B, mix including T6 H66S UvsX without UvsY. 13C, mix including T6 UvsX and UvsY. 13D, mix including T6 UvsX without UvsY. For each set: top, DIC; background, fluorescence. FIG. 14A-14B are line graphs showing amplification reactions in mixtures including T6 H66S UvsX and UvsY (Standard UvsX + UvsY), T6 H66S UvsX without UvsY (Standard UvsX -UvsY), T6 UvsX and UvsY (T6 UvsX + UvsY) E6 UvsX without UvsY (T6 UvsX - UvsY). 14A, 500 mold copies. 14B, 50 copies of the mold. FIG. 15 is a line graph describing amplification reactions in mixtures including T6 H66S UvsX and UvsY (Standard UvsX + UvsY), T6 H66S UvsX without UvsY (Standard UvsX -UvsY), T6 UvsX and UvsY (T6 UvsX + UvsY) and T6 UvsX without UvsY (T6 UvsX - UvsY). FIG. 16A-16B are line graphs showing amplification reactions in mixtures including T6 H66S UvsX and UvsY (Standard UvsX + UvsY), T6 H66S UvsX without UvsY (Standard UvsX -UvsY), T6 UvsX and UvsY (T6 UvsX + UvsY) UvsY UvsX without UvsY (T6 UvsX - UvsY). DETAILED DESCRIPTION
[0040] In microscopic observation, structures with the appearance of particles were observed inside RPA mixtures. During the progress of the RPA nucleic acid amplification reaction, the particles are associated with active amplification loci.
[0041] The observed particles were typically in the range of 1-10 μm in size, and were present at about 100-500 particles / nL. The particles were found to contain the oligonucleotides present in the mixtures. The formation of particles does not require the presence of magnesium. However, particles formed in the absence of a recombinase or a single-stranded DNA binding protein had an altered morphology. The formation of the particles, in the absence of other agents, such as the loading protein recombinase, DNA polymerase, creatine kinase, or exonucleases, does not significantly affect the morphology of the particles. In addition, particle formation was more efficient in the presence of agglomerating agents.
[0042] The particles were observed to be relatively stable in solution. Separate populations of particles can be mixed and remain distinct for a period of time after mixing. Recombinase Polymerase Amplification
[0043] RPA is a method for the amplification (for example, isothermal amplification) of nucleic acids. In general, in a first RPA step a recombinase is contacted with a first and a second nucleic acid primer to form first and second nucleoprotein primers. In general, in a second step, the first and second nucleoprotein primers are contacted with a double stranded template nucleic acid to form a first double stranded structure on a first portion of the first strand of the template nucleic acid and a second stranded structure. double strand on a second portion of the second template nucleic acid strand, such that the 3 'ends of the first nucleic acid primer and the second nucleic acid primer are oriented relative to each other over a given DNA molecule. In general, in a third step the 3 'end of the first and the second nucleoprotein primer are extended by DNA polymerases to generate first and second double stranded nucleic acids, and a first and second displaced nucleic acid strands. Generally, the second and third steps can be repeated until a desired degree of amplification is achieved.
[0044] As described herein, RPA employs enzymes, known as recombinases, which are capable of pairing oligonucleotide primers with homologous sequences in double-stranded template DNA. In this way, DNA synthesis is directed to defined points in a double-stranded template DNA. Using two or more sequence-specific primers (for example, gene-specific), an exponential amplification reaction is initiated if the template nucleic acid is present. The reaction progresses rapidly and results in the specific amplification of a sequence present within the double stranded template DNA from just a few copies of the template DNA to detectable levels of the amplified products within minutes. RPA methods are disclosed, for example, in the USA 7,270,981; USA 7,399,590, USA 7,666,598, USA 7,435,561, USA 2009/0029421 and WO 2010/141940, all of which are incorporated herein by reference.
[0045] RPA reactions contain a mixture of proteins and other factors that support the activity of the recombination element of the system, as well as those that support the DNA synthesis of 3 'ends of the complementary oligonucleotides paired with the substrates. In some embodiments, the RPA reaction contains a mixture of a recombinase, a single-stranded binding protein, a polymerase, dNTP, ATP, a primer, and a template nucleic acid. In some embodiments, the RPA reaction can. include one or more of the following (in any combination): "at least one recombinase, at least one single-stranded DNA binding protein, at least one DNA polymerase, dNTPs or a mixture of dNTPs and ddNTPs, a binding agent , a buffer, a reducing agent, ATP or ATP analogue, at least one recombinase loading protein, a first primer and, optionally, a second primer, a probe, a reverse transcriptase, and a template nucleic acid molecule, for example example, a single-stranded (for example, RNA), or double-stranded nucleic acid. In some embodiments, RPA reactions may contain, for example, a reverse transcriptase. Additional non-limiting examples of RPA reaction mixtures are here described.
[0046] In some embodiments, RPA reactions may contain a UvsX protein, a gp32 protein, and a UvsY protein. Any of the processes, compositions or particles described herein may contain, in part, for example, a UvsX protein, a gp32 protein, and a UvsY protein. For example, any of the processes, compositions, or particles described herein may contain, in part, T6H66S UvsX, Rb69 gp32 and Rb69 UvsY.
[0047] In some embodiments, RPA reactions may contain a UvsX protein and a gp32 protein. For example, any of the processes, compositions, or particles described herein may contain, in part, for example, a UvsX protein and a gp32 protein.
[0048] A protein component of a RPA reaction is a recombinase, which can come from prokaryotic, viral or eukaryotic origin. Exemplary recombinases include RecA and UvsX (for example, a RecA protein or UvsX protein obtained from any species), and fragments or mutations thereof, and combinations thereof. RecA and UvsX fragments or mutant proteins can be obtained from any species. RecA and UvsX fragments or mutant proteins can also be produced using the available RecA and UvsS protein and nucleic acid sequences, and molecular biology techniques (see, for example, the mutant forms of UvsX described in U.S. Patent No. 8,071. 308). Exemplary UvsX proteins include those derived from Myoviridae phages, such as T4, T2, T6, Rb69, Aehl, KVP40, Acinetobacter 133 phage, Aeromonas 65 phage, P-SSM2 cyanophagus, PSSM4 cyanophagus, S-PM2 cyanophagus, Rbl4, Rb32, Aeromonas 25 phage, Vibrio nt-1 phage, phi-1, Rbl6, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Additional exemplary recombinase proteins include RADA archeabacteria and RADB and eukaryotic proteins (eg, plant, mammal, and fungi) Rad51 proteins (eg, RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3 and recA) (see, for example , Lin et al., Proc. Acad. Sci. USA 103: 1032810333, 2006).
[0049] Throughout the process of the present disclosure, the recombinase (for example, UvsX) can be a mutant or hybrid recombinase. In some embodiments, the mutant UvsX is an Rb69 UvsX that includes at least one mutation in the UvsX Rb69 amino acid sequence, where the mutation is selected from the group consisting of (a) an amino acid other than histidine at position 64, a serine at position 64, the addition of one or more glutamic acid residues at the C-terminal position, the addition of one or more aspartic acid residues at the C-terminal region, and a combination of these. In other embodiments, the mutant UvsX is a T6 UvsX having at least one mutation in the T6 UvsX amino acid sequence, where the mutation is selected from the group consisting of (a) an amino acid other than histidine at position 66, ( b) a serine at position 66, (c) adding one or more glutamic acid residues at the C-terminal position, (d) adding one or more aspartic acid residues at the C-terminal region, and (e) a combination of these methods. Where a hybrid recombinase protein is used, the hybrid protein can be, for example, a UvsX protein that includes at least one region that includes an amino acid sequence derived from a different UvsX species. The region can be, for example, the UvsX loop 2 DNA binding region.
[0050] In addition, one or more single-stranded DNA-binding proteins can be used to stabilize nucleic acids during the various exchange reactions that are ongoing in the reaction. The one or more single-stranded DNA binding proteins can be derived or obtained from any species, for example, from a viral, prokaryotic or eukaryotic species. Non-limiting examples of single-stranded DNA binding proteins include E. coli SSB and those derived from Myoviridae phages, such as T4, T2, Τ6, Rb69, Aehl, KVP40, Acinetobacter 133 phage, Aeromonas 65 phage, cyanophagus P-SSM2, cyanophagus PSSM4, cyanophagus S-PM2, Rbl4, Rb32, Phage of Aeromonas 25, phage of Vibrio nt-1, phi-1, Rbl6, Rb43, phage 31, phages 44RR2.8t, Rb49, phage Rb3, and phage LZ2. Other examples of single-stranded DNA binding proteins include A. denitrifleans Alide_2047, Burkholderia thailandensis BthaB_33951, Prevotella pallens HMPREF9144_0124, and eukaryotic single-stranded DNA binding protein replication protein A.
[0051] DNA polymerase can be a eukaryotic or prokaryotic polymerase. Examples of eukaryotic polymerases include pol-alpha, pol-beta, pol-delta, pol-epsilon, and mutants or fragments thereof, or combinations thereof. Examples of prokaryotic polymerase include E. coli DNA polymerase I (for example, Klenow fragment), bacteriophage T4 gp43 DNA polymerase, Bacillus stearothermophilus polymerase I large fragment, Phi-29 DNA polymerase, T7 DNA polymerase, Bacillus subtiloc Pol I Pol I, E. coli DNA polymerase I, E. coli DNA polymerase II, E. coli DNA polymerase III, E. coli DNA polymerase IV, E. coli DNA polymerase V, and the mutants or fragments thereof , or combinations thereof. In some embodiments, the DNA polymerase has no 3'-5 'exonuclease activity. In some embodiments, DNA polymerase has displacement tape properties, for example, large fragments of class I or pol V prokaryotic polymerases.
[0052] Any of the processes of the present disclosure can be carried out in the presence of a binding agent. In some embodiments, the binding agent may include one or more of polyethylene glycol, polyethylene oxide, polyvinyl alcohol, polystyrene, Ficoll, dextran, poly (vinylpyrrolidone) (PVP), and albumin. In some embodiments, the binding agent has a molecular weight of less than 200,000 daltons. In addition, the binding agent can be present, for example, in an amount of about 0.5% to about 15% by weight by volume (w / v).
[0053] If a recombinase loading protein is used, the recombinase loading protein can be of prokaryotic, eukaryotic or viral origin. Exemplary recombinase loading proteins include E. coli RecO, E. coli RecR, UvsY, and mutants or fragments thereof, or combinations thereof. Exemplary UvsY proteins include those derived from Myoviridae phages, such as T4, T2, T6, Rb69, Aehl, KVP40, Acinetobacter 133 phage, Aeromonas 65 phage, P-SSM2 cyanophagus, PSSM4 cyanophagus, S-PM2 cyanophagus, Rbl4, Rb32, Aeromonas 25 phage, Vibrio nt-1 phage, phi-1, Rbl6, Rb43, phage 31, phages 44RR2.8t, Rb49, phage Rb3 and phage LZ2. In any of the processes of the present disclosure, the loading agent recombinase can be derived from a Myoviridae phage. Myoviridae phage can be, for example, T4, T2, T6, Rb69, Aehl, KVP40, Acinetobacter 133 phage, Aeromonas 65 phage, P-SSM2 cyanophagus, PSSM4 cyanophagus, S-PM2 cyanophagus, Rbl4, Rb32, Phage Aeromonas 25, Vibrio nt-1 phage, phi-1, Rbl6, Rb43, phage 31, phages 44RR2.8t, Rb49, phage Rb3 or phage LZ2.
[0054] In addition, any of the processes of the present disclosure can be performed with a blocked initiator. A blocked primer is a primer that does not allow elongation with a polymerase. When a blocked initiator is used, an unlocking agent can be used to unlock the initiator to allow for stretching. The deblocking agent can be an endonuclease or exonuclease that is capable of cleaving the blocking group of the primer. Examples of deblocking agents include E. coli exonuclease III and E. coli endonuclease IV.
[0055] In some embodiments, the processes of the present disclosure may include: contacting a recombinase with a first and a second nucleic acid primer and a third extension blocked primer, which contains one or more non-complementary or modified internal residues in order to forming a first, second and third nucleoprotein primer; contacting the first and second nucleoprotein primers with the double stranded target nucleic acid to form a first double strand structure between the first nucleoprotein primer and the first DNA strand in a first portion of the first strand (forming a D loop) and a second double strand structure between the second nucleoprotein primer and the second DNA strand to a second portion of the second strand (forming a D loop), such that the 3 'ends of the first nucleoprotein primer and the second nucleoprotein primer are oriented towards one another on the same target nucleic acid molecule with a third portion of target nucleic acid present between the 5 'ends of the first and second primers, and extending from the 3' end of the first nucleoprotein primer and the second nucleoprotein primer with one or more polymerases and dNTPs to generate a first amplified target nucleic acid; contacting the first amplified target nucleic acid with the third nucleoprotein primer to form a third double-stranded structure on the first amplified target nucleic acid (forming a D loop), in the presence of a nuclease, where the nuclease specifically cleaves the internal residue complementary only after the formation of the third double strand structure to form a third primer 5 'and a third blocked primer of extension 3', and extending the 3 'end of the third primer 5' with one or more polymerase and dNTP to generate a second double-stranded amplified nucleic acid.
[0056] In some embodiments, the processes include a first and second primer to amplify a first portion present within a double stranded target nucleic acid to generate a first amplified product, and at least one additional primer that can be used to amplify a sequence contiguous present within the first amplified product (e.g., an additional third primer that can be used in combination with, for example, the first or second primer, to amplify a contiguous sequence present within the first amplified product). In some embodiments, the methods include a first and second primer to amplify a first portion present within a double stranded target nucleic acid to generate a first amplified product, and a third and fourth primer that can be used to amplify a sequence contiguous present within the first amplified product.
[0057] In some embodiments, the processes may include, for example, a forward initiator and a reverse initiator. In some embodiments, the processes may include at least one blocked initiator, which comprises one or more non-complementary or modified internal residues (for example, one or more non-complementary or modified internal residues that can be recognized and cut by a nuclease, for example, DNA glycosylase, AP endonucleases, fpg, Nth, MutY, MutS, MutM, E. coli, MUG, human MUG, human Oggl, a vertebrate type Nei (Neyl) glycosylase, Nfo, exonuclease III, or uracil glycosylase). Additional non-limiting examples of nucleic acids (for example, primers and probes) that can be included in the process are described below.
[0058] In some embodiments, the processes may include a probe or primer that is resistant to nuclease, for example, a primer or probe that contains at least one (e.g., at least two, three, four, five, six, seven, or eight) phosphorothioate bond.
[0059] Any of the processes of the present disclosure can be carried out in the presence of heparin. Heparin can serve as an agent to reduce the level of nonspecific initiator noise, and to increase the ability of E. coli with exonuclease III or E. coli endonuclease IV to quickly polish 3 'blocking groups or intermediate recombination end residues .
[0060] Based on the particular type of reaction, the mixture can also contain one or more of the buffers, salts, and nucleotides. The reaction mixture can be maintained at a specific temperature or temperature range suitable for the reaction. In some embodiments, the temperature is maintained at or below 80 ° C, for example, at or below 70 ° C, at or below 60 ° C, at or below 50 ° C, at or below 40 ° C, at or below 37 ° C, at or below 30 ° C, or at or below room temperature. In some embodiments, the temperature is maintained at or above 4 ° C, at or above 10 ° C, at or above 15 ° C, at or above 20 ° C, at or above room temperature, or above 25 ° C, at or above 30 ° C, at or above 37 ° C, at or above 40 ° C, at or above 50 ° C, at or above 60 ° C, at or above 70 ° C. in some embodiments, the reaction mixture is maintained at room or ambient temperature. In some embodiments, the Celsius temperature scale of the mixture varies by less than 25% (for example, less than 20%, less than 15%, less than 10%, or less than 5%) throughout the reaction time and / or the temperature of the mixture is varied by less than 15 ° C (for example, less than 10 ° C, less than 5 ° C, less than 2 ° C, or less than 1 ° C) throughout the reaction time .
[0061] Amplification detection, for example, in real time, can be performed by any method known in the art. In some embodiments, one or more primers or probes (for example, molecular guide probes) are labeled with one or more detectable labels. Examples of detectable markers include enzymes, enzyme substrates, coenzymes, enzyme inhibitors, fluorescent markers, suppressors, chromophores, particles or magnetic granules, redox sensitive moieties (eg electrochemically active moieties), luminescent markers, radioisotopes (including radionucleotides) and link peer members. More specific examples include fluorescein, phycobiliprotein, tetraethyl rhodamine, and beta-galactosidase. Binding pairs can include biotin / avidin, biotin / streptavidin, antigen / antibody, ligand / receptor, and analogs and mutants of the binding pairs.
[0062] It should be noted that a fluorescence suppressing agent is also considered to be a detectable marker. For example, the fluorescence suppressing agent can be contacted with a fluorescent dye and the amount of cooling is detected. Particle detection
[0063] The detection and monitoring of the particles can be carried out using any suitable method. Examples of methods include microscopy, light scattering, flow cytometry, and microfluidic methods.
[0064] In some embodiments, the particles can be detected using microscopy, for example, the difference in interference contrast or fluorescence microscopy, to directly observe the particles at high magnification. With the aid of a computer, microscope images can be automatically obtained and analyzed. In addition, microscopy can allow continuous or frequent monitoring of at least a portion of a mixture containing particles.
[0065] In some embodiments, the particles can be detected by flow cytometry. In flow cytometry, one or more beams of light, for example, each of a single wavelength, are directed to a hydrodynamically focused flow of fluid. The suspended particles that pass through the scattered beams of light, and fluorescent chemicals found in the particle or attached to the particle can be excited. The scattered and / or fluorescent light is captured by detectors within the device, from which information on particle size and fluorescence can be determined. Modern flow cytometers can analyze several thousand particles per second, in "real time" and can actively separate and isolate particles with specific properties.
[0066] In some embodiments, the particles can be detected using cytometric methods, devices and systems as disclosed in USA 2009/0079963, USA 2010/0179068 and WO 2009/1 12594.
[0067] In some embodiments, the particles can be detected using microfluidic methods, devices and systems. For example, particles can be detected using a lab-on-a-chip device or system, or the like. See, for example, U.S. Patent Application Publication No. 2009/0326903 and 2009/0297733.
[0068] In some embodiments, the particles can be detected using a device or system appropriate for the treatment point, field, or consumer use. For example, a device (for example, a lab-on-a-chip device) can include a recombinase, a polymerase, a single-stranded protein, ATP, dNTPs, and a primer or probe. In some embodiments, a device may be provided that contains a recombinase, a polymerase, a single-stranded binding protein, ATP, dNTPs, and a primer or probe, where one of the recombinase, the polymerase, the primer or probe , or recombinase senod bound covalently or non-covalently (for example, through the use of an affinity tag), to a surface. In some embodiments, the particles can be placed in multiple individual wells in a multi-well plate.
[0069] In any of the disclosed methods, when desired, the particles can be fixed before detection. For example, the particles can be fixed by treatment with an aldehyde (for example, formaldehyde, paraformaldehyde or glutaraldehyde) to cross-link proteins and nucleic acids present in the sample, effectively stop the progress of the mixture reactions and allow observation of the particles in the state, in which the reaction was stopped. By fixing the mixtures, the particles can be detected at a later point in time, potentially simplifying processing and detection. Oligonucleotides
[0070] Oligonucleotides as described herein can serve as amplification primers and / or detection probes. In some embodiments, oligonucleotides are provided as a set of two or more (for example, two, three, four or more) oligonucleotides, for example, for use in an amplification method (for example, as described herein).
[0071] Oligonucleotides can be synthesized according to standard phosphoramidate chemistry, or otherwise. Modified and / or chemical bases of ligand backbone may be desirable and functional and, in some cases, may be incorporated during synthesis. In addition, oligonucleotides can be modified with groups that serve various purposes, for example, fluorescent groups, suppressors, protection groups (reversible or not) (blocking), magnetic markers, proteins, etc.
[0072] In some embodiments, the oligonucleotide used herein may contain a contiguous sequence (for example, at least 10 base units) that is at least 90% identical (for example, at least 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98%, 99% or 100%) to a contiguous sequence present within a target nucleic acid. The percentage of identity or homology between two sequences can be determined using a mathematical algorithm. A non-limiting example of a mathematical algorithm used to compare two sequences is the algorithm by Karlin and Altschul (1990) Proc. Natl. Acad. Know. USA, 87: 2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Know. USA, 90: 5873-77. Such an algorithm is incorporated into the NBLAST program by Altschul, et al., (1990); J. Mol. Biol. 215: 403-410. To obtain Gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res, 25: 3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the NBLAST program can be used. See online at ncbi.nlm.nih.gov.
[0073] Oligonucleotides can include one or more detectable markers. The detectable marker can be a fluorophore, an enzyme, a suppressor, an enzyme inhibitor, a radioactive marker, a sensitive portion of redox (e.g., an electrochemically active portion), a member of a binding pair, and a combination thereof. In some embodiments, oligonucleotides can include both a fluorophore and a suppressor. The suppression agent can be close to the fluorophore to suppress the fluorescence of the fluorophore. For example, the separation between the fluorophore and the suppressor can be 0 to 2 bases, 0 to 5 bases, 0 to 8 bases, 0 to 10 bases, 3 to 5 bases, 6 to 8 bases, and 8 to 10 bases. The fluorophore and suppressor can be any fluorophore and suppressor known to work together, including, but not limited to, the fluorophore and suppressors of any of the fluorophores described in this disclosure. When the detectable marker is a fluorophore or a suppressor, it can be attached to the oligonucleotide by a fluorophore-dT amidite residue or a suppressor-dT amidite residue respectively. Other connections are possible and widely known.
[0074] In another aspect, either the fluorophore or the suppressor can be attached to a modified internal residue and the fluorophore and suppressor can be separated following cleavage of the nuclease-modified internal residue.
[0075] Although any fluorophore can work for the methods of the invention, fluorescein, FAM, TAMRA, and Texas red fluorophores are exemplary. Exemplary suppressors include a dark suppressor, which can be, for example, Dark Quencher 1, Dark Quencher 2, Black Hole Quencher 1 or Black Hole Quencher 2.
[0076] In some embodiments, oligonucleotides may include a modified internal residue. The modified internal residue can be any chemical structure (residue) that cannot form a Watson-Crick base-pairing structure with its corresponding base of a double-stranded nucleic acid structure. The term "internal modified residue" also includes at least any residue that is not normally found in DNA, which is any residue, which is not an "A", "L", "C" or "T", as such as uracil or inosine. In some embodiments, the modified internal residue is inosine, uracil, 8-oxoguanine, thymine glycol, or an abasic mimetic site. Preferred abasic mimetic site includes a residue of tetrahydrofuran or D-spacer (which can be produced as a product of using a 5'-O-dimethoxytrityl-1 ', 2'-Didesoxyribose-3' - [(2-cyanoethyl) - (N, N-diisopropyl)] - phosphoramidite, during oligonucleotide synthesis.
[0077] In some embodiments, oligonucleotides are blocked in extension. An extension blocked oligonucleotide is blocked at its 3 'end so that it cannot normally be stretched by polymerase and dNTP, even in the presence of a complementary model. Methods of blocking an oligonucleotide are well known and include, at least, the inclusion of a blocked 3 'nucleotide. The blocked 3 'nucleotide can contain, for example, a blocking group that prevents polymerase extension. Blocking groups are generally attached to the 3 'or 2' sites of the 3 'sugar residue, but other attachment sites are possible. One of the most common methods of 3 'blocking is to place a didesoxy sugar at the 3' end of an oligonucleotide. The blocking group can be, for example, a detectable marker.
[0078] In some embodiments, the oligonucleotides described herein can be modified by incorporating one or more detectable markers, modified residues (e.g., the modified internal residues), and blocking groups. When the oligonucleotide disclosed herein includes one or more detectable markers, modified residues (e.g., modified internal residues), and blocking groups, the oligonucleotide without such modifications or with additional modifications is also included in the description. In addition, an oligonucleotide, as described herein, which includes one or more detectable markers, modified residues (for example, modified internal residues), and blocking groups can have such a radical replaced by another detectable marker, modified residue (for example, example, modified internal residues), or blocking group, for example, a detectable marker, modified residue (for example, modified internal residue), or a blocking group, as disclosed herein. applications
[0079] The methods and compositions described herein can be used, for example, to detect the copy number of a target nucleic acid and to monitor the amplification of a sequence present in a target nucleic acid. In some embodiments of the present method, target nucleic acids can be detected in low copy numbers and in relatively crude samples. In some embodiments, the detected nucleic acid is a bacterial nucleic acid, for example, from a bacterium selected from Chlamydia trachomatis, Neisseria gonorrhea, Group A Streptococci, Group B Streptococci, Clostridium difficile, Escherichia coli, Mycobacterium tuberculosis , Helicobacter pylori, Gardnerella vaginalis, Mycoplasma hominis, Mobiluncus spp., Prevotella spp. and Porphyromonas spp, or from another bacterium described or known in the art. In some embodiments, the detected nucleic acid is a mammalian nucleic acid, for example, a nucleic acid that is associated with tumor cells. In some embodiments, the detected nucleic acid is a viral nucleic acid, for example, from HIV, influenza virus, or dengue virus, or another virus. In some embodiments, the detected nucleic acid is a nucleic acid from fungi, for example, from Candida albicans or another fungus. In some embodiments, the detected nucleic acid is a protozoan nucleic acid, for example, from Trichomonas or another protozoan. The methods and compositions described herein can be used in the diagnosis of a disease or condition associated with a detected nucleic acid, for example, a bacterial nucleic acid, mammalian nucleic acid, viral nucleic acid, fungal nucleic acid, or protozoan nucleic acid (for example, as disclosed here). For example, the methods and compositions provided herein can be used to diagnose a bacterial infection, a viral infection, a fungal infection or a parasitic infection. In some embodiments, the nucleic acid detected is a nucleic acid from: influenza A or a variant, influenza B or a variant, methicillin-resistant Staphlococcus aureus (MRSA), C. difficile, M. tuberculosis, species Chlamydia (for example, Chlamydia trachomatis), N. gonorrhoeae, Treponema pallidum, human papilloma virus (HPV) (for example, HPV types 16 and type 18), hepatitis virus (for example, hepatitis A, B, and C), or a circulating cancer cell. In some embodiments, the methods and compositions provided herein can be used to diagnose MRSA infection, C. difficile infection, tuberculosis, chlamydia infection, gonorrhea, syphilis, HPV infection, hepatitis virus infection, or infection by HPV. The methods and compositions described herein can be used in the quantification of nucleic acids. "Digitization" of nucleic acid amplification / detection reactions is a recent approach to allow accurate counting of mold molecules (see, for example, Vogelstein, 1999, Proc. Natl. Acad. Sci. USA, 96: 9236). Typically in these methods, the spatial separation of the reaction mixture into the required micro compartments (typically in the nanoliter range) is achieved by physically separating an amplification reaction, for example, by crushing it under pressure in suitable microfluidic cassettes or dispersing it in an emulsion proper. Without wishing to be limited by theory, if the particles described here are active amplification centers, then the presence of the particles constitutes an inherent compartmentalization of the reaction mixture that can be used in the quantification. For example, by counting the number of "active" RPA particles (for example, those associated with the generation of a fluorescent signal), one can measure or estimate the number of template nucleic acid molecules present in the reaction mixture.
[0080] The methods can also be used to detect the physical binding of two or more nucleic acids. In many molecular biology applications, detecting the physical link of two different genetic markers present in a given sample is important. For example, the mere presence of a bacterial species marker and an antibiotic resistance marker in a given sample does not provide information on whether the two markers are present on the same bacteria (for example, on the same nucleic acid), or whether the markers are present in different species of co-colonizing bacteria. Demonstrating that the two markers are linked to a single piece of genomic DNA associated with antibiotic resistance with a specific pathogen. The co-location of the two markers can provide vital diagnostic information in this scenario.
[0081] The methods and compositions described herein can be used to demonstrate that the locations or positions of two amplification events for two nucleic acids are overlapping, providing information on the physical binding of the nucleic acids. In contrast, demountable amplification events may indicate the presence of both nucleic acids, but in distinct segments of DNA (for example, in two co-colonizing species of bacteria). In some embodiments, the binding of the two nucleic acid sequences can be detected by looking at the active amplification products from both located to a single particle in a reaction mixture. In other embodiments, the binding of the two nucleic acid sequences on a single DNA segment can be detected by observing the "binding" of two particles, each amplifying one of the nucleic acids, by the DNA segment.
[0082] In some embodiments, the observation of the particles described here can be used in quality control methods. For example, a relationship between the appearance of particles (number, size, density) and RPA performance can be used to generate an analytical quality parameter to predict RPA reaction before amplification. This could be used for quality control purposes in general (for example, to determine what type / number of particles are present in a given reaction mixture), or to monitor the effect of changes in production procedures (for example, stabilization) or under storage conditions, etc.
[0083] In some embodiments, the methods and compositions described herein can be used to obtain the results of amplification reactions (for example, within minutes, at about 8, 7, 6, 5, 4, 3, 2, 1, 5, or 1 minute) from the start of the reaction. Typically, monitoring of amplification reactions by detecting the accumulation of fluorescence signal is carried out "en masse", that is, the signals generated by the individual mold molecules are integrated throughout the determined reaction volume, producing a fluorescence response detectable in 5-8 minutes. In contrast, looking at the fluorescence signal generated in RPA particles can also, in principle, be used to shorten the time to result in a reaction. This result is due, at least in part, to the higher detection sensitivity under high magnification at defined loci (eg, particles).
[0084] The fluorescence signal strength of standard RPA reactions, typically performed and controlled "in bulk", gains from mixing steps performed during the incubation period, especially if very small amounts of the mold starting material are used. Observing amplification reactions directly to particles can reduce any variation introduced by mixing. EXAMPLES Example 1. Particles in Recombinase Polymerase amplification mixes
[0085] This example describes the observation of particles containing oligonucleotides within RPA mixtures. Frozen dry mixtures of RPA reaction components, including FAM labeled oligonucleotides, were obtained by preparing a mixture containing 2.96 μg Creatinokinase, 13.1 μg Rb69 gp32, 18.1 μg T6 H66S UvsX, 5.15 μg de Rb69 UvsY, 5.38 μg of Exonuclease ΙΠ and 5.0 μg of DNA Polymerase (large fragment of S. aureus polymerase I) in 80 μL of 9.38 mM Tris Acetate, pH 8.3, 3.13 mM DTT, 2.5% PEG, 3.75% trehalose, 31.3 mM phosphocreatine, 1.56 mM ATP, 750 μM dNTPmix (188 μM each of dATP, dTTP, dCTP and dGTP), Spyl258F2 388 nM (CACAGACACACTGCACAAGTCCTCAATCAACCT, SEQ ID NO: 1), Spyl258R2 363 nm (CAGAAATCCTTGATGAGTTGCGGAAATTTGAGGT, SEQ ID NO: 2) and Spyl258exoPl 75 nM (CCTTGTCCTACCTTATAGAACATAGAGAATQTHFAACCGCACTCGTT-H, d = FAM; '= c3spacer block; SEQ ID NO: 3) and lyophilized the mixture in 0.2 ml tubes. The dry reagents were resuspended in 46.5 μL of rehydration buffer (48 mM Tris acetate, 133.8 mM KOAc, 2% PEG) + 3.5 μL of water and stirred. These mixtures did not contain template nucleic acid or magnesium. Ten microliters of the mixture were transferred to a microscope slide and photographed using differential interference contrast (DIG) and fluorescence microscopy at 40x magnification (Fig. 1A-1C). Particles of about 1-10 microns in size were observed using DIC (Fig. IA), or fluorescence (Figure 1B), and when the two images were merged (Fig. 1C). Approximately 100-500 particles / nL were observed (field of view at 40x magnification was equivalent to 1.55 nL of the mixture).
[0086] In a separate experiment, the mixtures were prepared as above, but replacing 2.5 ml of water and 1 μL of a pyogenes Streptococci genomic DNA preparation (100 copies / pL) with 3.5 μL of water. The mixture was vortexed and mirrored as above (Fig. 2A-2C). Similar particles, as above, were observed using DIG (Fig. 2A) or fluorescence (Fig. 2B) and when the two images were merged (Fig. 2C).
[0087] This example demonstrates that the particles are formed in RPA mixtures, and that the particles are not dependent on the inclusion of mold or magnesium. Example 2. Agglomeration Agents from Stimulation to Particle Formation
[0088] To determine the effects of agglomerating agents on particle formation, fresh RPA mixtures were prepared containing 2.96, μg of creatine kinase, 13.1 μg of Rb69 gp32, 18.8 μg of T6 H66S UvsX, 2.5 μg of Rb69 UvsY, 5.38 μg of Exonuclease III and 5.0 μg of DNA Polymerase in 50 mM Tris acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 1.2 mM dNTP mixture, (300 μM each dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM MgAc, 30 nM HIV p2LFtexas (oligo AOAATTACAAAAACAAAT TACAAAAAT TCA5AATTTTCGGGTTTTTGGGTTT 'red marked, Texas red, 5 = dSpacer; SEQ ID NO: 4), Spyl258F2420 nM (CACAGACACTCGACAAGTCCTCAATCAAACCTTG: SEQ ID NO: 5) and Spyl258R2 390 nm (CAGAAATCCTTGATGAGTTGCGGAAATTTGAGGT: SEQ. IDQ: SEQ. PEG was included in each mixture at 0%, 2%, 2.5%, 3%, 3.5%, 4%, 5.5%, or 8%. The mixtures were mixed with a pipette and 10 μL of each were transferred to a microscope slide. The images were obtained using a differential interference contrast (DIG) and fluorescence microscopy and 40x magnification. The number of particles observed increased with an increase in the concentration of PEG up to 5.5% (Figures 3A-3G). Fewer particles were observed and 8% PEG (Fig. 3H).
[0089] This example demonstrates that PEG can improve particle formation in RPA mixtures. Example 3. Contribution of the components of the mixture to the formation of particles
[0090] To determine the contribution of the components of the mixture to the formation of RPA particles, the mixtures were prepared as in Example 2 with 5.5% PEG, except that the individual components were excluded in each reaction. The mixtures were photographed as above using DIG and fluorescence microscopy. When all components were present, particles formed in the mixture as described above (Figures 4A-4B). The particles formed in the absence of UvsX appeared different in size from those formed in the presence of UvsX and were not easily observed by DIG (FIG. 4C-4D). Particles formed in the absence of gp32 appeared different in shape and size than those formed in the presence of gp32 (Fig. 4E-4F). Structures formed in the absence of other RPA components (UvsY, DNA polymerase, creatine kinase, or exonuclease III) appeared similar to those formed in a complete RPA reaction (Fig. 5A-5H). The absence of UcsY appeared to cause a slight reduction in the number of particles and an increase in particle size (Fig. 5A-5B).
[0091] Additional mixtures were prepared to exclude the two or three components of the reaction. A control RPA mixture was prepared containing 2.96 μg of creatine kinase, 13.1 μg of Rb69 gp32, 18.8 μg of T6 H66S UvsX, 5.15 μg of UvsY, 8.26 μg of Exonuclease III and 5.0 μg DNA polymerase in 50 mM Tris acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 0.2 mM of a mixture of dNTP (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 14 mM MgAc, 5.5% PEG, 120 nM M2intFAM (probe labeled with FAM 5'-tectcatatccattctgTcgaatatcatcaaaagc-3 ', T = carboxyfluorescein-dT; SEQ ID NO: 19), 420 nM each SpaF3 (CGCTTTGTTGATCTTTGTTGAAGTTATTTTGTTGC: SEQ ID NO: 7) and SpaRlO + 1 (TTAAAGATGATCCAAGCCAAAGTCCTAACGTTTTA; SEQ ID NO: 8). Parallel mixtures were prepared which lacked (i) gp32 and UvsY, (ii) UvsX and UvsY, (iii) UvsX and gp32, (iv) UvsX, UvsY, and gp32, or (iv) gp32, UvsY and Emix (phosfocreatine and ATP). No particles were observed in the mixtures lacking UvsX and at least one other component. In the mixtures that lack UvsY and gp32, large and irregular fluorescent organisms were observed (Fig. 6A-6C).
[0092] This example demonstrates that the exclusion of UvsX or gp32 has the greatest effect on particle morphology, followed by an effect of exclusion of UvsY, with no significant effect on the observed exclusion of DNA polymerase, creatine kinase, or exonuclease III. Exclusion of two or more components had an increased effect. Example 4. Separate populations of particles that remain distinct when mixed
[0093] Two lyophilized mixtures were prepared as described in Example 1, except that each mix included different oligonucleotides and 18.8 µg of UvsX. Mix 1 reagent contained SpaF3 296 nM (SEQ ID NO: 7), SpaR10 + 1 298 nM (SEQ ID NO: 8) and SpaProbel 149 nM (CATCAGCTTTTGGAGCTTGAG AGTCAT9 A8G6TTTTGAGCTTCAC, 3 'biotin, 6 = BHQ-2 dac, 8 = BHQ-2 dac, 8 = , 9 = TMR dT; SEQ ID NO: 9). Reagent mixture 2 contained MecF9-8 + 2,299 nM (CCCTCAAACAGGTGAA TTATTAGCACTTGT; SEQ ID NO: 10), MecRla 300 nM (CTTGTTGAGCAGAGGTTCTTTTTTATCTTC; SEQ ID NO: 11) and MecProbel 150 nM (ATGATGATGATGATGATT , H = THF (abasic mimetic site), F = FAM-dT; SEQ ID NO: 12). Equal volumes of the two reagent mixtures were combined, and 80 μL was distributed into 0.2 ml tubes and lyophilized. The dry mixtures were resuspended in 46.5 μL of rehydration buffer (see Example I), 1 μL of water, and 2.5 μL of 80 mM MgAc 2. The mixture was vortexed and 10 μL was transferred to a microscope slide to obtain an image using DIC and fluorescence. The observed particles containing both red (TMR) and green (FAM) fluorescence indicated that both labeled oligonucleotides are present in the particles (Fig. 7A-7F).
[0094] In another experiment, two separate lyophilized mixtures were prepared as described above, including only the TMR probe labeled with Spa RPA (Reagent Mix 1, above), and the other, including only the RPA FAM probe labeled with MECA (Reagent Mixture 2, above) ). After reconstitution, the two reconstituted mixtures were combined and photographed using DIC and fluorescence. Distinct particles that contained predominantly one fluorophore or the other were observed in the mixture (Figures 8A-8F). This indicates that the particles including each probe may remain distinct from each other after mixing.
[0095] To determine the stability of mixed particle populations over time, two free lyophilized reactions of primer were reconstituted in rehydration buffer with MgAc and oligonucleotides as below. A mixture included HIV p2LFtexas 30 nM (Texas red marker), Spyl258F2 420 nM (SEQ ID NO: 1, unmarked), and Spyl258R2 390 nm (SEQ ID NO: 2, unmarked). The other mixture included M2intFAM 50 nM oligo (SEQ ID NO: 19, FAM marked), Spyl258F2 420 nM (SEQ ID NO: 1, unmarked), and Spyl258R2 390 nM (SEQ ID NO: 2, unmarked). Five microliters of each mixture were pipetted on a microscope slide and mixed, and the combination was photographed at 2, 7 and 13 minutes (Figure 9). Images of the mixture after the 12 minute period are shown in FIG. 9. After 13 minutes, particles including predominantly Texas Red or FAM fluorescence were observable.
[0096] This example demonstrates that the particles remain relatively stable in solution and can be labeled independently. This observation can be useful in controlling two or more RPA reactions simultaneously, occurring in different subsets of particles. Example 5. RPA reactions are observed localized for particles
[0097] Dry frozen mixtures of RPA reaction components, including a FAM-labeled oligonucleotide probe, as in Example 1, were reconstituted with 46.5 μL of rehydration buffer and an amplification reaction was started by adding 1 μL of 50,000 copies / uL of S. pyogenes genomic DNA and 2.5 μL of 280 mM MgAc. The reaction was mixed by pipetting and transferred to a microscope slide to obtain the image by DIG and fluorescence from about 2 minutes, 40 seconds after the start and then at 8, 12, 14, 15, 16 , 18, 20, and 22 minutes (Fig. 10.). An increase in fluorescence (indicating amplification) was observed, which was at least initially located in individual particles.
[0098] In another experiment, freeze-dried mixtures of reaction component initiator (prepared by mixing a 50 μg volume of 2.96 μg creatine kinase, 9.88 μg Rb69 gp32, 18.8 μg T6 H66S UvsX, 5.38 μg UvsY, 5.38 μg Exomyclease III and 5.34 μg DNA Polymerase in 25 mM Tris Acetate, pH 8.3, 5 mM DTT, 2.28% PEG, 25 mM Tris Acetate, pH 8.3, 5 mM DTT , PEG 2.28%, trehalose 5.7%, phosphocreatine 50 mM, ATP 2.5 mM, dNTPmix 1,200 μΜ (300 μΜ each of dATP, dTTP, dCTP and DGTP and freeze drying in 0, 2 mL) were reconstituted with 29.5 μL of initiator-free rehydration buffer (41.7 mM Tris acetate, 67.5 mM potassium acetate, 5.4% PEG, pH 8.3), 3.5 μL of Spa F36 μΜ (SEQ ID NO: 7), 3.5 μL of SpaR10 + 1 6 μΜ (SEQ ID NO: 8), 1 μL of Spa Probe 1 TMR-labeled 6 μΜ (SEQ ID NO: 9), 1 μL M2intFAM 0.6 μΜ oligo (SEQ ID NO: 19, used as a fluorescent marker for particles that are not involved in the RPA reaction), and 8 μL of water. addition of 1 μL of 50,000 copies / μL of genomic DNA purified Group A Streptococci template and 2.5 μL of 280 mM MgAc and mixing with a pipette. Ten microliters of the mixture were transferred to a microscope slide, and imaging was started approximately 3 minutes after the start of the reaction. A time course of the reaction mixture at 3, 8, 15, 18, 22, and 26 minutes (Fig. 11) showed an increase in red fluorescence (indicating amplification), which was, at least initially located in individual particles.
[0099] This example demonstrates that nucleic acid amplification products can be observed co-located with particles. Example 6. Effects of UvsX Variants
[0100] To investigate the effects of different UvsX variants, mixtures were created at room temperature containing 2.96 mg creatinokinase, 13.1 mg Rh69 gp32, 8.26 μg Exonuclease III, 5.0 mg Polymerase in Tris acetate 50 mM, pH 8.3, 100 mM KOAc, 5 mM DTT, 1.2 mM dNTP mix (300 μΜ, each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose , 14 mM MgAc, 5.5% PEG, 120 nM M2intFAM (SEQ ID NO: 19), each SpaF3 and SpaRlO + 1 420 nm (50 μL final volume). Four different mixtures were prepared, containing either 18.8 mg of T6H66S UvsX or 17.6 mg of T6 UvsX, and with or without 5.15 μg of Rb69 UvsY. Ten microliters of each mixture were transferred to a microscope slide and photographed at 20x magnification about 5-20 minutes after setup (Figures 12A-12D) and also at 40x magnification about 50-60 minutes after installation (Fig 13A-13D). In general, more particles were observed in the T6H66S UvsX mixture than with T6 UvsX. In addition, T6H66S UvsX particles were often different in shape from those with T6 UvsX, including more shapes like a comet, while T6 UvsX particles were more spherical. The mixtures T6H66S UvsX missing UvsY had more diffuse particles and diffuse "halos" or "Donuts" that had no signal in the middle. With T6 UvsX the opposite effect was often observed. Without UvsY, the particles were small shiny spheres, but with UvsY they were less shiny and more greasy and small.
[0101] The effect of UvsY on the kinetics of the RPA reaction using T6H66S UvsX and T6 UvsX was investigated. The reactions were prepared as above, with T6H66S UvsX or T6 UvsX, and with or without Rb69 UvsY. Three separate experiments were carried out using different sets of primers and molds. In the first experiment, the initiators were FluAPAFNA507 420 nM (AACCTOGGACCTTTGATCTTGGGOGGCTATATG; SEQ ID NO: 13) and FluAPARNAl06 (ATGTGTTAGGAAGGAGTTGAACCAAGAAGCATT; SEQ ID NO: 14), with probe FluCTGAGGG THF (abasic mimetic site), Q = BHQ-1-dT, 3 '= c3spacer blocker; SEQ ID NO: 15). Quinches or 50 copies of influenza A RNA template were used in each reaction. RPA reactions were assembled containing 2.96 μg of Creatinokinase, 13.1 μg of Rb69 gp32, 18.8 μg of T6H66S UvsX or 17.6 μg of T6 UvsX, 8.26 μg of Exonuclease III, 5.0 μg of Polymerase , 1.79 μg of Reverse Transcriptase, 5.15 μg of UvsY (when present) in 50 mM Tris Acetate, pH 8.3, 100 mM KOAc, 5 mM DTT, 0.2 units / uL of Ribolock ™ RNAse Inhibitor ( Ferments), 1.2 mM dTP mix (300 μM each of dATP, dTTP, dCTP and dGTP), 50 mM phosphocreatine, 2.5 mM ATP, 6% trehalose, 5.5% PEG. The above components were mounted in a volume of 46.5 μL in a 0.2 mL tube, and reactions were initiated by adding 2.5 μL of 2.80 mM MgOAc and 1 μL of 500 or 50 copies / pL of influenza A RNA template. Reactions were vortexed, centrifuged quickly and transferred to a Twista instrument (ESE) and fluorescence monitored every 20 seconds for 20 minutes at 40 ° C with a mixing step (vortex type and fast centrifugation) at 5 minutes. Inclusion of UvsY with T6H66S UvsX leads to a delay in amplification relative to the reaction without UvsY, and the opposite was seen for T6 UvsX (Fig. 14A-14B). When only 50 copies of the mold were present, reactions without UvsY generated less overall signal (Fig. 14A-14B). A similar effect on kinetic reactions was observed in a second experiment using SpaF3 and SpaRlO 420 nM as primers, with SpaProbel.2 120 nM and 1000 copies of purified group A strep genomic template DNA (FIG. 15).
[0102] In the second experiment, the primers used were FluBNSF1007 (CATCGGATCCTCAACTCACTCTTCGAGCGT; SEQ ID NO: 16) and FluBNSR705 420 nm (GACCAAATTGGGATAAGACTCCCACCGCAGTTTC; SEQ ID NO: 17), with 120 nMC of CATTCTGGTGTGACTGTGTG; THF (basic mimetic site), Q = BHQ-1-dT, 3 '= c3spacer block; SEQ ID NO: 18). Five hundred copies of influenza B PCR amplified template DNA were used in each reaction. In these reactions, no amplification was observed with T6H66S UvsX without UvsY (FIG. 16A-16B). The opposite effect was observed with T6 UvsX (Figures 16A-16B).
[0103] This example demonstrates that different UvsX variants may have different requirements for UvsY with respect to particle morphology and amplification reaction kinetics. Additionally, the particle's morphology appears to be correlated with the kinetics and / or progress of the amplification reaction. Example 7. Quantification of nucleic acids
[0104] The methods described herein can be used for the quantification of nucleic acids. In one experiment, dilutions of a template nucleic acid are combined with an RPA reaction mixture as described in Example 5. The number of particles in a specified reaction volume that are associated with nucleic acid amplification sites is determined at each dilution . Within a range, the number of particles associated with nucleic acid amplification sites varies according to the concentration of template nucleic acid in the reaction. For example, the number of particles associated with nucleic acid amplification can be proportional to the concentration of template nucleic acid, or the number of particles associated with nucleic acid amplification can be equivalent to the number of template nucleic acid molecules, in the same volume. Using this information about the correlation between the number of active particles and template nucleic acid concentration, the template nucleic acid concentration in an experimental sample can be determined. OTHER WAYS OF ACCOMPLISHMENT
[0105] A number of embodiments of the invention have been described. However, it will be understood that various modifications can be made without departing from the spirit and scope of the invention. Thus, other embodiments are within the scope of the following claims.

权利要求:
Claims (13)
[0001]
Process for monitoring mixtures of recombinase polymerase amplification characterized by the fact that it comprises: (a) providing an amplification reaction mixture with recombinase polymerase comprising a binding agent; (b) maintaining the reaction mixture under conditions that allow the production of nucleic acid amplification products in the reaction mixture, the conditions are such that microscopic structures with the appearance of particles are formed in the reaction mixture, associated with amplification loci active; (c) detecting particles associated with the nucleic acid amplification products in the reaction mixture, by observing particles and determining a number or proportion of particles co-located with the nucleic acid products in the reaction mixture.
[0002]
Process according to claim 1, characterized in that the reaction mixture comprises a recombinase, a single-stranded binding protein, and one or more oligonucleotides.
[0003]
Process according to claim 1 or 2, characterized by the fact that the binding agent is present in the mixture in a concentration between 1 and 12% by weight or by volume of the mixture.
[0004]
Process according to claim 2 or 3, characterized by the fact that the agglomeration agent is i) polyethylene glycol, or ii) comprises polyethylene glycol optionally PEG 1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with molecular weight between 15,000 and 20,000 daltons, and combinations thereof.
[0005]
Process according to any one of claims 2 to 4, characterized by the fact that (i) the recombinase includes a RecA or Uvsx recombinase; (ii) the single-stranded DNA-binding protein includes a prokaryotic SSB protein or a gp32 protein; (iii) the single-stranded binding protein is E. coli SSB or single-stranded DNA binding protein derived from Myoviridae phages, such as T4, T2, T6, Rb69, Aehl, KVP40, Acinetobacter phage 133, Aeromonas phage 65, cyanophage P-SSM2, cyanophage PSSM4, cyanophagus S-PM2, Rb14, Rb32, Aeromonas phage 25, phage of Vibrio nt-1, phi-1, Rb16, Rb43, phage 31, phage 44RR2.8t, Rb49, phage Rb3 and phage LZ2; (iv) at least one of the one or more oligonucleotides includes a detectable marker; and / or (v) the reaction mixture includes one or more of: a DNA polymerase, a recombinase loading protein, ATP, dNTPs or a mixture of dNTPs and ddNTPs, a reducing agent, creatine kinase, a nuclease, an acid initiator nucleic acid, a probe nucleic acid, reverse transcriptase and a model nucleic acid (in any combination).
[0006]
Process according to any one of claims 1 to 5, characterized by the fact that: (i) the detection is carried out within 10 minutes after the start of maintenance; (ii) the detection comprises the detection of single particles associated with two or more distinct nucleic acid amplification products; (iii) the particles are detected using particle fluorescence or without using particle fluorescence; (iv) the detection of particles in the mixture includes the use of one or more of the microscopies, a microfluidic device, flow cytometry and a camera; and / or (v) the particles comprise a first subset of particles and a second subset of particles, the first subset of particles is detected using fluorescence from the first subset of particles and the second subset of particles are detected without the use of fluorescence from the second subset of particles .
[0007]
Process according to any one of claims 1 to 6, characterized by the fact that: (i) the particles are between 0.5-20 pm in size; and / or (ii) the particles include one or more (e.g., two or more, or all) of a recombinase, a single-stranded protein and at least one of the one or more nucleic acids (in any combination).
[0008]
Process, characterized by the fact that it comprises: (a) providing a mixture comprising a recombinase, a single-stranded DNA binding protein, a binding agent and one or more oligonucleotides as defined in claim 1; and (b) detecting microscopic structures with the appearance of particles formed in the mixture, observing particles and determining a number or proportion of particles co-located with nucleic acid amplification products.
[0009]
Process, according to claim 8, characterized by the fact that: (i) the binding agent comprises polyethylene glycol (for example, selected from the group consisting of PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG15000, PEG20000, PEG250000, PEG30000, PEG35000, PEG40000, PEG compound with a molecular weight of 15,000 and 20,000 daltons, and combinations thereof), polyvinyl alcohol, dextran and / or ficol; and / or (ii) the agglomerating agent is present in the mixture at a concentration between 1 to 12% by weight or by volume of the mixture.
[0010]
Process according to claim 8 or 9, characterized by the fact that: (i) the recombinase comprises a RecA or UvsX protein; (ii) the single-stranded DNA-binding protein comprises a prokaryotic SSB protein or a gp32 protein; and / or (iii) at least one of the one or more oligonucleotides comprises a detectable marker.
[0011]
Process according to any one of claims 8 to 10, characterized in that the particles: (i) comprise one or more recombinases, the single-stranded binding protein and at least one of the one or more oligonucleotides; and / or (ii) are between 0.5-20 pm or 1-10 pm in size.
[0012]
Process according to any one of claims 8 to 11, characterized in that the mixture further comprises one or more of: a DNA polymerase, a recombinase loading protein, dNTPs or a mixture of dNTPs and ddNTPs, an agent reducer, creatine kinase, a nuclease, a nucleic acid probe, a reverse transcriptase and a standard nucleic acid.
[0013]
Process according to any of claims 8 to 12, characterized by the fact that: (i) the detection of particles in the mixture comprises the use of microscopy, a microfluidic device or flow cytometry; and / or ii) the particles: (a) are detected using particle fluorescence; or (b) are detected without the use of particle fluorescence; or (c) comprise a first subset of particles and a second subset of particles, the first subset of particles is detected using fluorescence from the first subset of particles and the second subset of particles is detected without using fluorescence from the second subset of particles.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013025758B1|2021-04-06|MONITORING OF RECOMBINASE POLYMERASE AMPLIFICATION MIXTURES

---

ES2824700T3|2021-05-13|High-throughput single-cell analysis combining proteomic and genomic information

---

CN110964796A|2020-04-07|Massively parallel single cell analysis

---

WO2015048173A2|2015-04-02|Encapsulated sensors and sensing systems for bioassays and diagnostics and methods for making and using them

---

CN107735497A|2018-02-23|Measure and its application for Single Molecule Detection

---

BR112017000167B1|2021-08-24|MICROFLUID DEVICE, MICROFLUID DEVICE LOADING METHOD, METHOD FOR ANTIBIOTIC SENSITIVITY TESTING, METHOD FOR IN SITU CELL GENOTIPATION AND METHOD FOR CHARACTERIZATION OF CELL PHENOTYPE

---

Tanner et al.2010|Visualizing DNA replication at the single-molecule level

---

US20090221095A1|2009-09-03|Colorimetric Screening of DNA Binding/Intercalating Agents with Gold Nanoparticle Probes

---

US20170136433A1|2017-05-18|Loading nucleic acids onto substrates

---

CN106574925A|2017-04-19|Substrate-mediated reactors for bioassays

---

CN109477095A|2019-03-15|Array and its application for Single Molecule Detection

---

DE102012008375A1|2012-10-31|Methods and components for the detection of nucleic acid chains

---

Ma et al.2018|Developing novel methods to image and visualize 3D genomes

---

KR102129506B1|2020-07-06|Probes for improved melt discrimination and multiplexing in nucleic acid assays

---

JP2017532030A|2017-11-02|Diagnostic method and composition

---

EP2494073B1|2017-11-29|Nucleotide conjugates and methods of uses thereof

---

US20200061617A1|2020-02-27|Devices and methods for nucleic acid identification

---

NZ615861B2|2016-03-30|Monitoring recombinase polymerase amplification mixtures

---

WO2021242804A1|2021-12-02|Apparatus and method for fast digital detection

---

WO2022051296A1|2022-03-10|Methods and systems for reducing particle aggregation

---

Rombouts et al.2016|Advanced microscopy methods for detecting plasmid DNA degradation in a biological environment

---

Lee2013|Fluorescence imaging of single molecule dynamics on long single stranded DNA

同族专利:

---

公开号 | 公开日

---

US20120258456A1|2012-10-11|

---

JP2016119912A|2016-07-07|

---

AU2012239989A1|2013-10-17|

---

EP2694666B1|2018-05-23|

---

BR112013025758A2|2016-08-16|

---

NZ615861A|2015-12-24|

---

EP2694666A1|2014-02-12|

---

JP6209638B2|2017-10-04|

---

US8809021B2|2014-08-19|

---

CN105907846A|2016-08-31|

---

US9157127B2|2015-10-13|

---

EP3202918B1|2021-10-20|

---

US20160068898A1|2016-03-10|

---

ZA201307184B|2014-12-23|

---

EP2694666A4|2014-12-24|

---

CA2831140A1|2012-10-11|

---

CA2831140C|2017-11-07|

---

AU2012239989B2|2016-03-10|

---

US20150024397A1|2015-01-22|

---

WO2012138989A1|2012-10-11|

---

US9719132B2|2017-08-01|

---

CN103476940A|2013-12-25|

---

JP5961247B2|2016-08-02|

---

JP2014516512A|2014-07-17|

---

CN103476940B|2016-07-13|

---

EP3202918A1|2017-08-09|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US4965188A|1986-08-22|1990-10-23|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme|

---

US5858652A|1988-08-30|1999-01-12|Abbott Laboratories|Detection and amplification of target nucleic acid sequences|

---

GB8903627D0|1989-02-17|1989-04-05|Unilever Plc|Assays|

---

EP0439182B1|1990-01-26|1996-04-24|Abbott Laboratories|Improved method of amplifying target nucleic acids applicable to both polymerase and ligase chain reactions|

---

EP0612352B1|1990-05-07|1997-05-28|Daikin Industries, Ltd.|Diagnostic applications of double d-loop formation|

---

US5223414A|1990-05-07|1993-06-29|Sri International|Process for nucleic acid hybridization and amplification|

---

US5273881A|1990-05-07|1993-12-28|Daikin Industries, Ltd.|Diagnostic applications of double D-loop formation|

---

ES2128323T3|1990-07-24|1999-05-16|Hoffmann La Roche|REDUCTION OF NON-SPECIFIC AMPLIFICATION DURING IN VITRO AMPLIFICATION OF NUCLEIC ACID USING MODIFIED NUCLEIC ACID BASES.|

---

CA2077135A1|1991-08-30|1993-03-01|Joh-E Ikeda|A method of dna amplification|

---

US5326692B1|1992-05-13|1996-04-30|Molecular Probes Inc|Fluorescent microparticles with controllable enhanced stokes shift|

---

CA2122203C|1993-05-11|2001-12-18|Melinda S. Fraiser|Decontamination of nucleic acid amplification reactions|

---

FR2708288B1|1993-07-26|1995-09-01|Bio Merieux|Method for amplification of nucleic acids by transcription using displacement, reagents and necessary for the implementation of this method.|

---

US6117679A|1994-02-17|2000-09-12|Maxygen, Inc.|Methods for generating polynucleotides having desired characteristics by iterative selection and recombination|

---

US5705366A|1994-09-15|1998-01-06|Johnson & Johnson Clinical Diagnostics, Inc.|Coamplification of target nucleic acids using volume exclusion agent in reaction composition, test kit and test device useful therefor|

---

US5656430A|1995-06-07|1997-08-12|Trevigen, Inc.|Oscillating signal amplifier for nucleic acid detection|

---

US5853990A|1996-07-26|1998-12-29|Edward E. Winger|Real time homogeneous nucleotide assay|

---

US6335164B1|1996-08-29|2002-01-01|Daikin Industries, Ltd.|Methods for targeting, enriching, detecting and/or isolating target nucleic acid sequence using RecA-like recombinase|

---

JP3065035B2|1998-10-01|2000-07-12|ダイキン工業株式会社|Method for preparing high-performance RecA-like recombinant enzyme / single-stranded nucleic acid probe complex and use thereof|

---

US6087112A|1998-12-30|2000-07-11|Oligos Etc. Inc.|Arrays with modified oligonucleotide and polynucleotide compositions|

---

EP1149175A2|1999-01-11|2001-10-31|President And Fellows Of Harvard College|Isothermal amplification of dna|

---

US6699693B1|1999-02-04|2004-03-02|Sloan-Kettering Institute For Cancer Research|Process for DNA replication|

---

US6387621B1|1999-04-27|2002-05-14|University Of Utah Research Foundation|Automated analysis of real-time nucleic acid amplification|

---

NO314091B1|2000-01-12|2003-01-27|Biotec Pharmacon Asa|Heat-labile uracil DNA glycosylase, DNA sequence encoding the enzyme, microorganism containing the DNA sequence, and use of the enzyme|

---

WO2001070947A2|2000-03-20|2001-09-27|Maxygen, Inc.|Method for generating recombinant dna molecules in complex mixtures|

---

US20020061530A1|2000-07-31|2002-05-23|Belotserkovskii Boris P.|Enhanced targeting of DNA sequences by recombinase protein and single-stranded homologous DNA probes using DNA analog activation|

---

US6379899B1|2001-03-13|2002-04-30|Discoverx|Isothermal exponential RNA amplification in complex mixtures|

---

WO2003027640A2|2001-09-28|2003-04-03|University Of Delaware|Polymorphism detection and separation|

---

US20040137456A1|2002-04-04|2004-07-15|Hiroki Yokota|Method for identifying and characterizing individual dna molecules|

---

CA2444649C|2001-04-20|2012-10-02|The Penn State Research Foundation|Methods for nucleic acid manipulation|

---

WO2003016569A1|2001-08-20|2003-02-27|Takara Bio Inc.|Nucleic acid amplification methods|

---

US7244562B2|2001-11-01|2007-07-17|Gene Check, Inc.|RecA assisted detection of mutations, single nucleotide polymorphisms and specific sequences|

---

DE60322044D1|2002-02-21|2008-08-21|Asm Scient Inc|Recombinase Polymerase Amplification|

---

EP1759012B1|2004-06-01|2013-05-22|Alere San Diego, Inc.|Recombinase polymerase amplification|

---

US7399590B2|2002-02-21|2008-07-15|Asm Scientific, Inc.|Recombinase polymerase amplification|

---

US8030000B2|2002-02-21|2011-10-04|Alere San Diego, Inc.|Recombinase polymerase amplification|

---

US20030228611A1|2002-05-01|2003-12-11|President And Fellows Of Harvard College|Nucleic acid memory device|

---

WO2004007078A1|2002-07-12|2004-01-22|British Biocell International Limited|Lateral flow assay device and method|

---

EP1543154A4|2002-08-21|2006-08-16|Epoch Biosciences Inc|Abasic site endonuclease assay|

---

WO2004027025A2|2002-09-20|2004-04-01|New England Biolabs, Inc.|Helicase dependent amplification of nucleic acids|

---

CA2518452A1|2003-03-11|2004-09-23|Gene Check, Inc.|Reca-assisted allele specific oligonucleotide extension method for detecting mutations, snps and specific sequences|

---

US7582729B2|2003-05-15|2009-09-01|The Rockefeller University|Nucleic acids and polypeptides of C1 bacteriophage and uses thereof|

---

US7745125B2|2004-06-28|2010-06-29|Roche Molecular Systems, Inc.|2′-terminator related pyrophosphorolysis activated polymerization|

---

JP2005110621A|2003-10-10|2005-04-28|Aisin Seiki Co Ltd|Method for amplifying nucleic acid and reagent kit for amplifying nucleic acid|

---

CA2497324A1|2004-02-17|2005-08-17|Affymetrix, Inc.|Methods for fragmenting and labelling dna|

---

CN1942761A|2004-04-21|2007-04-04|东丽株式会社|Substrate for labo-on-a-chip|

---

EP1825000A4|2004-11-23|2009-05-13|Xiao Bing Wang|Detection of nucleic acid variation by cleavage-amplification method|

---

AU2006339057B2|2005-07-25|2011-09-22|Abbott Diagnostics Scarborough, Inc.|Methods for multiplexing recombinase polymerase amplification|

---

DE102005052752A1|2005-11-04|2007-05-10|Clondiag Chip Technologies Gmbh|Apparatus and method for detecting molecular interactions|

---

CA2650993C|2006-05-04|2015-06-16|Asm Scientific, Inc.|Recombinase polymerase amplification|

---

US8633013B2|2007-05-03|2014-01-21|Clondiag Gmbh|Assays|

---

US8560130B2|2007-12-04|2013-10-15|Lester F. Ludwig|Software controlled lab-on-a-chip emulation|

---

US20090215050A1|2008-02-22|2009-08-27|Robert Delmar Jenison|Systems and methods for point-of-care amplification and detection of polynucleotides|

---

EP3636341B1|2008-03-14|2021-12-08|Abbott Rapid Diagnostics Jena GmbH|Assays and devices|

---

EP3360974A1|2009-06-05|2018-08-15|Alere San Diego, Inc.|Recombinase polymerase amplification reagents|US7399590B2|2002-02-21|2008-07-15|Asm Scientific, Inc.|Recombinase polymerase amplification|

---

US8030000B2|2002-02-21|2011-10-04|Alere San Diego, Inc.|Recombinase polymerase amplification|

---

CA2650993C|2006-05-04|2015-06-16|Asm Scientific, Inc.|Recombinase polymerase amplification|

---

US9399217B2|2010-10-04|2016-07-26|Genapsys, Inc.|Chamber free nanoreactor system|

---

US9926596B2|2011-05-27|2018-03-27|Genapsys, Inc.|Systems and methods for genetic and biological analysis|

---

SG189839A1|2010-10-04|2013-06-28|Genapsys Inc|Systems and methods for automated reusable parallel biological reactions|

---

US9184099B2|2010-10-04|2015-11-10|The Board Of Trustees Of The Leland Stanford Junior University|Biosensor devices, systems and methods therefor|

---

US9309566B2|2010-12-17|2016-04-12|Life Technologies Corporation|Methods, compositions, systems, apparatuses and kits for nucleic acid amplification|

---

CN103370425B|2010-12-17|2019-03-19|生命技术公司|For the method for nucleic acid amplification, composition, system, instrument and kit|

---

US9334531B2|2010-12-17|2016-05-10|Life Technologies Corporation|Nucleic acid amplification|

---

US9309557B2|2010-12-17|2016-04-12|Life Technologies Corporation|Nucleic acid amplification|

---

US8585973B2|2011-05-27|2013-11-19|The Board Of Trustees Of The Leland Stanford Junior University|Nano-sensor array|

---

SG11201402760VA|2011-12-01|2014-06-27|Genapsys Inc|Systems and methods for high efficiency electronic sequencing and detection|

---

US9809852B2|2013-03-15|2017-11-07|Genapsys, Inc.|Systems and methods for biological analysis|

---

EP3022319A4|2013-07-15|2017-03-22|Seegene, Inc.|Detection of target nucleic acid sequence by pto cleavage and extension-dependent immobilized oligonucleotide hybridization|

---

AU2014351800B2|2013-11-22|2021-04-08|Orion Diagnostica Oy|Detection of nucleic acids by strand invasion based amplification|

---

WO2015089238A1|2013-12-11|2015-06-18|Genapsys, Inc.|Systems and methods for biological analysis and computation|

---

EP3132060B1|2014-04-18|2019-03-13|Genapsys Inc.|Methods and systems for nucleic acid amplification|

---

CN108064315B|2014-08-22|2022-01-18|西菲伊德公司|Method for detecting influenza|

---

DK3201222T3|2014-09-29|2019-06-24|Illumina Cambridge Ltd|Recombinant mutants|

---

CN104830820A|2015-05-07|2015-08-12|浙江泰晶生物科技有限公司|Protease and detection method for rapidly detecting ribonucleic acid at constant room temperature|

---

CN107849600A|2015-06-09|2018-03-27|生命技术公司|For the method for molecular labeling, system, composition, kit, device and computer-readable media|

---

US20180291413A1|2015-10-06|2018-10-11|Thermo Fisher Scientific Geneart Gmbh|Devices and methods for producing nucleic acids and proteins|

---

GB201519565D0|2015-11-05|2015-12-23|Alere San Diego Inc|Sample preparation device|

---

US11118206B2|2016-01-13|2021-09-14|The Trustees Of The University Of Pennsylvania|Multiple stage isothermal enzymatic amplification|

---

EP3419989A4|2016-02-26|2019-11-06|Alere San Diego, Inc.|Redox labeled oligonucleotide probes and their use|

---

JP2019508043A|2016-03-04|2019-03-28|アリーア サン ディエゴ， インコーポレイテッド|Automated nested recombinase polymerase amplification|

---

WO2017172699A1|2016-03-28|2017-10-05|Illumina, Inc.|Recombinase mutants|

---

US20200255885A1|2016-04-04|2020-08-13|Nat Diagnostics, Inc.|Isothermal amplification components and processes|

---

US10544456B2|2016-07-20|2020-01-28|Genapsys, Inc.|Systems and methods for nucleic acid sequencing|

---

CN111566224A|2017-09-21|2020-08-21|吉纳普赛斯股份有限公司|Systems and methods for nucleic acid sequencing|

---

CN108195801B|2017-11-17|2020-11-24|北京林业大学|Method for observing pore guard cell membrane protein distribution and dynamics at single molecule level|

---

CN107893103A|2017-11-29|2018-04-10|默禾医疗科技（上海）有限公司|Recombinase and protein concentration when active level method in recombinase polymeric enzymatic amplification|

---

WO2019238765A1|2018-06-12|2019-12-19|Keygene N.V.|Nucleic acid amplification method|

---

GB201905303D0|2019-04-15|2019-05-29|Thermo Fisher Scient Geneart Gmbh|Multiplex assembly of nucleic acid molecules|

---

CN111154739B|2020-02-06|2021-03-02|广州普世利华科技有限公司|Novel recombinase-dependent amplification method and kit|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-06-25| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-02-18| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2020-11-17| B25A| Requested transfer of rights approved|Owner name: ABBOTT DIAGNOSTICS SCARBOROUGH, INC. (US) |

---

2021-02-02| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-04-06| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 06/04/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US201161472919P| true| 2011-04-07|2011-04-07|

---

US61/472,919|2011-04-07|

---

PCT/US2012/032508|WO2012138989A1|2011-04-07|2012-04-06|Monitoring recombinase polymerase amplification mixtures|

---