coelenterazine compounds, kit comprising said compounds and method for detecting luminescence in an

专利摘要:
NEW COELENTERAZINE SUBSTRATES AND METHODS OF USE. An isolated polynucleotide that encodes a modified luciferase polypeptide and new coelenterazine-based substrates. The OgLuc variant polypeptide has at least 60% amino acid sequence identity with SEQ ID NO: 1 and at least one amino acid substitution at a position corresponding to an amino acid in SEQ ID NO: 1. The OgLuc variant polypeptide has at least one enhanced luminescence, enhanced signal stability and enhanced protein stability in relation to the corresponding wild-type Oplophorus luciferase polypeptide.
公开号:BR112013010487B1
申请号:R112013010487-2
申请日:2011-11-02
公开日:2021-02-02
发明作者:Dieter H. Klaubert；Poncho Meisenheimer；James Unch
申请人:Promega Corporation；
IPC主号:

专利说明:

REMISSIVE REFERENCE TO RELATED ORDERS
[001] This application claims priority of Provisional Application US 61 / 409,422, filed on November 2, 2010, which is incorporated herein by reference in its entirety. BACKGROUND
[002] Luciferase secreted from Oplophorus gracilirostris from deep-sea shrimp has been shown to have many interesting characteristics, such as high activity, high quantum yield and broad substrate specificity (including, for example, celenterazine, as well as several analogs of celenterazine). The bioluminescent reaction of Oplophorus occurs when the oxidation of celenterazine (substrate) with molecular oxygen is catalyzed by Oplophorus luciferase, resulting in maximum intensity light at 462 nm, and the products of CO2 and celenteramide (Shimomura et al., Biochemistry, 17: 994 (1978)). Optimal luminescence occurs at pH 9 in the presence of 0.05-0.1 M NaCl at 40 ° C and, due to the unusual resistance of this enzyme to heat, visible luminescence occurs at temperatures above 50 ° C, when the enzyme highly purified is used or at more than 70 ° C, when partially purified enzyme is used. At pH 8.7, native luciferase was reported by Shimomura et al. (1978) as having a molecular weight of approximately 130 kDa, apparently comprising four monomers of 31 kDa each; at lower pH, native luciferase tends to polymerize.
[003] Further work has shown that Oplophorus gracilirostris luciferase is a complex of native 35 kDa and 19 kDa proteins, that is, a heterotetramer consisting of two components of 19 kDa and two components of 35 kDa. Inouye et al. (2000) reported the molecular cloning of cDNAs encoding Oplophorus luciferase 35 kDa and 19 kDa proteins, and the identification of the protein component that catalyzes the luminescence reaction. The cDNAs encoding the proteins were expressed in bacterial and mammalian cells, and the 19 kDa protein was identified as the component capable of catalyzing the luminescent oxidation of celenterazine (Inouye et al., 2000).
[004] The 19 kDa protein from Oplophorus luciferase (GenBank access BAB13776, 196 amino acids), appears to be the minor catalytic component having luciferase function, and its primary structure bears no significant resemblance to any reported luciferase including imidazopyrazinone luciferases (Lorenz et al., PNAS USA, 88: 4438 (1991); Thompson et al., PNAS USA, 86: 6567 (1989)). Expression of the 19 kDa protein in E. coli resulted in the formation of inclusion bodies (Inouye and Sasaki, Protein Expression and Purification, 56: 261-268 (2007)). The formation of inclusion bodies is probably due to the instability of the protein.
[005] The substrate specificity of Oplophorus luciferase is unexpectedly broad (Inouye and Shimomura. BBRC, 223: 349 (1997)). For example, bisdesoxicelenterazine (ie, celenterazine-hh), an analog of celenterazine, is an excellent substrate for Oplophorus luciferase comparable to celenterazine (Nakamura et al., Tetrahedron Lett., 38: 6405 (1997)). In addition, Oplophorus luciferase is a secreted enzyme, as is the lucidase from the Cypridina (Vargula) marine hilgendorfii (Johnson and Shimomura, Meth. Enzyme, 57: 331 (1978)), which also uses an imidazopyrazinone luciferin to emit light . SUMMARY
[006] In one aspect, the disclosure refers to a compound of formula (Ia) or (Ib):
where R2 is selected from the group consisting of
C2-5 straight chain alkyl; R6is selected from the group consisting of -H, -OH, -NH2, -OC (O) R or - OCH2OC (O) R; R8 is selected from the group consisting of
H or linear cycloalkyl; wherein R3 and R4 are both H or both C1-2 alkyl; W is -NH2, halo, -OH, -NHC (O) R, -CO2R; X is -S-, -O- or -NR22-; Y is -H, -OH, or -OR11; Z is -CH- or -N-; each R11 is independently -C (O) R '' or -CH2OC (O) R ''; R22 is H, CH3 or CH2CH3; each R is independently C 1-7 straight chain alkyl or C 1-7 branched alkyl; R '' is straight chain C1-7 alkyl or branched C1-7 alkyl; dashed bonds indicate the presence of an optional ring, which can be saturated or unsaturated; with the proviso that when R2 is

with the proviso that when R2 is
or linear cycloalkyl; and with the proviso that when R6 is NH2, R2 is
, or C2-5 alkyl; or R8 is not

[007] In another aspect, the disclosure refers to a compound selected from
[008] In one aspect, the disclosure refers to a compound of formula
[009] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 60% amino acid sequence identity with SEQ ID NO: 1 comprising at least one amino acid substitution in one position corresponding to an amino acid in SEQ ID NO: 1 where the OgLuc variant polypeptide has enhanced luminescence.
[0010] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 60% amino acid sequence identity with SEQ ID NO: 1 comprising at least one amino acid substitution in one position corresponding to an amino acid in SEQ ID NO: 1 where the OgLuc variant polypeptide has enhanced luminescence in relation to an OgLuc polypeptide of SEQ ID NO: 3 with the proviso that the polypeptide encoded by the polynucleotide is not one of those listed in the Table 47.
[0011] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 60% amino acid sequence identity with SEQ ID NO: 1 comprising at least one amino acid substitution in one position corresponding to an amino acid in SEQ ID NO: 1 where the OgLuc variant polypeptide has enhanced luminescence relative to a polypeptide of SEQ ID NO: 31 with the proviso that the polypeptide encoded by the polynucleotide is not SEQ ID NO: 3 or 15.
[0012] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 60% amino acid sequence identity with SEQ ID NO: 1 comprising at least one amino acid substitution in one position corresponding to an amino acid in SEQ ID NO: 1 where the OgLuc variant polypeptide has enhanced luminescence relative to a polypeptide of SEQ ID NO: 29 with the proviso that the polypeptide encoded by the polynucleotide is not SEQ ID NO: 3 or 15.
[0013] In one aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1 comprising A4E amino acid substitutions, Q11R, A33K, V44I, P115E, Q124K, Y138I, N166R, I90V, F54I, Q18L, F68Y, L72Q, and M75K comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0014] In one aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino acid in position 4 is glutamate, position 11 is arginine, position 18 is leucine, position 33 is lysine, position 44 is isoleucine, position 54 is isoleucine, position 68 is tyrosine, position 72 is glutamine, position 75 is lysine, at position 90 is valine, at position 115 is glutamate, at position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity .
[0015] In one aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1 comprising A4E amino acid substitutions, Q11R, A33K, V44I, P115E, Q124K, Y138I, N166R, Q18L, F54I, L92H, and Y109F comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0016] In one aspect, the disclosure relates to an isolated polynucleotide encoding an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1 comprising A4E amino acid substitutions, Q11R, A33K, V44I, A54I, F77Y, I90V, P115E, Q124K, Y138I and N166R comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0017] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino acid in position 4 is glutamate, position 11 is arginine, position 18 is leucine, position 33 is lysine, position 44 is isoleucine, position 54 is isoleucine, position 92 is histidine, position 109 is phenylalanine, position 115 is glutamate, at position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0018] In one aspect, the disclosure relates to an isolated polynucleotide that encodes an OgLuc variant polynucleotide having at least 80% amino acid sequence identity with an OgLuc polypeptide of SEQ ID NO: 1, wherein the amino acid in position 4 is glutamate, position 11 is arginine, position 33 is lysine, position 44 is isoleucine, position 54 is isoleucine, position 77 is tyrosine, position 90 is valine, position 115 is glutamate, position 124 is lysine, at position 138 is isoleucine, and at position 166 is arginine comprising SEQ ID NO: 1 and the OgLuc variant polypeptide having luciferase activity.
[0019] In one aspect, the disclosure relates to an isolated polynucleotide comprising the polynucleotide that encodes the polypeptide of SEQ ID NO: 19.
[0020] In one aspect, the disclosure relates to an isolated polynucleotide comprising the polynucleotide of SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 42, SEQ ID NO: 88, or SEQ ID NO: 92.
[0021] In one aspect, the disclosure relates to an isolated polynucleotide that encodes a decapod luciferase polypeptide having at least 30% amino acid sequence identity with SEQ ID NO: 1, the polypeptide comprising a sequence pattern corresponding to a sequence pattern of Formula (VII) and including no more than 5 differences, where the differences include differences from the standard positions 1, 2, 3, 5, 8, 10, 12, 14, 15, 17 , or 18 in relation to Formula (VII) according to the OgLuc standard listed in Table 4 as well as gaps or insertions between any of the standard positions of Formula (VII) according to the OgLuc standard listed in Table 4, in that decapod luciferase produces luminescence in the presence of a celenterazine.
[0022] In one aspect, the disclosure relates to a synthetic nucleotide sequence encoding an OgLuc variant polynucleotide comprising a fragment of at least 100 nucleotides having 80% or less nucleic acid sequence identity with a nucleic acid sequence original having SEQ ID NO: 2 and having 90% or more sequence identity with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 or the complement thereof, where the decreased sequence identity is a result of different codons in the synthetic nucleotide sequence compared to the codons in the original nucleic acid sequence, where the synthetic nucleotide sequence encodes an OgLuc variant that has at least 85% sequence identity amino acids for the corresponding luciferase encoded by the original nucleic acid sequence, and where the synthetic nucleotide sequence has a reduced number of regulatory sequences in relation to the sequence of original nucleic acids.
[0023] In one aspect, the disclosure relates to a synthetic nucleotide sequence that encodes an OgLuc variant polynucleotide comprising a fragment of at least 300 nucleotides having 80% or less nucleic acid sequence identity with a nucleic acid sequence original having SEQ ID NO: 14 and having 90% or more sequence identity with SEQ ID NO: 22 or SEQ ID NO: 23 or the complement thereof, where the decreased sequence identity is a result of different codons in the sequence of synthetic nucleotides relative to the codons in the original nucleic acid sequence, where the synthetic nucleotide sequence encodes a firefly lucifer that has at least 85% amino acid sequence identity to the corresponding luciferase encoded by the original nucleic acid sequence, and where the synthetic nucleotide sequence has a reduced number of regulatory sequences in relation to the original nucleic acid sequence final.
[0024] In one aspect, the disclosure relates to a synthetic nucleotide sequence that encodes an OgLuc variant polynucleotide comprising a fragment of at least 100 nucleotides having 80% or less nucleic acid sequence identity with a nucleic acid sequence original having SEQ ID NO: 18 and having 90% or more sequence identity with SEQ ID NO: 24 or SEQ ID NO: 25 or the complement thereof, where the decreased sequence identity is a result of different codons in the sequence of synthetic nucleotides relative to codons in the original nucleic acid sequence, where the synthetic nucleotide sequence encodes an OgLuc variant that has at least 85% amino acid sequence identity to the corresponding luciferase encoded by the original nucleic acid sequence, and wherein the synthetic nucleotide sequence has a reduced number of regulatory sequences in relation to the original nucleic acid sequence.
[0025] In one aspect, the disclosure relates to a fusion peptide comprising a signal peptide from Oplophorus gracilirostris fused to a heterologous protein, wherein said signal polypeptide is SEQ ID NO: 54, wherein the fusion peptide it is expressed in a cell and secreted from the cell.
[0026] In one aspect, the disclosure relates to a method for generating a polynucleotide that encodes an OgLuc variant polypeptide comprising: (a) using a parent fusion protein construct comprising a parental OgLuc polypeptide and at least one heterologous polypeptide to generate a library of variant fusion proteins; and (b) screening the library for at least one of enhanced luminescence, enhanced enzyme stability, or enhanced biocompatibility with respect to the parent fusion protein construct.
[0027] In one aspect, the disclosure refers to a method for generating codon-optimized polynucleotides that encode a luciferase for use in an organism, comprising: for each amino acid in the luciferase, randomly select a codon from the two most commonly used codons in the body to encode the amino acid to produce a first codon-optimized polynucleotide.
[0028] Other aspects of the invention will be evident by considering the detailed description and accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] FIG. 1 shows the chemical structure of native celenterazine, known bis-cellenterazine (celenterazine-hh), and known celenterazine-h, in which R2, R6 and R8 represent the regions of the molecule, where modifications were made.
[0030] FIG. 2 shows the chemical structure of new cellenterazines PBI-3939, PBI-3889, PBI-3945, PBI-4002, PBI-3841, PBI-3897, PBI-3896, PBI-3925, PBI-3894, PBI-3932, and PBI -3840.
[0031] FIG. 3 shows the Km determination of PBI-3939.
[0032] FIG. 4 shows the chemical structure of several new cellenterazines of the present invention.
[0033] FIGS. 5A-G show the luminescence (RLUs) generated from lysed bacterial cells that express C1 + A4E using native, known, and new celenterazine as substrates. FIGS. 5A, 5C-5G show independent luminescence measurement experiments in RLUs generated by C1 + A4E with celenterazines and new ones using native celenterazine as a comparison. FIG. 5B shows the decrease in fold in luminescence generated by C1 + 4AE using the substrates shown in FIG. 5A compared to native celenterazine.
[0034] FIGS. 6A-D show the luminescence generated from lysed bacterial cells that express various variants of OgLuc using native celenterazine ("Celente"), known celenterazine-h ("h"), known celenterazine-hh ("h, h"), known 2-methyl celenterazine (“2-me”), known celenterazine-v (“v”), new cellenterazine PBI-3840, PBI-3897, PBI-3889, PBI-3899, PBI-3900, PBI-3912, PBI - 3913, PBI-3925, PBI-3897, PBI-3899, PBI-3889, PBI-3939, PBI-3933, PBI-3932, PBI- 3946, PBI-3897, PBI-3841, PBI-3825, PBI-3925 , and PBI -3945 as
[0035] FIG. 7 shows amino acid substitutions in several OgLuc variants.
[0036] FIGS. 8A-B show the luminescence generated from lysed bacterial cells expressing variants of OgLuc listed in FIG. 7 using native celenterazine (“Celenterazine”), known celenterazine-h (“H”), known celenterazine-hh (“h, h”), and new celenterazines PBI-3840, PBI-3925, PBI-3912, PBI- 3889 , PBI-3939, PBI-3933, PBI-3932, PBI-3946, PBI-3941, and PBI-3896 as substrates.
[0037] FIG. 9 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc using native cellenterazine (“Celenterazine”), known cellenterazine-hh (“h, h”), and new cellenterazines PBI-3939, PBI-3945, PBI -3840, PBI -3932, PBI-3925, PBI-9894, and PBI-3896 as substrates.
[0038] FIG. 10 shows the amino acid substitutions in several variants of OgLuc.
[0039] FIG. 11 shows the luminescence generated from lysed bacterial cells expressing variants of OgLuc listed in FIG. 10 using native celenterazine (“Celenterazine”), well-known celenterazine-hh (“h, h”), and new cellenterazines PBI-3939, PBI-3945, PBI-3840, PBI-3932, PBI-3925, PBI-3894, and PBI-3896, as substrates.
[0040] FIG. 12 shows the luminescence generated from lysed bacterial cells that express OgLuc variants using native celenterazine (“Celenterazine”), known celenterazine-hh (“h, h”), and new cellenterazines PBI-3939, PBI-3945, PBI- 3889, PBI-3840, PBI-3932, PBI-3925, PBI-3894, PBI-3896, and PBI-3897 as substrates.
[0041] FIG. 13 shows the luminescence generated from lysed bacterial cells that express variants of OgLuc using native celenterazine (“Celenterazine”), known cellenterazine-hh (“H, H”), and new PBI-3897, PBI-3896, and PBI-new cellenterazines -3894 as substrates.
[0042] FIG. 14 shows amino acid substitutions in several OgLuc variants.
[0043] FIG. 15 shows the luminescence generated from lysed bacterial cells expressing variants of OgLuc listed in FIG. 14 using native celenterazine (“Celenterazine”), known celenterazine-hh (“h, h”), and new cellenterazines PBI-3897, PBI-3841, PBI-3896, and PBI-3894 as substrates.
[0044] FIG. 16 shows the luminescence generated from lysed bacterial cells that express OgLuc variants using native celenterazine (“Celenterazine”), known celenterazine-H (“H”), known celenterazine-hh (“HH”), and new PBI- 3841 and PBI-3897 as substrates.
[0045] FIG. 17 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc and humanized Renilla luciferase (hRL) using native celenterazine ("Coel"), known celenterazine-hh ("h, h"), and new PBI cellenterazines. -3897 and PBI-3841 as substrates.
[0046] FIG. 18 shows the luminescence generated from lysed bacterial cells that express several variants of OgLuc using native cellenterazine (“Celenterazine”), known cellenterazine-hh (“h, h”), and new cellenterazines PBI-3939, PBI-3945, PBI -3889, and PBI-4002 as substrates.
[0047] FIG. 19 shows the luminescence generated from lysed bacterial cells that express several variants of OgLuc using native celenterazine ("Celenterazine"), known celenterazine-h ("H"), known celenterazine-hh ("h, h"), and new cellenterazines PBI-3939, PBI-3945, PBI-3889, P-4002 PBI as substrates.
[0048] FIG. 20 shows amino acid substitutions in several OgLuc variants.
[0049] FIG. 21 shows the luminescence generated from lysed bacterial cells expressing variants of OgLuc listed in FIG. 20 using native celenterazine (“Celenterazine”), known celenterazine-h (“H”), known celenterazine-hh (“h, h”), and new celenterazines PBI-3939, PBI-3945, PBI-4002, PBI-3932 , and PBI-3840 as substrates.
[0050] FIG. 22 shows amino acid substitutions in several OgLuc variants.
[0051] FIG. 23 shows the luminescence generated from lysed bacterial cells that express OgLuc variants listed in FIG. 22 using native celenterazine (“Celenterazine”), known celenterazine-h (“H”), known celenterazine-hh (“h, h”), and new celenterazines PBI-3939, PBI-3945, PBI-3889, PBI-4002 , PBI-3932, P-3840 PBI as substrates.
[0052] FIG. 24 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc and hRL ("Renilla") using native celenterazine ("Celenterazine"), known celenterazine-h ("H"), known celenterazine-hh ("HH ”), And new cellenterazines PBI-3939 and PBI-3945 as substrates.
[0053] FIG. 25 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc and hRL (“Renilla”) using native celenterazine (“Celenterazine”), known celenterazine-hh (“h, h”), and new PBI- 3939, -PBI 3945, PBI-3889, P-4002 PBI as substrates.
[0054] FIG. 26 shows amino acid substitutions in several OgLuc variants.
[0055] FIG. 27 shows the luminescence generated from lysed bacterial cells expressing variants of OgLuc listed in FIG. 26 using native celenterazine (“Celenterazine”), known celenterazine-h (“H”), known celenterazine-hh (“h, h”), and new PBI-3939, PBI-3945, PBI-3889, and PBI- 4002 as substrates.
[0056] FIG. 28 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc and hRL (“Renilla”) using native celenterazine (“Coel.”), Known Celenterazine-h (“H”), known celenterazine-hh (“ H, H ”), and new cellenterazines PBI-3939, PBI-3945, PBI-3889, and PBI-4002 as substrates.
[0057] FIG. 29 shows the luminescence of 9B8 opt and 9B8 opt + K33N in bacterial lysates using native celenterazine and PBI-3939 as substrates and the relative specificity of these variants for PBI-3939 compared to native celenterazine.
[0058] FIGS. 30A-D show mutation analysis at position 166 using native celenterazine (Fig. 30A), celenterazine-h (FIG.30B), and PBI-399 (Fig. 30C).
[0059] FIG. 31 shows the luminescence of several deletions in the OgLuc L27V variant where (-) is the bottom of the machine.
[0060] FIG. 32 shows the normalized luminescence generated from lysed HEK293 cells that express hRL (“Renilla”) using native celenterazine as a substrate, firefly luciferase (Luc2) using luciferin (BRILHO-GLO ™ assay reagent) as a substrate, and several OgLuc variants using new PBI-3939 as a substrate.
[0061] FIG. 33 shows the stability of the IV and 15C1 signal in bacterial lysates using the new celenterazine PBI-3945 as substrate and IV and 9B8 in bacterial lysates using the new celenterazine PBI-3889 as substrate.
[0062] FIGS. 34A-B show the higher signal activity (Fig. 34A) and stability (Figure 34B) of the OgLuc L27V variant compared to firefly (Fluc) and Renilla (Rluc) luciferases.
[0063] FIG. 35 shows the values of Vmax (RLU / s) and Km (μM) for several OgLuc variants in bacterial lysates using the new cellenterazine PBI-3939 as a substrate.
[0064] FIG. 36 shows the values of Vmax (RLU / s) and Km (μM) for various variants of OgLuc in bacterial lysates using the new celenterazine PBI-3939 as a substrate.
[0065] FIG. 37 shows the values of Vmax (RLU / s) and Km (μM) for 9B8 opt and 9B8 opt + K33N, both in bacterial lysates using the new celenterazine PBI-3939 as a substrate.
[0066] FIG. 38 shows the protein stability at 50 ° C of various OgLuc variants in bacterial lysates using native celenterazine as a substrate such as luminescence at t = 0 and half-life in minutes.
[0067] FIGS. 39A-B show structural integrity (determined by expression, stability and solubility, as shown by SDS-PAGE analysis) in bacterial lysates from different OgLuc variants at 25 ° C (Fig. 39A) and 37 ° C (Figure 39B) , in comparison to Renilla (hRL) and firefly Luciferase (Luc2).
[0068] FIGS. 40A-B show protein stability at 60 ° C in 9B8 opt and 9B8 opt + K33N bacterial lysates using the new cellenterazine PBI-3939 as a substrate, as the natural logarithm (ln) of luminescence (in RLU) over time (Fig. 40A) and as the half-life in hours (Fig. 40B).
[0069] FIG. 41 shows the percentage activity of OgLuc 9B8 and L27V variants at 60 ° C.
[0070] FIGS. 42A-B show the protein stability of the OgLuc L27V variant at various pH (Fig. 42A) and as salt concentrations (Fig. 42B).
[0071] FIGS. 43A-B show chromatographic analysis of purified C1 + A4E gel filtration (FIG. 43A) and 9B8 (Fig. 43B).
[0072] FIG. 44 shows the chromatographic analysis of gel filtration that demonstrates that the OgLuc L27V variant exists in a monomeric form.
[0073] FIGS. 45A-B show protein expression levels of various OgLuc variant HALOTAG® (HT7) fusion proteins in 1: 1 diluted bacterial lysate samples analyzed by SDS-PAGE (FIG.45A) and expression levels of normalized protein (Figure 45B).
[0074] FIGS. 46A-B show protein expression (Fig. 46A) and solubility of OgLuc 9B8 opt, V2 and L27V variants (Fig. 46B).
[0075] FIG. 47 shows the normalized luminescence in RLUs generated from lysed HEK293 cells that express IV, 9B8, and hRL (“Renilla”), using native celenterazine and the new cellenterazine PBI-3939 as substrates.
[0076] FIG. 48 shows normalized luminescence in RLUs generated from lysed HEK293 cells that express pF4Ag-Ogluc-9B8-HT7, pF4Ag- Luc2-HT7 and pF4Ag-Renilla-HT7 using PBI-3939, Luciferin (BRIGHT-GLO ™ Assay Reagent) , and native celenterazine, respectively, as a substrate.
[0077] FIG. 49 shows the luminescence generated from lysed HEK293 cells that express 30 or 100 ng of plasmid DNA encoding either 9B8 opt or 9B8 opt + K33N (“K33N”) using the new cellenterazine PBI-3939 as a substrate.
[0078] FIGS. 50A-E show the luminescence of the OgLuc L27V variant compared to the firefly luciferase (Luc2) in HEK 293 (FIG. 50A) and HeLa cells (non-fusion) (FIG. 50B), the HaloTag® fusion luminescence in comparison with the variant of OgLuc L27V (Fig. 50C) and firefly luciferase (Luc2) (Fig. 50D), and the expression of the HaloTag®-OgLuc L27V protein compared to HaloTag®-firefly (Luc2) in cells HEK 293 (“HEK”) and HeLa cells (“HeLa”).
[0079] FIG. 51 shows the analysis of the inhibition of the OgLuc 9B8 and L27V variants against a LOPAC library to determine their susceptibility to off-target interactions.
[0080] FIGS. 52A-E show inhibition analyzes of the OgLuc 9B8 and L27V variants by suramine and Tyr ag 835 (FIGS. 52A-C) and the chemical structures of Suramine (Fig. 52D) and Tyr ag 835 (FIG. 52E).
[0081] FIG. 53 shows the activity of the OgLuc 9B8 and L27V variants was analyzed in the presence of BSA to determine the resistance to the interaction of non-specific proteins.
[0082] FIG. 54 shows the percentage activity of OgLuc 9B8 and L27V variants to determine reactivity to plastic.
[0083] FIG. 55 shows the luminescence generated from lysed HEK293 cells that express the transcription IV cAMP reporter compared to hRL (“Renilla”) using a celenterazine-h known as a substrate treated with (“induced”) or without (“basal” ”) Forskolin and the induction of fold (response) due to treatment with forskolin (“ fold ”).
[0084] FIG. 56 shows the normalized luminescence generated from lysed HEK293 cells that express the 9B8, 9B8 opt, hRL (“Renilla”) or firefly luciferase transcription reporter (“Luc2”) cAMP using PBI-3939 (for 9B8 and 9B8 opt) , native celenterazine (for hRL) or luciferin (BRIGHT-GLO ™ Assay Reagent, for Luc2) as a substrate with (“+ FSK”) or without (“-FSK”) treatment with forskolin and fold induction (response) due to treatment with forskolin (“fold”).
[0085] FIG. 57 shows the luminescence generated from lysed HEK293 cells that express 9B8 opt and 9B8 opt + K33N (“K33N”) cAMP transcriptional reporters using the new cellenterazine PBI-3939 as a substrate with (“induced”) or without (“basal”) ”) Forskolin treatment and fold induction due to forskolin treatment (“ Fold induction ”).
[0086] FIGS. 58A-C show the luminescence of the reporter constructs of 9B8 and L27V lytic OgLuc variants for multiple pathways in multiple cell types.
[0087] FIGS. 59A-C show the luminescence of reporter constructs of the OgLuc L27V variant in various cell lines and with various response elements.
[0088] FIGS. 60A-B show the luminescence of the OgLuc variant L27V secretable reporter Metridia longa compared to luciferase, with a CMV promoter (fig. 60A) or an NFkB response element (FIG. 60B).
[0089] FIGS. 61A-F show the absolute luminescence (FIGS 61A and 61B), the normalized luminescence (FIG. 61C and 61D) and the bend response (FIGS. 61E and 61F) of optimized versions of L27V (L27V01, L27V02 and L27V03) in comparison with L27V (L27V00) expressed in HeLa cells.
[0090] FIGS. 62A-B show the luminescence of secreted OgLuc L27V02 variant reporter (containing the IL-6 secretion signal) (Fig. 62A) and L27V02 (“L27V (02)”), L27V02P (“L27V (02) P (01 ) ”) And luc2 (“ Fluc ”) reporters (FIG. 62A), expressed in HepG2 cells treated with various doses of rhTNFa (“ TNFa ”).
[0091] FIG. 63 shows the luminescence generated from the HEK293 medium and cell lysate samples that express the variant IV opt codon optimized with or without the secretion signal sequence using the new PBI-3939 as a substrate in relation to the hRL (“Renilla” ) with or without the secretion signal sequence using native celenterazine as a substrate.
[0092] FIGS. 64A-D show the luminescence of secreted OgLuc 9B8, V2 and L27V variant reporters expressed in CHO (FIGS. 64A and 64B) and HeLa (FIG. 64C and 64D) cells
[0093] FIGS. 65A-B show a comparison of the luminescence of the OgLuc 9B8 and V2 variants secreted using PBI-3939 as a substrate for Metridia long luciferase using Ready-to-Glow ™ as a substrate numerically (FIG. 65A) and graphically (FIG. 65B) .
[0094] FIGS. 66A-B show the increase in fold in luminescence on the background generated from HEK293 cells expressing hRL (“Ren”) and 9B8 opt using the celenterazine derivatives ENDUREN ™ (FIG. 66A) and VIVIREN ™ (Fig. 66B) and the new celenterazine PBI-939 (FIG. 66B), as substrates.
[0095] FIGS. 67A-D show confocal images of U2OS cells that transiently express the L27V-HaloTag® fusion (FIG. 67A) or the IL6-L27V fusion (FIGS. 67B-D). Scale bars = 20μm.
[0096] FIG. 68 shows the luminescence generated from lysed bacterial cells that express various variants of OgLuc and hRL (“Renilla”), in the presence (“Areia”) or absence of the sandwich base (“pF4Ag”) using native celenterazine as a substrate.
[0097] FIG. 69 shows the decrease in fold in activity of several variants of OgLuc and hRL (“Renilla”) due to the presence of the sandwich base using native celenterazine as a substrate.
[0098] FIG. 70 shows the decrease in the fold in the activity of 9B8 opt and 9B8 opt + K33N in bacterial lysates, due to the presence of the sandwich base using the new celenterazine PBI-3939 as substrate.
[0099] FIG. 71 shows the spectral profile of the L27V variant of OgLuc.
[00100] FIG. 72 shows the luminescence of two circulated interchanged (CP) versions of the OgLuc L27V variant, CP84 and CP95, either without linker with a linker of 5, 10, or 20 amino acids.
[00101] FIGS. 73A-G show the luminescence of the various constructs of CP-TEV protease L27V expressed in wheat germ extract (FIGS. 73A-D), E. coli (Fig. 73F-G) and HEK 293 cells (Fig. 73H). FIGS. 73A-D show the basal luminescence of various constructs of CP-TEV protease L27V prior to the addition of TEV. FIG. 73E shows the response of the L27V CP-TEV protease constructs of FIG. 73A-D.
[00102] FIG. 74 shows the fold response of several L27V protein complementing pairs.
[00103] FIGS. 75A-C show the luminescence of several L27V protein complementing pairs (PCA): an L27V fragment from each pair was fused to FKBP or FRB using a 1/4 configuration (FIG. 75A) or a 2/3 configuration (FIG. 75B), and the interaction of FKBP and FRB monitored in HEK 293 cells. The luminescence of several negative protein complementation (PCA) controls was also monitored (FIG. 75C).
[00104] FIGS. 76A-H show the luminescence of a variety of L27V protein complementing pairs (PCA): an L27V fragment from each pair has been fused to either FRB or FKBP using a 2/3 configuration (FIGS. 76A and 76C) or a 1/4 configuration (FIGS. 76B and 76D), and the interaction of FKBP and FRB monitored in wheat germ extract (FIGS. 76A and 76B) and rabbit reticulocyte lysate (RLL) (Figures 76C and 76D). The luminescence of several negative protein complementation controls (PCA) was also measured (figure 76E) in a cell-free system. The 1/4 configuration was used in a cell-free system (FIG. 76F), with HEK293 cells (FIG.76G) and a lytic system (FIG. 76H).
[00105] FIGS. 77A-C show the luminescence of several L27V protein complementing pairs treated with FK506 and rapamycin (FIG. 77A) and the chemical structure of FK506 (FIG. 77A) and rapamycin (Figure 77B).
[00106] FIG. 78 shows the activity of the cAMP biosensor of the OgLuc 9B8 variant with forskolin treatment.
[00107] FIGS. 79A-D show the luminescence of circular shifts (FIGS 79A and 79C) and linearly dividing L27V variants (FIG. 79B and 79D) in rabbit reticulocyte lysate (Figures 79A-B) and HEK293 cells (FIGS 79C-D) .
[00108] FIGS. 80A-B show the subcellular distribution of the OgLuc L27V variant (Fig. 80A) and pGEM3Zf control vectors (FIG. 80B) in U2OS cells for various exposure times.
[00109] FIGS. 81A-C show the subcellular location of the OgLuc L27V variant fused to either the transcription factor Nrf2 (FIG. 81B) or GPCR (Fig. 81C), compared to a non-fused L27V control (FIG. 81a).
[00110] FIGS. 82A-C show the use of the OgLuc opt 9B8 variant to monitor intracellular signaling pathways using PBI-4377 (FIG. 82A). The luciferase 9B8 opt was fused to either IkB (Fig. 82B) or ODD (HIF-1α oxygen-dependent degradation domain) (FIG. 82C), and the fold response to a stimulus (TNFα to IKB and ODD) was monitored through luminescence.
[00111] FIGS. 83A-C show the monitoring of oxidative stress signal pathways using the OgLuc (FIG. 83A), L27V02 (FIG. 83B), or Renilla luciferase (Rluc) variant (Fig. 83C).
[00112] FIGS. 84A-B show the comparison of Nrf2 sensor L27V02 (FIG. 84A) and reporter Nrf2 (ARE) -Luc2P (Fig. 84B).
[00113] FIGS. 85A-B show the emission spectrum of IV-HT7 with and without ligand, using 1 μM of TMR (FIG. 85A) or 10 μM of Rhodamine 110 (FIG. 85B), as a ligand for HT7 and celenterazine-h as substrate for IV.
[00114] FIG. 86 shows the luminescence generated from lysed bacterial cells that express 9B8 opt mixed with (“+ caspases”) oue without (“without caspase”) caspase-3 using a pro-celenterazine substrate.
[00115] FIGS. 87A-C show the luminescence generated from the circularly exchanged L27V variants CP84 and CP103 using PBI-3939 as the substrate with (Figure 87B) or without (not shown) rapamycin treatment and the response (FIG. 87C) due to rapamycin treatment. The concept of the circularly interchanged linear division variants is shown in FIG. 87A.
[00116] FIG. 88 shows the percentage remaining activity of the L27V variant after exposure to different amounts of urea.
[00117] FIG. 89 shows the effect of 3M urea on the activity of the L27V variant.
[00118] FIGS. 90A-B show the bioluminescence image of nuclear receptor (NR) translocation induced by OgLuc fusion hormone using the substrate PBI-3939.
[00119] FIGS. 91A-B show the bioluminescence image of the translocation of protein kinase C alpha (PKC alpha) induced by phorbol ester from OgLuc fusions using the substrate PBI-3939.
[00120] FIGS. 92A-B show the bioluminescence image of the translocation of the autophagosomal protein from OgLuc fusions using the substrate PBI-3939. DETAILED DESCRIPTION
[00121] Before any modalities of the invention are explained in detail, it should be understood that the invention is not limited in its application to the details of structure, synthesis, and arrangement of the components presented in the following description or illustrated in the following drawings. The invention is described with respect to specific modalities and techniques, however, the invention is capable of other modalities and can be practiced or carried out in different ways.
[00122] In the following description of the methods of the invention, the process steps are carried out at room temperature (about 22 ° C) and at atmospheric pressure, unless otherwise indicated. It is also specifically understood that any numerical range recited in this document includes all values from the lowest value to the highest value. For example, if a concentration range or range of beneficial effect is indicated as 1% to 50%, values such as 2% to 40%, 10% and 30%, or 1% to 3%, etc., are intended. , are expressly listed in this specification. Similarly, if a sequence identity range is given as between, for example, 60% to <100%, intermediate values, such as 65%, 75%, 85%, 90%, 95%, are intended , etc., are expressly listed in this specification. These are only examples that are specifically intended, and all possible numerical values from the lowest value to the highest value are considered to be expressly indicated in the order.
[00123] Unless expressly specified otherwise, the term "comprising" is used in the context of the present application, to indicate that more elements may optionally be present in addition to the elements of the list introduced by "comprising". It is, however, contemplated as a specific modality of the present invention that the term "comprising" includes the possibility that no additional elements are present, that is, for the purpose of this modality "comprising" should be understood as having the meaning of "consisting of ”.
[00124] The following detailed description describes specific and / or preferred variants of the individual characteristics of the invention. The present invention also contemplates, as particularly preferred embodiments, those that are generated by combining two or more specific and / or preferred variants described for two or more of the features of the present invention.
[00125] Unless expressly specified otherwise, all indications of relative quantities in this application are by weight / weight basis. Indications of relative quantities of a component characterized by a generic term that are intended to refer to the total quantity of all specific variants or elements covered by that generic term. If a particular component defined by a generic term is specified to be present in a certain relative quantity, and, if this component is further characterized to be a specific variant or an element covered by the generic term, it is understood that no other variant or element covered by the generic term is additionally present in such a way that the total relative quantity of components covered by the generic term exceeds the specified relative quantity. More preferably, no other variant or element covered by the generic term is present at all. Global vision
[00126] In several aspects, the invention is designed for new compounds, new luciferases, and combinations thereof. The invention encompasses methods, compositions and kits, including new compounds, new luciferases, and / or combinations thereof.
[00127] The new compounds are new cellenterazines, which can be used as substrates for proteins that use cellenterazines to produce luminescence, including, but not limited to, luciferases and photoproteins found in various marine organisms, such as cnidarians (for example, luciferase from Renilla), jellyfish (for example, Aequorea jellyfish aequorin) and decapod luciferases (for example, Oplophorus gracilirostris luciferase complex). In a number of embodiments, the new cellenterazines of the present invention have at least one of enhanced physical stability (e.g., enhanced celenterazine stability), reduced autoluminescence, and increased biocompatibility with cells (e.g., less toxic to cells , including heterologous cell types) in relation to native celenterazine.
[00128] The new luciferases disclosed herein include variants of the active subunit of a decapod luciferase. The new luciferases can use a variety of cellenterazines as substrates, including, but not limited to, native and known celenterazines, as well as the new cells of the present invention. The new luciferases exhibit at least one of the following: increased luminescence (including increased brightness, enhanced signal stability and / or enhanced signal duration), enhanced enzyme stability (ie, enhanced enzyme activity, including enhanced high temperature resistance, changes in pH, inhibitors, denaturants and / or detergents); altered substrate specificity (ie, changes in relative substrate specificity), and enhanced biocompatibility (including at least enhanced cell expression, reduced toxicity, and / or cell stress). In several embodiments, the present invention encompasses new luciferases that are present in the solution of soluble active monomers chemically linked to other molecules (for example, fusion proteins), or attached to a solid surface (for example, particles, capillaries or tubes or plates test).
[00129] Certain combinations of the new celenterazins and the new luciferases provide significant technical advantages for bioluminescent assays including enhanced luminescence, in which the enhanced luminescence may be due to one or more factors, including enhanced signal stability and enhanced celenterazine stability. In addition, many of the new celenterazines are designed to be smaller than commercially available and / or known celenterazines. In some cases, the new luciferases of the present invention, preferably, use the newer smaller cellenterazines than the larger commercially available and / or known cellenterazines.
[00130] The invention encompasses combinations of: new variants of luciferase with the new celenterazines; the new variants of luciferase with known or native celenterazine, and the new celenterazine with any known or native protein (for example, luciferases or photoproteins), which uses celenterazine as a substrate.
[00131] The term "celenterazine" refers to naturally occurring ("native") celenterazine, as well as its analogues, including celenterazine-n, celenterazine-f, celenterazine-h, celenterazine-hcp, celenterazine-cp, celenterazine -c, celenterazine-e, celenterazine-fcp, bis-deoxychelenterazine (“celenterazine-hh”), celenterazine-i, celenterazine-icp, celenterazine-v, and 2-methyl celenterazine, in addition to those described in WO 2003/040100 and US Order 12 / 056,073 (paragraph [0086]), the disclosures of which are hereby incorporated by reference. The term “celenterazine” also refers to new celenterazines disclosed here (see below). The term "known celenterazine" refers to a known celenterazine analog prior to the present invention.
[00132] The term "OgLuc" refers to a decapod luciferase protein, or a variant of such a protein, which generates light in the presence of a celenterazine. The OgLuc protein may, in its naturally occurring form, be a monomer or it may be a subunit of a protein complex. OgLuc used in the exemplary modalities disclosed here is the 19 kDa subunit of the luciferase complex of Oplophorus gracilirostris, although comparable polypeptides from other decapod species (including other Oplophorus species) can also be employed and embedded in the invention (see RD Dennell, Observations on the luminescence of bathypelagic Decapod crustacea of the Bermuda area, Zool. J. Linn. Soc., Lond. 42 (1955), pp. 393-406; see also Poupin et al. Sept 1999. Inventaire documenté des espècies et bilan des formes les plus communes de la mer d'Iroise.Rapport Scientifique du Laboratoire d'Océanographie de l'École Navale (LOEN), Brest (83pgs), each of which is incorporated into this document by reference); examples include, without limitation, luciferases of the Aristeidae family, including Plesiopenaeus coruscans; the Pandalidea family, including Heterocarpus and Parapandalus richardi, the Solenoceridae family, including Hymenopenaeus debilis and Mesopenaeus tropicalis; the Luciferidae family, including Lucifer typus; the Sergestidae family, including Sergestes atlanticus, Sergestes arcticus, Sergestes armatus, Sergestes pediformis, Sergestes cornutus, Sergestes edwardsi, Sergestes henseni, Sergestes pectinatus, Sergestes sargassi, Sergestes similis, Sergestes vigilax, Sergia lucisis, Sergia challengeri, , Sergia potens, Sergia robusta, Sergia scintillans, and Sergia splendens; the Pasiphaeidae family, including Glyphus marsupialis, Leptochela bermudensis, Parapasiphae sulcatifrons, and Pasiphea tarda; the family oplophoridae including Acanthephyra acanthitelsonis, Acanthephyra acutifrons, Acanthephyra brevirostris, Acanthephyra cucullata, curtirostris Acanthephyra, Acanthephyra exempted, Acanthephyra gracilipes, Acanthephyra kingsleyi, Acanthephyra media Acanthephyra microphthalma, pelagica Acanthephyra, Acanthephyra prionota, Acanthephyra purpurea, blood Acanthephyra, Acanthephyra sibogae , stylorostratis Acanthephyra, spina Ephyrina, Ephyrina figueirai, Ephyrina koskynii, Ephyrina ombango, Hymenodora glacialis, Hymenodora gracilis Meningodora miccyla, Meningodora mollis, Meningodora vesca, Notostomus gibbosus, Notostomus auriculatus, Oplophorus gracilirostris, Oplophorus grimaldii, Oplophorus novaezealandiae, Oplophorus spinicauda, Oplophorus foliaceus, Oplophorus spinosus, Oplophorus typus, Systellaspis braueri, Systellaspis cristata, Systellaspis debilis, and Systellaspis pellucida; and the Thalassocaridae family, including Chlorotocoides spinicauda, Thalassocaris crinita, and Thalassocaris lucida.
The polypeptide sequence of the mature 19 kDa subunit (ie, with no signal sequence) of the naturally occurring form of Oplophorus gracilirostris luciferase (ie, 169 amino acids, 28 to 196 residues of BAB 13776) is provided in SEQ ID NO: 1. In several embodiments, a methionine residue and a valine residue are inserted at the beginning of the synthetic OgLuc sequence (for example, as indicated in the C1 + A4E polypeptide sequence, SEQ ID NO: 3) to facilitate cloning and expression in heterologous systems. However, for consistency, the position numbers of the various amino acid substitutions referred to herein are specified “in relation to” SEQ ID NO: 1, that is, the sequence of the mature polypeptide (no signal sequence), a 19 kD subunit native to the luciferase protein complex of Oplophorus gracilirostris.
[00134] Specifically, a protein is a decapod luciferase if, in the alignment of this amino acid sequence with SEQ ID NO: 1, the sequence identity is> 30%, preferably> 40%, and more preferably> 50%, and the protein you can use celenterazine as a substrate to catalyze the emission of luminescence, and the amino acid sequence starting at the position corresponding to position 8 of SEQ ID NO: 1 is: [GSAIVK] - {FE} - [FYW] -x- [LIVMFSYQ] -xx- {K} -x- [NHGK] -x- [DE] -x- [LIVMFY] - [LIVMWF] -x- {G} - [LIVMAKRG] (SEQ ID NO. 330) (VII), with no more than 5 differences, or more preferably no more than 1, 2, 3 or 4 differences, or more preferably no differences, where the differences occur in the positions corresponding to the standard position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according to Table 4. Differences may also include gaps or insertions between the standard positions in Table 4.
[00135] The term "variant" refers to a modified version of a starting polypeptide or polynucleotide sequence. The term “parental” is a relative term that refers to a starting sequence that is then modified. The parental sequence is generally used as a reference for the protein encoded by the resulting modified sequence, for example, to compare the levels of activity or other properties of the proteins encoded by the modified and parental sequences. The starting sequence can be a naturally occurring (i.e., native or wild type) sequence. The starting sequence can also be a variant sequence which is then further modified. A polypeptide sequence is "modified" when one or more amino acids (which may be naturally occurring or synthetic) are replaced, deleted, and / or added at the beginning, middle, and / or end of the sequence. A polynucleotide sequence is "modified" when one or more nucleotides are replaced, deleted, and / or added at the beginning, middle, and / or end of the sequence, but which may or may not alter the amino acid encoded by the sequence. In some embodiments, the modifications produce a variant that is a functional fragment of a specific OgLuc or OgLuc variant. A functional fragment is a fragment that is smaller than a full-length parental sequence that has the same functional activity as the full-length parental sequence. Functional activity is the ability to exhibit luminescence. In some embodiments, the modifications produce a variant which is an interchanged sequence from the parental sequence, such as a circularly interchanged sequence and interchanged sequences comprising deletions and / or insertions.
[00136] Several of the OgLuc variants disclosed in this document have been short names designed to facilitate discussion. The term “C1 + A4E” (also referred to as “C1A4E”) refers to a specific OgLuc variant with amino acid substitutions A4E, Q11R, A33K, V44I, A54F, P115E, Q124K, Y138I, and N166R in relation to SEQ ID NO: 1 (SEQ ID NOs: 2 and 3) (where the format “x # y” indicates a main amino acid 'x' in a position '#' which is changed to variant amino acid 'y'). Variants of the C1 + A4E OgLuc variant that are presented in this document contain at least the amino acid substitutions found in C1 + A4E, unless otherwise indicated. The term "IVY" refers to a variant of the C1 + A4E OgLuc variant having additional amino acid substitutions F54I, I90V, and F77Y in relation to SEQ ID NO: 1 (SEQ ID NOs: 8 and 9). The term "IV" refers to another variant of the C1 + A4E OgLuc variant having additional amino acid substitutions F54I and I90V in relation to SEQ ID NO: 1 (SEQ ID NOs: 14 and 15). The term "QC27" refers to yet another variant of the C1 + A4E OgLuc varinate having additional amino acid substitutions Q18L, F54I, L92H, and Y109F in relation to SEQ ID NO: 1 (SEQ ID NOs: 4 and 5). The term “QC27-9a” refers to a variant of the QC27 OgLuc variant with additional amino acid substitutions V21L, F68Y, L72Q, M75K, H92R, and V158F in relation to SEQ ID NO: 1 (SEQ ID NOs: 6 and 7). The term “9B8” refers to a variant of the IV OgLuc variant with additional amino acid substitutions Q18L, F68Y, L72Q, and M75K in relation to SEQ ID NO: 1 (SEQ ID NOs: 18 and 19). The term “9B8 opt” refers to the codon-optimized version of the 9B8 variant (SEQ ID NO: 24). The term “9B8 opt + K33N” refers to a variant of the 9B8 opt variant with an additional K33N amino acid substitution in relation to SEQ ID NO: 1 (SEQ ID NOs: 42 and 43). The term “9B8 opt + K33N + 170G” refers to a variant of the “9B8 opt + K33N” variant with an additional glycine attached to the variant's C-terminal, ie 170G in relation to SEQ ID NO: 1 (SEQ ID NO: 68 and 69). The terms “L27V + T39T + K43R + Y68D” and “L27V” refer to a variant of the 9B8 opt + K33N variant with additional amino acid substitutions L27V, T39T, K43R, and Y68D in relation to SEQ ID NO: 1 (SEQ ID NOs: 88 and 89). The terms “T39T + K43R + Y68D” and “V2” refer to a variant of the “9B8 opt + K33N” variant with additional amino acid substitutions T39T, K43R, and Y68D in relation to SEQ ID NO: 1 (SEQ ID NOs: 92 and 93).
[00137] In general, "enhanced" indicates that the specific property (for example, luminescence, signal stability, biocompatibility, protein stability (for example, enzyme stability), or protein expression) is enhanced with respect to such of the combination of luciferase plus reference celenterazine or luciferase under consideration, when the increase is at least 1%, at least 5%, at least 10%, at least 20%, at least 25%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, at least 500%, or at least 1000% greater than the combination of luciferase plus reference celenterazine or luciferase under consideration.
[00138] The term "luminescence" refers to a light output of the OgLuc variant under appropriate conditions, for example, in the presence of a suitable substrate such as celenterazine. The light emission can be measured as an instantaneous or almost instantaneous measure of light output (which is sometimes referred to as “T = 0” or “flash” luminescence), at the start of the luminescence reaction, which can be initiated by addition of the celenterazine substrate. The luminescence reaction in several modalities is carried out in solution. In other modalities, the luminescence reaction is carried out on a solid support. The solution may contain a lysate, for example, from cells in a prokaryotic or eukaryotic expression system. In other embodiments, expression occurs in a cell-free system, or the luciferase protein is secreted in an extracellular medium, such that, as a last resort, it is not necessary to produce a lysate. In some embodiments, the reaction is initiated by injecting appropriate materials, for example, celenterazine, buffer, etc., into a reaction chamber (for example, a well in a multi-well plate, such as a 96-well plate ) containing the luminescent protein. In still other modalities, the OgLuc variant and / or the new celenterazine are introduced into a host and luminescence measurements are made on the host or a portion of it, which may include an entire organism or cells, tissues, explants , or extracts thereof. The reaction chamber can be located in a reading device, which can measure the emission of light, for example, using a photometer or photomultiplier. The light output or luminescence can also be measured over time, for example, in the same reaction chamber for a period of seconds, minutes, hours, etc. The light output or luminescence can be reported as the average over time, the signal degradation half-life, the sum of the signal over a period of time, or the peak output. Luminescence can be measured in Relative Light Units (RLUs).
[00139] The "enhanced luminescence" of an OgLuc variant may be due to one or more of the following characteristics: enhanced light output (ie, clarity), enhanced substrate specificity, enhanced signal stability, and / or the duration intensified signal. Enhanced signal stability includes an increase in the time that the signal from a luciferase continues to luminescence, for example, as measured by the signal degradation half-life in a time-stroke. The enhanced luminescence can be determined with respect to a comparable property of a luciferase such as wild-type OgLuc, an OgLuc variant protein, Renilla luciferase (eg hRluc), or firefly luciferase (eg luciferase Luc2 of Photinus pyralis), combined with a native, known, or new substrate as shown in the Examples below. For example, the luminescence of a particular OgLuc variant in combination with a specific celenterazine (including, known or new, native celenterazines) can be compared to the properties of one of the OgLuc C1 + A4E, IV, or IVY variants combined with any of a known, or new, native celenterazine disclosed herein, using one or more of the assays described in the Examples below. In particular, the enhanced luminescence can be determined by measuring the luminescence signal (RLU) resulting from the incubation of bacterial lysates containing OgLuc variants in question with the substrate, PBI-3939. Measurements are made on a reagent that may contain TERGITOL ™ to provide Glo-type kinetics, for example, in which enzyme inactivation is delayed and the luminescence signal is stabilized, which is described elsewhere in the application. In some embodiments, some variants of luciferase, for example, L27V, with certain compounds, for example, PBI-3939, provide prolonged duration of luminescent emission, or kinetics of similar brightness, in the absence of TERGITOL ™. The luminescence signal can be compared with that of a reference point, such as the C1 + A4E variant with celenterazine or celenterazine-h or Renilla's luciferase with native celenterazine.
[00140] "Enzyme stability" refers to a stability of enzyme activity (ie, tolerance of enzyme activity to reaction conditions). Enhanced enzyme stability refers to enhanced stability of enzyme activity (i.e., enhanced tolerance to reaction conditions). Enhanced enzymatic stability includes enhanced thermal stability (for example, stability at elevated temperatures) and chemical stability (for example, stability, in the presence of inhibitors or denaturing agents, such as detergents, including, for example, TRITON ™ X-100) . Enzymatic stability can be used as a measure of protein stability, in particular under conditions known to be disruptive of the protein structure, such as elevated temperatures or in the presence of chemical denaturing agents. In particular, the stability of the enhanced protein can be determined by means of thermal analysis, as described elsewhere in the application (for example, in Example 28). The luminescence signal can be compared with the reference point of the C1 + A4E variant with celenterazine or celenterazine-h or Renilla's luciferase with native celenterazine.
[00141] "Biocompatibility" refers to a cell's tolerance (for example, prokaryotic or eukaryotic) to a compound of celenterazine and / or luciferase. Biocompatibility of a compound of celenterazine and / or luciferase is related to the stress it causes in the host cell. For example, a luciferase that is not tolerated by the cell (that is, one that tenses a cell), cannot be expressed efficiently within the cell, for example, luciferase can be expressed within the cell, but it has an activity reduced due to the formation of inclusion bodies by the expressed protein. Biocompatibility of a luciferase is related to the ability of cells to support the insertion of the exogenous gene, that is, a transgene containing the gene encoding luciferase or its fragment, in which cells with the transgene do not exhibit manifestations of stress, including induction of stress response pathways, reduced growth rate, and / or reduced viability (for example, reduced number of living cells, reduced membrane integrity, or increased rates of apoptosis). Other indications of cell stress may include changes in gene expression, signaling pathways, and / or regulatory pathways. Enhanced biocompatibility of an OgLuc variant may be due to factors such as enhanced protein expression and / or reduced cell stress. The increased expression of luminescence for a specific polynucleotide encoding an OgLuc variant can be determined in relation to luminescence expression levels for wild-type OgLuc encoding a polynucleotide or OgLuc variant protein, including polynucleotides with optimized codons, where activity luminescence can be used as a means to monitor protein expression levels.
[00142] In particular, the enhanced biocompatibility of the OgLuc variant, a new compound of celenterazine and / or a combination thereof, can be determined by measuring cell viability and / or the rate of growth of cells. For example, the enhanced biocompatibility of OgLuc variants can be determined by measuring cell viability and / or growth rate of cells containing OgLuc variants compared to cells containing firefly or Renilla luciferase or no luciferase, in absence of any celenterazine compound to determine how compatible and / or toxic luciferase is to cells. The enhanced biocompatibility of the new celenterazine compounds can be determined by measuring cell viability in the absence of luciferase expression from cells exposed to the new celenterazine compound compared to known or native celenterazine to determine how compatible and / or toxic the celenterazine compound is. it's for the cells. The enhanced biocompatibility of a combination of an OgLuc variant with a new celenterazine compound can be determined by measuring cell viability and / or growth rate of cells containing the OgLuc variant and exposed to the new celenterazine and in comparison to cells containing luciferase of fireflies or Renilla or no luciferase exposed to native or known celenterazins.
[00143] In particular, the enhanced biocompatibility can be determined using cell viability analysis, as described elsewhere in the application (for example, using a CELLTITER-GLO® assay as described in Example 18, or an apoptosis assay, such as as one, using CASPASE-GLO® technology according to the manufacturer's instructions) or one known in the art. The effect of an OgLuc variant on cell viability or apoptosis can be compared with the effect of a reference luciferase, such as the C1 + A4E variant, a firefly luciferase or Renilla luciferase. The effect of the new celenterazine compound on cell viability or apoptosis can be compared to the effect of native or known cellenterazine compounds on cell viability or apoptosis.
[00144] Enhanced biocompatibility can also be determined by measuring the effect of the OgLuc variant and / or the new celenterazine compound on cell growth or gene expression. For examples, the enhanced biocompatibility of the OgLuc variant can be determined by measuring the number of cells after a period of time or by determining the expression of stress response genes in a sample of cells containing the OgLuc variant compared to cells that contain another luciferase or no luciferase. The enhanced biocompatibility of the new celenterazine compound can be determined by measuring the number of cells after a period of time or by determining the expression of stress response genes in a sample of cells that are exposed to the new celenterazine compound compared to cells exposed to native or known cellenterazines or no celenterazine. The effect of the OgLuc variant on cell growth or gene expression can be compared to a reference luciferase, such as a C1 + A4E variant, a firefly luciferase or Renilla luciferase. The effect of the new celenterazine on cell growth or gene expression can be compared to that of native or known celenterazines.
[00145] The identification of stable, solid cell lines that express an OgLuc variant of the present invention, both in the cytoplasm and as a secreted form, can be facilitated by the light signal of luciferase and the small size of the OgLuc gene. The relatively small genetic sequence is expected to reduce the risk of genetic instability that results from the integration of foreign DNA into a cell's genome. As a result of the increased luminosity of the OgLuc variants and / or the new celenterazines of the present invention, less protein expression, and therefore less DNA needed for transfection, can produce a certain degree of brightness compared to other known luciferases, such as like native OgLuc, firefly or Renilla luciferase, which contributes to an enhanced biocompatibility for OgLuc variants and / or new celenterazins. The enhanced biocompatibility of OgLuc variants can be measured by the amount of DNA or reagents, for example, transfection of chemicals needed in transient transfections to generate cells with the same level of luminescence as cells transfected with other luciferases, for example, OgLuc native, firefly or Renilla luciferase. In some embodiments, the amount of DNA from the OgLuc variant or reagents needed for transfection is less than the amount needed for another luciferase, for example, native OgLuc, firefly or Renilla luciferase, to generate cells transfected with the same level of luminescence obtained with the other luciferase. The enhanced biocompatibility of OgLuc variants can be measured by the cell recovery time after transfection. In some embodiments, the amount of time required for recovery after transfection with the OgLuc variant is less than the time required for the other luciferase, for example, native OgLuc, firefly or Renilla luciferase.
[00146] "Relative specificity of the substrate" is determined by dividing the luminescence of a luciferase in the presence of a test celenterazine substrate by the luminescence of luciferase in the presence of a reference celenterazine substrate. For example, the relative specificity can be determined by dividing the luminescence of a luciferase with a new celenterazine of the present invention by means of the luminescence of luciferase with a different celenterazine (for example, native or known celenterazine, see figure 1, for example, or a new celenterazine other than the present invention). The test celenterazine substrate and the reference celenterazine substrate that are compared are considered a pair of comparison substrates to determine the relative specificity of the substrate.
[00147] The "change in the relative substrate specificity" is determined by dividing the relative substrate specificity of a test luciferase using a pair of comparison substrates by the relative substrate specificity of a reference luciferase using the same pair of substrates comparison. For example, a change in relative specificity can be determined by dividing the relative specificity of a test luciferase substrate with the new celenterazine of the present invention compared to a different celenterazine (for example, known or native celenterazine or a different new celenterazine) of the present invention), by the relative specificity of the substrate of a reference luciferase with the same new celenterazine of the present invention compared to the same different celenterazine used for the test luciferase.
[00148] In some modalities, luminescence with a new celenterazine is compared to luminescence with a different new celenterazine. In some embodiments, luminescence with a native or known celenterazine is compared to luminescence with another native or known celenterazine. In still other embodiments, luminescence with a native or known celenterazine is compared to luminescence with a new celenterazine.
[00149] The new celenterazines of the present invention include properties, such as enhanced physical stability (e.g., enhanced celenterazine stability) or reduced autoluminescence. The physical stability of celenterazine refers to how celenterazine is stable under certain conditions so that it maintains its luminescence capacity, when used as a substrate by a luciferase. Luminescence that is not dependent on the activity of a luciferase or photoprotein is called autoluminescence. Autoluminescence is the luminescence of a substance produced by the energy released in the form of light during degradation or decomposition. For example, autoluminescence can be caused by the spontaneous oxidation of celenterazine from the luminogenic substrate.
[00150] As used in this document, “pure” or “purified” means that one species of the object is the predominant species present (that is, on a molar and / or mass basis, it is more abundant than any other individual species , in addition to water, solvents, buffers, or other common components of an aqueous system in the composition) and, in some embodiments, a purified fraction is a composition in which the species of the object comprises at least about 50% (on a molar basis) ) of all macromolecular species present. Generally, a "substantially pure" composition will contain more than about 80% of all macromolecular species present in the composition, in some embodiments more than about 85%, more than about 90%, more than about 95 %, or more than about 99%. In some embodiments, the object species is purified to essential homogeneity (contaminating species cannot be detected in the composition by conventional detection methods) where the composition essentially consists of a single macromolecular species. Celenterazine Derivatives
[00151] In some embodiments, the present invention provides new celenterazine derivatives of formula (Ia) or (Ib):
where R2 is selected from the group consisting of
C2-5 straight chain alkyl; R6is selected from the group consisting of -H, -OH, -NH2, -OC (O) R or - OCH2OC (O) R; R8is selected from the group consisting of
H or linear cycloalkyl; wherein R3 and R4 are both H or both C1-2 alkyl; W is -NH2, halo, -OH, -NHC (O) R, -CO2R; X is -S-, -O- or -NR22-; Y is -H, -OH, or -OR11; Z is -CH- or -N-; each R11 is independently -C (O) R '' or -CH2OC (O) R ''; R22 is H, CH3, or CH2CH3 each R is independently C1-7 straight chain alkyl or C1-7 branched alkyl; R '' is straight chain C1-7 alkyl or branched C1-7 alkyl; dashed bonds indicate the presence of an optional ring, which can be saturated or unsaturated; with the proviso that when R2 is

with the proviso that when R2 is
linear cycloalkyl; and with the proviso that when R6 is NH2, R2 is
or C2-5 alkyl; or R8 is not

[00152] The term "alkyl", as used here, refers to a monovalent moiety obtained by removing a hydrogen atom from a hydrocarbon compound, and which can be saturated, partially unsaturated, or totally unsaturated. The alkyl group can be a straight or branched chain. An alkyl group can be optionally substituted with, for example, halogen. Examples of straight-chain alkyl groups include, but are not limited to, ethyl, n-propyl, n-butyl, and n-propyl, n-hexyl and n-heptyl. Examples of unsaturated alkyl groups that have one or more carbon-carbon double bonds include, but are not limited to, ethylene (vinyl, -CH = CH2), 2-propenyl (allyl, -CH-CH = CH2), and butenyl . Examples of unsaturated alkyl having one or more carbon-carbon triple bonds include, but are not limited to, ethynyl and 2-propynyl (propargyl). Examples of branched alkyl groups include isopropyl, iso-butyl, sec-butyl, t-butyl and iso-pentyl.
[00153] The term "linear cycloalkyl", as used here, refers to a monovalent moiety obtained by removing a hydrogen atom from a hydrocarbon compound that has 3-5 carbon atoms. Examples of saturated lower cycloalkyl groups include, but are not limited to, groups such as cyclopropyl, cyclobutyl and cyclopentyl. Examples of linear unsaturated cycloalkyl groups that have one or more carbon-carbon double bonds include, but are not limited to, groups such as cyclopropenyl, cyclobutenyl and cyclopentenyl.
[00154] The term "halo", as used here, refers to a halogen, such as Cl, F, Br or I.
[00155] In some modalities, R2 is
and X is O or S. In other embodiments, R2 is C2-5 straight-chain alkyl. In certain modalities, R8 is
, linear cycloalkyl or H. In other embodiments, R8 is benzyl. In some embodiments, R '' is -C (CHs) 3, -CH (CH3) 2, -CH2C (CH3) 3, or -CH2CH (CH3) 2.
[00156] In some embodiments, the present invention provides compounds according to Formula (IIa) or (IIb):
where X is O or S, R6 is H or OH, R11 is as defined above, and the broken bonds indicate the presence of an optional ring.
[00157] In some embodiments, the invention provides compounds according to Formula (IIIa) or (IIIb):
wherein R12 is C2-5 straight chain alkyl, furyl or thienyl, R6 is H or OH, R11 is as defined above, and the broken bonds indicate the presence of an optional ring.
[00158] In some embodiments, the invention provides compounds according to Formula (IVa) or (IVb):
where X is O or S, R6 is H or OH, R18 is H,
or linear cycloalkyl, R3, R4 and R11 are as defined above, and dashed bonds indicate the presence of an optional ring.
[00159] In some embodiments, the invention provides a compound according to Formula (Va) or (Vb):
where R8 is benzyl, R11 is as defined above, and the broken bonds indicate the presence of an optional ring.
[00160] In some embodiments, the present invention provides new celenterazine derivatives of formula (VIa) or (VIb):
where R2 is selected from the group consisting of
C2-5 straight chain alkyl; R6is selected from the group consisting of -H, -OH, -NH2, -OC (O) R or - OCH2OC (O) R; R8 is selected from the group consisting of
, H or linear cycloalkyl; wherein R3 and R4 are both H or both C1-2 alkyl; W is -NH2, halo, -OH, -NHC (O) R, -CO2R; X is -S-, -O- or -NH-; Y is -H, -OH, or -OR11; Z is -CH- or -N-; each R11 is independently -C (O) R '' or -CH2OC (O) R ''; each R is independently C 1-7 straight chain alkyl or C 1-7 branched alkyl; R '' is straight chain C1-7 alkyl or branched C1-7 alkyl; dashed bonds indicate the presence of an optional ring, which can be saturated or unsaturated; with the proviso that when R2 is

with the proviso that when R2 is
or linear cycloalkyl; and with the proviso that when R6 is NH2, R2 is
or C2-5 alkyl; or R8 is not

[00161] Suitable compounds according to the present invention include:
Isomer, Salts and Protected Forms
[00162] Certain compounds may exist in one or more particular geometric, optical, enantiomeric, diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric forms, including, but not limited to, cis- and trans- forms, E- and E- forms Z-, forms c-, t- and r-; endo- and exo forms; R-, S-, and meso- forms; D- and L- forms; d- and l-forms (+) and (-) forms; keto-, enol- and enolate- forms; syn and anti- forms; anticlinical and synclinal forms; α- and β- forms, axial and equatorial forms, dinghy-, chair-, twist-, envelope-, and half-chair forms, and their combinations, hereinafter referred to as “isomers” (or “isomeric forms”).
[00163] It should be noted that, except as discussed below for tautomeric forms, specifically excluded from the term "isomers", as used herein, are structural (or constitutional) isomers (that is, isomers that differ in the connections between atoms in rather than simply the position of the atoms in space). For example, a reference to a methoxy group, -OCH3, should not be understood as a reference to its structural isomer, a hydroxyl group, -CH2OH. Likewise, a reference to ortho-chlorophenyl should not be understood as a reference to its structural isomer, meta-chlorophenyl. However, a reference to a class of structures may well include structurally isomeric forms that fall within that class (for example, C1-7alkyl includes n-propyl and iso-propyl, butyl includes n-, iso-, sec-, and tert-butyl; methoxyphenyl includes ortho-, meta- and parametoxyphenyl).
[00164] Note that specifically included in the term "isomer", are compounds with one or more isotopic substitutions. For example, H can be in any isotopic form, including 1H, 2H (D), and 3H (T); C can be in any isotopic form, including 12C, 13C and 14C; The can be in any isotopic form, including 16O and 18O, and the like.
[00165] Unless otherwise specified, a reference to a particular compound includes all such isomeric forms, including (wholly or partially) racemic mixtures and other mixtures thereof. The methods for the preparation (e.g., asymmetric synthesis) and the separation (e.g., fractional crystallization and chromatographic media) of these isomeric forms are either known in the art or are easily obtained by adapting the methods taught herein, or known ways, in a manner known.
[00166] Unless otherwise specified, a reference to a particular compound also includes ionic, salt, solvate, and protected forms thereof, for example, as discussed below. It may be convenient or desirable to prepare, purify and / or manipulate a corresponding salt of the active compound, for example, a pharmaceutically acceptable salt. Examples of pharmaceutically acceptable salts are discussed in Berge et al., J. Pharm. Sci., 66: 1-19 (1977).
[00167] For example, if the compound is anionic, or has a functional group that can be anionic (for example, -COOH can be -COO-), then a salt can be formed with a suitable cation. Examples of suitable inorganic cations include, but are not limited to, alkali metal ions, such as Na + and K +, alkaline earth cations such as Ca2 + and Mg2 +, and other cations such as Al3 +. Examples of suitable organic cations include, but are not limited to, ammonium ions (i.e., NH4 +) and substituted ammonium ions (for example, NH3R +, NH2R2 +, NHR3 +, NR4 +). Examples of some suitable substituted ammonium ions are those derived from: ethylamine, diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and tromethamine, as well as amino acids, such as lysine and arginine. An example of a common quaternary ammonium ion is N (CH3) 4+.
[00168] If the compound is cationic, or has a functional group that can be cationic (for example, -NH2 can be -NH3 +), then a salt can be formed with a suitable anion. Examples of suitable inorganic anions include, but are not limited to, those derived from the following inorganic acids: hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfurous, nitric, nitrous, phosphoric, and phosphorous. Examples of suitable organic anions include, but are not limited to, those derived from the following organic acids: acetic, propionic, succinic, glycolic, stearic, palmitic, lactic, malic, pamoic, tartaric, citric, gluconic, ascorbic, maleic, hydroxylenic, phenylacetic, glutamic, aspartic, benzoic, cinnamic, pyruvic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric, phenyl sulfonic, toluenesulfonic, methanesulfonic, ethanesulfonic, ethanedisulfonic, oxalic, pantothenic, isotonic, valetic, isonic acid, lithiumic, isonic acid, isotonic, isotonic, valetic, isotonic, isotonic, valetic, isotonic, isotonic, isotonic, isotonic, isotonic. Examples of suitable polymeric anions include, but are not limited to, those derived from the following polymeric acids: tannic acid, carboxyl cellulose.
[00169] It may be convenient or desirable to prepare, purify and / or manipulate a corresponding solvate of the active compound. The term "solvate" is used here in the conventional sense to refer to a solute complex (for example, active compound, active compound salt) and solvent. If the solvent is water, the solvate can be conveniently referred to as a hydrate, for example, a monohydrate, a dihydrate, a trihydrate, etc.
[00170] It may be convenient or desirable to prepare, purify and / or manipulate the active compound in a chemically protected form. The term "chemically protected form", as used herein, refers to a compound in which one or more reactive functional groups are protected from undesirable chemical reactions, that is, they are in the form of a protected or protective group (also known as a masked or masking group or a blocked or blocking group). By protecting a reactive functional group, reactions involving other unprotected reactive functional groups can be carried out without affecting the protected group: the protecting group can be removed, usually in a subsequent step, without substantially affecting the rest of the molecule. See, for example, Protective Groups in Organic Synthesis (T. Green and P. Wuts, Wiley, 1999).
[00171] For example, a hydroxy group can be protected as an ether (OR) or an ester (-OC (= O) R), for example, as: a t-butyl ether; a benzyl, benzhydryl (diphenylmethyl), or trityl (triphenylmethyl) ether; a trimethylsilyl or t-butyldimethylsilyl ether; or an acetyl ester (-OC (= O) CH3, -OAc). For example, an aldehyde or ketone group can be protected as an acetal or ketal, respectively, in which the carbonyl group (> C = O) is converted to a diether (> C (OR) 2), by reaction with, for example , a primary alcohol. The aldehyde or ketone group is easily regenerated by hydrolysis using a large excess of water in the presence of acid. For example, an amine group can be protected, for example, as an amide or urethane, for example, as: methyl amide (-NHCO-CH3); a benzyloxy amide (-NHCO-OCH2C6H5, - NHCbz); as a t-butoxy amide (-NHCO-OC (CH3) 3, -NH-Boc); a 2-biphenyl-2-propoxy amide (-NHCO-OC (CH3) 2C6H4C6H5, -NH-Bpoc), as a 9-fluorenylmethoxy amide (-NH-Fmoc), as a 6-nitroveratryloxy amide (-NH-Nvoc) , as a 2-trimethylsilylethyloxy amide (-NH-Teoc), as a 2,2,2-trichloroethyloxy amide (-NH-Troc), as an allyloxy amide (-NH-Alloc), as a 2 (-phenylsulfonyl) ethyloxy amide (-NH- Psec); or, in appropriate cases, as an N-oxide.
[00172] For example, a carboxylic acid group can be protected as an ester, for example, as: a C1-7 alkyl ester (for example, a methyl ester; a t-butyl ester); a C1-7 haloalkyl ester (for example, C1-7 trihaloalkylester); a triC1-7 alkylsilyl-C1-7 alkyl ester; or a C5-20 aryl-C1-7 alkyl ester (for example, a benzyl ester; a nitrobenzyl ester); or as an amide, for example, as a methyl amide.
[00173] For example, a thiol group can be protected as a thioether (SR), for example, as: a benzyl thioether; an acetamidomethyl ether (-S- CH2 NHC (= O) CH3). Synthesis of Celenterazine Derivatives
[00174] The celenterazine derivatives according to the present invention can be synthesized according to the methods described in Examples 1-16. Luciferases of mutant Oplophorus
[00175] In embodiments of the present invention, various techniques as described herein have been used to identify the amino acid substitution sites to produce an improved synthetic OgLuc polypeptide. Other techniques were used to optimize the codons of the polynucleotides that encode the various polypeptides in order to enhance the expression of the polypeptides. It has been found that by making one or more amino acid substitutions, either alone or in various combinations, synthetic OgLuc-type polypeptides are produced having enhanced luminescence (e.g., enhanced brightness, enhanced signal stability, enhanced stability of the enhanced enzyme, and / or alteration of the relative specificity of the substrate). In addition, including one or more codon-optimized substitutions, the polynucleotides encoding the various synthetic OgLuc variant polypeptides produced enhanced expression of the polypeptides in various prokaryotic and eukaryotic expression systems. One embodiment of the present invention is a polynucleotide that encodes a synthetic OgLuc polypeptide variant that is soluble and active in monomeric form, when expressed in prokaryotic and / or eukaryotic cells.
[00176] The OgLuc variants of the present invention can be coupled to any molecule of interest or protein of interest. In some embodiments, the variants are fusion proteins, for example, some variants are coupled to a HaloTag® polypeptide attached to either the N-terminal or C-terminal. Unless otherwise stated, variants that are mergers of HaloTag® include 'HT7' as part of the name, for example, 'IVY-HT7'. In some embodiments, a signal sequence (for example, the naturally occurring Oplophorus gracilirostris signal sequence) is attached to the N-terminus of the fusion protein to facilitate the secretion of the fusion protein from the cell. Signal sequences, in addition to the naturally occurring OgLuc luciferase signal sequence, are known in the art to facilitate the secretion of proteins in mammalian cells or other types of cells. The signal sequences, in combination with the membrane anchoring sequences, can be used to position or display the OgLuc variants on the outer surface of the cell membrane. Other methods, known in the art, can also be used to position OgLuc variants on the membrane or other locations within the cell.
[00177] In some embodiments, the invention provides a modified decapod luciferase that has enhanced luminescence in relation to a corresponding parental variant decapod luciferase. For example, the parental OgLuc variant is C1 + A4E, IVY, IV, QC27, QC27-9a, 9B8, 9B8 opt + K33N, 9B8 opt + K33N + 170G, V2 or “L27V”. In another embodiment, the invention provides a modified decapod luciferase, which uses a new celenterazine. In one embodiment, the modified decapod luciferase has a change in relative specificity for new, or known, native celenterazines. In one embodiment, the modified decapod luciferase has a change in relative specificity in relation to a corresponding parental variant decapod luciferase.
[00178] In some embodiments, the corresponding decapod parental variant luciferase is a decapod species, including several species of the families within the order of decapods, including, without limitation, luciferases of the Aristeidae family, including Plesiopenaeus coruscans; the Pandalidea family, including Heterocarpus and Parapandalus richardi, the Solenoceridae family, including Hymenopenaeus debilis and Mesopenaeus tropicalis; the family of, including Lucifer typus; the Sergestidae family, including Sergestes atlanticus, Sergestes arcticus, Sergestes armatus, Sergestes pediformis, Sergestes cornutus, Sergestes edwardsi, Sergestes henseni, Sergestes pectinatus, Sergestes sargassi, Sergestes similis, Sergestes vigilax, Sergia lucisis, Sergia challengeri, , Sergia potens, Sergia robusta, Sergia scintillans, and Sergia splendens; the Pasiphaeidae family, including Glyphus marsupialis, Leptochela bermudensis, Parapasiphae sulcatifrons, and Pasiphea tarda; the family oplophoridae including Acanthephyra acanthitelsonis, Acanthephyra acutifrons, Acanthephyra brevirostris, Acanthephyra cucullata, curtirostris Acanthephyra, Acanthephyra exempted, Acanthephyra gracilipes, Acanthephyra kingsleyi, Acanthephyra media Acanthephyra microphthalma, pelagica Acanthephyra, Acanthephyra prionota, Acanthephyra purpurea, blood Acanthephyra, Acanthephyra sibogae , stylorostratis Acanthephyra, spina Ephyrina, Ephyrina figueirai, Ephyrina koskynii, Ephyrina ombango, Hymenodora glacialis, Hymenodora gracilis Meningodora miccyla, Meningodora mollis, Meningodora vesca, Notostomus gibbosus, Notostomus auriculatus, Oplophorus gracilirostris, Oplophorus grimaldii, Oplophorus novaezealandiae, Oplophorus spinicauda, Oplophorus foliaceus, Oplophorus spinosus, Oplophorus typus, Systellaspis braueri, Systellaspis cristata, Systellaspis debilis, and Systellaspis pellucida; and the Thalassocaridae family, including Chlorotocoides spinicauda, Thalassocaris crinita, and Thalassocaris lucida. In certain embodiments, the modified luciferase has an increased luminescence emission, for example, at least 1.3-fold, at least 2-fold, or at least 4-fold, in a prokaryotic cell and / or a eukaryotic cell in relation to the luciferase of the corresponding wild type. In some embodiments, one or more properties of the modified decapod luciferase is compared to comparable properties of a luciferase from another species, for example, a firefly luciferase or a Renilla luciferase.
[00179] In some modalities, the OgLuc variant has at least 60%, for example, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, or 99%, or 100%, amino acid sequence identity for SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 27, 35, 37, 39, 41 , 43, 45, 47, 49, 51, 53, 56, 58, 60, 62, 64, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, or 95. In some embodiments, the OgLuc variant, or a functional fragment thereof, has more than 5 differences, or more preferably, no more than 4, 3, 2, or 1 difference, or more preferably no difference, in that the differences occur in the positions corresponding to the standard position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17, or 18 of Formula (VII) according to Table 4. Differences may also include gaps or insertions between the Standard Position of Table 4.
[00180] In some embodiments, the OgLuc variant of the invention has one or more heterologous amino acid sequences at the N-terminal, C-terminal, or both (a fusion polypeptide such as one with an epitope or fusion tag), which optionally directly or indirectly interact with a molecule of interest. In some modalities, In some modalities, the presence of the heterologous sequence (s) does not substantially alter the luminescence of the OgLuc variant before or after interaction with the molecule of interest. In some embodiments, the heterologous amino acid sequence is an epitope tag. In some embodiments, the heterologous amino acid sequence is one that, during or after interaction with a molecule of interest, undergoes a conformational change that, in turn, alters the activity of the OgLuc variant, for example, an OgLuc variant with such an amino acid sequence is useful for detecting allosteric interactions. The OgLuc variant or a merger with the OgLuc variant or a fragment thereof can be used as a reporter.
[00181] In some embodiments, a fragment of an OgLuc variant of the invention is fused to a heterologous amino acid sequence, the fusion thus forming a beta-barrel, whose fusion protein is capable of generating luminescence of an occurring celenterazine natural or an analogue thereof including the various known celenterazines discussed herein, or a new celenterazine of the present invention.
[00182] Also provided is a polynucleotide encoding an OgLuc variant of the invention or a fusion thereof, an isolated host cell having the polynucleotide or OgLuc variant or a fusion thereof, and methods of using the polynucleotide, a variant of OgLuc or fusion of the same or host cell of the invention.
[00183] The term "identity", in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid or nucleotide residues that they are the same when compared and aligned for maximum correspondence over a comparison window or region designated as measured using any number of sequence comparison algorithms, or by manual alignment and visual inspection. Sequence alignment methods for comparison are well known in the art. The optimal alignment of sequences for comparison can be conducted by the algorithm of Smith et al., (J. Mol. Biol. 147: 195-197 (1981)), by the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol., 48: 443-453 (1970)), for the search for Pearson and Lipman's similarity method, (Proc. Natl. Acad. Sci. USA, 85: 2444-2448 (1988)), for implementations of computerized algorithms , for example, FASTA, SSEARCH, GGSEARCH (available at the University of Virginia FASTA server by William R. Pearson http://fasta.bioch.virginia.edu/fasta_www2/fasta_intro.shtml), the Clustal program series (Chenna et al., Nucl Acids Res. 31 (13): 3497-3500 (2003); examples available at http://www.ebi.ac.uk or http://www.ch.embnet.org), or other analyzes of software sequence. It is known in the art that the generation of alignments with maximum correspondence between polypeptide sequences with significant sequence changes (for example, altered order, missing / added domains, repeated domains, scrambled domains, circular permutation) may involve the use of specialized methods, such as the ABA method (Raphael et al., Genome Res. 14 (11): 2336-2346 (2004)), other suitable methods, or aligning with two identical concatenated copies of the polypeptide sequences.
[00184] The term "nucleic acid molecule", "polynucleotide" or "nucleic acid sequence" as used here, refers to the nucleic acid, including DNA or RNA, which comprises the coding sequences necessary for the production of a polypeptide or protein precursor. The encoded polypeptide can be a full length polypeptide, a fragment of it (less than full length), or a fusion of either the full length polypeptide or a fragment of it with another polypeptide, obtaining a fusion polypeptide .
[00185] A polynucleotide that encodes a protein or polypeptide, a sequence of nucleic acids that comprises the coding region of a gene, or in other words, the sequence of nucleic acids that encodes a gene product. The coding region can be present in a form of cDNA, genomic DNA or RNA. When present in the form of DNA, the oligonucleotide can be single-stranded (for example, sense strand) or double-stranded. Suitable control elements, such as promoters / enhancers, splice junctions, polyadenylation signals, etc., can be placed in close proximity to the coding region of the gene, if necessary, to allow for proper initiation of transcription and / or processing of the primary RNA transcript. Other control or regulatory elements include, but are not limited to, transcription factor binding sites, splicing signals, polyadenylation signals, termination signals and stimulating elements.
[00186] By "peptide", "protein" and "polypeptide" are meant chains of amino acids of varying lengths, regardless of post-translational modification (for example, glycosylation or phosphorylation). The nucleic acid molecules of the invention encode an artificial (i.e., synthetic) variant protein or polypeptide fragment thereof, which has an amino acid sequence that is at least 60%, for example, at least 65%, 70% , 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the amino acid sequence of the parental protein from which it is derived, in that the parental protein can be a naturally occurring sequence (native or wild-type), or a variant sequence that is further modified. The term "fusion polypeptide" or "fusion protein" refers to a chimeric protein containing a reference protein (for example, the OgLuc variant) joined to the N- and / or C-terminus of one or more heterologous sequences (for example, a non-OgLuc polypeptide). The heterologous sequence may include, but is not limited to, reporter proteins, such as the HALOTAG® fusion protein (Promega Corp), FlAsH (fluorescein arsenic helix ligand) and, ReAsH (red arsenic helix ligand) (for example , LUMIOTM tag (Invitrogen) recognition sequence), chloramphenicol acetyltransferase (CAT), β-galactosidase (β-Gal), lactamase (P-gal), neomycin resistance (neo), GUS, galactopyranoside, green fluorescent protein (GFP ), luciferase (for example, a Renilla reniformis luciferase, a firefly luciferase (for example, Photinus pyralis or Photuris pennsylvanica), or a beetle luciferase (for example, Pyrophorus plagiophthalamus or Pyrearinus termitilluminans) or a vagalume luciferase (vagalume poriferum) example, Phrixothrix hirtus), xylosidase, thymidine kinase, arabinosidase and SNAP-tag, CLIP-tag, ACP-tag and MCP-tag (New England Biolabs) In one embodiment, a chimeric protein contains a variant of OgLuc attached to N- terminal d and a HALOTAG® fusion protein (Promega Corp.). In another embodiment, a chimeric protein contains an OgLuc variant attached at the C-terminus to a HaloTag® fusion protein.
[00187] Nucleic acids are known to contain different types of "mutations", which refer to a change in the sequence of a nucleotide at a particular base position in relation to the wild type sequence. Mutations can also refer to the insertion or deletion of one or more bases so that the nucleic acid sequence differs from a reference sequence, for example, a wild type sequence, or a replacement with a stop codon. A "substitution" refers to a change of an amino acid at a particular position in a sequence, for example, a change from A to E, at position 4.
[00188] The term "vector" refers to nucleic acid molecules into which DNA fragments can be inserted or cloned and can be used to transfer the DNA segment (s) in a cell and is capable of replication in a cell. Vectors can be derived from plasmids, bacteriophages, viruses, cosmids and the like.
[00189] The term "wild-type" or "native" as used here, refers to a gene product or gene that has the characteristics of the gene product or gene isolated from a naturally occurring source . A wild type gene is one that is most frequently observed in the population and is thus arbitrarily referred to as the form of the “wild type” gene. In contrast, the term "mutant" refers to a gene or gene product that shows changes in the sequence and / or functional properties (i.e., altered characteristics) when compared to the wild type gene or gene product. Note that naturally occurring mutants can be isolated; these are identified by the fact that their characteristics are altered when compared to the wild type gene or gene product. Exemplary Polynucleotides and Proteins
[00190] The present invention includes a variant of OgLuc or protein fragments thereof, for example, those with deletions, for example, a deletion of about 1 to 5 residues, and chimeras (fusions) of them (see Patent Publication US No. 2009/0253131 and WIPO Publication WO 2007/120522, the disclosures of which are hereby incorporated by reference), having at least one substitution of amino acids in relation to a wild-type OgLuc, which results in the substitution of the OgLuc variant having enhanced stability, enhanced luminescence, for example, increased luminescence emission, greater luminescence kinetics stability, and / or change in luminescence color. The sequences of an OgLuc variant are substantially the same as the amino acid sequences of a corresponding wild type OgLuc. A polypeptide or peptide having substantially the same sequence means that an amino acid sequence is largely, but not entirely, the same and retains the functional activity of the sequence to which it is related. In general, two amino acid sequences are substantially the same if they are at least 60%, for example, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%, but less than 100%, of sequence identity. In some embodiments, the OgLuc variant is encoded by a recombinant polynucleotide. In some modalities, the OgLuc variant, or a functional fragment thereof, has no more than 5 differences, or more preferably no more than 4, 3, 2 or 1 difference, or more preferably, there are no differences, in which the differences occur in the positions corresponding to the standard position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17 or 18, of Formula (VII) according to Table 4. Differences can also include gaps, insertions or changes between the standard positions in Table 4.
[00191] The OgLuc variant proteins or fusion proteins of the invention can be prepared by recombinant methods or by chemical synthesis methods of solid phase peptides. Such methods are known in the art. Methods of Use and Kits
[00192] The compounds and proteins of the invention can be used in any form of luciferases and luciferase substrates, for example, celenterazins, have been used. For example, they can be used in a bioluminogenic method that employs a cellenterazine analogue to detect one or more molecules in a sample, for example, an enzyme, a cofactor for an enzymatic reaction, an enzyme substrate, an enzyme inhibitor, an enzyme activator, or OH radicals or one or more conditions, for example, redox conditions. The sample may include an animal (for example, a vertebrate animal), a plant, a fungus, physiological fluid (for example, blood, plasma, urine, mucous secretions and the like), a cell, a cell lysate, a cell supernatant or a purified fraction of a cell (for example, a subcellular fraction). The presence, quantity, spectral distribution, emission kinetics or specific activity of such molecules can be detected or quantified. The molecule can be detected or quantified in solution, including multiphase solutions (for example, emulsions or suspensions), or on solid supports (for example, particles, capillaries or container vessels). In some embodiments, the OgLuc variant can be used in luminescence-based assays to detect an enzyme of interest, for example, CYP450 enzymes, MAO A or B enzyme, a caspase, etc. The new celenterazines could be used with photoproteins, such as aequorin, obelin or iPhotina. In some embodiments, the OgLuc variant can be used as an energy donor for another molecule (for example, for a fluorophore, a chromophore, or a nanoparticle).
[00193] The invention also provides a polynucleotide that encodes a transcription reporter. In some embodiments, the OgLuc variant or fragment thereof can be operably linked to transcriptional regulation sequences, for example, one or more enhancers, a promoter, a transcription termination sequence or a combination thereof, to form a cassette of expression. For example, the OgLuc variant can be operably linked to a minimal promoter and cAMP response element (CRE).
[00194] The proteins of the invention can be used as biosensors, such as, for example, a variant of OgLuc, which, in the presence of another molecule (for example, one or more molecules of interest), or under certain conditions, have a or more of the changed activities. After interacting with a molecule of interest or being subject to certain conditions, the biosensor undergoes a conformational change, or is chemically altered which causes a change in the activity of the enzyme or luminescence, for example, specific activity, spectral distribution, or kinetics of issuance. For example, the OgLuc variant of the present invention, for example, a circularly exchanged variant, can comprise an interaction domain for a molecule of interest. Alternatively, for example, the OgLuc variant can be coupled to an energy receptor, for example, a fluorescent protein, and comprises an interaction domain that modifies the energy transfer efficiency from the enzyme to the energy receptor. For example, the biosensor can be generated to detect proteases, kinases, a linker, a binding protein, such as an antibody, cyclic nucleotides such as cAMP or cGMP, or a metal such as calcium, by inserting a sensor region appropriate in the variant sequence of OgLuc. One or more regions of the sensor can be inserted at the C-terminal, N-terminal end, and / or at one or more suitable locations in the polypeptide sequence, where the sensor region comprises one or more amino acids. In the case of a circularly exchanged OgLuc variant, the region sensor can be inserted between the N- and C-terminals of the original OgLuc variant. In addition, one or all of the inserted sensor regions can include linker amino acids to couple the sensor to the rest of the OgLuc variant polypeptide. Examples of luciferase biosensors are disclosed in US Patent Application publication 2005/0153310 and 2009/0305280 and PCT publication WO 2007/120522 A2, each of which is incorporated herein by reference.
[00195] In several modalities, the OgLuc variants disclosed here can be used to transfer energy to an energy receiver, for example, in Bioluminescent Resonance Energy Transfer Analysis (BRET). For example, the OgLuc variants used in BRET analysis can be used to determine whether two molecules are able to bind to each other or to colocalize in a cell. For example, a variant of OgLuc can be used as a bioluminescence donor molecule that is combined with a molecule or protein of interest to create a first fusion protein. In several embodiments, the first fusion protein contains a variant of OgLuc and a protein of interest. In several embodiments, the first fusion proteins containing the OgLuc variant can be used in BRET analysis for detection of proteins / protein interactions in systems, including, but not limited to, cell lysates, intact cells and live animals. In several modalities, HALOTAG® can be used as a fluorescent receptor molecule. In some embodiments, HALOTAG® can be fused with a second protein of interest or a variant of OgLuc. For example, a variant of OgLuc can be fused with HALOTAG®, expressed in cells or animals, and labeled with a fluorescent HALOTAG® linker, such as HALOTAG® TMR linker. The fusion can subsequently be excited by fluorescence in the presence of a cell permeate OgLuc substrate. In some embodiments, BRET can be performed using OgLuc variants in combination with fluorescent proteins, including, but not limited to, Fluorescent Green Protein (GFP) or Fluorescent Red Protein (RFP), or fluorescent markers include fluorescein, green rhodamine, Oregon green , or Alexa 488, to name just a few non-limiting examples.
[00196] In several embodiments, the OgLuc variants and / or the new celenterazines of the present invention can be used in protein complementation assays (APC), to detect the interaction of two biomolecules, for example, polypeptides. For example, an OgLuc variant of the present invention can be separated into two fragments at a tolerant separation site (s) and each fragment of the separated OgLuc variant can be fused to one of a pair of polypeptides of interest believed to be interact, for example, FKBP and FRB. If the two polypeptides of interest do interact, the OgLuc fragments then come in close proximity to each other to reconstitute the functional active OgLuc variant. In some embodiments, the activity of the reconstituted OgLuc variant can then be detected and measured using either a native or known celenterazine or a new celenterazine of the present invention. In some embodiments, the OgLuc variant of disvision can be used in a more general complementation system similar to lac-Z (Langley et al., PNAS 72: 1254-1257 (1975)) or ribonuclease S (Levit and Berger, J Biol Chem 251: 1333-1339 (1976)). In some embodiments, an OgLuc variant fragment (designated “A”) known to complement with another OgLuc variant fragment (“B”) can be fused to a target protein, and the resulting fusion can be monitored by luminescence in a B fragment containing cells or cell lysate. In some embodiments, the source of fragment B may be the same cell (for example, if the gene is fragment B it is integrated into the cell's genome or is contained in another plasmid in the cell), or it may be a purified or lysate protein derived from another cell. In some embodiments, this same fusion protein (fragment A) can be captured or immobilized using a fusion between fragment B and a polypeptide such as HALOTAG® capable of binding to a solid support. In some embodiments, luminescence can be used successfully to demonstrate capture or quantify the amount of material retained.
[00197] In various embodiments, the OgLuc and / or new cellenterazine variants of the present invention can be used to quantify celenterazine. In some embodiments, a celenterazine (for example, a known or native celenterazine, or a new celenterazine of the present invention) can be used as a probe with a specific biochemical activity, for example, apoptosis and drug metabolism. In some embodiments, the concentration of celenterazine is coupled with a specific enzyme activity of a "pro-celenterazine" or "pro-substrate" that can be performed by the specific enzyme of interest. In some embodiments, pro-celenterazine is a molecule that cannot directly support luminescence when combined with luciferase, but can be converted to celenterazine through catalytic processing by a specific enzyme of interest. In some embodiments, the method can be used for enzymes such as those used in drug metabolism, for example, cytochrome P450 enzymes, monoamine oxidase and glutathione S-transferase, and apoptosis, for example, caspases. For example, celenterazine (for example, a known or native celenterazine, or a new celenterazine of the present invention) can be modified to contain a cleavable group, such as 6'-O-methyl. In some embodiments, when incubated with a specific cytochrome P450 enzyme, 6'-O-methyl is cleaved, and the pro-celenterazine converted to celenterazine which can be detected with an OgLuc variant of the present invention. In some embodiments, pro-celenterazine can be combined with other components necessary to support luminescence, for example, luminescent proteins, such as an OgLuc variant of the present invention, to provide a single reagent and a homogeneous assay. For example, when the reagent is added to a sample, luminescence is generated as pro-celenterazine is converted to celenterazine. In various modalities, similar assays can be developed for other enzymes, small molecules, or other cellular processes that can be linked to the generation of celenterazine from pro-celenterazine.
[00198] In various embodiments, the OgLuc variants and / or the new celenterazines of the present invention can be used as genetic transcription reporter systems. In some embodiments, OgLuc variants can be multiplexed with a luciferase that emits light at a different wavelength, for example, red beetle luciferase (CHROMA-LUC ™; Promega Corp.) For example, if an OgLuc variant from The present invention is used as a functional reporter, so the red CHROMA-LUC ™ luciferase can be used to control non-specific effects on genetic regulation or to normalize for transfection efficiency. In some embodiments, the luminescence generated from the OgLuc (approximately 460 nm) and red CHROMA-LUC ™ variant (approximately 610 nm) can be easily resolved using a luminometer with wavelength discriminating filters, allowing the measurement of both the signals from the same sample. In another example, an OgLuc variant of the present invention could be used as a transcriptional reporter and paired with a luciferase that emits light at a different wavelength contained in an assay reagent. For example, an OgLuc variant of the present invention could be used as a transcriptional reporter and paired with either an aequorin firefly biosensor or circularly exchanged cAMP, or both at the same time, to detect multiple pathways in a single sample. In such a system, for example, aquorin could be used for the detection and / or quantification of calcium, the biosensor for the detection and / or measurement of cAMP, and a variant of OgLuc for monitoring the expression of downstream genes. In another example, a variant of OgLuc can be used with one or more additional luciferases, where the luminescence of each luciferase can be measured separately using selective enzyme inhibitors. For example, the luminescence of a first luciferase can be measured after adding appropriate substrates and buffers, followed by measuring a second luciferase by subsequently adding appropriate substrates and buffers and one or more selective inhibitors for the first luciferase. In another example, the luciferase contained in an assay reagent can be used to measure a specific aspect of cell physiology, for example, ATP to estimate cell viability, or caspase activity to estimate cell apoptosis.
[00199] In various embodiments, the OgLuc variants of the present invention can be used as reporters in difficulty in transfecting cell lines or, perhaps, even in primary cells that do not divide, for example, stem cells or HepG2 cells. Due to their high signal strength, the OgLuc variants of the present invention will allow detectable luminescence when the transfection efficiency is low. In some embodiments, OgLuc variants can be used as reporters in cells that are especially sensitive to conditions associated with transfection, for example, that are sensitive to high concentrations of DNA or to the addition of transfection reagent. Thus, in various modalities, due to the enhanced luminescence of OgLuc variants of the present invention, an adequate level of luminescence can be achieved by using lower concentrations, less DNA, less transfection reagents, and / or shorter times after transfection before starting an assay so that there is a reduced toxicity load on sensitive cells. In several modalities, the greater luminescence of the OgLuc variants will also allow a signal to be detected at points in time much later. In yet other embodiments, the OgLuc variants could be used as reporters for native single-copy promoters.
[00200] In various embodiments, the OgLuc variants of the present invention can be used as fusion markers for a target protein of interest, as a way of controlling the intracellular levels of the target protein. In some embodiments, OgLuc variants can be used to monitor the specific proteins involved in the stress response pathways (eg, DNA damage, oxidative stress, inflammation) in cells as a way to probe the role that various types of stimuli can reproduce in these pathways. In some embodiments, OgLuc variants can also be used as a means to monitor the cellular traffic of a target protein. For example, OgLuc variants can also be fused to viral genomes (for example, HIV, HCV), so that levels of titration, that is, infectivity, can be monitored in cells after treatment with potential antiviral agents. In some embodiments, the variants can also be fused with green fluorescent protein (GFP) or HALOTAG® (in addition to a target protein), for separating fluorescence-activated cells (FACS) to identify high-expression clones.
[00201] In several modalities, the identification of solid stable cell lines, which express an OgLuc variant of the present invention, either in the cytoplasm, or as a secreted form, can be facilitated by the enhanced signal of the OgLuc variant and the small size of the OgLuc gene. The relatively small gene sequence should reduce the risk of genetic instability that results from the integration of foreign DNA into a cell's genome.
[00202] In various embodiments, the OgLuc variants of the present invention can be integrated into a variety of different immunoassay concepts. For example, a variant of OgLuc can be fused with a primary or secondary antibody to provide a method of detecting a particular analyte. As another example, a variant of OgLuc can be fused to protein A or protein G, and then the fusion can be used to detect a specific antibody bound to a particular analyte. As another example, a variant of OgLuc can be fused with streptavidin and used to detect a specific biotinylated antibody bound to a particular analyte. As yet another example, complementary fragments of an OgLuc variant can be fused with primary and secondary antibodies, where the primary antibody recognizes a particular analyte, and the secondary antibody recognizes the primary antibody. In some modalities, the variant activity of OgLuc would be reconstituted in the presence of analyte. As yet another example, a variant of OgLuc can be combined with an analyte (for example, prostaglandins) and used in a competitive sandwich ELISA format. The OgLuc variant conjugated to an analyte can also be used to detect antibodies capable of binding to the analyte, where the binding activity allows the OgLuc variant to be selectively linked to the antibody. An example of using Renilla's luciferase to quantitatively measure patient antibody titers to an antigenic target is the Luciferase Immunoprecipitation System (Burbelo et al., Expert Review of Vaccines 9 (6): 567-578 (2010)) .
[00203] In various embodiments, the OgLuc variants and new substrates of the present invention can be used for the detection of luminescence in living cells. In some embodiments, a variant of OgLuc can be expressed in cells (like a reporter or otherwise), and cells treated with a celenterazine, for example, a new celenterazine like PBI-3939, which will permeate cells in culture, can react with the OgLuc variant and generate luminescence. In addition to being permeable to the cell, PBI-3939 shows biocompatibility comparable to that of native celenterazine, in terms of cell viability. In some embodiments, a version of PBI-3939 containing chemical modifications known to increase the stability of native celenterazine in the medium can be synthesized and used for more robust live cell-based OgLuc reporter assays. In still other embodiments, a sample (including cells, tissues, animals, etc.) containing an OgLuc variant and / or a new celenterazine of the present invention can be assayed using various imaging and microscopic techniques. In still other embodiments, a secretible OgLuc variant is expressed in cells as part of a reporter system in living cells.
[00204] In several modalities, the OgLuc variants and / or the new celenterazines disclosed here can be supplied as part of a kit. The kit may include one or more OgLuc variants as disclosed herein (in the form of a polypeptide, a polynucleotide, or both) and / or a celenterazine, together with the reagents and instructions appropriate to allow a user to perform assays such as those disclosed here. Celenterazine can be any of the native, known or new celenterazines disclosed herein. The kit may also include one or more plugs, such as those disclosed herein. Vectors and Host Cells That Encode a Modified Luciferase or Mergers of the Same
[00205] Since a nucleic acid molecule encoding a desirable OgLuc variant or a fragment thereof, such as with a luminescence activity or that can be complemented by another molecule to result in luminescent activity, or a fusion of the same with the luminescence activity, an expression cassette encoding the OgLuc variant or a fragment thereof, for example, one for complementation or a fusion of it with the luminescence activity, can be prepared. For example, a nucleic acid molecule comprising a nucleic acid sequence encoding an OgLuc variant is optionally operatively linked to transcriptional regulatory sequences, for example, one or more enhancers, a promoter, a transcription termination sequence or a combination of it, to form an expression cassette. The nucleic acid molecule or expression cassette can be introduced into a vector, for example, a plasmid or viral vector, which optionally includes a selectable marker gene, and the vector introduced into a cell of interest, for example, a prokaryotic cell such such as E. coli, Streptomyces spp., Bacillus spp., Staphylococcus spp. and the like, as well as eukaryotic cells, including a plant (or monocot dicot), fungi (including yeasts, for example, Pichia, Saccharomyces or Schizosaccharomyces), or a mammalian cell, their lysates, or a mixture of transcription / in vitro translation. Mammalian cells include, but are not limited to, bovine, caprine, ovine, canine, feline, non-human primate, for example, apes, and human cells. Mammalian cell lines include, but are not limited to, CHO, COS, HEK293, Hela, CV-1, SH-SY5Y and NIH 3T3 cells, although several other cell lines can also be used as well.
The expression of a coded OgLuc variant can be controlled by any promoter capable of expression in prokaryotic cells or eukaryotic cells, including synthetic promoters. Prokaryotic promoters include, but are not limited to, SP6, T7, T5, tac, bla, trp, gal, lac or maltose promoters, including any fragment that has promoter activity. Eukaryotic promoters include, but are not limited to, constitutive promoters, for example, viral promoters, such as CMV, SV40 and RSV promoters, as well as regulated promoters, such as, an inducible or repressible promoter such as the tet promoter, the hsp70 promoter and CRE-regulated synthetic promoter, including any fragment that has promoter activity. The expression of a coded OgLuc variant can also be controlled by means of post-transcriptional processes, such as by RNA processing or regulation of translation, for example, by RNAi, miRNA, shRNA, siRNA, or RNA or protein degradation. The nucleic acid molecule, expression cassette and / or vector of the invention can be introduced into a cell by any method, including, but not limited to, calcium-mediated transformation, electroporation, microinjection, lipofection, and the like. Optimized sequences, and vectors and host cells that encode a variant of OgLucs
An isolated nucleic acid molecule (polynucleotide) is also provided which comprises a nucleic acid sequence encoding an OgLuc variant of the invention, a functional fragment thereof or a fusion protein thereof. In some embodiments, the isolated nucleic acid molecule comprises a sequence of nucleic acids that is optimized for expression in at least one selected host. Optimized sequences include sequences that are codon optimized, that is, the codons that are used most frequently in one organism in relation to another organism, for example, a distantly related organism, as well as modifications to add or modify Kozak and / or introns, and / or to remove unwanted sequences, for example, the binding sites of potential transcription factors. Such optimized sequences can provide enhanced expression, for example, increased levels of protein expression, when introduced into a host cell. Examples of optimized sequences are disclosed in US Patent Nos. 7,728,118 and US Patent Publications No. 2008/0070299, 2008/0090291, and 2006/0068395, each of which is incorporated herein by reference.
[00208] In some embodiments, the polynucleotide includes a nucleic acid sequence that encodes an OgLuc variant of the invention, the nucleic acid sequence of which is optimized for expression in a mammalian host cell. In some embodiments, an optimized polynucleotide does not hybridize with the corresponding non-optimized sequence, for example, it does not hybridize with the non-optimized sequence under medium or high stringency conditions. The term "rigor" is used in reference to conditions of temperature, ionic strength and the presence of other compounds, in which nucleic acid hybridizations are carried out. With “high stringency” conditions, nucleic acid base pairing will only occur between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, "medium" or "low" stringency conditions are often used when nucleic acids that are not fully complementary to each other are intended to be hybridized or annealed together. The technique is well aware that numerous equivalent conditions can be used to understand medium or low stringency conditions.
[00209] In some embodiments, the polynucleotide has less than 90%, for example, less than 80%, nucleic acid sequence identity with the corresponding non-optimized sequence and, optionally, encodes a polypeptide having at least 60%, for example example, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, of amino acid sequence identity with the encoded polypeptide by the non-optimized sequence. Constructs, for example, expression cassettes and vectors comprising the isolated nucleic acid molecule, for example, with the optimized nucleic acid sequence, as well as kits comprising the isolated nucleic acid molecule, construct or vector are also provided.
A nucleic acid molecule comprising a nucleic acid sequence encoding an OgLuc variant of the invention, a fragment thereof or a fusion thereof is optionally optimized for expression in a particular host cell and also, optionally, operably linked transcriptional regulation sequences, for example, one or more enhancers, a promoter, a transcription termination sequence or a combination thereof, to form an expression cassette.
[00211] In some embodiments, a nucleic acid sequence encoding an OgLuc variant of the invention, a fragment thereof or a fusion thereof is optimized by replacing codons, for example, at least 25% of the codons in a sequence of Parental OgLuc with codons that are preferably used in a particular (selected) cell. Preferred codons have a relatively high frequency of codon usage in a selected cell, preferably, their introduction results in the introduction of relatively few transcription factor binding sites for transcription factors present in the selected host cell, and relatively few other attributes undesirable structural problems. Examples of undesirable structural attributes include, but are not limited to, restriction enzyme sites, eukaryotic sequence elements, vertebrate promoter modules and transcription factor binding sites, response elements, E. coli sequence elements, secondary mRNA structure. Thus, the optimized nucleic acid product may have a higher level of expression due to improved codon usage frequency, and a reduced risk of inappropriate transcriptional behavior due to a reduction in the number of undesirable transcriptional regulatory sequences.
[00212] An isolated and optimized nucleic acid molecule may have a different codon composition than that of the wild type nucleic acid sequence corresponding to more than 30%, 35%, 40% or more than 45%, for example, 50% , 55%, 60% or more of the codons. Exemplary codons for use in the invention are those that are used more frequently than, at least, another codon for the same amino acid, in a particular organism and, in some modalities, are also not codons of little use in the organism and are not are codons of little use in the organism used to clone or track the expression of the nucleic acid molecule. In addition, codons for certain amino acids (that is, amino acids that have three or more codons) can include two or more codons that are used more frequently than other (non-preferred) codons. The presence of codons from the nucleic acid molecule that are used more often in one organism than in another organism results in a nucleic acid molecule that, when introduced into the cells of the organism that employs the codons most often, is expressed in those cells in a level that is greater than the expression of the wild-type or original nucleic acid sequence in these cells.
[00213] In some embodiments of the invention, codons that are different are those most frequently used in a mammal, while in still other modalities, codons that are different are those most frequently used in a plant. Preferred codons for different organisms are known in the art, for example, see http://www.kazusa.or.jp./codon/. A particular type of mammal, for example, a human, may have a different set of preferred codons from another type of mammal. Likewise, a given type of plant may have a different set of preferred codons than another type of plant. In one embodiment of the invention, most codons that differ are those that are the preferred codons of a desired host cell. Preferred codons for organisms, including mammals (eg, humans) and plants are known in the art (eg, Wada et al., Nucl. Acids Res., 18: 2367 (1990); Murray et al., Nucl Acids Res., 17: 477 (1989)). EXAMPLES Reference Example 1 - Synthesis of a-Aminonitrile (Compound 1):

[00214] One vial was loaded with sodium bisulfite (71.4 mmol) and 17 mL of water. For this, a solution of the aldehyde (69.3 mmol) in 14 mL of tetrahydrofuran (THF) was added dropwise, at a rate that kept the internal temperature below 60 ° C. The resulting suspension was stirred at room temperature for 40 minutes, and ammonium hydroxide solution (4.85 ml) added over 2 min. The resulting solution was magnetically stirred while being heated in an oil bath at 60 ° C for 1 hour and then left at room temperature overnight. The solution was cooled in an ice / salt water bath until the internal temperature was measured below 5 ° C. For this, a solution of sodium cyanide (71.4 mmol) in 14 ml of water was added dropwise over 30 min. The resulting mixture was stirred at approximately 10 ° C for 20 min, 30 ° C for 2 hours, and at room temperature for 18 hours. The reaction mixture was extracted with three 200 ml portions of diethyl ether, and the combined extracts were dried over anhydrous sodium sulfate. The mixture was filtered, and the solution was cooled in an ice bath for 20 min. To the stirred solution, hydrogen chloride gas was added until the precipitation ceased, and the suspension was stirred for 1 hour. The solid was isolated by filtration and washed with three 50 ml portions of diethyl ether. The material was dried under vacuum, and 6.4 g (47.5 mmol) of a white solid was obtained (69%). The procedure was adapted from: Freifelder and Hasbrouck, “Synthesis of Primary 1,2-Diamines by Hydrogenation of alpha-Aminonitrilas,” Journal of the American Chemical Society, 82 (3): 696-698 (1960) Reference Example 2 - Synthesis of 2-oxo-2-phenylacetaldehyde oxime (Compound 2):

[00215] One vial was loaded with tert-butyl butoxide (58 mmol) and 63 mL of tert-butyl alcohol. The mixture was stirred until a solution was formed, and an appropriate benzophenone solution (50 mmol) in 35 ml of tert-butyl alcohol added dropwise over 15 min. The reaction mixture was stirred for 1 hour, and pure isoamyl nitrite (75 mmol) added over five minutes. The reaction mixture was monitored until completion and then diluted with 100 ml of heptanes. The resulting solid (38 mmol) was collected by suction filtration and dried to a constant weight, under vacuum. The procedure was adapted from: Hagedorn et al., Chem. Ber., 98: 193 (1965). Reference Example 3 - Synthesis of Pyrazine Derivatives (Compound 3)

[00216] A bottle with 3 necks was equipped with a thermometer, stopper and an argon line. To this, aminonitrile (47.5 mmol), dry pyridine (190 mL), and oxime (61.75 mmol) were added. The mixture was stirred well for 15 min, and tetra-chloro- (bis-pyridyl) titanium complex (94.9 mmol) in five portions over 35 minutes to ensure that the internal temperature remained below 40 ° C . After the addition was complete, the reaction mixture was stirred overnight at room temperature. The reaction mixture was slowly added to a solution of sodium bicarbonate (21.75 g in 174 ml of water), in small portions. The resulting mixture was stirred well for 15 min and 80 g of Celite was added. The suspension was stirred for 30 min and filtered through a Buchner funnel. The filtrate was removed into a separating funnel, and the filter cake was suspended in 400 ml of methanol. The mixture was stirred for 30 min and filtered again. This process was repeated a total of four times. The methanolic filtrates were combined and concentrated, and the residue dissolved in 200 ml of ethyl acetate (EtOAc). The solution was added to the separating funnel containing the initial filtrate, and the mixture was subsequently extracted with three 100 ml portions of EtOAc. The combined extracts were washed with two 100 ml portions of saturated sodium carbonate and two 100 ml portions of a brine solution. The organic solvent was evaporated, and the crude piazine oxide product obtained as a brown oil. The material was dissolved in 3 ml of methanol and 89 ml of dichloromethane (DCM) was added. To this solution, zinc powder (80.7 mmol) was added, and the mixture was cooled in an ice bath to an internal temperature of 15 ° C reached. The mixture was treated with glacial acetic acid (3 ml) and heated to an internal temperature of 30 ° C in an oil bath for 40 min. The reaction mixture was cooled to room temperature and filtered through a pad of celite. The filter cake was washed with DCM and the combined filtrates were washed with an aqueous saturated sodium bicarbonate solution. The crude product was purified by chromatography on silica gel using a heptane / EtOAc gradient. This generated 2.9 g (29%) of the pyrazine as a brown solid. The procedure was adapted from: Kishi et al., “The structure confirmation of the light-emitting moiety of bioluminescent jellyfish.” Tetrahedron Lett., 13 (27): 2747 (1972). Reference Example 4 - Synthesis of Celenterazines
[00217] Method A: (the following compounds can be synthesized by method A: Compounds PBI-3840, PBI-3886, PBI-3857, PBI-3887, PBI-3913, PBI-3894, PBI-3896, PBI-3897, PBI-3841 and PBI-3842)

[00218] A flask was loaded with pyrazine (8.25 mmol), pyruvic acid (14.0 mmol), camphor sulfonic acid (0.8 mmol), and anhydrous 2-methyl THF (150 mL). The flask was equipped with a Soxhlet condenser and extractor loaded with 4-angstrom molecular sieves, and the reaction mixture was heated in an oil bath at 110 ° C for 18 hours. The screens were replaced by new ones, and the reflux continued for 24 hours. The reaction mixture was filtered and concentrated, and the residue dissolved in EtOAc (200 ml). This solution was washed with three 25 ml portions of saturated sodium bicarbonate solution, with 100 ml of 0.1 M sodium acetate buffer, pH 5, and 100 ml of brine solution. The solution was dried over magnesium sulfate, filtered and concentrated to generate 2.3 g (6.2 mmol, 75%) of the enamine / crude acid. This material was dissolved in anhydrous THF (30 ml), and the solution was cooled in an ice / water bath for 10 min. For this, carbodiimide (9.0 mmol) and pure diisopropylethylamine (14.9 mmol) were added. The cold bath was removed after 10 min, and the reaction mixture was stirred at room temperature for 3 hours. For the reaction mixture, 50 ml of 0.1% sodium acetate buffer, pH 5 was added, and the mixture was stirred well for 10 min. The biphasic mixture was extracted with three 100 ml portions of EtOAc, and the combined extracts were washed with a brine solution. The organic solution was concentrated, and the residue purified by chromatography on silica gel using a DCM / methanol gradient. This generated 336 mg (0.94 mmol, 16%) dehydrocellenterazine as a red solid. This material was suspended in 10 ml of methanol, and the mixture cooled in an ice bath. For this, sodium borohydride (100 mg, 2.6 mmol) was added in three portions over the course of 1 hour. The reaction mixture was stirred for an additional 30 min, and pure glacial acetic acid added dropwise until a pH of 5. was reached. The solution was concentrated, and the residue was triturated with 15 ml of water. The solid was isolated by suction filtration and dried under vacuum for several hours to generate 318 mg (94%) of crude celenterazine as a yellow solid. The procedure was adapted from: Kakoi and Inoue, Chem. Lett. 11 (3): 299-300 (1980).
[00219] Method B: (the following compounds can be synthesized by method B: PBI-3882, PBI-3932, PBI-3881 compounds)
A flask was loaded with glyoxal (2.2 mmol), aminopyrazine (1.1 mmol), ethanol (20 mL), 12 N HCl (0.6 mL), and water (1 mL). The reaction mixture was heated to reflux for 24 hours and concentrated. The residue was purified by column chromatography on silica gel using a DCM / methanol gradient. This generated 100 mg (0.25 mmol, 23%) of the product as a dark celenterazine solid. The procedure was adapted from: Inoue et al. “Squid bioluminescence. II. Isolation of Watasenia scintillans and synthesis of 2- (p-hydroxybenzyl) -6- (p-hydroxyphenyl) - 3,7-dihydroimidazo [1,2-a] pyrazin-3-one. ” Chem. Lett., 4 (2): 141-4 (1975) ..
[00220] Method C: Synthesis of new cellenterazines (the following compounds can be synthesized by method C: PBI-3939, PBI-3945, PBI-3889, PBI-4002) Compound 4- (5-amino-6-benzylpyrazin- 2-yl) phenol can be prepared according to previously described methods (Kishi et al., Tetrahedron Lett., 13: 2747 (1972); Mosrin et al., Organic Letters, 11: 3406 (2009); Kakoi, Chem. Pharm. Bull., 50: 301 (2002)).
[00221] Synthesis of 2-amino-3-benzyl-5-phenylpyrazine. A round bottom flask was loaded with 5 g (33.5 mmol) of 2-isonitrosoacetophenone, 6.7 g (36.8 mmol) of 2-amino-3-phenylpropanonitrile hydrochloride and 100 ml of dry pyridine. The mixture was cooled to -20 ° C and 4.6 ml (40.0 mmol) of TiCl4 was added dropwise. The reaction was maintained at -20 ° C for 30 min and heated to 80 ° C for 2.5 h. The solvent was evaporated, and the residue taken up in 1 L of DCM. This solution was washed with saturated NaHCO3 and brine. All volatile products were evaporated, and the residue re-dissolved in ethanol (400 ml). Raney's Ni (2.0 g, aqueous suspension) was added, and the reaction allowed to stir for 5 days under a hydrogen atmosphere. The mixture was passed through celite, and the volatiles removed. The residue was chromatographed on silica gel (heptane / DCM) to generate 2.5 g (29%) of 2-amino-3-benzyl-5-phenylpyrazine.
[00222] Synthesis of 2-amino-3-phenylpropanonitrile hydrochloride. A round bottom flask was loaded with 65 g (0.624 mol) of sodium hydrogensulfite and 150 ml of water. A solution of 75 g (0.624 mol) of phenylacetaldehyde in 150 ml of THF was added dropwise. After stirring for 20 min, 37 ml of 14 M ammonium hydroxide was added in one portion, and the mixture was heated to 60 ° C for 60 min. After cooling to 0 ° C, the mixture was diluted with 150 ml of water, and a solution of sodium cyanide (27.5 g, 0.560 mol) in 100 ml of water dropwise, keeping the internal temperature below 10 °. Ç. After the addition, the mixture was heated to 30 ° C for 2 hours and extracted with ether. After drying with sodium sulfate, all volatiles were evaporated, and the residue dissolved in 3.5 L of ether and treated with 400 mL of 3.3 M ethanolic HCl. The resulting precipitate was filtered and dried in vacuo to generate 55 g (60%) of product.
[00223] Synthesis of 3- (furan-2-yl) -2-oxopropanoic acid. For a 100 ml vial, 3- (furan-2-yl) -2-oxopropanoate (940 mg), along with 23 ml of cold 6N NaOH was added. The insoluble mixture was stirred in a 90 ° C bath for 5 min until they dissolved. Cold IN HCl was added until the solution became acidic (approximately 120 ml). The solution was extracted with 2 x 50 ml of EtOAc. The combined organic phases were washed with 40 ml of brine and dried with Na2SO4. The solution was evaporated to produce 540 mg of brown solid. The solid was further purified by reverse phase high performance liquid chromatography (HPLC), 97% aqueous trifluoroacetic acid (TFA) ramp to acetonitrile (ACN).
[00224] Synthesis of 3- (furan-2-yl) -2-oxopropanoate. For a 500 ml vial, containing the mixture of (E / Z) -ethyl-2-formamide-3- (furan-2-yl) acrylate isomers (5.0 g), a 220 ml cold solution of 1, 4 M (5%) in 50/50 HCI ethanol / water was added. After 5 hours, the reaction was divided between 200 ml of EtOAc and 30 ml of brine. The aqueous layer was extracted with 2 x 50 ml of EtOAc. The combined organic phases were washed with 1 x 50 ml of water, and 1 x 50 ml of brine and dried over Na2SO4. The organic layers were coevaporated with 26 g of celite and eluted over 80 g of silica-gold with a ramp from heptane to EtOAc. The appropriate combined fractions were evaporated to give 2.1 g
[00225] Synthesis of (E / Z) -ethyl-2-formamide-3- (furan-2-yl) acrylate. For a 500 ml flask, 50 ml of diethyl ether, Cu2O (320 mg), and furyl aldehyde (5.2 ml) was added. The flask was cooled in an ice bath and 2-isocianoacetate acetate (5.3 mL). After 1.5 hours, potassium tert-butoxide (5 g) was added to the reaction. After 4 hours, the heterogeneous reaction was filtered. 60 ml of 30% citric acid and 20 ml of EtOAc and stirred for 10 min. The aqueous layer was extracted with 50 ml of EtOAc. The combined organic phases were dried over anhydrous sodium sulfate. The EtOAc layers were coevaporated with 24 g of celite and eluted over 80 g of silica-gold with a ramp from heptane to EtOAc. Yellow syrup was used without further purification.
[00226] Synthesis of 2-oxo-3- (thiophen-2-yl) propanoic acid. For a 250 ml flask, (E / Z) -5- (thiophen-2-ylmethylene) imidazolidine-2,4-dione (5.0 g) and 100 ml of cold 6N NaOH were added. The mixture was heated at 100 ° C for 1 hour. Concentrated HCl was added to the solution cooled to acid (pH = 1). The mixture was extracted 8 x 50 ml of diethyl ether. The combined ether layers were washed with 50 ml of brine, dried over Na2SO4 and evaporated to obtain 3.36 g of a solid. The sample was further purified by recrystallization with α, α, α-trifluortoluene to give 1.63 g.
[00227] Synthesis of (E / Z) -5- (thiophen-2-ylmethylene) imidazolidine-2,4-dione. For a 250 ml vial, hydantoin (9.8 g) and thiophene-2-carbaldehyde (10 g) were added. For the mixture, piperidine (9.6 ml) was dripped. The mixture was heated at 100 ° C for 1 hour and then poured into 300 ml of 1N HCl. The solid was filtered, washed with water and dried in vacuo to yield 4.9 g of a solid.
[00228] Step 1- For a microwave vial (10 mL), the appropriate phenylpyrazin-2-amine (100 mg), the appropriate pyruvic acid (2 equivalents), DCM (1 mL) and 1,1,1 -trifluorethanol (1 ml) were heated with stirring for 30 min at 80 ° C. The reaction was co-absorbed in 2 g of Celite and the solvents were removed in vacuo. Celite was loaded into 24 g of spherical silica gel and eluted with a heptane ramp to ethyl acetate. The appropriate fractions were combined and evaporated.
[00229] Step 2 - The material isolated in step 1 dissolved in THF (0.5 mL) was cooled in an ice bath. Acetic anhydride (25 μL), dimethylaminopyridine (8.5 mg) and triethylamine (25 μL) were added. After 2 hours, most of the THF was removed in vacuo. The product was precipitated with a 30% aqueous citric acid solution (2 ml). The solid was washed with water (2 ml) and then dissolved in 3 ml of DCM. The DCM was washed with 1 x 2 ml of water followed by 1 x 2 ml of brine. The DCM layer was co-adsorbed on 2 g of celite, and the solvent removed in vacuo. Celite was loaded into 12 g of spherical silica gel and eluted with a heptane ramp to DCM. The appropriate fractions were combined and evaporated.
[00230] Step 3 - The material from step 2 dissolved in DCM (1 mL) was cooled in an ice bath. For the solution, methanol (0.5 mL) and a solution of sodium borohydride in diglyme (325 μL of 0.5 M) were added. After 2 hours, acetic acid (10 μL) was added, and the solution was quickly divided between a 30% aqueous solution of citric acid (1 ml) and DCM (2 ml). The DCM layer was co-adsorbed on 1 g of celite, and the solvent removed in vacuo. Celite was loaded on 4 g of spherical silica gel and eluted with a DCM ramp to EtOAc. The appropriate fractions were combined and evaporated.
[00231] Step 4 (only if R ”= OAc) - The material in step 3 was dissolved in THF (200 mL) and cooled in an ice bath. 1 equivalent of 1.35 M potassium methoxide in THF was added to the solution. After 30 min, the reaction was divided between DCM (1 ml) and 30% citric acid (1 ml). The DCM layer was co-absorbed in 0.5 g of celite, and the solvent removed in vacuo. Celite was loaded on 4 g of spherical silica gel and eluted with a DCM ramp to EtOAc. The appropriate fractions were combined and evaporated.
[00232] Method D: (The following compounds can be synthesized by method D: Compounds of PBI-3899, PBI-3900, PBI-3925, PBI-3933, PBI-3946) - In general, an aminopyrazine was condensed with 2 equivalents of a 2-oxoacid under a hydrogen atmosphere in the presence of a palladium catalyst. The alpha-amino acid produced was purified and subsequently activated by intramolecular condensation giving rise to the corresponding imidazopyrazinone.
[00233] Example 5 - Synthesis of 8-benzyl-6- (4-hydroxyphenyl) -2-propylimidazo [1,2-a] pyrazin-3 (7H) -one
[00234] Acid.2 - ((3-benzyl-5- (4-hydroxyphenyl) pyrazin-2-yl) amino) pentanoic 4- (5-amino-6-benzylpyrazin-2-yl) phenol (100 mg, 0 , 36 mmol) was mixed with 2-Oxovaleric acid (84 mg, 0.72 mmol) in ethanol (20 mL). Pd / C (10% palladium on activated carbon, 40 mg) was added, and the reaction mixture was heated to 65 ° C. The air was bubbled through the N2 gas, and a hydrogen flask was applied to the reaction flask. The reaction was stirred continuously for 4 hours. After cooling, it was filtered, and the resulting solution was purified by flash chromatography (elution solvent: 50% EtOAc in heptane) to generate the product as a yellow powder (70 mg, 52%). 1H NMR (300 MHz, CD2CI2, δ): 8.31 (s, 1H), 7.82 (d, 2H, J = 9.0Hz), 7.31 (m, 5H), 6.92 (d, 2H, J = 9.0Hz), 5.34 (s, 2H), 4.20 (m, 1H), 1.10 (m, 2H), 0.98 (m, 2H), 0.87 (t, 3H); MS (ESI) m / z 378.3 (M + 1).
[00235] 8-benzyl-6- (4-hydroxyphenyl) -2-propylimidazo [1,2-a] pyrazin-3 (7H) -one. 2 - ((3-benzyl-5- (4-hydroxyphenyl) pyrazine-2-yl) amino) pentanoic acid (49 mg, 0.13 mmol) was dissolved in DCM (10 mL). Pyridine (0.5 ml) was added, followed by N, N'-dicyclohexylcarbodiimide (54 mg, 0.26 mmol). The reaction mixture was stirred slowly at room temperature over 1 hour. The solvent was evaporated, and the residue purified by flash chromatography (eluting solvent: EtOAc for DCM 10% methanol in DCM) to generate the product as a yellow powder (40 mg, 86%). 1H NMR (300 MHz, CD3OD, δ): 7.35 (m, 8H), 6.88 (d, J = 9.0Hz, 2H), 4.40 (s, 2H), 2.81 (t, J = 7.5Hz, 2H), 1.81 (m, 2H), 1.02 (t, J = 7.5 Hz, 3H); MS (ESI) m / z 359.0.
[00236] Example 6 - Synthesis of 8-benzyl-2-butyl-6- (4-hydroxyphenyl) imidazo [1,2- a] pyrazin-3 (7H) -one
[00237] 2 - ((3-Benzyl-5- (4-hydroxyphenyl) pyrazin-2-yl) amino) hexanoic acid.4- (5-amino-6-benzylpyrazin-2-yl) phenol (200 mg, 0 , 72 mmol) was mixed with the sodium salt of 2-ketohexanoic acid (220 mg, 1.44 mmol) in ethanol (20 mL). Pd / C (10% palladium on activated carbon, 100 mg) was added with a few drops of acetic acid, and the reaction mixture was heated to 65 ° C. The air was bubbled through the N2 gas, and a hydrogen balloon was applied to the reaction flask. The reaction was stirred continuously for 4 hours. After cooling, it was filtered and the resulting solution was purified by flash chromatography (elution solvent: 50% EtOAc in heptane) to generate the product as a yellow powder (130 mg, 46%). MS (ESI): m / z 392.2 (M +1).
[00238] 8-benzyl-2-butyl-6- (4-hydroxyphenyl) -imidazo [1,2-a] pyrazine-3- (7H) -one. 2 - (((3-Benzyl-5- (4-hydroxyphenyl) pyrazine-2-yl) amino) -hexanoic acid (130 mg, 0.33 mmol) was dissolved in DCM (10 mL). Pyridine (0.5 ml) was added, followed by N, N'-dicyclohexylcarbodiimide (137 mg, 0.67 mmol). The reaction mixture was stirred slowly at room temperature over 1 hour. The solvent was evaporated, and the residue purified by flash chromatography (eluting solvent: EtOAc for DCM 10% methanol in DCM) to give the product as a yellow powder (110 mg, 89%). 1H NMR (300 MHz, CD3OD, δ): 7.30 (m, 8H), 6.88 (d, 2H), 4.40 (s, 2H), 2.84 (t, 2H), 1.77 (m, 2H), 1.51 (m, 2H), 0.89 (m, 3H), MS (ESI) m / z 374.3 (M + 1).
[00239] Example 7 - Synthesis of 8-benzyl-2-ethyl-6-phenylimidazo [1,2-a] pyrazine- 3- (7H) -one (PBI-3925)
[00240] 2 - (((3-Benzyl-5-phenylpyrazin-2-yl) amino) butanoic acid. 3-benzyl-5-phenylpyrazin-2-amine (200 mg, 0.77 mmol) was mixed with 2-oxobutyric acid (157 mg, 1.54 mmol) in ethanol (20 mL). Pd / C (10% palladium on activated carbon, 100 mg) was added, and the reaction mixture was heated to 65 ° C. The air was bubbled through the N2 gas, and a bottle of hydrogen was applied to the reaction flask. The reaction was stirred continuously for 4 hours. After cooling, it was filtered, and the resulting solution was purified by flash chromatography (elution solvent: 50% EtOAc in heptane) to generate the product as a yellow powder (90 mg, 34%). 1H NMR (300 MHz, CD2Cl2, δ): 7.72 (s, 1H), 7.32-7.48 (m, 10H), 4.46 (s, 2H), 4.20 (m, 2H ), 2.25 (q, 2H), 0.99 (t, 3H), MS (ESI): m / z 348.3 (M +1).
[00241] 2 - ((3-Benzyl-5-phenylpyrazin-2-yl) amino) butanoic acid was dissolved in DCM (10 ml). Pyridine (0.5 ml) was added, followed by N, N'-dicyclohexylcarbodiimide (137 mg, 0.67 mmol). The reaction mixture was stirred slowly at room temperature over 1 hour. The solvent was evaporated, and the residue purified by flash chromatography (eluting solvent: EtOAc for DCM 10% methanol in DCM) to generate the product as a yellow powder (110 mg, 89%). 1H NMR (300 MHz, CD3OD, δ): 7.26 (m, 3H), 6.84-7.07 (m, 8H), 4.03 (s, 2H), 2.47 (q, J = 9.0 Hz, 2H), 0.96 (t, J = 9.0 Hz, 3H), MS (ESI): m / z 330.2 (M +1).
[00242] Example 8 - Synthesis of 8-benzyl-6-phenyl-2- (3,3,3-trifluorpropyl) imidazo [1,2-a] pyrazin-3 (7H) -one
[00243] 5,5,5-Trifluor-2-oxopentanoic acid. Ethyl 4,4,4-trifluorbutyrate (1 g, 5.88 mmol) and diethyl oxalate (3.87 g, 26.5 mmol) was dissolved in ethanol. Sodium ethoxide (21% in ethanol, 2.09 g) was added to the solution, and the reaction mixture was stirred for 0.5 hours. The solvent was distilled off, and the residue extracted with EtOAc / water. The organic layers were collected and dried over sodium sulfate. After filtration, the solvent was removed to generate a clear liquid. MS (ESI): m / z 269.1 (M-1). The liquid was then dissolved in 3N HCl (20 ml), and the reaction mixture was refluxed for 4 hours. After cooling, the reaction mixture was extracted with EtOAc. The organic layers were collected and dried over sodium sulfate. After filtration, the solvent was removed, and the residue used directly in the next step. MS (ESI): m / z 169.7 (M-1).
[00244] 5,5,5-Trifluor-2 - ((3-benzyl-5-phenylpyrazin-2-yl) amino) butanoic acid. 3-benzyl-5-phenylpyrazin-2-amine (240 mg, 0.92 mmol) was dissolved with 5,5,5-trifluor-2-oxopentanoic acid (150 mg, 0.88 mmol) in ethanol (20 mL). Pd / C (10% palladium on active carbon, 100 mg) was added, and the reaction mixture was heated to 65 ° C. The air was bubbled through the N2 gas, and a hydrogen flask was applied to the reaction flask. The reaction was stirred continuously for 4 hours. After cooling, it was filtered, and the resulting solution was purified by flash chromatography (elution solvent: 50% EtOAc in heptane) to generate the product as a yellow powder (200 mg, 54%). 1H NMR (300 MHz, CD2Cl2, δ): 11.45 (s, 1H), 10.20 (s, 1H), 7.94 (s, 1H), 7.34 (m, 10H), 5, 34 (s, 2H), 3.96-4.23 (m, 2H), 3.02-3.28 (m, 2H); FNMR: -76.3, MS (ESI): m / z 416.1 (M +1).
[00245] Celenterazine (R1 = H, R2 = -CH2CH2CF3). 5,5,5-Trifluor-2 - (((3-benzyl-5-phenylpyrazin-2-yl) amino) butanoic acid (100 mg, 0.24 mmol) was dissolved in DCM (10 ml). Pyridine (0.5 ml) was added followed by N, N'-Dicyclohexylcarbodiimide (100 mg, 0.48 mmol). The reaction mixture was stirred slowly at room temperature for 1 hr. The solvent was evaporated, and the residue was purified by flash chromatography (elution solvent: EtOAc for DCM to 10% methanol in DCM) to generate the product as a yellow powder (80 mg, 87%). 1H NMR (300 MHz, CD2 Cl2, δ): 7.36 (m, 11H), 3.43 (s, 2H), 1.60-1.92 (m, 4H); FNMR: 67.4 (t, J = 18Hz); MS (ESI): m / z 398.2 (M + 1).
[00246] Example 9 - Synthesis of 8-benzyl-2- (furan-2-ylmethyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-3939)
8-benzyl-2- (furan-2-ylmethyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one: Synthesized from method C using 3- (furan-2-yl) - 2-oxopropanoic acid and 3-benzyl-5-phenylpyrazin-2-amine as starting materials. 1H NMR (300 MHz, dmso) δ 8.88 (s, 1H), 8.02 (d, J = 7.9, 2H), 7.61 - 7.38 (m, 6H), 7.37 - 7.14 (m, 3H), 6.38 (s, 1H), 6.26 (d, J = 3.2, 1H), 4.64 (s, 3H), 4.40 (s, 3H) ; exact mass calculated for C24H20N3O2 + m / z + 382.16, found m / z + 382.
[00247] Example 10 - Synthesis of 8-benzyl-6-phenyl-2- (thiophen-2-ylmethyl) imidazo [1,2-a] pyrazin-3 (7H) -one (PBI-3889)

[00248] 8-benzyl-6-phenyl-2- (thiophen-2-ylmethyl) imidazo [1,2-a] pyrazin-3 (7H) -one: Synthesized from method C using 2-oxo-3 acid - (thiophen-2-yl) propanoic and 3-benzyl-5-phenylpyrazin-2-amine as starting materials. 1H NMR (300 MHz, dmso) δ 8.85 (s, 1H), 7.99 (d, J = 6.8, 2H), 7.63 - 7.02 (m, 10H), 6.94 ( dd, J = 3.5, 5.1, 1H), 4.62 (s, 2H), 4.58 (s, 2H), 2.69 (contaminated); exact mass calculated for C24H20N3OS + m / z + 398.13, found m / z + 398.
[00249] Example 11 - Synthesis of 8-cyclopropyl-2- (4-hydroxy benzyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-3897)

[00250] 8-cyclopropyl-2- (4-hydroxy benzyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) - one: Synthesized using method A with 3-cyclopropyl-5-phenylpyrazin-2- amine and 3- (4-hydroxyphenyl) -2-oxopropanoic acid as starting materials. Exact mass calculated for C22H18N3O2-m / z- 356.14, found m / z- 356.
[00251] Example 12 - Synthesis of 8-benzyl-2-methyl-6-phenylimidazo [1,2- a] pyrazin-3 (7H) -one (PBI-3932)
8-benzyl-2-methyl-6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one: Synthesized using method B with 1,1-dimethoxypropan-2-one and 3-benzyl-5-phenylpyrazin- 2-amine as starting materials. Exact mass calculated for C20H18N3O + m / z + 316.14, found m / z + 316.
[00252] Example 13 - Synthesis of 2- (4-hydroxy benzyl) -8-methyl-6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-3896)
2- (4-hydroxy benzyl) -8-methyl-6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one: Synthesized using method A with 3-methyl-5-phenylpyrazin-2-amine and acid 3- (4-hydroxyphenyl) -2-oxopropanoic as starting materials. 1H NMR (300 MHz, dmso) δ 8.84 (s, 1H), 8.00 (d, J = 7.6, 2H), 7.47 (dd, J = 8.6, 16.2, 3H ), 7.17 (d, J = 7.3, 2H), 6.69 (d, J = 8.4, 2H), 6.26 (s, 4H), 4.17 (s, 2H), 2.86 (s, 3H), 2.48 (s, 1H).
[00253] Example 14 - Synthesis of 8-benzyl-2- (4-hydroxy benzyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-3840)
8-benzyl-2- (4-hydroxy benzyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one: Synthesized using method A with 3- (4-hydroxyphenyl) -2-oxopropanoic acid and 3-benzyl-5-phenylpyrazin-2-amine as starting materials. Exact mass calculated for C26H22N3O2 + m / z + 408.17, found m / z + 408.
[00254] Example 15 - Synthesis of Protected (Stabilized) Celenterazine (PBI-4377) For a mixture of PBI-3939, potassium carbonate (1.1 equiv) and potassium iodide (1.1 equiv) in dimethylformamide (DMF) , under an argon atmosphere, an equivalent of chloromethyl pivalate was added at room temperature. The progress of the reaction was monitored by thin layer chromatography, and after completion, the reaction mixture was cooled in an ice bath for several minutes before adding a volume of water equal to the reaction volume. The resulting mixture was extracted with a suitable organic solvent (for example, EtOAc), and the extract was concentrated to generate the crude product. The material was further purified by chromatography on silica gel.
[00255] Example 16 - Synthesis of 8-benzyl-2 - (((1-methyl-1 H-imidazol-2-yl) methyl) - 6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-4525), 8-benzyl-6- (4-hydroxyphenyl) -2 - (((1-methyl-1H-imidazol-2-yl) methyl) -6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI-4540) and 2- ((1H-imidazol-2-yl) methyl) -8-benzyl-6-phenylimidazo [1,2-a] pyrazin-3 (7H) -one (PBI -4541)

[00256] To a flask containing 10 mmol of 1 or 2 2-methyl imidazole derivative, under an argon atmosphere, 20 mL of dry THF were added, and the solution was cooled in a dry ice / acetone bath to approximately -78 ° C. To the cooled mixture, 9.3 mmol of a solution of n-butyllithium (2.46 M in hexanes) was added dropwise over several minutes. The resulting solution was stirred at approximately -78 ° C for 30 min, and 6.7 mmol of compound 3 was added via syringe. The reaction mixture was stirred for 3 hours and quenched with the addition of 20 ml of saturated ammonium chloride solution and 20 ml of saturated sodium bicarbonate solution. The cold bath was removed, and after heating to room temperature, the mixture was extracted with 3 x 100 ml of EtOAc. The combined extracts were dried (MgSO4), concentrated in vacuo, and the crude 4 or 5 compounds were purified by column chromatography using silica gel (EtOAc / Heptane).
[00257] A microwave vial was loaded with 100 mg (1 eq) of the compound of 6 or 7 and 2 equivalents of the compound 8 or 9. For the mixture, 4.5 ml of ethanol and 0.25 were added mL of concentrated HCl. The reaction mixture was heated in a microwave at 100 ° C for 1.5 hours. The resulting mixture was added to 50 ml of EtOAc and washed sequentially with 20 ml of saturated sodium bicarbonate solution and 20 ml of brine. The organic phase was concentrated in vacuo, and the residue was purified by column chromatography using silica gel (methanol / dichloromethane) to generate compounds 10-12.
[00258] Example 17 - Characterization of Stability and Autoluminescence of New Celenterazines
[00259] The characterization of stability and autoluminescence of new cellenterazines PBI-3939, PBI-3889, PBI-3945, PBI-4002, or PBI-3896 were determined. Greater stability and less autoluminescence is an attractive technical feature in a substrate / reagent.
[00260] To determine stability, 20 μM of new cellenterazines PBI-3939, PBI-3889, PBI-3945, PBI-4002, or PBI-3896, 30 μM of native celenterazine, or 22 μM of known celenterazine-h or celenterazine -hh known, were placed in a reporter reagent buffer containing 50 mM CDTA, 150 mM KCl, 50 mM DTT, 35 mM thiourea, 1% TERGITOL® NP-9 (v / v) and 0.1 % MAZU®DF 204. The identical samples were incubated at room temperature (i.e., 22-24 ° C) for several periods of time and then transferred to -70 ° C. After all samples were collected and frozen, they were thawed and mixed with 10 μl of bacterial cell lysate containing the OgLuc IV variant in 40 ml of DMEM medium without phenol red + 0.1% PRIONEX®. The luminescence of the sample was read at 5 min after IV addition.
[00261] "T90" indicates the amount of time for the luminescent signal to decay to 10% (ie, 10% loss of activity), at room temperature, that is, 22 ° C. The rate of decay of the luminescent signal (“T90”) was determined from the slope of the linear adjustment of the data represented as ln RLU versus time, which was calculated from the following equation: t = ln (A / Ao) + ( -k), where A = intensity at time t, A0 = intensity at time 0, and k = decay rate. As shown in Table 1, the T9o values for known h-and -hh cellenterazines, new PBI-3939, PBI-3889, PBI-3945, PBI-4oo2, and PBI-3896 cell centers are higher than for native celenterazine, which indicates that these celenterazins were more stable compounds than native celenterazine.
[oo262] To determine the characterization of autoluminescence, HEK293 cells were grown overnight at 15,000 cells per well in DMEM + 10% FBS + pyruvate medium. The medium was removed and replaced with 20 μM from each of the new cell centers shown in FIG. 2, that is, PBI-3939, PBI-3889, PBI-3945, PBI-4002, PBI-3841, PBI-3897, PBI-3896, PBI-3925, PBI-3894, PBI-3932, and PBI-3840, native celenterazine and known celenterazine, celenterazine-h and celenterazine-hh, diluted in CO2-independent media, plus 10% FBS. Luminescence was measured immediately after adding the substrate on the GLOMAX® Luminometer (1 s / well). The base luminescence was 154 ± 15 RLU. Table 1 shows the characterization of normalized autoluminescence for native celenterazine (“Autolum (standard for coel)”). While celenterazine-h had more autoluminescence than native celenterazine, all other tested celenterazines had less autoluminescence.
[00263] Table 1: Experiences of Stability and Characterization of IV Autoluminescence with Various Celenterazins.

[00264] Example 18 - New Celenterazine Toxicity
[00265] The toxicity of the new celenterazines has been investigated in HEK293 cells. HEK293 cells were cultured overnight at 15000 / well in DMEM + 10% FBS + pyruvate. The medium was removed and replaced with the new celenterazine compounds (or DMSO control) diluted in CO2-independent media plus 10% FBS. Cell viability was measured 24 hours after compound addition using the CELLTITER-GLO® assay reagent (Promega Corp), according to the manufacturer's instructions, and luminescence was measured on the GLOMAX® Luminometer (1 s / well) . Table 2 shows the toxicity of native celenterazine, known celenterazine-h and celenterazine-hh and the new celenterazines PBI-3939, PBI-3889, PBI-3841, PBI-3897, PBI-3945, PBI-4002, and PBI 3840 in HEK293 cells. With the exception of PBI-3840, the new celenterazins had at least the same toxicity as celenterazine-hh. Some of the new celenterazins had the same toxicity as native celenterazine and celenterazine-h.
[00266] Table 2: Toxicity of Various Celenterazines in HEK293 cells Based on CellTiter-Glo®

[00267] Example 19 - Km from PBI-3939
[00268] To determine the PBI-3939 km, the OgLuc L27V variant (described in Example 26) was purified by HALOTAG® fusion using the HALOTAG® Protein Purification System according to the manufacturer's instructions and diluted in DMEM without phenol red and 0.1% PRIONEX®. 50 μL of assay buffer (100 mM MES pH 6, 35 mM Thiourea, 0.5% TERGITOL® NP-9, 1 mM CDTA (v / v), 2 mM DTT and 150 mM KCl), with Variable amounts of PBI-3939 were added to the 50 μL of diluted enzyme (about 20 pM of final enzyme concentration), and the luminescence measured in 3 min at 22 ° C. As the data in FIG. 3 demonstrate, the Km of PBI-3939 is approximately 10 mM.
[00269] Example 20 - Characterization of PBI-4525, PBI and PBI- 4540-4541 compounds
[00270] The compounds of PBI-4525, PBI and PBI-4540-4541 were selected for their ability to detect luminescence. For analysis, 20 μM of each compound was added to the assay buffer (100 mM MES pH 6, 35 mM Thiourea, 0.5% TERGITOL® NP-9 (v / v), 1 mM CDTA, 2 mM DTT and 150 mM KCl), which was adjusted to pH 7 with 100 mM HEPES pH 7 to create a test reagent. The test reagent was then mixed with 36 pM of purified L27V02 enzyme (described in Example 25B), in DMEM without phenol red and 0.1% PRIONEX®. As a control, the 20 μM assay buffer of PBI-3939 or PBI-4528 was used. Luminescence was measured as previously described in 3 min after the assay reagent was added to the enzyme mixture. Table 3 demonstrates that the PBI-4525, PBI-4540 and PBI-4541 compounds can be used to detect a luciferase luminescence using celenterazine. Table 3
Example 21 - Standard OgLuc Sequence
[00271] Enzyme families, including the different classes of luciferases, can be recognized by the presence of common three-dimensional structures and defined catalytic activity. Due to families of enzymes sharing evolutionary histories with other families of enzymes, which will also show similarities in their three-dimensional structures. Through various means of structural and functional analysis, the inventors determined that OgLuc, as a representative of decapod luciferases, has a three-dimensional structure very similar to that of fatty acid-binding proteins (by FABPs), indicating similarity of evolutionary history. Thus, decapod luciferase can be defined as having a characteristic three-dimensional structure similar to FABPs and using celenterazine as a substrate to catalyze the emission of luminescence. Other luciferases, for example, firefly luciferase, Renilla luciferase, bacterial luciferase and so on, have three-dimensional structures that are clearly distinct, indicating that they belong to different enzyme families and do not share evolutionary histories. Dinoflagellate luciferase has a three-dimensional structure, which exhibits some similarities to FABPs, suggesting a common evolutionary history, but does not use celenterazine as a substrate and therefore does not belong to the same family of enzymes as decapod luciferases.
[00272] Since amino acid sequences are not well conserved as three-dimensional structures, the definition of enzyme families based only on sequence comparisons can be difficult. For example, although all FABPs have a characteristic three-dimensional barrel-shaped shape, comparisons of their amino acid sequences often reveal extremely low levels of sequence identity. However, the sequence identity can be used to demonstrate the uniformity of three-dimensional structures. Two proteins will have analogous three-dimensional structures if their amino acid sequences can be aligned to reveal> 30% sequence identity, preferably> 40% sequence identity, and more preferably> 50% sequence identity (Chothia and Lesk, EMBO J. 5 (4): 823-826 (1986); Tramontano, Genomics, 4: 402-405 (2003)). Thus, a protein is a decapod luciferase if, after aligning its amino acid sequence with the OgLuc sequence, the sequence identity is> 30%, preferably> 40%, and more preferably,> 50%, and the protein you can use a substrate as celenterazine to catalyze the emission of luminescence.
[00273] Due to the structural restrictions necessary to maintain the three-dimensional structural characteristic of an enzyme family, some portions of the amino acid sequences of an enzyme family show greater conservation amounts (for example, a greater degree of sequence identity). Thus, these conserved regions can serve as further evidence of a common three-dimensional structure shared between two proteins. A conserved sequence pattern, also called a signature, pattern, or fingerprint, can be generated by manual or computational methods that are known in the art. The patterns can be found in public databases, such as PROSITE (http://expasy.org/prosite; Sigrist et al., Nucleic Acids Res. 38 (suppl 1): D161-D166 (2010)).
[00274] For example, a pattern of conserved amino acids can be found by analyzing a large number of known FABPs. PROSITE (Release 20.67, of 05-Oct-2010) contains a FABP standard (accession number PS00214, created in April 1990, data updated in April 2006). This FABP standard covers the positions of 18 amino acids and is defined as: [GSAIVK] - {FE} - [FYW] -x- [LIVMF] -xx- {K} -x- [NHG] - [FY] - [ DE] -x- [LIVMFY] - [LIVMFY] - {N} - {G} - [LIVMAKR] (SEQ ID NO: 329) (VI), where: • the IUPAC standards for single letter codes for amino acids are used. • the 'x' symbol is used for a position where any amino acid is accepted. • alternative amino acids are in a place indicated by listing the amino acids in square brackets '[]' (for example: [ALT] represents the possibility of an Ala, Leu, or Thr in position). • absence of certain amino acids at a site is indicated by curly brackets “{}” (for example: {AM} represents any amino acid in one position, except Met and Ala). • each sequence position (or element in the pattern) is separated from its neighbor by '-'. • each position sequence is referred to as a “standard position”, for example, [GSAIVK] would be considered a Formula 1 (VI) standard position, {FE} is considered a Formula (VI) 2 standard position, etc.
[00275] Although a conserved sequence test pattern results from a common underlying three-dimensional structure, some changes in the sequence pattern can be allowed without disruption to the three-dimensional structure. For example, for some members of the FABP family, the differences are found at four sites in the PROSITE standard. These additional members of the FABP family include five proteins listed in PROSITE as false negative hits, that is, members of the FABP protein family are not doped by the FABP standard (UniProt database access numbers FBP12_HUMAN, FABP1_FASGI, FABP2_FASHE , FABPL_SCHBI, RET5_BOVIN) and a known protein having a FABP doubling (Protein Database accession number 2A02). Although OgLuc shares a three-dimensional structure closely similar to FABPs, the sequence patterns of native and variant amino acid sequences also differ slightly, with differences in 5 positions from the PROSITE pattern. In various embodiments, the pattern in OgLuc starts at a position corresponding to position 8 of SEQ ID NO: 1. An acid substitution, deletion or insertion of the amino sequence pattern is counted as a difference.
[00276] Combination of sequence information from these additional FABPs and OgLuc variants, an improved sequence pattern can be derived: [GSAIVK] - {FE} - [FYW] -x- [LIVMFSYQ] -xx- {K } -x- [NHGK] -x- [DE] -x- [LIVMFY] - [LIVMWF] -x- {G} - [LIVMAKRG] (SEQ ID NO: 330) (VII).
[00277] The sequence information used to derive this pattern is shown in Table 4. Column 1 identifies the position of the pattern (listed from N- to C-terminal, standard length is 18 amino acids), and column 6 identifies the corresponding position in the OgLuc sequence (numbering according to SEQ ID NO: 1). Column 2 shows the standard element of PROSITE FABP (Formula (VI)) for each standard position. Column 3 lists the amino acids present in six members of the FABP family that are not represented by the PROSITE FABP standard. Column 4 lists the amino acids present in OgLuc (SEQ ID NO: 1) or OgLuc variants that are not represented by the PROSITE standard. Column 5 lists the improved standard (“OgLuc standard”) (Formula (VII)) created by merging standard information from columns 2, 3 and 4. Column 7 lists the amino acids in OgLuc (SEQ ID NO: 1) corresponding to standard PROSITE FABP positions. Column 8 lists the amino acids found in the dinoflagellate luciferase sequences (eight different species) in positions corresponding to the improved pattern (GenBank accession numbers 2021262A, AAA68491, AAC36472, AAV35379, AAV35380, AAL40676, AAL40677, AAV35378, A3535387, AAV access to the 1VPR Protein Database).
[00278] The improved pattern (Formula (VII)) serves as an indication (ie, a fingerprint) of the three-dimensional protein structure shared between FABPs and OgLuc. However, strict compliance with this standard is not necessary to indicate similarity of the three-dimensional structure. From the examples given here, a common three-dimensional structure can exist, even with up to five changes in the pattern. Also, for example, although dinoflagellate luciferase has a similar three-dimensional structure for FABPs and OgLuc, it has four differences from the improved pattern.
[00279] Thus, although a protein can be recognized as a decapod luciferase based on the similarity of sequence and use of celenterazine for luminescence, it can also be recognized for having an improved pattern sequence. Specifically, the protein is a decapod luciferase if, after aligning its amino acid sequence with SEQ ID NO: 1 or variants thereof, the sequence identity is> 30%, preferably> 40%, and more preferably,> 50% and the protein can use celenterazine as a substrate to catalyze the luminescence emission, and the amino acid sequence starting at the position corresponding to position 8 of SEQ ID NO: 1 is as follows: [GSAIVK] - {FE} - [FYW] -x- [LIVMFSYQ] -xx- {K} -x- [NHGK] -x- [DE] -x- [LIVMFY] - [LIVMWF] -x- {G} - [LIVMAKRG] (SEQ ID NO: 330 ) (VII), with no more than 5, or more differences, preferably, no more than 4, 3, 2, or 1 difference, or more preferably, there are no differences, in which the differences occur in positions corresponding to the standard position 1, 2, 3, 5, 8, 10, 12, 14, 15, 17 or 18, with Formula (VII) according to Table 4. Differences may also include gaps or insertions between the standard positions of the Table 4. Table 4: Sequence Patterns of Protein


Example 22 - Generation of OgLuc Variants Experimental Details
[00280] Unless otherwise specified, other variants of a starting OgLuc variant sequence with random substitutions were generated using the system based on mutagenic, error-prone PCR, GeneMorph II Random Mutagenesis Kit (Stratagene; Daughtery, PNAS USA, 97 (5): 2029 (2000)), according to manufacturer's instructions, and NNK site saturation (Zheng et al., Nucleic Acids Research, 32: e115 (2004)).
[00281] In addition, variants of a starting OgLuc variant having specific mutations were generated using QuikChange site-directed mutagenesis kit based on oligo (Stratagene; Kunkel, PNAS USA, 82 (2): 488 (1985)), de according to the manufacturer's instructions.
[00282] The resulting variants were built in the context of the pF1K FLEXI® vector for expression based on the T7 promoter (Promega Corp.) Alternatively, the resulting variants were built in the context of the pF4Ag vector (a commercially available version of pF4A (Promega Corp), which contained T7 and CMV promoters modified to contain an E. coli ribosome binding site, with or without HALOTAG® C-terminal (Promega Corp .; referred to as “HT7”) (Ohana et al., Protein Expression and Purification , 68: 110-120 (2009)) to generate a fusion protein, for example, to obtain C1 + A4E variants, NNK saturation mutagenesis experiments were performed on a pF1K base vector. a pF4Ag vector base without HT7 The QC27 A, QC27-9a and IVY libraries were generated in a pF4Ag base vector with a C-terminal HT7.The IR-based variants were generated in a pF4Ag vector base without HT7. The resulting vectors were used to transfer KRX E. coli using techniques known in the art.
The generated OgLuc variants are named for the amino acid substitutions identified in the variant and / or for the E. coli clone that contained the variant, for example, FIG. 6A shows, among other results, that E. coli clone 16C5 has Q20R substitution. Screening Details
[00284] The resulting libraries were expressed in E. coli and mainly screened with a robotic system for OgLuc variants having an increased light output (i.e., increased luminescence, increased brightness, or increased light emission) or a change in specificity relative to the corresponding starting OgLuc variant. Primary robotic screening was conducted as follows: individual colonies from the generated library were used to inoculate the minimal medium in 96-well plates and cultured at 37 ° C for 17 to 20 hours ("M1 culture"). The M1 culture was diluted 1:20 with minimal fresh medium and grown at 37 ° C for 17-20 hours ("M2 culture"). The M2 culture was diluted 1:20 in an induction medium and grown 17-20 hours at 25 ° C with walk-away induction, that is, Schagat et al., “KRX Autoinduction Protocol: A Convenient Method for Protein Expression. " Promega Notes, 98: 16-18 (2008)). The induction media contained rhamnose and glucose when new cellenterazines PBI-3841, PBI-3842, PBI-3857, PBI-3880, PBI-3881, PBI-3886, PBI-3887, PBI-3897, PBI-3896, or PBI- 3894 were used as substrates in primary screening. The induction media did not contain rhamnose or glucose when native celenterazine, known celenterazine-h, or new PBI-3840, PBI-3889, PBI-3899, or PBI-3900 were used as substrates in the main screening. The use of different induction media was determined from the luminescence generated between C1 + A4E and the new celenterazines, that is, the induction media containing rhamnose and glucose, were used with the new celenterazines that generated less luminescence with C1 + A4E in compared to the other new celenterazine with C1 + A4E.
[00285] Ten μL of induced cells were lysed using 60 μL of lysis buffer containing 300 mM HEPES pH 8.0, 300 mM thiourea, 0.3 X Passive Lysis Buffer ("PLB" ,. Promega Corp Cat No. E194A), 0.3 mg / ml lysozyme, and 0.003 U / μL of DNAQ RQ1 and measured for luminescence with 50 μL of assay buffer containing 150 mM KCl, 1 nM CDTA, 10 mM DTT, 0 , 5% TERGITOL® NP-9 (v / v), and 20 μM of a known, native or new celenterazine, as a substrate. The luminescence measurements for each variant were taken 3 min after adding the reagent and the relative luminescence unit (RLU) values were normalized to the average of 8 control wells for the corresponding starting OgLuc variant for each plate. and was completed in a TECAN® robotic system.
[00286] The OgLuc variants of interest were sequenced using conventional sequencing techniques known in the art, to identify any additional amino acid substitutions in each such variant. A secondary screening using a non-robotic (manual) system was performed on the clones of the variant of interest. Manual sorting was performed as follows: the variant clones were grown, in triplicate, in 96-well plates and expressed and analyzed as described for the automatic assay, except for the assay buffer that was added manually, with a multichannel pipette. For each variant, luminescence was measured on average, and normalized for the corresponding starting OgLuc variant. Luminescence measurements were made using a TECAN® INFINITE® F500 luminometer. Determination of Change in Relative Specificity
[00287] The relative substrate specificity was determined by dividing the luminescence of a luciferase in the presence of a test celenterazine substrate by luciferase luminescence in the presence of a reference celenterazine substrate. For example, the relative specificity was determined by dividing the luminescence of a luciferase with a new celenterazine of the present invention by the luminescence of luciferase with a different celenterazine (e.g., native or known celenterazine, or a new celenterazine different from the present invention). The test celenterazine substrate and the reference celenterazine substrate, which were compared, were considered a pair of comparison substrates to determine the relative specificity of the substrate.
[00288] A change in the relative substrate specificity was determined by dividing the relative substrate specificity of a luciferase assay using a pair of comparison substrates by the relative substrate specificity of a reference luciferase using the same pair of comparison substrates . For example, a change in relative specificity has been determined by dividing the relative substrate specificity of a test luciferase with the new celenterazine of the present invention compared to a different celenterazine (for example, native or known celenterazine or a new celenterazine other than present invention), by the relative substrate specificity of a reference luciferase with the same new celenterazine of the present invention compared to the same different celenterazine used for the test luciferase.
[00289] Luminescence with a new celenterazine was compared to luminescence with a different new celenterazine. Luminescence with a native or known celenterazine was compared to luminescence with another native or known celenterazine. Luminescence with a native or known celenterazine was compared to luminescence with a new celenterazine.
[00290] An increase in luminescence (RLUs) for the OgLuc variant compared to the starting OgLuc model for the corresponding new celenterazine and a decrease or no change in the reference celenterazine luminescence was indicative of a change in relative specificity. A decrease in the luminescence of an OgLuc variant for both the new celenterazine and the reference compared to the corresponding starting OgLuc, but the luminescence of the OgLuc variant with the new celenterazine decreasing further, was also indicative of a change in specificity relative. An increase in the luminescence of the OgLuc variant compared to the corresponding starting OgLuc for new and reference ceelenterazines indicated an improvement in activity / stability / expression. If the luminescence of the OgLuc variant increased with both new and reference cellenterazines, but the increase in luminescence with the new celenterazine was greater, this is indicative of an increase in relative specificity and an improvement in the activity / stability / expression of the variant of OgLuc. A. Variants C1 + A4E
[00291] C1 + A4E (SEQ ID NOs: 2 and 3), previously described in US Patent Application no. 12 / 773,002 (US Published Order No. 2010/0281552), was used as a primary initial sequence (i.e., the parental sequence) to generate additional synthetic OgLuc variants. C1 + A4E has the following amino acid substitutions: A4E, Q11R, A33K, V44I, A54F, P115E, Q124K, Y138I and N166R, in relation to SEQ ID NO: 1. The luminescence of C1 + A4E containing bacterial lysates, using the new cellenterazines described in Examples 1-14 (see FIG 4 for examples) as substrates, was measured as described previously and compared to luminescence using native cellenterazines known as substrates (FIGS. 5A-G). FIG. 5A shows the C1 + A4E luminescence using native celenterazine (“celenterazine”), the known PBI-3880 and the new cellenterazines PBI-3842, PBI-3857, PBI-3881, PBI-3882, PBI-3886 and PBI-3887 as substrates. Luminescence measurements using new and known cellenterazines were normalized for C1 + A4E luminescence using native celenterazine and the decrease compared to native celenterazine (Figure 5B). FIGS. 5C-E show the C1 + A4E luminescence using native cellenterazine and new cellenterazines PBI-3945, PBI-3894 and PBI-4002, respectively. FIG. 5F shows the luminescence of C1 + A4E using native cellenterazine and the new cellenterazines PBI-3840, PBI-3897, PBI-3889, PBI-3899 and PBI-3900. FIG. 5G shows the C1 + A4E luminescence using native cellenterazine, the known cellenterazine PBI-3912 and the new cellenterazines PBI-3913, PBI-3925, PBI-3939, PBI-3933, PBI-3932 PBI-3946, PBI-3841 and PBI - 3896. The data indicates that the variant C1 + A4E can use each of the new celenterazines as substrates.
[00292] C1 + A4E that were generated had at least the amino acid substitutions identified in C1 + A4E, unless otherwise indicated. A library (Library 1) of clones of 4400 variants of C1 + A4E was generated by random mutagenesis as previously described and screened as previously described for improvement in altering relative specificity and / or altering activity, for example, brightness. The variants were selected mainly with native celenterazine, known celenterazine-h, known PBI-3880 and the new cellenterazines PBI-3840, PBI-3841, PBI-3842, PBI-3857, PBI-3881, PBI-3887, PBI-3887, PBI-3889 PBI-3897 and PBI-3900 as substrates. In addition, half of the variants were screened with the new cellenterazines PBI-3896 and PBI-3894 as substrates. Plates containing variants with known mutations of interest, identified from screening for new previous compounds, were selected. Variants that showed improvement (or change in relative specificity or change in activity) for one or more of the new celenterazines tested in the primary screening were isolated, sequenced and tested in a second screening.
[00293] In manual secondary screening, the variants were tested with known cellenterazines PBI-3912, celenterazine-h, celenterazine-hh, 2-methyl celenterazine and celenterazine v; and the new cellenterazines PBI-3840, PBI-3897, PBI-3889, PBI-3899, PBI-3900, PBI-3925, PBI-3944, PBI-3932, PBI-3945, PBI-3913 and PBI-3896 as substrates. FIGS. 6A-D summarize the average luminescence normalized to C1 + A4E for the variants (“Clone”). FIGS. 6A-D summarize the substitutions in these variants (“AA sequence”), which had at least one of the following additional amino acid substitutions: A14V, G15R, Q18L, Q20R, L22I, E23K, L27V, L27M, K33N, T39I, E49K, F54S, F54I, D55G, I56V, V58I, V58L, I59T, S66T, G67S, F68S, L72Q, M75K, I76N, F77T, F77C, K89E, I90V, I90T, L92H, H93R, M106K, Y109F, P113T, I116, V127A, L136M, D139G, P145L, S148T, C164S or A169V.
[00294] Amino acid substitutions at position 54, 92 and 109 were of interest, since substitutions at these positions provided greater light production or improved relative specificity, that is, the distance specificity of native celenterazine and in the direction of at least one new celenterazine, as shown in FIGS. 6A-C. The substitution of the amino acid F54I in clone 29H7 provided greater light production with native celenterazine and several of the new celenterazines. Replacement of amino acid Q18L in clone 40H11, replacement of amino acid L92H in clone 04A12 and replacement of amino acid Y109F in clone 43F9 provided improvement in relative specificity.
[00295] Table 5 lists the C1 + A4E variants with an additional amino acid substitution at position 77, 92 or 109 ("AA change"), generated as previously described. These variants were analyzed for increased light production, as previously described, that is, selected for variants that were at least 1.3 times brighter than C1 + A4E, using native celenterazine, known celenterazine-hh and new cellenterazines PBI-3939, PBI-3894, PBI-3896, PBI-3897, PBI-3932 or PBI-3925, as a substrate. The following additional replacements yielded a variant that was at least 1.3 times brighter than C1 + A4E: L92G, L92Q, L92S, L92A, L92M, L92H, L92Y, F77W, F77Y, F77S, F77T, F77V, F77A, F77G , F77C, F77D, F77M and Y109F. As shown in Table 5, the L92H, F77W and F77A substitutions had the most dramatic improvements with PBI-3897, PBI-3896 and PBI-3932. Table 5: Site Saturation of Positions 77, 92 and 109


[00296] Additional variants of C1 + A4E (Group A) were generated by site-directed mutagenesis, as described above, in having an additional substitution in at least one of the following amino acid positions relative to SEQ ID NO: 1: 18, 20, 54, 59, 72, 77, 89, 92, 109, 113, 127, 136 or 164. These amino acid positions were chosen because, based on the primary and secondary screens in Library 1, substitutions in these positions increased total production light compared to C1 + A4E using at least one of the following as a substrate: new cellenterazines PBI-3841, PBI-3896, PBI-3897, PBI-3894, PBI-3925 or PBI-3932, or known 2-methyl celenterazines celenterazines or PBI-3912. FIG. 7 lists the variants (“Clone”) and additional amino acid substitutions contained in each variant. Variant clones were assayed in triplicate as described for secondary manual screening, as previously described and normalized to C1 + A4E. Figs 8A-B and 9 show the normalized average luminescence of the variants listed in FIG. 7 with several celenterazines as substrates. Figs 8A-B and 9 show variants with large increases in luminescence of the new compounds listed compared to C1 + A4E or no change or decrease in luminescence for 2-methyl cellenterazine compared to C1 + A4E. The QC27 clone, which has additional amino acid substitutions Q18L, F54I, L92H and Y109F, had a 561.32-fold increase in luminescence with PBI-3896, a 392.98-fold increase with PBI-3894 and an increase of 283.85 times with PBI-3896 compared to C1 + A4E. These data show that Q18L, L92H and Y109F can be combined with each other and with additional substitutions to result in variants with improved relative specificity.
[00297] Other substitutions of interest identified from Library 1 have been combined to generate additional variants (Group B) (fig. 10). Additional amino acid substitutions were made in at least one of the following amino acid positions relative to SEQ ID NO: 1: 18, 20, 54, 71, 77, 90, 92, 109 or 127. These substitutions showed an improvement with at least one of the following celenterazines as a substrate: PBI-3841, PBI-3896, PBI-3897, PBI-3894, PBI-3925 or PBI-3932. These variants were analyzed as described for Group A variants using native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3939, PBI-3945, PBI-3840, PBI-3932, PBI-3925, PBI-3894 and PBI -3896. Variant clones were assayed in triplicate as described for secondary manual screening, as previously described and normalized to C1 + A4E. FIG. 11 shows the normalized average luminescence of the variants listed in FIG. 10 with the various celenterazines as substrates. FIG. 11 shows the variants with large increases in luminescence for the new cellenterazine listed compared to C1 + A4E or no change or decrease in luminescence for known and native cellenterazine compared to C1 + A4E.
[00298] Additional variants were generated by substituting additional amino acids I90V and / or Y109F (Group C) and compared to variants generated from Group A or B (see Fig. 12). The clones containing the variants with an I90V substitution (“I90V”), a Y109F substitution (“Y109F”) or both substitutions (“LE2”) were compared with clones QC # 27, QC # 2 E7, QC # 2 F4 and QC # 1 A11 using assays, as described, for Group A recombinants with native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3939, PBI-3945, PBI-3889, PBI-3840, PBI-3925, PBI -3932, PBI-3894, PBI-3896 and PBI-3897 as substrates (Figure 12). Variant clones were assayed in triplicate as described for secondary manual screening as previously described and normalized to C1 + A4E (Fig. 12). FIG. 12 shows the variants with large increases in luminescence for new cellenterazine compared to C1 + A4E and no change or decrease in luminescence for known and native cellenterazine compared to C1 + A4E. FIG. 12 shows that I90V provided greater light production for native celenterazine and several of the new substrates. B. Variants of QC27
[00299] The QC27 variant (SEQ ID NOs: 4 and 5) of A, which has additional amino acid substitutions Q18L, F54I, L92H and Y109F has been cloned into a modified pF4A vector as described above to create an HT7 C-terminal fusion protein (Promega Corp.) (“QC27-HT7”) (SEQ ID NOs: 44 and 45). 4400 variants of QC27-HT7 (Library 2) were generated by random mutagenesis, as previously described, and screened primarily for the increase in the change in relative specificity, as previously described, using native celenterazine and the new cellenterazines PBI-3896 and PBI -3897 as substrates. The variant clones were selected, sequenced and analyzed in a secondary manual screening as previously described using native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3897, PBI-3896 and PBI-3894 as substrates.
[00300] FIG. 13 lists the additional amino acid substitutions (“Sequence”) identified in these variants (“Sample”) and the luminescence of the variants using native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3897, PBI-3896 and PBI-3894 as substrates for secondary screening normalized to the initial corresponding QC27-HT7. The variants in FIG. 14 had at least one of the following additional amino acid substitutions: F1I, R11Q, L18I, L18Q, V21L, V21M, L22F, F31I, Q32H, V45E, L46Q, S47P, G48R, E49D, G51E, D55E, G67S, F68Y, F68L, Q69H, L72Q, E74K, E74I, M75K, I76F, I76V, H86R, I90T, H92Q, H92R, T96A, V98F, I99V, I99T, V102M, M106I, F109Y, L142V, V158I, T159S, G1 is located in the connection region between HT7 and the OgLuc variant).
[00301] The substitutions of amino acid F68Y in variant 24B12, of L72Q in variant 29C4 and M75K in variant 3H11 provided a greater light production for native celenterazine and several of the new substrates. Substitutions for amino acids V21L in variant 25A11 and H92R in variant 1B6 provided the improvement in relative specificity. Both substitutions were cases where the luminescence signals were low using the new cellenterazines as substrates, but they fell even further using the native and known substrates.
[00302] Additional QC27-HT7 variants were generated to have specific amino acid substitutions (Fig. 14) using site-directed mutagenesis, as previously described. Additional substitutions were made at least one of the following amino acid positions relative to SEQ ID NO: 1: 21, 68, 72, 75, 76, 90, 92 and 158, as these positions showed an improvement in changing relative specificity as shown in FIG. 14. FIG. 15 shows the luminescence of the QC27-HT7 variants using native celenterazine, known celenterazine-hh and the native cellenterazines PBI-3897, PBI-3841, PBI-3896 and PBI-3894 as normalized substrates for the initial corresponding QC27-HT7. As can be seen in FIG. 15, combining the three substitutions of the amino acid F68Y, L72Q and M75K with V158I, as, for example, in the variant QC27 # 1, provided a greater production of light for each celenterazine tested. C. Variants QC27-9S
[00303] The QC27-9a variant (SEQ ID NOs: 6 and 7) of B, a QC27-HT7 fusion protein with the additional amino acid substitutions V21L, H29R, F68Y, L72Q, M75K and V158I, was used as a sequence starting point to generate a library. 4,400 variants of QC27-9a (Library 3) were generated by random mutagenesis, as previously described, and tested for increased relative specificity change using native celenterazine and the new cellenterazines PBI-3841 and PBI-3897. The variant clones were selected, sequenced and tested in a secondary manual screening, as previously described using native celenterazine, known celenterazine-hh, known celenterazine-h and the new cellenterazines PBI-3841 and PBI-3897 as substrates. FIG. 16 lists the additional substitutions (“AA change”) identified in the variants (“sample”) and the average luminescence of the variants using native celenterazine, known celenterazine-hh, known celenterazine-h and the new cellenterazines PBI-3841 and PBI - 3897 as substrates in the secondary screening normalized to the initial QC27-9a correspondent. The increase in relative specificity represents cases in which there was a decrease in luminescence for the variant with new, native and known cellenterazines compared to the starting model, but the luminescence with native and known cellenterazines decreased even more. For example, the 30D12 variant with the substitution of the amino acid L22F had a loss of about three times in activity with the new cellenterazines PBI-3841 and PBI-3897. However, with native celenterazine, known celenterazine-h and known celenterazine-hh, the luminescence of the 30D12 variant was ten or more times less.
[00304] FIG. 17 shows a comparison of the C1 + A4E, QC27 and QC27-9a luminescence with the humanized Renilla luciferase (here referred to as “hRL”) (SEQ ID NOs: 30 and 31) using known cellenterazine-hh and the new cellenterazines PBI-3841 and PBI-3897 as substrates. Although the reaction of QC27-9a with PBI-3897 was more luminous than QC27-9a with PBI-3841 (see Fig. 17), the trend of evolution, that is, the magnitude of the improvement in luminescence was greater for PBI- 3841 (Table 6). The combination of the improvement in luminescence (440 times) with the decrease in luminescence for native celenterazine (800 times) indicated a change in the relative specificity (350,000 times) of QC27-9a using PBI-3841 compared to native celenterazine. Table 6: The Change in the Relative Specificity of the OgLuc Variants for PBI-3897 and PBI-3841 Compared to Native Celenterazine and Celenterazine-hh.
D. IVY variants
[00305] IVY (SEQ ID NOs: 8 and 9), a C1 + A4E variant with additional amino acid substitutions F54I, I90V and F77Y, was cloned into a modified pF4A vector as described above to create an HT7 C-terminal fusion protein ( “IVY - HT7”). 4,400 variants of IVY-HT7 (Library 4) were generated by random mutagenesis and selected for increased light production (ie, increased luminosity) and increased relative specificity using native celenterazine, known celenterazine-hh and the new PBI- 3840, PBI-3889, PBI-3925, PBI-3932 and PBI-3945 as substrates. Variant clones were selected, sequenced and tested in triplicate in a secondary screening, as previously described using native celenterazine, known celenterazine-hh and the new celenterazine PBI-3889, PBI-3939, PBI-3945 and PBI-4002 as substrates. FIGS. 18 and 19 list the additional substitutions ("AA change") identified in the variants ("Sample") and the average luminescence of the variants normalized to IVY-HT7 using native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3889, PBI -3939, PBI-3945 and PBI-4002 as substrates in secondary screening. FIG. 18 lists these variants chosen based on the performance of PBI-3945 (Group A), which had at least one of the following amino acid substitutions: Q18H, D19N, Q20P, Q32P, K33N, V38I, V38F, K43N, I44F, E49G, I60V , Q69H, I76N, Y77N, Y94F, G95S, G95D, F110I, V119M, K124M, L149I or R152S. FIG. 19 lists these variants chosen based on performance with PBI-3889 (Group B), which had at least one of the following amino acid substitutions: F6Y, Q18L, L27V, S28Y, Q32L, K33N, V36E, P40T, Q42H, N50K, G51R , H86L, N135D or I155T.
[00306] Additional variants of IVY-HT7 have been generated to have additional specific amino acid substitutions using site-directed mutagenesis, as previously described. FIG. 20 lists variants with at least one of the following additional amino acid positions relative to SEQ ID NO: 1: 19, 20, 27, 32, 38, 43, 49, 58, 77, 95, 110 and 149, as these substitutions were identified in the variants of FIG. 18, which show specificity for PBI-3945 and PBI-4002. FIG. 21 shows the luminescence of the variants listed in FIG. 20 normalized to IVY-HT7 using native celenterazine, known celenterazine-h, known celenterazine-hh and the new cellenterazines PBI-3939, PBI-3945, PBI-4002, PBI-3932 and PBII-3840 as substrates. None of the variants showed an improvement over IVYI-HT7, but there were situations such as variant C5.19 (SEQ ID NOs: 12 and 13) where the luminescence with native or known celenterazine decreased by about 3-4 logs, but the luminescence with PBI-3945 and PBI-4002 decreased only twice. Variant C5.19 has additional amino acid substitutions L27V, V38I and L149I.
[00307] FIG. 22 lists variants with at least one of the following additional amino acid positions for SEQ ID NO: 1: 6, 18, 27, 28, 33, 34, 36, 40, 50, 51, 135 and 155, and as these substitutions have been identified in the variants of FIG. 19, who showed specificity for PBI-3889 and PBI-3939. FIG. 23 shows the luminescence of the variants listed in FIG. 21 using native celenterazine, known celenterazine-h, known celenterazine-hh and the new cellenterazines PBI-3939, PBI-3945, PBI-3889, PBI-4002, PBI-3932 and PBI-3840 as normalized substrates for IVY-HT7. Luminescence decreased in each variant compared to IVY-HT7. Variant C1.3 (SEQ ID NOs: 10 and 11) had about 2000 times more luminescence with PBI-3939 than with native or known celenterazine. Variant C1.3 has additional amino acid substitutions F6Y, K33N, N135D and I155T.
[00308] The best IVY-HT7 variants for the change in relative specificity in relation to hRL and IVY-HT7 were C5.19, which had the best luminescence with PBI-3945 and C1.3, which had the best luminescence with PBI -3889. FIG. 24 shows the luminescence of hRL, IVY-HT7, C5.19 (a HT7 C-terminal fusion) and C1.3 (a HT7 C-terminal fusion) with native celenterazine, known celenterazine-h, known celenterazine-hh and celenterazine new PBI-3939 and PBI-3945. E. Variants IV
[00309] IV (SEQ ID NOs: 14 and 15), a variant C1 + A4E with additional amino acid substitutions F54I and I90V, was generated as previously described. To determine the most brilliant variant for use as a transcriptional reporter, luminescence was measured as described previously for C1 + A4E (SEQ ID NOs: 2 and 3), IVY (SEQ ID NOs: 8 and 9) and IV (SEQ ID NOs: 14 and 15), using native celenterazine, known celenterazine-hh and the new cellenterazines PBI-3939, PBI-3945, PBI-3889 and PBI-4002 as substrates. hRL was used as a control. As can be seen in FIG. 25, IV was brighter than both C1 + A4E and IVY. The substitution of amino acid F54I in IV provided a greater production of light for native celenterazine and several of the new substrates. All three variants were brighter than the hRLs with the tested cellenterazines.
[00310] The data from A, B and D (ie, traces of libraries generated from C1 + A4E, IVY and QC27 as the starting sequences) were analyzed to determine additional amino acid substitutions with increased light production ( that is, the increase in brightness) with a variety of cellenterazines. Variants IV were generated as previously described to have additional substitutions that reduced the specificity for native celenterazine two to ten times. As indicated in FIG. 26, variants IV (“clone”) had an additional amino acid substitution (“Sequence”) of at least one of the following amino acid substitutions: F1I, E4K, Q18L, L27V, K33N, V38I, F68Y, M70V, L72Q, M75K or V102E.
[00311] Sixteen clone plates of variants for all combinations of amino acid substitutions were first screened and analyzed using the automated robotic method described previously with native celenterazine, known celenterazine-h, known celenterazine-hh and the new celenterazines PBI-3889 and PBI-3945 as substrates. Variants with greater luminescence were selected, sequenced and analyzed in triplicate using manual screening, as previously described. Luminescence was measured using native celenterazine, known celenterazine-h, known celenterazine-hh and the new cellenterazines PBI-3889, PBI-3939, PBI-3945 and PBI-4002 as substrates. The corresponding initial sequences IV and hRL were used as controls.
[00312] FIG. 26 lists the variants and additional amino acid substitutions identified in the variants. FIG. 27 shows the average luminescence of the variants in secondary screening normalized to IV. Variant 8A3 (SEQ ID NOs: 26 and 27), which has additional amino acid substitutions F1I, L27V and V38I, had improved relative specificity with the new celenterazines, but was not brighter than IV. The 8F2 variant (SEQ ID NOs: 46 and 47), which has an additional L27V amino acid replacement, offered better relative specificity and brilliance with 3 of the 4 of the new celenterazines used. Variant 9B8 (SEQ ID NOs: 18 and 19), which has additional amino acid substitutions Q18L, F68Y, L72Q and M75K, was brighter for all substrates and offered some advantage in the relative specificity over native celenterazine thus. The 9F6 variant (SEQ ID NOs: 20 and 21), which has additional amino acid substitutions Q18L, L27V, V38I, F68Y, L72Q and M75K, showed similar improvements as seen with 8F2. The 15C1 variant (SEQ ID NO: 16 and 17), which has additional amino acid substitutions E4K, K33N, F68Y, L72Q and M75K, was brighter for all new cellenterazines, but has no benefit in relative specificity. The substitution of amino acid Q18L in variant 1D6 provided improved relative specificity, that is, away from native celenterazine and towards new substrates, in the context of IV. In general, the replacement of additional L27V amino acid provided improved relative specificity in the context of IV.
[00313] FIG. 28 shows the luminescence of variants 8A3, 9B8, 9F6 and 15C1 in secondary screening using native celenterazine, known celenterazine-hh, known celenterazine-h and the new cellenterazines PBI-3939, PBI-3945, PBI-3889 and PBI -4002 as substrates compared to IV and hRL. Variant 8A3 had a reduction of 2 logs in brightness with native celenterazine compared to IV. Variant 9F6 had a 1 log reduction in brightness with native celenterazine compared to IV. The 15C1 variant with PBI-3945 was the brightest, but the half-life signal was short (see Example 27). F. Variants 9B8
[00314] The 9B8 variant of E was further modified to generate additional variants with increased light emission and / or improved relative specificity for PBI-3939.The substitution of the amino acid L72Q appeared to be a beneficial substitution for increasing the light emission (this ie, brightness) since this substitution was identified in variants 9B8, 9F6 and 15C1, all of which showed increased light emission. To determine whether other amino acid substitutions at position 72 could provide similar increases in brightness, additional variants of 9B8 were generated as described previously by saturating position 72 with alternative residues. Four replicates of E. coli lysates were prepared and analyzed for brightness, as previously described using PBI-3939 as a substrate, except that the assay buffer contained 10 mM CDTA, 150 mM KCl, 10 mM DTT, 100 mM HEPES, pH 7.0, 35 mM thiourea and 0.5% TERGITOL ® NP-9 (v / v). Table 7 lists the variants of 9B8 (“Variant”) with similar or improved luminescence compared to 9B8, as indicated by the luminescence normalized to 9B8 (“RLU (normalized to 9B8)”), that is, double the improvement. Substitutions for amino acids A, G, N, R and M at position 72 provided at least the same brightness benefit as amino acid Q, i.e., 1 time. Table 7: Variants with Similar Luminescence Compared to Variant 9B8.

[00315] Additional variants with greater relative specificity for the new PBI-3939 were generated, as previously described, by saturating the positions of amino acids 18, 68, 72, 75 and 90 in variant 9B8. E. coli lysates were prepared and analyzed for brightness, as previously described, using native celenterazine and PBI-3939 as substrates. The relative specificity was determined from the luminance ratio of the variant with PBI-3939 to the luminescence of the variant with native celenterazine, normalized to the corresponding luminescence ratio of 9B8. Table 8 lists variants of 9B8 (“Variant”) with at least a 1.1X increase in relative specificity for PBI-3939. The results demonstrate that at least one additional change at each site provided improved relative specificity for PBI-3939 against native celenterazine. Variants of 9B8 with substitutions for amino acids K, D, F, G, Y, W and H at position 18 showed the greatest improvement in relative specificity. Table 8: Variants with Enhanced Relative Specificity for PBI-3939

G. Variants 9B8 + K33N
[00316] An additional variant, 9B8 opt + K33N (SEQ ID NOs: 42 and 43) was generated to investigate the benefits of replacing the K33N amino acid for brightness, relative specificity and thermal stability. 9B8 opt + K33N has been analyzed and compared to 9B8 opt (described in Example 25A) in various applications.
[00317] E. coli lysates containing the 9B8 opt or 9B8 opt + K33N variant were prepared and analyzed as previously described, except the assay buffer containing 0.1% TERGITOL ® NP-9 (v / v). The luminescence generated from the lysates was measured using the new PBI-3939 and native celenterazine as substrates. The relative specificity of the variants for PBI-3939 and native celenterazine was calculated as described previously. 9B8 opt + K33N (“K33N”) showed higher light production (RLU) and a higher relative specificity for PBI-3939 than native celenterazine compared to opt 9B8 (Fig. 29), indicating that the replacement of K33N provided greater production of light and greater relative specificity.
[00318] A new OgLuc library was created using 9B8opt + K33N as a starting model. The random library was created using DIVERSIFY ® PCR Random Mutagenesis Kit (ClonTech; Catalog # 630703). Condition 5 (as indicated in the user manual) was used to generate additional variants and the average mutation rate was calculated to be 2.6 mutations per gene by compiling sequence data from 83 randomly selected clones. This PCR library was cloned into the pF4Ag-based non-fusional vector base described above and the sandwich bottom, i.e., Id-OgLuc-HT7 (described in Example 45). Variants on the pF4Ag-based non-fusional vector base are designated with (NF). Variants of the sandwich-based vector are designated with (F). In order to clone the PCR product in both vectors, an amino acid, that is, a glycine, was attached to the variant sequence in pF4Ag, generating a new 170 position in the OgLuc (“170G”) variant. 170G is present in the sandwich construct, but in this case, it is considered as part of the link between OgLuc and HT7. For each library, 4,400 E. coli clones were tested, as previously described, with the following exceptions. The lysis buffer contained 300 mM MES at pH 6.0 instead of HEPES and 0.5% TERGITOL ® NP-9 (v / v), but did not contain thiourea. The assay buffer contained 100 mM MES pH 6.0, instead of HEPES and 35 mM thiourea. The assay volumes were as follows: 10 L of cells, 40 L of lysis buffer and 50 L of assay buffer.
[00319] The pF4Ag-based non-fusional PCR library was screened for additional variants with increased luminescence compared to 9B8 opt + K33N +170 G (SEQ ID NOs: 68 and 69). The selected variants were then tested on NIH3T3 and HEK293 cells. For each cell type, 15,000 cells were plated and cultured overnight at 37 ° C. The next day, the cells were transfected as described in Example 25 with 10 ng of pGL4,13 (Promega Corp) as a transfection control and 100 ng of OgLuc test DNA. The medium was removed and the cells were lysed with 100 l of lysis buffer, as described in Example 25, except for the lysis buffer that contained 100 mM MES pH 6.0 instead of HEPES and the luminescence measured using a Luminometer GLOMAX ®. For each sample, 10 l of lysate were tested with 50 L of lysis buffer containing 20 M of PBI-3939. For transfection control, 10 l of lysate were tested with 50 L of BRIGHT-GLO ™ Assay Reagent.
[00320] Table 9 shows twice the increase in the luminescence of variants in E. coli, HEK293 and NIH3T3 cells and the amino acid substitutions found in the variants. O Variants 27A5 (NF) (SEQ ID NOs: 70 and 71), 23D4 (NF) (SEQ ID NOs: 72 and 73) and 24C2 (NF) (SEQ ID NOs: 74 and 75) had at least an increase of 1 , 3 times in luminescence in E. coli and HEK293 cells. Table 9: Increase in Luminescence Generated by OgLuc Variants compared to 9B8 opt + K33N + 170G in HEK293 and NIH3T3 cells, from E. coli,


[00321] Based on the data above, other combinations of variants were designed and generated (see Table 10), in the context of the non-fusional vector base based on pF4Ag without 170G. The variants were analyzed in E. coli, HEK293 and NIH3T3 cells, as described above, and compared to 9B8 opt + K33N. The variants were also examined for luminescence with native celenterazine. Table 10 shows the increase in luminescence of the variants in E. coli, HEK293 and NIH3T3 cells, and the amino acid substitutions found in the variants (“sample”). The variants were named by adding additional amino acid substitutions in the OgLuc variant to the prefix “9B8 opt + K33N” Table 11 shows the relative specificity of different variants for PBI-3939 compared to native celenterazine in E. coli, NIH3T3 cells and HEK293. As shown in Table 10, the 9B8 opt + K33N + T39T + K43R + Y68D variant (“V2”; SEQ ID NOs: 92 and 93) showed increased luminescence in E. coli and a slight improvement in luminescence in NIH3T3 cells. The variant 9B8 opt + K33N + L27V K43R + Y68D (“L27V, K43R, Y68D”) showed a neutral improvement in luminescence (Table 10) and a 5X increase in the relative specificity over 9B8 opt + K33N (Table 11) in the three cell types examined. Table 10: Increase in Luminescence Generated by Combination of OgLuc Variants Compared to 9B8 opt + K33N in E. coli NIH3T3 and HEK293 Cells

Table 11: Change in the Relative Specificity of Combinations of OgLuc Variants for PBI-3939 Compared to Native Celenterazine in E. coli NIH3T3 and HEK293 Cells


[00322] Additional OgLuc variants were generated from 9B8 opt + K33N to contain at least one of the following additional amino acid substitutions for SEQ ID NO: 1: L27V, T39T, K43R, Y68D or S66N (see "Sample" in Table 12 for amino acid substitutions in variants). The variants were named by adding additional amino acid substitutions in the variant after the prefix “9B8 opt + K33N”. These additional variants and variants 9B8 opt + K33N + L27V + Y68D (“L27V, Y68D”), 9B8 opt + K33N + L27V + K43R + Y68D (“L27V, K43R, Y68D”), 9B8 opt + K33N + L27V + K43R + S66N ( “L27V, K43R, S66N”) and 9B8 opt + K33N + T39T + K43R + Y68D (“T39T, K43R, Y68D”, also known as “V2”) above, were examined for brightness, relative specificity, signal stability and stability thermal. The variants were compared with the 9B8 opt (“9B8”) and 9B8 opt + K33N (“K33N”) variants
[00323] E. coli lysates containing the variants were prepared and analyzed as described above. The luminescence generated from the lysates was measured using the new one from PBI-3939 and the native celenterazine as substrates. The luminescence of the variants was normalized to the luminescence generated by the 9B8 opt (Table 12). The relative specificity of the variants for PBI-3939 and native celenterazine was calculated by dividing the luminescence of the variants using PBI-3939 as a substrate with the luminescence of the variants using native celenterazine as a substrate (Table 12). These data indicate that the substitution of the amino acid L27V reduces the specificity for native celenterazine. Table 12: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 and Change in Specificity of OgLuc Variants for PBI-3939 compared to Native Celenterazine in Bacterial Lysates
H. V2 variants
[00324] A set of additional variants was designed using V2 (9B8opt with the additional amino acid substitutions K33N + T39T + K43R + Y68D) as a model. The substitutions shown in Table 13 were designed based on: 1) known diversity according to the alignment based on the structure of 28 fatty acid binding proteins (1VYF, 1FDQ, 2A0A, 1O8V, 1BWY, 2ANS, 1VIV, 1PMP, 1FTP , 2HNX, 1JJJ, 1CBR, 2CBS, 1LPJ, 1KQW, 2RCQ, 1EII, 1CRB, 1IFC, 2PYI, 2JU3, 1MVG, 2QO4, 1P6P, 2FT9, 1MDC, 1O1U, 1EIO; See Published Order US 2010/0281552); or 2) investigation of alternative residues at previously identified positions to play an important role in the specificity of the substrate. The changes listed under “Consensus” in Table 13 refer to residues identified in at least 50% of the fatty acid binding proteins mentioned above, aligned. The changes listed under "Predominant Minority" relate to residues identified in many of the fatty acid binding proteins mentioned above, but found in less than 50% of the aligned sequences. The changes listed in “Others” relate to residues that were identified less frequently than that of the predominant minority residue in a given position in the aligned sequences. Finally, the changes listed under "Specificity" concern positions suspected of being involved in determining the specificity of a variant for celenterazine or an analogue celenterazine. For example, changes in specificity projected at position 27 (leucine residue in the parental sequence, for example, V2), have been changed to other hydrophobic residues or amino acids representing alternative chemicals (eg, ring-containing hydrophobic residues, residues containing side chains uncharged polar or residues containing charged side chains); and the specificity changes projected at position 40 (proline in the parental sequence), were in a sampling of different chemicals (ie, other hydrophobic residues containing rings, residues containing uncharged polar side chains or residues containing charged side chains); note that glycine, glutamine, isoleucine and leucine are identified at this position in the aligned fatty acid binding protein. Table 13

[00325] The variants were constructed using standardized site-directed mutagenesis protocols (see previous examples) and the resulting plasmids transformed into E. coli for analysis. Cultures were grown by standard walk away induction in minimal medium, as previously described. A10 l of E. coli cells transformed and cultured, 40 l of lysis buffer (100 mM MES pH 6.0, 0.3 X PLB, 0.3 mg / ml lysozyme, 0.003 U / L of RQ1 DNA and 0.25% TERGITOL® NP-9 (v / v)) was added followed by the addition of an equal volume (50 l) of assay reagent (1 mM CDTA, 150 mM KCl, 2 mM DTT, 20 M PBI-3939 or native celenterazine, 100 mM MES pH 6.0, 35 mM thiourea and 0.5% TERGITOL® NP-9 (v / v)). Luminescence was measured in a GLOMAX® 96 Microplate Luminometer (Promega Corp.).
[00326] Table 14 summarizes the different amino acid substitutions identified in the analysis. The data are presented as normalized for the parental clone (V2) with respect to the luminescence measured for both PBI-3939 and native celenterazine. The relative change in the specificity of PBI-3939 compared to native celenterazine is also shown. Table 14
I. L27V variants
[00327] Using the L27V OgLuc variant as a starting model, that is, starting sequence or parental sequence, additional variants were performed in which some of the amino acids (Table 15) in the L27V variant were reverted to the amino acids found in the native OgLuc luciferase from SEQ ID NO: 1. The variants were constructed by site-directed mutagenesis, as previously described. The variants were then examined as described above for relative activity, either with native celenterazine or with PBI-3939. Luminescence was measured on a TECAN ® INIFINITE® F500 5 minutes after the substrate / assay reagent (as described in H) was added and normalized for the L27V variant starting model. SDS-PAGE analysis of lysates indicates comparable levels of expression (data not shown).
[00328] Table 15 shows the relative activities of the L27V variants with native celenterazine or with PBI-3939. Relative activities <1 indicate that the reversal is harmful compared to the residue at the site in the L27V variant. Relative activities> 1 indicate that the reversal is favorable for the activity compared to the residue at that location in the L27V variant. Some additional data on these mutants indicated the following: 166K, 54F, 54A and L27V were tested for thermal stability. The T1 / 2 60 ° C for 166K, 54F and 54A were 87, 74, and 33%, respectively, indicating that these substitutions cause a reduction in thermal stability. The Km values for the same four variants were as follows: for native celenterazine, L27V was 16 μM, 54A was 23 μM, 54F was 40 μM, and 166K was 21 μM; for PBI-3939, L27V was 18 μM, 54A was 62 μM, 54F was 163 μM, and 166K was 23 μM. This indicates a greater affinity for the L27V, particularly for the 54 substitution position. Table 15

Example 23 - Mutational Analysis of Position 166
[00329] A. To evaluate the effect of different amino acids at position 166 in relation to luciferase activity, the arginine residue (R) at position 166 was substituted for each of the other 19 amino acids, using site-directed mutagenesis, as previously described in the context of a pF4Ag vector (i.e., within the wild-type OgLuc sequence SEQ ID NO: 1). These 166 position variants were then expressed in E. coli, as described above.
[00330] To create lysates, 50 μL of 0.5X FASTBREAK ™ Cell Lysis Reagent (Promega Corp.) was added to 950 l of induced cultures, and the mixtures were incubated for 30 minutes at 22 ° C. For analysis, 50 µL of lysate was analyzed in 50 µL of assay reagent (as described previously in Example 22H) with 100 µM of PBI-3939, native 30M celenterazine, or 22M celenterazine-h). Luminescence was measured as previously described (FIGS. 30A-C). The figures. 30 A-C show the relative activity of the N166 mutants. Western analysis confirmed the comparable expression of all variants (data not shown).
[00331] B. The substitutions of specific individual amino acids, L27V, A33N, K43R, M75K, T39T, L72Q and F68D were evaluated in the wild type or N166R base OgLuc. Individual amino acid substitutions were generated through site-directed mutagenesis, as previously described, expressed in E. coli, as described above, and luminescence measured using the assay reagent (described previously in Example 22H) with 22 μL of native celenterazine (Fig. 30D). Western analysis confirmed the comparable expression of all variants (data not shown). Example 24 - Suppression Variants
[00332] The deletions to the L27V variant were made as follows: Table 16

[00333] The N-terminal of the OgLuc L27V variant is methionine, valine and phenylalanine, that is, MVF. For numbering purposes, phenylalanine was considered as the first amino acid. "Val-1" indicates that Valina in "MVF" has been suppressed. The "MVF" methionine has been included in these deletions. The L27 deletion variants were cloned into the pF4Ag vector and expressed in an E.coli KRX cell, as previously described. Lysate inductions and preparations were performed as described, lysates were analyzed using the assay reagent (described earlier, 100 μL PBI-3939), and luminescence measured as described previously (FIG 31). The data shows that the smaller fragments of the OgLuc variants can also generate luminescence. Example 25 - Codon optimization of OgLuc variants A. IV and 9B8
[00334] OgLuc variants IV and 9B8 were used as models for codon optimization. The objectives, as understood by those skilled in the art, were two: 1) to remove transcription factor binding sites, or other regulatory sequences, for example, promoter modules, Splice donor / receptor sites, splice mufflers, Kozak sequences , and poly-A signals, which could potentially interfere with the regulation or expression of the OgLuc and 2 variants) to alter the DNA sequence (via silent mutations that do not alter the protein sequence) to eliminate the rarely used codons, and favor the most commonly used codons in E. coli cells, from other mammals, or other eukaryotic organisms (Wada et al., Nucleic Acids Res., 18: 2367 (1990)).
[00335] Two different optimized sequences for IV and 9B8, known as opt (also known as optA) and optB, were designed for each variant. The first optimized sequence, that is, opt / optA for each variant, was designed by identifying the two best, that is, the most common human codons for each site (see Table 17) and, then, by randomly choosing one of the two for incorporation in each site. For the optB versions, the previous optimized version of the codon usage, that is, opt / optA, was used as a starting model, and each codon was replaced with the other of the two best human codons identified for this codon optimization strategy. As an example, leucine at position 3 in sequence IV or sequence 9B8 is encoded by the codon TTG. TTG is not one of the two most common codons for leucine in a human cell, and therefore the codon has been changed to the most common, alternative codons for leucine, CTC (opt / optA) or CTG (optB). This same process was repeated for all leucines in the sequence, and due to the random nature of the approach, the CTC codon may end in optB and CTG may end in optA. Due to this approach of using two codons for optimization, the opt / optA and optB sequences were maximally different from codons. Table 17: Codons used in Codon Optimization


[00336] Each of the 4 sequences (IV opt, IV optB; 9B8 opt, 9B8 optB) were then analyzed (Genomatix Software, Germany) for the presence of the transcription factor binding sites or other regulatory sequences, as described above , and these undesirable sequences were interrupted by silent nucleotide changes. In some cases, where there were other non-rare codons for both the human and E. coli cells, the transcription factor binding sites or other regulatory elements were removed by altering one of these codons, even though they were not the choice # 1 or choose # 2 (see Table 18). In cases where the removal of a transcription factor binding site or a regulatory element could involve the introduction of a rare codon, the transcription binding site (or other regulatory element) has generally not been changed. Table 18: Additional Codons Used to Remove the Transcription Factor Binding Sites and Other Regulatory Elements


[00337] Codon optimized versions of IV (“IV opt” (SEQ ID NO: 22) and “IV optB” (SEQ ID NO: 23)) and 9B8 (“9B8 opt” (SEQ ID NO: 24) and “ 9B8 optB ”(SEQ ID NO: 25)) were generated and cloned into pF4Ag by methods known in the art. HEK293 cells were plated in 96-well plates at 15,000 cells / well and cultured overnight at 37 ° C. The next day, the cells were transiently transfected in 6 replicates of wells using the TRANSIT®-LT1 Transfection Reagent (Mirus Bio) with 100 ng of plasmid DNA that encodes the codon-optimized versions in pF4Ag and grown overnight at 37 ° C ° C. HEK293 cells were also transfected with pGL4,13 (Luc2 / SV40) (Paguio et AL., “Vectors pGL4: Promega Notes, 89: 7-10 (2005)) or pGL4,73 (hRL / SV40) (Id.) to normalize differences in transfection efficiency. 10 ng / transfection or 10% of the total transfected DNA was used. The medium was removed, and the cells were lysed with 100 μL of lysis buffer which contained 10 mM CDTA, 150 mM KCl, 10 mM DTT 100 mM HEPES, pH 7.0, 35 mM thiourea and 0, 5% TERGITOL® NP-9 (v / v) to create a lysate sample. The luminescence of the lysate sample was measured in a TECAN ®INFINITE ® F500 luminometer, as indicated: for hRL, and the OgLuc variants, 10 μL of the lysate sample were examined for luminescence with 50 μL of lysis buffer containing 20 μM substrate (native celenterazine for hRL and PBI-3939 for OgLuc variants). For Luc2 (SEQ ID NOs: 28 and 29), a firefly luciferase, 10 μL of lysate sample were examined for luminescence with 50 μL of BRIGHT-GLO ™ Luciferase Assay Reagent (Promega Corp.).
[00338] FIG. 32 shows a comparison between the luminescence measured for the lysates containing the codon-optimized versions of the OgLuc variants, compared to hRL and Luc2. The hRL and OgLuc variants were normalized to pGL4,13 and Luc2 was normalized to pGL4,73 using methods known in the art. As shown in FIG. 32, Luc2 had a luminescence of about 14 times greater than hRL. The OgLuc variants had greater luminescence compared to Luc2 and hRL. The optimized versions of IV codons (“IV opt” and “IV optB”) and 9B8 (9B8 opt ”), showed an increase in luminescence compared to the non-optimized codon versions.
[00339] As a result of this optimization, the "opt / optA" versions have better expression in human HEK293 cells than their parental sequences, while the "optB" versions did not express themselves as well as in HEK293 cells compared to the parental sequence. B. L27V
[00340] The L27V variant (SEQ ID NO: 88) has been optimized to minimize the occurrence of elements to minimize the occurrence of elements responding to any common vertebrates (any transcription factor binding site (TFBS) in the Genomatix database ). Three different optimized versions of the L27V variant have been created:
[00341] 1. L27V01 - version 1 (SEQ ID NO: 319) - The Promoter Modules and all other undesirable sequence elements (more details below) have been removed by nucleotide substitutions except for the individual TFBSs.
[00342] 2. L27V02 - version 2 - L27V01 was used as a starting point, that is, parental sequence, and as much TFBSs are removed as possible, using high rigor comparison criteria (A high rigor involves a better correspondence with the site and therefore will find fewer matches than a low stringency). There were two versions, A (SEQ ID NO: 322) & B (SEQ ID NO: 318), created for L27V02. These two versions were created by selecting different codons for each version to remove unwanted sequence elements. Both versions were analyzed, in the search for TFBSs with less rigor.
[00343] 3. L27V03 - version 3 (SEQ ID NO: 325) - L27V02B (SEQ ID NO: 318) was used as the starting sequence. TFBS matches that are less stringent are removed whenever possible. L27V03 was created to be a very distinct codon from L27V02A.
[00344] The following criteria were used to create the optimized variants of L27V:
[00345] 1. Use of codons: Preferably, the two best human codons were used for each amino acid (as was done for variant IV), as well as the use of rare human codons (HS, which codes for <10% of amino acids) was avoided (Table 19). Rare E.Coli (CE) codons are used, if necessary, to remove unwanted sequence elements. Table 19


[00346] 2. Undesirable sequence elements that have been removed whenever possible.
[00347] A. Restriction Enzyme (RE) Sites: RE sites have been removed, which would be very useful (ORF).
[00348] B. Eukaryotic Sequence Elements: donor and splice acceptor sites, splice silencers, Kozak sequence and PolyA sequences in the mRNA (+) filament were removed.
[00349] C. The Vertebrate Promoter (PM) Modules (in the Genomatix: Vertebradoe category) have been removed.
[00350] D. TFBS Vertebrates (in the Genomatix categories: Vertebrates, general Core Promoter Elements, and other diverse sequences) have been removed, whenever possible. This applied only to L27V 2 and 3, but not for version 1.
[00351] E. E. colis Sequence Elements: E. coli promoters have been removed.
[00352] F. Secondary RNA Structure: Strong secondary structures (high mRNA duplication energy) close at the 5 'end (Zuker, Nucleic Acid Res. 31 (13): 3406-3415 (2003)) and other strong hairpin structures have been removed.
[00353] A sequence comparison, the percentage of the paired sequence identity is provided in Table 20 ("()" indicates the number of nucleotide differences). Table 20
Example 26 - Signal Stability of OgLuc Variants A. 15C1.9B and IV
[00354] Signal stability of 15C1 with PBI-3945 and 9B8 with PBI-3889 was measured and compared to IV. E. coli that contains the plasmid DNA encoding 15C1.9B8, or IV that was cultured and induced as described previously in 8-well replicates. The cells were lysed using a lysis buffer containing 300 mM HEPES pH 8.0, Passive Lysis Buffer 0.3X ("PLB"; Promega Corp. Cat. No. E194A), Lysozyme 0.3 mg / mL, and 0.003 U / μL RQ1 DNase. Lysates were diluted 1: 1000 in a lysis buffer and measured for luminescence using a TECAN® INFINITE® F500 luminometer. Measurements were taken immediately after adding 10 μL of the diluted lysate sample to 50 μL of 0.5% TERGITOL “Glo” assay buffer (“0.5% TERGITOL”), which contained 150 mM KCl, 1 mM CDTA, 10 mM DTT, 100 mM thiourea, 0.5% TERGITOL® NP-9 (v / v), and 20 μM new celenterazine PBI-3945 or PBI 3889.
[00355] The signal stability of the variants was determined by reading the plate every 30 seconds for a period of time after adding the test buffer to the sample. The half-life of the signal was determined from these measurements, using methods known in the art. The half-life of the signal was compared between the variants and IV. Both 15C1 and 9B8 had a signal half-life of at least 30 min (FIG. 33). Although 15C1 tested with PBI-3945 had a greater luminescence at t = 0, the signal decreased faster than the 9B8 variant tested with PBI-3889. At t = 10 min, the luminescence for 15C1 with PBI-3945 and 9B8 with PBI-3889 was equivalent. B. 9B8 opt + K33N
[00356] The signal stability of the 9B8 opt + K33N variants was examined. E. coli lysates containing the variants were prepared and analyzed as described above, except the assay buffer containing 0.25% TERGITOL® NP-9 (v / v), 100 mM MES pH 6.0, 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, and 20 μM PBI-3939. Table 22 shows the signal half-life in minutes of the variants and indicates that substitution of the amino acid L27V improves signal stability. Table 22: Signal Stability of OgLuc variants in bacterial lysates

[00357] The signal activity and the stability of the L27V variant (9B8 + K33N + L27V + T39T + K43R + Y68D; SEQ ID NO: 88 and 89) were measured and compared to the firefly luciferases (Luc2) and Renilla. The L27V variant, Luc2 and Renilla luciferases were fused with HALOTAG® and expressed in E. coli. Luciferases were purified using HALOTAG® as a purification tag according to the manufacturer's protocol (pFN18A; HALOTAG® Protein Purification System). 10 pM of each purified luciferase (diluted in DMEM without 0.01% PRIONEX® phenol red) was then mixed with an equal volume of a test reagent (100 mM MES pH 6, 35 mM thiourea, 0.5% TERGITOL® NP-9 (v / v), 1 mM CDTA, 2 mM DTT, 150 mM KCl, and 100 μM PBI-3939 for the L27V variant; ONE-GLO ™ Luciferase Assay System (Promega Corp.) for the luciferase of firefly, and RENILLA-GLO ™ Luciferase Assay System (Promega Corp.) for Renilla luciferase), and luminescence was measured over time (3, 10, 20, 30, 45 and 60 min). FIGS. 34A-B demonstrate the high specific activity (FIG. 34A) and signal stability (FIG. 34B) of the L27V variant compared to firefly and Renilla luciferase. Example 27 - Kinetics of the OgLuc Variant enzyme A. IV, 15C1.9B8, 9F6 and 9A3
[00358] Using methods known in the art, kinetic enzyme assays that measure luminescence were performed with E. coli lysates containing variants IV and IV 15C1.9B8, 9f6, and 9A3. The cells were induced, lysed, and diluted as described in Example 26, except for the lysis buffer which had a pH of 7.5. Two double serial dilutions of PBI-3939 in assay buffer described earlier in Example 26 were assayed with the diluted lysates. FIG. 35 shows the Km and Vmax values calculated using a hyperbolic adjustment for IV and variants 15C1.9B8, 9f6, and 9A3. Variants 9B8 and 9f6 had higher Km values compared to IV, while Km values for the other variants were unchanged. Variants 15C1.9B8, 9f6 and all had higher Vmax values, while 8A3 had a lower Vmax value compared to IV.
[00359] 15C1, which showed the highest luminescence with PBI-3945 contained the substitution of the amino acid K33N, indicating that K33N provided increased luminescence. A variant 9B8 was generated to have this additional replacement to provide an improvement in luminescence for this variant. Other variants of 9B8 and 9f6 have been generated to have at least one of the amino acid substitutions K33N or V38I (“9B8 + K33N + V38I” and “9F6 + K33N”). The 1D6 variant was used to highlight the importance of amino acid substitutions at positions 68, 72 and 75 to increase light output and stability. FIG. 36 shows the Km and Vmax values calculated using a hyperbolic adjustment for IV and variants 9B8, 9B8 + K33N + V38I, 9F6, 9F6 + K33N and 1D6. While the actual Km values were different between FIGS. 35 and 36 for 9B8 and 9F6, the general trend between the variants was consistent.
[00360] The enzyme kinetics, that is, Km and Vmax values, were determined and compared for variants 9B8 opt and 9B8 opt + K33N, as described above, except for E. coli lysates that were tested with a buffer containing 1 mM CTDA, 150 mM KCl, 2 mM DTT, 100 mM MES pH 6.0, 35 mM thiourea, 0.25% TERGITOL® NP-9 (v / v), 10 mg / mL hydroxypropyl-β-cyclodextrin, and 20 μM PBI-3939. Luminescence was measured on a TECAN® INFINITE® F500 luminometer. As shown in FIG. 37, the Vmax and Km values for 9B8 opt + K33N were higher than 9B8 opt, indicating that this clone is brighter and has a lower affinity for the substrate. B. VARIANTES 9B8 OPT + K33N
[00361] The enzymatic kinetics values were determined for the OgLuc variants as previously described, except for the luminescence that was measured using a GLOMAX ® luminometer. Three replicas were used for each variant. Table 23 shows the average of Km and Vmax values, with the standard deviation (“Km (+/-)” and “Vmax (+/-)” respectively) calculated using HYPER.EXE, Version 1.0. Table 23: Vmax (RLU / 0.5 sec) and Km (µM) values for OgLuc variants
Example 28 - Protein Stability of OgLuc variants
[00362] Since the stability of the luciferase protein is another factor that affects luminescence, the stability of the protein, that is, the thermal stability of the variants has been determined. A. 15C1.9B8, 9F6, 8A3 and IV
[00363] E. coli lysates containing 15C1.9B8, 9F6, 8A3 or IV e. coli expressing hRL (SEQ ID NO: 30 and 31) were prepared from induced cultures, as described previously. Lysate samples were diluted 1: 1000 with a buffer containing 10 mM HEPES pH 7.5 with 0.1% gelatin. Samples of diluted lysate (100 μL) in replicated 96-well plates were incubated at 50 ° C. At different time periods, plates were placed at -70 ° C (minus seventy degrees Celsius). Before luminescence measurement, as previously described, each plate was thawed at room temperature, that is, 22 ° C, for 10 min. Samples (10 μL of each thawed sample) were assayed using native celenterazine as a substrate. Luminescence was measured immediately after adding a test buffer to each time plate. The protein half-life, which indicated the protein's stability, was calculated from the luminescence data, for each period of time using methods known in the art.
[00364] Table 24 shows the protein stability of variants 15C1.9B8, 9F6, and 8A3 that have half-lives in min (h) of 630.1 (10.5), 346.6 (5.8), 770.2 (12.8) and 65.4 (1.1), respectively. In comparison, hRL had a half life of 9.6 min, while IV had a half life of 27.2 min. Table 24 also shows that at 4 h, 79%, 61%, and 80% of 15C1.9B8, and 9F6, respectively, remained active. Table 24: Protein Stability of OgLuc Variants at 50 ° C
B. 1D6.9B8, 9B8 + K33N + V38I, 9F6, 9F6 + K33N, and IV
[00365] E. coli lysates containing 1D6.9B8, 9B8 + K33N + V38I, 9F6, 9F6 + K33N, or IV were prepared from induced cultures and tested for luminescence, as previously described. Protein stability, i.e., thermal stability of lysates, was measured as described above in this Example. FIG. 38 shows the half-life in minutes (min) of the variants at 50 ° C, and the luminescence of the samples measured at the beginning of the incubation period, that is, t = 0, using native celenterazine as a substrate. The difference between the 9B8 + 33 + 38 and 9F6 variant was an amino acid substitution, L27V, indicating that this amino acid substitution had increased stability. The addition of the “activity / expression” substitutions at positions 68, 72, and 75 had increased stability. FIG. 38 shows that K33N provides greater thermal stability for variant 9F6 and that variant 9B8 had greater light output and stability than variant 1D6. The difference between these two variants, that is, 9B8 contains additional amino acid substitutions F68Y, L72Q, and M75K, indicated the importance of these three substitutions.
[00366] In addition to thermal stability, structural integrity determined by expression, stability, and solubility can also affect luminescence. As a way to further test the structural integrity of the improved variants, KRX E. coli which houses N166R OgLuc variants based on pF4Ag (ie, without HT7) (previously described in Order US 12 / 773.002 (Published Order US 2010/0281552) ), C1 + A4E, IV, 9B8, and 9F6 were grown at 37 ° C in Luria broth (LB) for an OD600 = 0.6 and then induced for overexpression by the addition of rhamnose (0.2% final concentration). Duplicate induced cultures were then grown at 25 or 37 ° C for 17 h, in which the total time (T) and soluble (S) fractions were prepared and analyzed by SDS-PAGE using SIMPLYBLUE ™ SafeStain (Invitrogen) to stain the gels (FIGS. 39A-B). hRL and Luc2 were used as controls.
[00367] The OgLuc, hRL and Luc2 variants had good expression and were soluble when the induction occurred at 25 ° C (FIG. 39A; observe the dark band of about 19 kDa in the “soluble” fraction for the OgLuc variants , excluding the N166R variant, and the bands of approximately 36 and 64 kDa in the “soluble” fraction for hRL and Luc2, respectively). In contrast, although C1 + A4E, IV, 9B8, and 9F6 expressed well at 37 ° C (significantly better than hRL or Luc2, as shown in the “total” fraction), only variants 9B8 and 9F6 were soluble when the high induction temperature was employed (see FIG. 39B; observe the dark band of approximately 19 kDa dark in the “soluble” fraction for 9B8 and 9F6). These results were tracked with the thermal stability data shown in Table 24 and FIG. 38. C. 9B8 OPT AND 9B8 OPT + K33N
[00368] The thermal stability of the 9B8 opt and 9B8 opt + K33N variants was compared. E. coli lysates containing the 9B8 opt + K33N variant were prepared and analyzed as previously described with the following exceptions: The lysates were diluted 1: 100 in the lysis buffer described above and replicated diluted lysates were incubated at 60 ° C in a thermocycler. The aliquots were removed at different time points and placed on dry ice to freeze the samples. Frozen lysates were thawed at 22 ° C and assayed with a buffer containing 20 mM CDTA, 150 mM KCl, 10 mM DTT, 20 μM PBI-3939, 100 mM HEPES pH 7.0, 35 mM thiourea, and 0.1% TERGITOL® NP-9 (v / v). Luminescence was measured using a GLOMAX® luminometer (Promega Corp.). FIG. 40A shows the output time course of the natural logarithm (ln) value of luminescence measured in RLU over time in min. As shown in FIG. 40B, 9B8 opt + K33N had a half life at 60 ° C of 6.8 h, which was longer than the 5.7 h half life of 9B8 opt.
[00369] Table 25 shows the thermal stability at 60 ° C (“T1 / 2 (60 ° C)”) of 9B8 opt and 9B8 opt + K33N, and the luminescence data (“RLU”) at the beginning of the incubation (ie, t = 0). 9B8 opt + K33N was more stable and approximately 1.8 times brighter than 9B8 opt, indicating that the replacement of the amino acid K33N provided both greater light output and greater thermal stability. Table 25: Thermal Stability and Luminescence Data for 9B8 opt and 9B8 opt + K33N
D. Variants 9B8 + K33N
[00370] The thermal stability of the variants at 60 ° C was examined as described above, except for the assay buffer which contained 100 mM MES pH 6.0 instead of HEPES. Table 26 and FIG. 41 show the half-life in h of the variants at 60 ° C. The data indicate that substitution of the amino acid L27V improves thermal stability. Table 26: Thermal Stability of OgLuc Variants at 60 ° C

[00371] Variants 9B8 and V2 (9B8 + K33N + T39T + K43R + Y68D) were also screened in HEK293 cells to determine their stability. The variants were cloned into pF4Ag and transfected into HEK293 cells (15,000 cells / well) as previously described. After transfection, cells were lysed in an assay reagent (as previously described; without PBI-3939), and luminescence measured using the 20 μM PBI-3939 assay reagent. 9B8 had a half life of 5.2 h while V2 had a half life of 16.8 h. This is consistent with the half-life observed for these variants in E. coli (Table 26). E. L27V variant
[00372] The activity of the L27V variant (9B8 + K33N + L27V + T39T + K43R + Y68D) was evaluated at various pHs and different salt conditions. 9B8 and 9B8 + K33N have previously been observed to have similar stability at pH 6 and pH 7 (data not shown). For the assessment of activity under various salt conditions, 50 μL of assay buffer with 20 μM PBI-3939 and varying amounts of KCl or NaCl were mixed with 50 μL of HEK293 cells transiently transfected with L27V (pF4Ag). Luminescence was measured, and the percentage activity (the ratio of luminescence to no salt) was determined (FIG. 42B). For the evaluation of activity at various pHs, a reagent was performed containing 100 mM citrate, 100 mM MES, 100 mM PIPES, 100 mM HEPES, 100 mM TAPS, 0.5% TERGITOL® NP-9 (v / v), 0.05% MAZU® DF 204, 1 mM CDTA, and 1 mM DTT titrated to various pH values. 362 pM L27V in a test reagent were mixed with 100 μM PBI-3939 substrate and luminescence was measured. (FIG. 42A). Example 29 - Filtration of Gel Chromatographic Analysis of OgLuc Variants A. C1 + A4E and 9B8
[00373] Gel filtration analysis was used to check the molecular weight of purified OgLuc proteins based on theoretical values and consequently to determine their oligomeric states. A comparison between the relative hydrodynamic volume of the OgLuc C1 + A4E and 9B8 variants was performed using gel filtration chromatography. For this analysis, the nucleotide sequence for the OgLuc variants, C1 + A4E and 9B8, was cloned into a HQ-Labeled FLEXI® Vector (Promega Corp.) to create an N-terminally labeled protein HQHQHQ that was overexpressed in E cells coli KRX. The overexpressed proteins were purified using the HISLINK ™ Protein Purification System (Promega Corp.) according to the manufacturer's instructions. Samples of each sample protein and individual standard were analyzed using gel filtration chromatography, which was performed at 24 ° C on an Agilent 1200 HPLC, using a Superdex 200 5/150 GL column (GE Healthcare) with a flow rate of 0 , 25 ml / min (FIGS. 43A-B). The mobile phase (i.e., running buffer) consisted of 50 mM Tris and 150 mM NaCl, pH 7.5. Protein elution was monitored at 214 and 280 nm. A standard calibration curve was generated using: 1) Ovalbumin, 43 kDa (GE Healthcare), 2) Carbonic Anhydrase, 29 kDa (Sigma) and 3) Myoglobin, 17 kDa (Horse Heart, Sigma). The molecular weights of the purified proteins were calculated directly from the calibration curve.
[00374] The relative elution of proteins observed with this column was Ovalbumin at 7.98 min, Carbonic Anhydrase at 8.65 min, 9B8 at 8.97 min, and Myoglobin at 9.06 min (FIGS. 43A-B) . As shown in FIG. 43B, 9B8 eluted as a 21 kDa protein (predicted PM is about 19 kDa) indicating that variant 9B8 existed as a monomer, while C1 + A4E eluded in approximately 4.3 min (FIG. 43A), indicating that C1 + A4E has been expressed and exists as a multimer, for example, possibly as a tetrametric complex or something larger. B. L27V variant
[00375] To demonstrate that the OgLuc L27V variant exists in a monomeric state, the gel filtration analysis was used to verify the expected molecular weight of the purified L27V protein based on the theoretical value, and consequently to determine its oligomeric state. The relative hydrodynamic volume of the L27V variant was performed using gel filtration chromatography. For this analysis, the nucleotide sequence for the variant was cloned into a pFN18A HaloTag® vector (Promega Corp.) to create a terminally labeled HaloTag® protein that was overexpressed in E. coli KRX cells (Promega Corp.). The overexpressed protein was purified using the HaloTag® Protein Purification System (Promega Corp.) according to the manufacturer's instructions. Samples of each sample protein and individual standard were analyzed using gel filtration chromatography performed at 24 ° C on an Agilent 1200 HPLC using a Superdex 200 5/150 GL column (GE Healthcare) with a flow rate of 0.25 mL / min (FIG. 56). The mobile phase (i.e., running buffer) consisted of 50 mM Tris and 150 mM NaCl, pH 7.5. Protein elution was monitored at 214 and 280 nm. A standard calibration curve was generated using: 1) Ovalbumin, 43 kDa (GE Healthcare), 2) Myoglobin, 17 kDa (Horse Heart, Sigma), and 3) Ribonuclease, 14 kDa (Bovine pancreas, GE Healthcare). As shown in FIG. 44, the L27V variant eluted as a 24 kDa protein (predicted PM is approximately 19 kDa) indicating it existed as a monomer. Example 30 - Protein Expression Levels of OgLuc variants A. IV. 8A3, 8F2, 9B8, 9F6 and 15C1
[00376] Normalization for protein expression provides information on potential differences in specific activity. To provide a means to quantify protein expression, the OgLuc variants were cloned into a pF4Ag vector containing a HT7 C-terminal to generate the OgLuc variant fusion proteins, as described above. The following fusion proteins were generated: IV-HT7 (SEQ ID NOs: 48 and 49), 8A3-HT7 (SEQ ID NOs: 34 and 35), 8F2-HT7 (SEQ ID NOs: 50 and 51), 9B8-HT7 (SEQ ID NOs: 36 and 37), 9F6-HT7 (SEQ ID NOs: 38 and 39), and 15C1-HT7 (SEQ ID NOs: 52 and 53). E. coli containing the HT7 fusions of the OgLuc variant was cultured and induced as previously described. 900 μL of the cell culture was lysed with 100 μL of 10X FASTBREAK ™ Cell Lysis Reagent (Promega Corp.). TMR HALOTAG® ligand (Promega Corp.) was added to each sample of bacterial lysate to obtain a concentration of 0.5 μM. Bacterial lysates were incubated with the TMR HALOTAG® TMR ligand for 30 min at room temperature according to the manufacturer's instructions. 10 μL of each sample was diluted 1: 1 with 1X FASTBREAK ™, that is, 10 μL of sample to 10 μL of 1X FASTBREAK ™. 15 μL of the lysate and 15 μL of the 1: 1 dilution for each sample were analyzed for each sample by SDS PAGE. Labeled fusion proteins were resolved by SDS-PAGE, and stained with SIMPLYBLUE ™ (FIG. 45A) and represented by fluorescence (GE Healthcare Typhoon). Bands were quantified using the software using Imagequant (GE Healthcare). FIG. 45B shows the volume of the strip measured from FIG. 45A for IV-HT7 (“IV”), 15C1-HT7 (“15C1”), 9B8-HT7 (“9B8”), 9F6-HT7 (“9F6”), and 8F2-HT7 (“8F2”), normalized to IV-HT7. The data show that variants IV expressed well compared to IV. B. 9B8 opt, V2 and L27V
[00377] The expression and solubility levels of 9B8 opt, V2 and L27V were compared. These three variants, in the context of a pF4Ag base, were used to transform E. coli KRX cells. The resulting clones were used for an expression experiment in which single colonies were grown overnight at 30oC, diluted 1: 100 in LB, grown in an OD600, of approximately 0.5, and then induced with 0.2% of rhamnose for 18 h at 25oC. The cells were then incubated for 30 min. at room temperature in the presence of 0.5X FASTBREAK ™ Lysis Reagent (Promega Corp.), and the resulting lysates were stored at -20oC. Subsequently, a slow thawing on ice, soluble fractions were prepared by centrifugation for 10 min at 4 ° C. The total crude (T) and soluble (S) fractions were then analyzed for expression levels using SDS-PAGE + Simply Blue Staining (FIG. 46A), as well as by measuring luminescence (FIG. 46B). For luminescence measurement, 50 μL of soluble lysates in 96-well microtiter plates were mixed with 50 μL of assay reagent (previously described; 40 μM PBI-3939), and the luminescence measured using a TECAN multidetection plate reader ® INFINITE® F500. These results indicated that the classification for these three variants, in terms of their levels of expression and solubility, is L27V> V2> 9B8 opt. Example 31 - Glow of OgLuc Variants Expressed in Mammalian Cells A. IV and 9B8
[00378] Variants IV and 9B8 in the pF4Ag vector (ie, without HT7) were evaluated for brightness in HEK293 cells. hRL was used with a control. Briefly, HEK293 cells, plated in 15,000 cells / wells transiently transfected using TRANSIT®-LT1 with plasmid DNAs encoding the various variants and / or control sequences. The cells were cultured, lysed and treated as described in Example 25. Cells were co-transfected with pGL4.13 (Promega Corp.) as a transfection control (10 ng / transfection or 10% of the total DNA was used). Luminescence was measured as previously described using native celenterazine as a substrate for hRL or PBI-3939 as a substrate for OgLuc variants. The data for the OgLuc variant were corrected for transfection efficiency using the Luc2 luminescence (i.e., the luminescence measurement after the addition of the luciferin substrate). The OgLuc IV and 9B8 variants had greater luminescence compared to hRL (“Renilla”) (FIG. 47).
[00379] For comparison of brightness on a per mole basis in mammalian cells, the HT7 C-terminal fusion protein of variant 9B8 ("pF4Ag-OgLuc-9B8-HT7") described in Example 30 has been described and compared to the HT7-hRL C-terminal fusion protein (“pF4Ag-Renilla-HT7”) and the HT7-Luc2 C-terminal fusion protein (“pF4Ag-Luc2-HT7”). HEK293 cells (15,000) were plated and cultured overnight at 37 ° C. These cells were transfected with 100 ng of DNA from pF4Ag-Renilla-HT7, pF4Ag-Luc2-HT7, or pF4Ag-OgLuc-9B8-HT7 and cultured overnight at 37 ° C. The medium was removed and the cells were lysed as described previously. 10 μL of each sample were tested for luminescence (RLU) with 50 μL BRIGHT-GLO ™ for Luc2, 50 μL of 20 μM native cellenterazine for hRL, and 50 μL of 20 μM PBI-3939 for variant 9B8.
[00380] The 6-well lysates were grouped and labeled with TMR HALOTAG® ligand, as described in Example 30. The labeled fusion proteins were resolved by SDS-PAGE and plotted for fluorescence (GE Healthcare Typhoon). The densities of the strips were determined to quantify the relative number of moles present for each luciferase enzyme and the RLU value for each sample was normalized through the density of the stripe calculated to normalize the expression levels of each protein, that is, RLUs normalized using the quantification of TMR label (FIG. 48). On a mole-by-mole basis, variant 9B8 was approximately 15 times brighter than Luc2 and> 100 times brighter than hRL. These data represented differences in the specific activity. B. 9B8 opt and 9B8 opt + K33N
[00381] The brightness of variants 9B8 opt and 9B8 opt + K33N expressed in HEK293 cells was measured and compared as described for variants without HT7 in Example 31. 30 and 100 ng of plasmid DNA containing the DNA variant were used for transfect HEK293 cells. The cells were cultured and induced as described in Example 31, except cells that were lysed with a lysis buffer containing 1 mM CTDA, 150 mM KCl, 2 mM DTT, 100 mM MES pH 6.0, 35 mM thiourea, 0, 25% TERGITOL® NP-9 (v / v), and 10 mg / mL 2-hydroxypropyl-β-cyclodextrin. Lysates were assayed with lysis buffer containing 20 μM PBI-3939 and luminescence was measured using a Tecan® GENios ™ Pro Luminometer. As shown in FIG. 49, 9B8 opt + K33N had greater luminescence compared to 9B8 opt in HEK293 cells, which accompanies the bacterial expression data in Table 25 and FIG. 29. C. VARIANTES 9B8 + K33N
[00382] The brightness of the variants expressed in the hek293 and NIH3T3 cells was measured as previously described. The luminescence of the variants was normalized as to the luminescence generated by 9b8 opt (table 27). Table 27: Increase in Luminescence generated by combining OgLuc variants in NIH3T3 and HEK293
D. L27V
[00383] A comparison of the luminescence of the L27V variant for firefly luciferase alone and how a fusion was performed. HEK293 and HeLa cells were plated at 15,000 and 10,000 cells / wells, respectively, in 12-well plate wells and incubated overnight at 37 ° C, 5% CO2. The cells were then transfected with serial dilutions of pF4Ag containing L27V or Luc2. 20 ng of pGL4.13 (Promega Corp.) was co-transfected with L27V, and 20 ng of pGL4.73 (Promega Corp.) was co-transfected with Luc2 to act as a DNA carrier for lower dilutions of L27V or DNA plasmid of Luc2. Plasmid DNA was then transfected into the cells (6 replicates for each dilution for each cell type) using TRANSIT®-LTI transfection reagent in accordance with the manufacturer's instructions. The cells were then incubated for 24 h at 37 ° C, 5% CO2.
[00384] After transfection, the medium was removed from the cells and 100 μL of PBS with 0.5% TERGITOL® NP-9 (v / v) was added and stirred for 10 min at room temperature. 10 μL of each cell lysate was assayed using ONE-GLO ™ Luciferase Assay System (Promega Corpo .; Luc2) or assay reagent (Example 22H with 20μM PBI-3939; OgLuc). Luminescence was measured as previously described for HEK293 (FIG. 50A) and HeLa (FIG. 50B) cells.
[00385] The comparison of L27V and Luc2 as fusion partners was performed as described above. L27V and Luc2 were fused to the HALOTAG® protein in pF4Ag. FIGS. 50C-D show luminescence measured with different fusions in HEK293 cells (FIG. 50C) HeLa (FIG. 50D).
[00386] In addition to luminescence measurement, protein expression was also analyzed. The transfection was performed, as described above. After transfection, the medium was removed from the cells, and the cells were washed in 1X PBS. 100 μL 0.1X of Mammalian Lysis Buffer (Promega Corp.) containing 1 μM HALOTAG®TMR of ligand (Promega Corp.) and 20 U DNase I were added, and the cells were incubated with slow shaking for 45 min at temperature environment. The cell samples were frozen at -20 ° C. For Protein analysis, 32.5 μL 4X SDS of dye was added for each sample, and the samples were heated at 95 ° C for 2 min. 10 μL of the sample was then loaded onto an SDS-PAGE gel and plotted on a Typhoon Scanner as previously described (FIG. 50E). Example 32 - Brightness of the Purified OgLuc Variant Compared to Firefly Luciferase
[00387] Variant 9B8 OgLuc was overexpressed and purified as described in Example 33. Reactions between the diluted enzyme and the substrate were performed using the following 2X buffer / assay reagent: 100 mM MES pH 6.0, 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v / v), 0.025% MAZU® DF 204, 10 mg / mL 2-hydr0xi-β-cyclodextrin, and 20 μM PBI -3939. The final assay concentrations of the purified enzyme and the substrate were 0.5 pM and 10 μM, respectively. In parallel, reactions between purified and diluted firefly luciferase (i.e. QUANTILUM® Recombinant Luciferase (Promega Corp.)) and luciferin were analyzed. The assay buffer / reagent for the firefly luciferase reaction was BRIGHT-GLO ™, and the concentrations in the final assay were 0.5 µM enzyme and 500 µM luciferin. Since the buffers / reagents for each reaction were observant to provide “brightness” kinetics, the 15 min time period was used to collect the luminescence data. The results of this experiment showed that 9B8 opt using PBI-3939 (19,200 RLU) was approximately 8 times brighter than QUANTILUM® Luciferase Recombinant with BRIGHT-GLO ™ (2,300 RLU). Example 33 - Inhibition Analysis
[00388] To determine susceptibility of OgLuc variants to off-target interactions, the activity of variants 9B8 and L27V were assayed in a LOPAC library (library of pharmacologically active compounds) library. A LOPAC 1280 library (Sigma) was prepared by diluting the compounds to 1 mM in DMSO. In one day of the test, the compounds were diluted in 20 μM in 1X PBS, and 10 μL transferred to a 96 well white plate. For each well, 10 μL of 9B8, L27V or firefly luciferase enzyme (Luc2) diluted to 10-4 in a Lise Glo Buffer (Promega Corp.) was added and incubated at room temperature for 2 min. To the samples, 20 μL of assay reagent (1 mM CDTA, 150 mM KCl, 2 mM DTT, 100 mM MES pH 6.0, 35 mM Thiourea, 0.5% TERGITOL® NP-9 (v / v) and 60 μM PBI-3939) were added, incubated for 3 min, and luminescence measured in a TECAN® GENIOS ™ Pro Luminometer. For the firefly luciferase assay, the BRIGHT-GLO ™ Assay reagent (Promega Corp.) was used according to the manufacturer's protocol. As a negative control, 8 wells on each plate contained 1X PBS + 2% glycerol. As a positive control, 8 wells on each plate contained 2 mM Suramin in 2% DMSO or 2 mM luciferase inhibitor 1 in 2% DMSO (Calbiochem). Suramin was identified in the preliminary screening of the LOPAC library (ie, the LOPAC library was analyzed using variant 9B8 with a substrate concentration less than 20 μM) to be the OgLuc inhibitor.
[00389] The results in FIG. 51 indicated a general low frequency of off-target interactions between compounds in the LOPAC and L27V library. This suggests a potential use for L27V as a screening tool for large libraries of various chemical substances and therapeutic candidates, including formats based on living cells (for example, e.g., high throughput screening).
[00390] To further examine the inhibition resistance, the purified 9B8 and L27V variants were analyzed for different concentrations of Suramina (Sigma S-2671) and Tyrphostin AG 835 ("Tyr ag 835") (Sigma T-5568) (FIGS 52A-C). FIGS. 52E-D show the chemical structures for Suramina and Tyr ag 835, respectively. Purified 9B8 and L27V were prepared as described above. Serial dilutions (0, 2 μM, 6 μM, 20 μM, 60 μM, 200 μM and 2 mM) of the inhibitors were prepared in 1X PBS with 2% DMSO. For the 96-well white assay plate, 10 μL of diluted enzyme and 10 μL of diluted inhibitor were added and incubated at room temperature for 2 min. 20 μL of assay reagent (described above) was added, and the luminescence measured in a GLOMAX®-96 luminometer (FIGS. 52A-C). FIGS. 52A-B show the dose response curves of 9B8 and L27V for Suramina (FIGS. 52A) and Tyr ag 835 (FIGS. 52B). FIG. 52C shows the half maximum inhibitory concentration (IC50) of Suramina and Tyr ag 835 for 9B8 and L27V. The data indicate that L27V is a robust reporter that could be used as a screening tool for large libraries of various chemical substances and / or therapeutic candidates. Example 34 - Resistance to Non-Specific Protein Interactions
[00391] 1. Purified 9B8 and L27V enzymes were serially diluted 1:10 in buffer (1X PBS, 1 mM DTT, and 0.005% IGEPAL® CA-630) with or without 0.5 mg / mL BSA (4 dilution sets) at 200 μL in PCR eppendorfs. The samples were incubated at 60 ° C, where at 0, 2, 4, and 6 h a set of dilutions for each variant was transferred to -70 ° C.
[00392] To analyze the activity, the samples were thawed at room temperature in a water bath. 50 μL of assay reagent (as previously described with h 100 μM PBI-3939) was added, and the luminescence measured for each minute for 30 min in a TECAN® INFINITE® F500 plate reader. Activity was calculated using the average luminescence of 1x106 and 1x107 dilutions (FIG. 53).
[00393] 2. To demonstrate the reactivity of the OgLuc variants to plastic, the purified 9B8 and L27V variants were exposed to the polystyrene plates and their activities were mediated.
[00394] 50 μL of purified variant 9B8 (45.3 pM) and L27V (85.9 pM) in DMEM without phenol red with 0.1% PRIONEX® were placed in wells of a 96-well polystyrene microtiter plate at 60, 40, 20 and 0 min. To the samples, 50 μL of assay reagent (described above) containing 20 μM PBI-3939 was added and incubated for 5 min at room temperature. Luminescence was measured as previously described, and percentage activity determined (FIG. 54; luminescence ratio at time 0). Example 35 - Post-Translational Modification
[00395] To determine whether OgLuc variants have undergone any post-translational modifications, when expressed in mammalian cells, variants 9B8 and L27V were expressed in both mammalian cells and E. coli and analyzed using mass spectrometry (MS ).
[00396] Variants 9B8 and L27V were expressed as fusions of HALOTAG® C-terminal (pFN18K for E. coli cells; pFN21K and HEK293) in HEK293 and E. coli KRX cells (Promega Corp.) and purified using the Purification System of HALOTAG® Protein (Promega Corp.) according to the manufacturer's instructions. Approximately 5 pmols of the purifying enzyme were analyzed using LC / MS using a C4 column (Waters Xbridge BEH300, 3.5μm) interconnected with an LTQ Orbitrap Velos mass spectrometer (Thermo Scientific). Data was acquired from 600-2000 m / z using LTQ for detection and processed using MagTran software v1.03 (Zhang et al., J. Am. Soc. Mass Spectrom., 9: 225-233 (1998)) . Both purified enzymes had an experimentally determined mass of 19.666 Da, compared to a calculated mass of an unmodified OgLuc variant, that is, absent of any translational modifications of 19.665 Da. Example 36 - Evaluation of OgLuc Variants as Transcriptional Reporters A. IV
[00397] The use of OgLuc variants as transcriptional reporters has been examined. To generate a reporter, cAMP, hRL and IV were subcloned using methods known in the art into a modified vector pGL4 (Promega Corp, 1) containing a barnase sequence, which was replaced by fragments of DNA interest. The modified pGL4 leader sequence contained a minimal promoter and a cAMP response element (CRE; SEQ ID NO: 96), so that after stimulation with a cAMP agonist, such as forskolin (FSK), cells that accumulate cAMP activated the reporter and generated the luminescence. In this experiment, 2 ng of DNA from the hRL or IV transcriptional reporter construct was used to transfect HEK293 cells, as described previously in Example 25. Within 24 hours after transfection, the cells were treated with 100 μM FSK. Cells that were not treated with FSK were used as a control. After 6 hours, a reporter reagent was added to the treated and control cells. For hRL, the reporter reagent was the Renilla-Glo ™ reagent (Promega Corp.). For IV, the reporter reagent contained 1 mM CDTA pH 5.5, 150 mM KCl, 10 mM DTT, 0.5% TERGITOL® NP-9 (v / v), 20 μM celenterazine-h, and 150 mM thiourea . After 10 min, the luminescence was read on a Varioskan® Flash (Thermo Scientific).
[00398] FIG. 55 shows the normalized luminescence of HEK293 cells containing the hRL (“Renilla”) or IV (“+ FSK”) or untreated (“-FSK”) transcriptional reporter (FSK). The answer, that is, the duplication induction or duplication increase (“DUPLICATION”) in the luminescence was determined by dividing the luminescence from the treated cells (+ FSK) with the luminescence from the control cells (-FSK) . As shown in FIG. 55, the response for hRL was <50, while for IV it was> 300, demonstrating the use of IV with a transcriptional reporter. B. 9B8 and 9B8 opt
[00399] The use of variants 9B8 and 9B8 opt as a transcriptional reporter has also been examined and compared to transcriptional reporters hRL and Luc2 as previously described for transcriptional reporter IV with the following modifications. Transcriptional cAMP reporters containing 9B8 or 9B8 opt variants were generated as described above. After 6 h of FSK induction, the medium was removed from the cells and replaced with 100 μL of the lysis buffer described in Example 25 creating a lysate. The lysate of transfected cells treated with or without FSK was evaluated for luminescence, as described in Example 25. 10 μL of the Luc2 lysate was assayed with 50 μL of BRIGHT-GLO ™ Luciferase Assay Reagent. 10 μL of the hRL lysate was assayed with 50 μL of the lysis buffer containing 20 μM of native celenterazine. 10 μL of variants 9B8 and 9B8 opt of lysates were assayed with 50 μL of the lysis buffer containing 20 μM PBI-3939.
[00400] FIG. 56 shows the normalized luminescence of HEK293 cells containing the transcriptional reporter 9B8, 9B8 opt, hRL, or Luc2 treated ("induced") or untreated ("basal") with FSK. The response, that is, duplication induction, or increase of times ("duplication") in luminescence, was determined by dividing the luminescence induced by basal luminescence (FIG. 56). Although the duplication induction values are similar for each reporter, except Luc2, the luminescence generated by the transcriptional reporter 9B8 opt induced was approximately 2.5 logs higher than the induced transcriptional reporter Renilla and approximately 1.5 logs higher than the transcriptional reporter Luc2. FIG. 56 demonstrated the use of 9B8 and 9B8 opt as transcriptional reporters. C. 9B8 opt and 9B8 opt + K33N
[00401] The 9B8 opt and 9B8 opt + K33N variants were compared in a lytic transcriptional reporter trial. The 9B8 opt + K33N variant was cloned using methods known in the art into a pGL4.29 vector (Promega Corp.), which contains a cyclic AMP response element (CRE). The transcriptional reporter 9B8 opt + K33N was tested and compared to the transcriptional reporter 9B8 opt as described above in HEK293 cells. 30 and 100 ng of plasmid DNA containing the transcriptional reporter versions of the variants used to transfect HEK293 cells. The cells were induced with FSK for 5 h before measurement for luminescence. The Cells were lysed with a lysis buffer containing 1 mM CTDA, 150 mM KCl, 2 mM DTT, 100 mM MES pH 6.0, 35 mM thiourea, 0.25% TERGITOL® NP-9 (v / v), and 10 mg / ml 2-hydroxypropyl-β-cyclodextrin. Luminescence was measured on a TECAN® GENIOS ™ Pro Luminometer. The lysate was assayed with the lysis buffer containing 20 μM PBI-3939. FIG. 57 shows the normalized luminescence (corrected transfection) of HEK293 cells that express the transcriptional reporter construct 9B8 opt or 9B8 opt + K33N treated ("Induced") or untreated ("Basal") with FSK. As shown in FIG. 57, duplication induction for 9B8 opt was 360 when 30 ng of DNA was used for transfection and 109 when 100 ng was used for transfection, while duplication induction for 9B8 opt + K33N was 275 and 147, respectively . When lighter amounts of DNA were used for transfection, K33N provided a greater response. D. L27V
[00402] 1. L27V was cloned into a reporter vector as described in C of this Example containing a response element CRE, NFkB or HSE (Thermal shock element). Reporter constructs were then transfected into HEK293 cells or HeLa cells, as previously described. The cells were then induced using FSK for CRE, TNFa for NFkB or 17-AAG for HSE. Luminescence was measured as previously described using a 20 μM assay reagent PBI-3939 (FIGS. 58A-C). The reporter constructs were all validated in HEK293, HeLa, NIH3T3, U2OS and Jurkat cell lines (data not shown).
[00403] 2. L27V02 and L27V02P (containing a PEST sequence; SEQ ID NO: 323) were cloned into a reporter vector (with pGL4,32) as described in C of this Example. Other OgLuc variants containing a PEST sequence include L27V01-PEST00 and L27V03-PEST02 (SEQ ID NOs: 320 and 326, respectively). The reporter construct was then transfected into HEK293 cells, as previously described. The cells were then induced using FSK, and luminescence was measured as previously described using a 20 μM assay reagent PBI-3939 (FIGS. 59A-B). Several other reporter constructs have also been created and tested on various cell lines (FIGS. 59C). FIG. 59A shows the full dose response for the CRE system in HEK293 cells. FIG. 59B summarizes FIG. 59B. FIG. 59C summarizes the data in FIGS. 59A-B and shows the same data type for the NFkB response element. Both the CRE and NFkB reporter constructs were examined on HEK293, HeLa, HepG2, Jurkat, ME180, HCT116, and U2OS cell lines.
[00404] 3. HEK293 cells (0.9x106 cells in a T25 flask) were transfected with the secretion construct pNFkB-L27V (SEQ ID NOS: 463 &464; where the IL-6 secretion sequence (SEQ ID NOs: 461 and 462) replaced the native OgLuc secretion sequence SEQ ID NO: 54), Metridia longa (Clontech), pNFkB-L27V (native secretion sequence; SEQ ID NOs: 465 and 466) or firefly luciferase plasmid DNA ( Luc2); (based on pGL4,32) using FUGENE® HD (Promega Corp.) according to the manufacturer's instructions. The cells were incubated at 37 ° C, 5% CO2 for 8 h, and then trypsinized in 0.5 ml of TrypLE (Invitrogen). The lysates were then resuspended in 8 ml DMEM with 10% FBS, 1X NEAA and 1X sodium pyruvate. 100 μL of the resuspended sample was then added to 96-well plate wells and incubated for 16 h at 37 ° C, 5% CO2.
[00405] After incubation, the medium was removed from the cells and replaced with 100 μL of new medium with no TNFα (serially diluted). To assess secretion, at 3 and 6 h, 5 μL of medium (in triplicate) was removed from the cells, taken to 50 μL with PBS and mixed with 50 μL of assay reagent (as previously described with 100 μM PBI-3939) . Luminescence was measured at 0 and 10 min, as previously described (FIG. 60).
[00406] For the measurement of Metridia long luciferase activity, the Ready-To-Glow ™ Secreted Luciferase System (Clontech) was used according to the manufacturer's protocol. Soon, 5 μL of Ready-to-Glow ™ reagent was added to 5 μL of the sample and 45 μL of PBS. Luminescence was measured immediately after adding reagent (FIG. 60). E. L27V optimized variants.
[00407] Plasmid DNAs (pGL4,32-L27V00, pGL4,32-L27V01, pGL4,32-L27V02, pGL4,32-L27V03, and pGL4,13) were prepared for transfection using FUGENE® HD according to the protocol manufacturer. The vector pGL4,32 (Promega Corp.) contains the response element NF-KB. The optimized L27V codon sequences replaced the Luc2P sequence in the vector. The pGL4,13 vector (Promega Corp.) contains the Luc2 gene triggered by the SV40 promoter.
[00408] 300 μL of the DNA transfection mixture was then mixed with 6 mL of HeLa cell suspension (2x105 cells / mL), homogenized, and 100 μL plated in wells of a 96-well plate. The cells were then incubated overnight at 37 ° C, 5% CO2. After incubation, 10 μL of 10X rhTNFa in DPBS with BSA was added to the wells and incubated for 4.5 h at 37 ° C, 5% CO2. Six wells were given vehicle only. The cells were then left to be equilibrated at room temperature for 20 min, and then 100 μL of assay reagent (as previously described with 100 μM PBI-3939) was added. To cells expressing Luc2 or receiving only one vehicle treatment, 100 μL of the ONE-GLO ™ Luciferase Assay Reagent was added. Luminescence was measured for 12 min after adding the test reagent, as previously described. FIGS. 61A-B show the absolute luminescence, FIGS. 61C-D show the luminescence and FIGS. 61E-F show the duplicate response. Example 37 - Variants of OgLuc in a Transcription Reporter Essay
[00409] To demonstrate the ability of the OgLuc variants of the present invention to be used as transcription reporters, the OgLuc 9B8 opt variant was used as a transcriptional reporter in direct, reverse and bulk transfection. These transfection methods were chosen since they are representative of the approaches commonly used for transient expression of transcriptional genetic reporters. Direct Transfection
[00410] Transcriptional reporters containing the response element cAMP (CRE) and 9B8 opt or 9B8 opt further comprising the PEST protein degradation sequence (9B8 opt-P) were prepared in the main structure of pGL4.29 (Promega Corp.), that is, the luc2P gene of the pGL4.29 vector was replaced with 9B9 opt (SEQ ID NO: 24) or 9B8 opt-P (SEQ ID NO: 65). pGL4.29 was used as a control / reference.
[00411] HEK293 cells were plated on 15,000 cells / well in 96-well culture plates. Cells were cultured in 100 μL of non-essential amino acids DMEM + 10% FBS + 1X (NEAA) and incubated overnight at 37oC. The cells were transiently transfected with 10 ng or 100 ng plasmid / well DNA from pGL4.29 9B8 opt, pGL4.29 9B8 opt-P, or pGL4.29. Plasmid DNA was mixed with 850 μL of OPTI-MEM® (Invitrogen) and 32.4 μL of FUGENE® HD transfection reagent (Promega Corp.) and incubated at room temperature for 10 min. Eight μL of the transfection / reporter DNA mixture was added to the appropriate wells (2 constructs / plate). The cells were incubated for 4 h at 37oC. The medium was replaced with OPTI-MEM® + 0.5% dialysate FBS + 1X NEAA + 1X sodium pyruvate + 1X Penn-Strep and incubated overnight at 37oC.
[00412] After incubation, 10 nM or 10 μM FSK (from an original 10X solution) in OPTI-MEM® were added to the cells and incubated for 3 hours at 37oC. A lytic reagent containing 100 mM MES pH 6.1, 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v / v), 0.025% MAZU® DF 204 , and 20 μM PBI-3939 were added to cells containing pGL4.29 9B8 opt or pGL4.29 9B8 opt-P and left to be incubated for 10 min at room temperature (100 μL of lithic reagent added to the 100 μL cells). ONE-GLO ™ assay reagent (Promega Corp.) was added to cells containing pGL4.29 and used according to the manufacturer's protocol (100 μL of reagent added to 100 μL cells). Luminescence was measured on a GLOMAX® Luminometer. Table 26 shows the luminescence of HEK293 cells that express transcriptional reporters containing CRE treated with 10 nM ("parameter") or 10 mM FSK, and the response to FSK (that is, the luminescence generated by the cells treated with 10 mM of FSK divided by the luminescence generated from the cells treated with 10 nM FSK.)
[00413] The results shown in Table 28 indicate that 9B8 opt and 9B8 opt-P were brighter than luc2P, and that all luciferase reporters responded to FSK when 100 ng of DNA was used for transfection. However, when only 10 ng of DNA was used for the transfection, the luminescence for the luc2P reporter was below the detection level for the luminometer. Table 28: Transcriptional Reporters Containing CRE in HEK293 Cells (3 hr time period)
Reverse Transfection
[00414] Transcriptional reporters containing the antioxidant response element (ARE) and 9B8 opt or 9B8 opt-P were prepared in the main structure of pGL4.29 (Promega Corp.), that is, the luc2P gene of the pGL4.29 vector was replaced with 9B9 opt or 9B8 opt-P, and CRE was replaced with 2X ARE (SEQ ID NO: 66) using methods known in the art.
[00415] HEK293 cells were trypsinized (T75 flask, 3 ml of trypsin) and resuspended in 1x105 cells / ml (approximately 8.9x106 of the total cells) in the medium containing DMEM + 10% FBS + 1X NEAA. Each transcriptional reporter was prepared for transfection by mixing 1.2 ml of OPTI-MEM®, 12 μL of transcription reporter DNA (100 ng) and 36 μL of FUGENE® HD transfection reagent together and incubated at room temperature for 35 min . After incubation, 624μL of the transfection / reporter DNA mixture was added to 12 ml of the cell suspension and mixed by inversion. After mixing, 100 μL of the DNA / cell mixture was added to the wells of a 96-well plate (2 constructs / plate). The cells were incubated at 37oC for 22 h. Terc-butylhydroquinone (a Nrf2 stabilizer; tBHQ; 1 μM (“baseline”) or 20 μM) or sulforaphane (an organosulfurized anitoxidant known to activate Nrf2; 1 μM (“baseline”) or 20 μM) in OPTI-MEM® they were added to each well and incubated at 37oC for 24 h. The cells were lysed with 100 μL of lytic reagent, as described above for direct transfection. Luminescence was measured using a GLOMAX® Luminometer.
[00416] Table 29 shows the luminescence of HEK293 cells that express the transcriptional reporters containing ARE treated with 1 μM ("parameter") or 20 μM sulforaphane and the response to sulforaphane (that is, the luminescence generated by 1 μM cells of sulforaphane divided by the luminescence generated by the treated cells of 20 μM sulforaphane). Table 30 shows the luminescence of HEK293 cells that express the transcriptional reporters containing ARE treated with 1 μM (“parameter”) or 20 μM tBHQ, and the response to tBHQ (that is, the luminescence generated by the treated cells of 1 μM tBHQ divided by the luminescence generated from the treated cells of 20 μM tBHQ). Tables 29 and 30 show that 9B8 opt and 9B8 opt-P could report the presence of two different stimuli known to ARE. Table 29: Transcriptional Reporters Containing ARE in HEK293 Cells (24h time period)
Table 30: Transcriptional Reporters Containing ARE in HEK293 cells (24 hr time period)
Bulk Transfection
[00417] The transcriptional reporters containing CRE and 9B8 opt or 9B8 opt-P described in direct transfection were used in bulk transfection of HEK293 and NIH3T3 cells. Transcriptional reporters containing the thermal shock response element (HRE; SEQ ID NO: 67) and 9B8 opt or 9B8 opt-P were prepared in structure pGL4.29 (Promega Corp.), that is, the luc2P gene of the pGL4 vector .29 was replaced with 9B9 opt or 9B8 opt-P, and CRE was replaced with HRE. The transcriptional reporter containing HRE and 9B8 opt-P were used for bulk transfection of HeLa cells.
[00418] HEK293, NIH3T3, or HeLa cells were plated on a single 6-well tissue culture plate the day before transfection at a density of 4.5x105 cells / well in 3 ml of complete medium (DMEM + 10% FBS + 1X NEAA + 1X sodium pyruvate) for HEK293 cells, 3x105 cells / well in 3 mL of complete medium (DMEM + 10% fetal calf serum (FCS) + 1X NEAA + 1X sodium pyruvate) for NIH3T3 cells, or 9, 9x105 cells / well in 3 mL of complete medium (DMEM + 10% FBS + 1X NEAA) for HeLa cells. The cells were cultured overnight at 37oC.
[00419] 3,300 ng reporter plasmid DNA in 155 μL of OPTI-MEM® were mixed with 9.9 μL of FUGENE® HD transfection reagent, centrifuged briefly, and incubated at room temperature for 10 min. CRE transcriptional reporters were used to transfect HEK293 and NIH3T3s cells. HRE transcriptional reporters were also used to transfect HeLa cells. The reporter mixture was added to the cells and mixed followed by incubation at 37oC for 6 h (HEK293 and NIH3T3) or 3 h (HeLa). The cells were then trypsinized again suspended in medium (DMEM + 10% FBS + 1X NEAA + 1X sodium pyruvate for HEK293 cells, DMEM + 10% FCS + 1X NEAA + 1X sodium pyruvate for NIH3T3 cells, or DMEM + 10% FBS + 1X NEAA for HeLa cells), followed by plating to individual wells of a 96-well plate (20,000 cells / 100 μL for HEK293 cells, 10,000 cells / 100 μL for NIH3T3, or 13,000 cells / μL for HeLa) and then incubation at 37oC overnight.
[00420] FSK (CRE simulator) or 17-AAG (HRE simulator; 17- Allylamino-demetoxigeldanamycin) in OPTI-MEM® was added to the cells (10 nM or 10 μM of final concentration for FSK; 1 nM or 1 μM of concentration final for 17-AAG) and charged at 37oC for 4 h (FSK) or 6 h (17-AAG). The Plates were then removed from the incubator and left to equilibrate at room temperature for 25 minutes. The cells were lysed with 100 μL of reagent, as described above for direct transfection. Luminescence was measured using a GLOMAX® Luminometer.
[00421] Table 31 shows the luminescence of HEK293 cells that express transcriptional reporters containing CRE treated with 10 nM ("baseline") or 10 mM FSK and the response to FSK. Table 32 shows the luminescence of NIH3T3 cells that express the transcriptional reporters containing CRE treated with 10 nM ("baseline") or 10 mM FSK and the response to FSK. Table 33 shows the luminescence of HeLa cells that express the transcriptional reporters containing 10 nM HRE ("baseline") or 10 mM 17-AAG and the response to 17-AAG.
[00422] Tables 29-31 show that 1) both versions of the 9B8opt OgLuc variant can report the presence and stimulatory effects of FSK in CRE in the context of two different cell lines, HEK293 and NIH3T3, and 2) 9B8 optP can report the presence and stimulatory effects of 17-AAG in HRE in the context of HeLa cells. Table 31: Transcriptional Reporters Containing CRE in HEK293 cells (4 hr time period)
Table 32: Transcriptional Reporters Containing CRE in NIH3T3 cells (4 hr time period)
Table 33: Transcriptional Reporters Containing HRE in HeLa cells (6 hr time period)
Example 38 - Reporter liable to Lytic Secretion in Difficulty Expressing Cells
[00423] HepG2 cells, 1x105 cells / mL in a cell suspension, were reverse transfected with plasmid DNA (GL4.32 backbone; Promega Corp.) containing L27V02, luc2P (Promega Corp.), luc2 (Promega Corp .) or L27V02-IL6 (L27V02 with native secretion sequence replaced with IL-6 secretion sequence; (“IL601-L27V02A”; SEQ ID NO: 324) using FUGENE® HD according to the manufacturer's instructions (1 : 20 of DNA transfection mix for cells) 100 μL of cell suspension was then plated in wells of a 96-well plate and incubated for 22 h at 37 ° C, 5% CO2. the native secretion sequence replaced by the IL-6 secretion sequence include IL601-L27V01 and IL602-L27V03 (SEQ ID NOs: 321 and 327, respectively).
[00424] For secretion analysis, the medium was removed from the cells, and the cells were washed in 100 μL of DPBS. 100 μL of complete medium (DMEM + 10% FBS + 1X NEAA) was added with varying doses (1 pg / mL - 100 ng / mL) of rhTNFa ("TNFa") over 4.5 h. 10 μL of the medium was then removed, added to 90 μL of complete medium, and 100 μL of assay reagent (as previously described; 100 μM PBI-3939) added. Luminescence was measured, as previously described (FIG. 62A).
[00425] For lytic analysis, after plating, cells were incubated for 4.5 h at 37 ° C, 5% CO2. The cells were then left to equilibrate at room temperature for 20 min. The test reagent (as previously described; 100 μM PBI-3939) was added to the cells, and the luminescence measured as previously described (FIG. 62B). Example 39 - Additional Aspects of the Lytic Reporter
[00426] The OgLuc variants of the present invention in the context of a cell-based lytic transcriptional reporter should offer a luminescent signal of a magnitude such that a signal appears before it can with the other luciferases. The bright luminescence should also allow weak promoters to be examined. Example 40 - Mammalian Cell Transfections
[00427] The OgLuc variants of the present invention were used as reporters in difficult cell lines, for example, Jurkat, HepG2, primary cells, non-dividing cells or stem cells (See, for example, FIG. 59C). Due to the high intensity of their signals, the variants and OgLuc allowed detectable luminescence when the transfection efficiency is low. OgLuc variants can also be used as reporters in cells that are especially sensitive to conditions associated with transfection, that is, concentration of DNA, addition of transfection reagent. Due to the brightness of the OgLuc variants, an adequate level of luminescence can be achieved by using lower DNA concentrations, less transfection reagent, and perhaps shorter post-transfection times before the start of an assay. This will place less burden of toxicity on what would otherwise be sensitive cells. The bright luminescence of the OgLuc variants should allow the signal to be detected over very long periods of time if such an output is desirable. Another example, OgLuc variants should be used as reporters for single copies of native promoters, for example, HSB thymidylate kinase (TK) promoter, HOX genes, or LIN28. Example 41 - Stable cell lines
[00428] The identification of robust, stable cell lines that express the OgLuc variant of the present invention, either in the cytoplasm or as a secreted form, can be facilitated through the bright luciferase signal and the small size of the OgLuc gene. The relatively small gene is expected to reduce the likelihood of genetic instability from foreign DNA integration.
[00429] To generate stable cell lines using an OgLuc variant of the present invention, plasmid DNA comprising a nucleotide sequence for the OgLuc variant and a selectable marker gene, for example, neomycin, hygromycin, or puromycin, are used to transfect a cell line of interest, for example HEK293 cells. Cells with an early pass number, for example, less than 10 passages, are plated in T25 (1x106) or T75 (3x106) tissue culture flasks and allowed to grow and overnight at approximately 75% confluence. The cells are then transfected using the plasmid DNA above and an appropriate transfection reagent, for example, TRANSIT®-LT1 or FUGENE® HD. Forty-eight hours after transfection, the medium is replaced with the selection medium containing the selection drug, for example, G418, hygromycin or puromycin, in a concentration previously determined to kill untransfected cells. The selection of the cells containing the plasmid DNA occurs over 2 to 4 weeks. During this period, the cells are replanted in a selection medium in various concentrations in T25 or T75 culture flasks. The medium in the replated cells is replaced every 3 to 4 days 2 to 3 weeks with fresh selection medium. The vials are monitored for the formation of living cell colonies. Eventually, the vials will contain many large colonies and some dead cells.
[00430] From the pool of stable colonies in the flasks, single colonies are isolated and expanded on a 24-well tissue culture plate. Briefly, the cells are harvested using the trypsin / EDTA method, that is, the cells are harvested by removing the medium, rinsing with Ca2 + and Mg2 + free PBS and separated by trypsin / EDTA treatment. The cells are counted using a hemocytometer and diluted 1x105 in the complete medium. The cells are then diluted to 100 cells / ml, 33 cells / ml, 10 cells / ml, and 3.3 cells / ml in complete medium. 100 μL of each dilution is plated in all wells of the 96-well tissue culture plate (1 plate for each dilution) and allowed to be cultured 4 to 5 days after which 50 μL of the selection medium is added to the cells. Approximately one week after plating, the cells are visually screened for colony growth and another 50 μL of the selection medium is added. The cells should be monitored until a single colony covers 40-60% of the well area. When a colony is ready for expansion and screening, colonies are harvested using the trypsin / EDTA method. Each colony is transfected into the colony medium, as indicated below: 1) Dilute 1:10 in 6 wells of a 96-well assay plate for the functional assay, for example, luminescence detection; 2) Dilute 1:10 in 3 wells of a 96 well transparent bottom assay plate for the viability assay, for example, CELLTITER-GLO® Luminescent Cell Viability Assay (Promega Corp.); and 3) Dilute 1:10 in a 24-well tissue culture plate. The cells on the plates for the functional and viability assays are then cultured 2 to 3 days and the functional and viability assays are performed. Positive clones in the 24-well plate are further tested with functional and cell viability assays, as well as for expression and response stability for at least 20 passages, normal growth rate morphology and frozen for future use in the first possible passage. Example 42 - Analysis of the OgLuc Secretion Sign A. IV opt
[00431] Wild-type OgLuc is processed after synthesis into a mature protein with the secreted signal sequence. To determine whether the secretion signal sequence would facilitate secretion of the OgLuc variant, variant IV opt of Example 25 and hRL was cloned into pF4Ag containing an N-terminal OgLuc secretion signal (SEQ ID NO: 54). HEK293 cells (15,000) in 100 μL of Dulbecco's Modified Eagle's medium (“DMEM”) with 10% fetal bovine serum (FBS) were transfected, as described in Example 25 with 100 ng of plasmid DNA, that is, hRL or IV opt with or without the secretion signal and grown overnight at 37 ° C. 50 μL of the medium was removed to a new plate and saved for later testing generating a sample of “medium”. The rest of the medium was removed, and the cells were lysed with 100 μL of the lysis buffer described in Example 25 to generate a "lysate" sample. 10 μL of the medium sample and 10 μL of the lysate sample were tested for luminescence (FIG. 63). For hRL samples with (“Renilla sig”) or without (“Renilla”), the OgLuc secretion signal sequence was measured using 50 μL of lysis buffer containing 20 μM of native celenterazine. Samples for IV opt with (“IV opt sig”) or without (“IV opt”), the OgLuc secretion signal sequence were measured using 50 μL of the lysis buffer containing 20 μM PBI-3939.
[00432] In FIG. 63, the filled bars represent the amount of light that was detected from the medium in the absence of any lytic reagent. The open bars represent the total light (secreted + non-secreted) that was detected after the addition of a lytic reagent. FIG. 63 shows that IV opt was secreted from HEK293 cells in cultured medium and that the secretion signal sequence was functional in mammalian cells. "IV opt sig" represents the only situation in which a significant amount of luciferase was detected in the medium. The results also indicate that a particular signal peptide did not facilitate hRL secretion. B. 9B8, V2 and L27V
[00433] To determine whether the OgLuc secretion signal sequence facilitates its secretion, the OgLuc 9B8, V2 and L27V variants were cloned into pF4Ag containing an N-terminal OgLuc secretion signal sequence. The variants were also cloned into vectors without the secretion signal sequence. The CHO or HeLa cells were then plated in 100,000 cells / well in 1 ml of F12 medium with 10% FBS and 1X sodium pyruvate (CHO cells) or DMEM with 10% FBS and 1X sodium pyruvate (HeLa cells) in 12-well plates and incubated overnight at 37 ° C, 5% CO2.
[00434] After overnight incubation, cells were transfected with 1 μg of plasmid DNA containing 9B8, V2, or L27V with or without the secretion signal sequence using the TRANSIT®-LT1 transfection reagent (Mirus Bio) and OPTI-MEM® medium (Invitrogen). The cells were again incubated overnight at 37 ° C, 5% CO2.
[00435] After the second overnight incubation, the medium was removed and saved for analysis. For cells, 1 mL of assay buffer (1 mM CDTA, 150 mM KCl, 2 mM DTT, 100 mM MES pH 6.0, 35 mM Thiourea and 0.5% TERGITOL® NP-9 (v / v) ) were added to create a cell lysate. In 10 μL of cell lysate or saved medium, 50 μL of assay buffer with 40 μM of PBI-3939 was added, and the luminescence measured, as described above. FIGS. 64A-D demonstrate that variants 9B8, V2 and L27V can be used in a secretable system.
[00436] To determine the stability of the secreted variants, 150 μL aliquots of the medium saved from each sample were placed at 37 ° C or 50 ° C. The aliquots were then removed at different times (0, 1, 2, 3, 5, 6, and 7 min), frozen on dry ice, and kept at -20 ° C until tested. To test for stability, the aliquots of the medium were thawed at room temperature, and 10 μL of each aliquot were mixed with assay buffer with PBI-3939 (pH 6.0), as described above. Luminescence was measured as above, and the half-life (t50) determined (Table 34). Table 34
C. Comparison 9B8 and V2 with Metridia long secreted luciferase
[00437] The secretion of the OgLuc 9B8 and V2 variants was compared to that of the luciferase secreted from Metridia longa. CHO cells were plated at 300,000 cells / well in 3 ml of F12 medium with 10% FBS in 6-well plate wells and incubated overnight at 37 ° C, 5% CO2. The cells were again transfected with 10 or 100 ng of each variant or DNA from plasmid of Metridia luciferase (Clontech) using TRANSIT®-LTI according to the manufacturer's instructions and incubated for 20 h at 37 ° C, 5% CO2. After transfection, the medium was removed from the cells and assayed. For OgLuc variants, 50 μL of the medium was assayed with 50 μL of the test reagent (previously described; 40 μM PBI-3939). For Metridia luciferase, the medium was assayed using the Ready-to-Glo ™ Secreted Luciferase Reporter System (Clontech) according to the manufacturer's protocol. Briefly, 5 μL of the 1X substrate / reaction buffer was added to 50 μL of the medium sample. The luminescence was then measured as previously described (FIGS. 65A-B). Example 43 - Evaluation of New OgLuc and Celenterazine Variants in Living Cells
[00438] A. The use of OgLuc and PBI-3939 variants in living cells has been examined. HEK293 cells were plated in 96-well plates at 15,000 cells / well and cultured overnight at 37 ° C. The next day, the cells were transiently transfected using TRANSIT®-LT1 in 3 replicates with 100 ng hRL or 9B8 opt in pF4Ag and grown overnight at 37 ° C. The next day the culture medium was removed and replaced with medium containing 60 μM of VIVIREN ™ Live Cell Substrate (Promega Corp.), 60 μM of Live Cell Substrate ENDUREN ™ (Promega Corp.), or 60 μM of PBI- 3939 for both hRL and 9B8 opt transfected cells. Untransfected cells were used as a baseline control. The plate was incubated at 37 ° C during the course of a day and periodically measured in a TECAN® GENIOS ™ Pro luminometer, that is, 11 times over the course of 24 h. FIGS. 66A-B show the luminescence of the transfected cells divided by the luminescence of the non-transfected cells for each of the substrates, i.e., the signal to base ratio. The data show that 9B8 opt generated luminescence in a live cell configuration (ie, without lysis) by incubation with VIVIREN ™, ENDUREN ™, or PBI-3939. The data also demonstrated that PBI-3939 can permeate cells in culture, react with the OgLuc variant, and generate luminescence, thus making it compatible with use in a live cell assay.
[00439] B. To demonstrate analysis of living cells using the OgLuc L27V variant, it was fused to HALOTAG® and expressed and monitored in living cells. U2OS cells were plated at 40,000 cells / ml in wells of the imaging chamber and incubated overnight at 37 ° C, 5% CO2. The cells were then transfected using FUGENE® HD according to the manufacturer's protocol with plasmids pFC14K, pFN21K or pF4Ag (all Promega Corp.) containing L27V or pF4Ag containing L27V with the IL-6 or native secretion sequence. The cells were then incubated for 24 h at 37 ° C, 5% CO2.
[00440] After incubation, the cells were exposed to the TMR HALOTAG® ligand (Promega Corp.), imaged, and corrected. Immunocytochemistry (ICC) was then performed according to the ICC protocol in HALOTAG® Technology: Focus on the technical imaging manual (Promega Corp .; TM260). The primary antibody used was a rabbit polyclonal, anti-OgLuc 9B8 antibody (1: 1000). The secondary antibody used was an Alexa 488 conjugated secondary antibody (green) (FIG. 67A). FIG. 67A shows the fluorescent channel and FIG. 67B shows the differential interference contrast (DIC). Images were acquired using an Olympus Fluoview FV500 confocal microscope (Olympus, USA) equipped with a 37 ° C + CO2 environmental chamber (Solent Scientific Ltd., UK).
[00441] FIGS. 67B-D show the ICC images with IL-6 or native secretion sequence. Both signal sequences dramatically decrease the amount of the enzyme in the nucleus. The punctual nature of the labeling in the cytoplasm is indicative of the formation of vesicles that must occur during the secretion process. The data demonstrate that the presence of the signal peptide reduces the amount of luciferase in the nucleus.
[00442] C. As shown above, OgLuc variants and new substrates of the present invention are biocompatible. A reporter system is envisaged where the OgLuc variant is cloned into an expression vector with a promoter of interest and expressed in cells as a reporter protein. The cells are then treated with PBI-3939, which will permeate cells in culture, react with the OgLuc variant and generate luminescence.
[00443] In addition to being cell permeable, PBI-3939 shows biocompatibility comparable to native celenterazine in terms of cell viability. A version of compound 3939 containing known chemical modifications to increase the stability of native celenterazine in the medium can be synthesized for reporter assays based on the live cell OgLuc variant. Another example of live cell reporting includes using the OgLuc variant with a reporter. The native secretion signal peptide (or other known signal peptides) can be fused to the N-terminal of the OgLuc variant so that when the fusion is expressed in mammalian cells, a part of it will be secreted through the cell membrane in the culture medium. After the addition of the substrate, luminescence is generated. Example 44 - Protein Fusion Reporters
[00444] The OgLuc variants of the present invention can be used as fusion tags for a protein of interest with a way of monitoring the intracellular levels of that target protein. Specific proteins involved in the stress response pathways, for example, DNA damage, oxidative stress, inflammation, can be monitored in cells as a way of probing the role that various types of stimuli play in these pathways. The variants can also be used as a means to monitor the cellular traffic of a target protein. Variants can also be fused to viral genomes (for example, HIV, HCV) so that titration levels, i.e., infectivity, can be monitored in cells after treatment with potential active agents. The variants can also be fused to the green fluorescent protein (GFP) or HALOTAG® (in addition to the addition to the target protein), so that FACS can be used to identify high-expression clones and to provide location information. Example 45 - Evaluation of the OgLuc Variant in 3-Component Protein (“Sandwich”)
[00445] 3-component fusion proteins, or "sandwich" fusions, can be used to place bioluminescent and fluorescent proteins next to each other for the optimization of a BRET-based biosensor. A. C1 + 4AE, IV, 9B8 and 9F6
[00446] OgLuc C1 + 4AE variants (SEQ ID NOs: 55 and 56), IV (SEQ ID NOs: 57 and 58), 9B8 (SEQ ID NOs: 61 and 62), and 9F6 (SEQ ID NOs: 63 and 64), and hRL (SEQ ID NOs: 32 and 33) were cloned into a pF4Ag fusion vector with N-terminal Id (Benezra et al., Cell, 61 (1): 49-59 (1990)), known be a weak fusion partner, and an HT7 C-terminal, which was used for normalization. The gene of interest was "sandwiched" between Id and HT7, that is, Id-Luciferase-HT7. E. coli lysates, containing the constructs of the variant on the basis of the pF4Ag or pF4Ag sandwich, were prepared as described in Example 26 and then tested with 20 μM of native celenterazine in the buffer described in Example 25.
[00447] FIG. 68 shows the luminescence for each variant on the pF4Ag or pF4Ag “Sand” sandwich base). FIG. 69 shows the decrease in duplication in luminescence due to the presence of Id and HT7 and determined by dividing the luminescence of the variant into pF4Ag by the luminescence of the variant in the pF4Ag sandwich. Samples with the highest values showed the greatest sensitivity to the weak fusion partner Id. Variant 9B8 was the most brilliant in the context of the sandwich. B. 9B8 OPT AND 9B8 OPT + K33N
[00448] The variants 9B8 opt and 9B8 opt + K33N were analyzed on a sandwich basis, as described above. The sandwich constructs for 9B8 opt (SEQ ID NOs: 40 and 41) and 9B8 opt + K33N (SEQ ID NOs: 59 and 60) were generated as described above. E. coli lysates were assayed and measured using the same assay buffer and luminometer as used for the generation of FIG. 40. FIG. 70 shows the decrease in duplication in the presence of a sandwich base indicating that 9B8 opt + K33N is less sensitive to the weak fusion partner Id than 9B8 opt. C. 23D2 and 24C2
[00449] Variants 23D4 (NF) and 24C2 (NF) were subcloned on the basis of sandwich Id-OgLuc-HT7 and tested in E. coli. The sandwich variants, 23D4 (F) (SEQ ID NOs: 76 and 77) and 24C2 (F) (SEQ ID NOs: 78 and 79) were compared to the 9B8 opt + K33N on the sandwich base (SEQ ID NO: 59 and 60). Table 35 shows that the variants had at least the same luminescence as 9B8 opt + K33N in the background context of the sandwich. Table 35: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt + K33N + 170G in Sandwich Base
D. 1F7 e15H1
[00450] The PCR library on the sandwich base Id-OgLuc-HT7 has been screened for additional variants with increased luminescence compared to 9B8 opt + K33N on the sandwich base. Selected variants were then tested on HEK293 and NIH3T3 cells. Table 36 shows the duplicated increase in luminescence of the sandwich variants in E. coli, HEK293 and NIH3T3 cells, and the amino acid substitutions found in the variants. 1F7 (F) (SEQ ID NOs: 84 and 85) and 15H1 (F) (SEQ ID NOs: 86 and 87) had at least 1.3-fold increase in luminescence in E. coli. 1F7 (F) was brighter than 9B8 opt + K33N on the sandwich basis in HEK293 and NIH3T3 cells. Table 36: Increase in Luminescence Generated by OgLuc Variants Compared to 9B8 opt + K33N in Sandwich Base

[00451] The sandwich variants were subcloned into the pF4Ag based non-fusion vector to generate 1F7 (NF) (SEQ ID NOs: 80 and 81) and 15H1 (NF) (SEQ ID NOs: 82 and 83) and were analyzed as described above and compared to 9B8 opt + K33N. Table 37 shows the increase in the luminescence times of the variants in E. coli, HEK293 and NIH3T3 cells. 1F7 (NF) and 15H1 (F) had at least a 1.3-fold increase in luminescence in E. coli and HEK293 cells. Table 37: Increased Luminescence Generated by OgLuc Variants Compared, with 9B8 opt + K33N + 170G
E. V2, 9B8 opt + K33N + L27V + K43R + Y68D, 9B8 opt + K33N + L27V + T39T + K43R + S66N and L27V
[00452] The 9B8 opt + K33N + T39T + K43R + Y68D variants (“V2”; SEQ ID NOs: 92 and 93), 9B8 opt + K33N + L27V + K43R + Y68D (SEQ ID NOs: 339 and 340), 9B8 opt + K33N + L27V + T39T + K43R + S66N (SEQ ID NOs: 341 and 342), and 9B8 opt + K33N + L27V + T39T + K43R + Y68D (“L27V”; SEQ ID NOs: 88 and 89) have been subcloned into a sandwich base as described above and assayed in HEK293 and NIH3T3 cells, as described above. The luminescence generated by the “sandwiched” variants was compared to the luminescence generated by the 9B9 opt + K33N sandwich (SEQ ID NOs: 59 and 60) (Table 38). Sandwich L27V (SEQ ID NOs: 90 and 91) and sandwich V2 (SEQ ID NOs: 94 and 95) had at least a 1.3X increase in luminescence in HEK293 and NIH3T3 cells. Table 38: Increase in Luminescence Generated by OgLuc variants on the sandwich base compared to 9B8 opt + K33N on the sandwich base

[00453] Sandwich and non-sandwich versions of variants V2, 9B8 opt + K33N + L27V + K43R + Y68D, 9B8 opt + K33N + L27V + T39T + K43R + S66N, and L27V were tested on HEK293 and NIH3T3 cells, as shown described in Example 37. The luminescence generated by the “non-sandwiched” variants was compared to the luminescence generated by the “sandwiched” variants (Table 39). The data shown in Table 39 indicate that the decrease in luminescence times for the 9B8 opt + K33N sandwich was less in mammalian cells than in E. coli cells, as shown in FIG. 70. Table 39: Decreased Times in the Luminescence of OgLuc Variants in the Presence of Sandwich Base
Example 46 - Multiplexing
[00454] A. E. coli lysates expressing the 9B8 opt variant were prepared as previously described in Example 27 and diluted 1000 times in DMEM without phenol red + 0.1% PRIONEX®. The luminescence of a sample containing 6.3 μg / mL of purified red beetle luciferase and E. coli lysate expressing the 9B8 opt variant was detected using a DUAL-GLO® Luciferase Assay System (Promega Corp.). DUAL-GLO® STOP & GLO® reagent containing 20 μM of celenterazine-h and DUAL-GLO® STOP & GLO® reagent containing 20 μM of PBI 3939 were used, according to the manufacturer's protocol to detect red beetle luciferase and variant luciferase of OgLuc 9B8 from a single sample. Three replicates were performed.
[00455] Luminescence was detected in a Turner MODULUS ™ luminometer. Table 40 shows the average luminescence generated by the red beetle luciferase (“red beetle”), and the luminescence generated by 9B8 opt (“Ogluc”) with celenterazine-h (“coel h”) or PBI-3939 (“3939 ”). Standard deviation (“+ /”) and coefficient of variation (“CV”) are also shown. A “non-celenterazine” control was performed to illustrate the amount of extinction of the red beetle signal through the DUAL-GLO® Reagent. STOP & GLO® of the DUAL-GLO® Luciferase Assay System in the absence of celenterazine. The control “without celenterazine” yielded a temper of 349 times. Table 40 shows that the large luminescence signals from both the red beetle and the OgLuc 9B8 variant were detected in a single sample. This demonstrates that each signal can be read sequentially in a two-step assay, and the signal from the first enzyme can be extinguished enough to not contribute to the signal from the second enzyme. Table 40: Average Luminescence Generated by the Red Beetle and 9B8 opt Luciferases Using a Modified DUAL-LUCIFERASE ™ Reporter Assay

[00456] B. To demonstrate that the multiplex reporter assay described above could be performed in reverse, that is, the OgLuc luminescence detected first, extinguished and a second detected luminescence, for example, red beetle, firefly luciferase, various inhibitors of Renilla luciferase (see US Published Order No. 2008/0248511) were screened for their ability to also inhibit OgLuc. Two Renilla inhibitors, previously identified, PBI-3077 and 1424, were added in different concentrations (see Table 41) for samples of E. coli lysate expressing variant 9B8 (diluted as above) and a buffer containing 100 mM MES pH 6.0 , 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v / v), 0.025% MAZU® DF 204, and 20 μM PBI-3939. Luminescence was measured as previously described, except luminescence measured using the GLOMAX® Multiplate Luminometer (Promega Corp .; also known as MODULUS ™). As shown in Table 41, both compounds were able to inhibit OgLuc luminescence. This demonstrates that an OgLuc variant can be multiplexed in a reporter assay with another luciferase, in which the luminescence of an OgLuc variant is detected first in the reporter assay. Table 41: The effect of PBI-3077 and PBI-1424 on Luminescence Generated by Bacterial Lysates Expressing 9B8 opt Using PBI-3939 as a Substrate

[00457] C. The spectral resolution between the OgLuc L27V variant and firefly luciferase (Fluc) was analyzed. Purified L27V (previously described; 9.54 pM) in DMEM without phenol red + 0.1% PRIONEX® was mixed with assay reagent (previously described) containing 20 μM PBI-3939. The purified firefly luciferase enzyme (QUANTILUM® Recombinant Luciferase; Promega Corp .; 271 ng / mL) in the same medium was mixed with a test reagent (100 mM HEPES, pH 7.4, 1 mM CDTA, 16 mM MgSO4, 1 % TERGITOL® NP-9 (v / v), 0.1% MAZU® DF 204, 5 mM ATP, 50 mM DTT, 333 μM luciferin). Purified Renilla luciferase (5 ng / mL GST-Renilla) in lysis buffer in the 1X Renilla Luciferase assay (Promega Corp.) was mixed with 10.5 μM of native celenterazine in Renilla Luciferase assay buffer. Luminescence was measured after 3 min by L27V and Fluc and after 10 min by Renilla luciferase (FIG. 71).
[00458] D. As another example, an OgLuc variant of the present invention could be used as a transcriptional and paired reporter like aequorinaa or a circularly interchanged firefly luciferase biosensor (or both simultaneously) to detect multiple paths in a single sample, for example, aequorin for the detection and / or measurement of calcium, the biosensor for the detection and / or measurement of cAMP and a variant of OgLuc for monitoring the expression of the downstream gene.
[00459] E. Other examples for multiplexing with the OgLuc variants of the present invention include: i) transfecting the cells with the constructs containing an OgLuc variant of the present invention and firefly Luciferase. After transfection, a first reagent could be added to lyse the cells as well as providing the substrate to generate luminescence for the first luciferase. The luminescence of the first luciferase would then be measured. A second reagent would then be added to extinguish the luminescence of the first luciferase as well as providing the substrate to generate the luminescence of the second luciferase. The luminescence of the second luciferase would then be measured. The choice of which luciferase to measure first would depend only on the ability to extinguish the luminescence of the first luciferase with p second reagent. For this example, the luminescence of the OgLuc variant could be measured first since high concentrations of luciferin (substrate for firefly luciferase) have been shown to inhibit the activity of the OgLuc variant. ii) transfection of cells with constructs containing an OgLuc variant of the present invention and firefly Luciferase. After transfection, a first reagent could be added which contained a living cell substrate to generate luminescence for the first luciferase. The luminescence of the first luciferase would then be measured. A second reagent would then be added to lyse the cells, extinguish the luminescence of the first luciferase and provide the substrate to generate luminescence of the second luciferase. The luminescence of the second luciferase would then be measured. This is similar to i) except that cell lysis will further limit the use of the living cell substrate and contribute to the extinction of the luminescence of the first luciferase. iii) Transfection of cells with constructs containing an OgLuc variant of the present invention and firefly Luciferase. After transfection, a reagent could be added which contained substrates to generate luminescence for both luciferases, but the luminescence of each luciferase is spectrally different. The maximum emission of the OgLuc variants is approximately 460 nm and certain substrates for firefly Luciferase, for example 5'-chloroluciferine and 5'-methylilliferiferine, can yield a maximum emission of approximately 610 nm. Therefore, although there may be some overlapping of the blue emission into the red emission, there would be no overlap of the red emission into the blue emission suggesting that little or no mathematical correction would be involved. iv) Transfection of cells with constructs containing an OgLuc variant of the present invention and firefly Luciferase. After transfection, a reagent could be added which contained live cell substrates to generate luminescence from both luciferases. The unique feature of this example is that the firefly luminescence tends to change to red at live cell assay temperatures, for example, 37 ° C, so several different luciferin derivatives could be chosen as a living cell substrate for firefly luciferase for generate luminescence that is spectrally different from that of the OgLuc variant. v) Transfection of cells with constructs containing an OgLuc variant of the present invention and Renilla luciferase. After transfection, a first reagent could be added to lyse the cells as well as to provide the substrate to generate luminescence for the first luciferase. The luminescence of the first luciferase would then be measured. The second reagent would then be added to extinguish the luminescence of the first luciferase as well as to provide the substrate to generate luminescence of the second luciferase. The luminescence of the second luciferase would then be measured. The choice of which luciferase to measure first would depend only on the ability to extinguish the luminescence of the first luciferase with the second reagent. For this example, it would be necessary to use the inhibitors to extinguish the OgLuc variant or the Renilla luciferase luminescence. vi) Transfection of cells with constructs containing an OgLuc variant of the present invention and beetle luciferase. After transfection, a reagent could be added which contained substrates to generate luminescence for both luciferases, but the luminescence of each luciferase is spectrally different since the beetle luciferase generates red-altered luminescence with native luciferin. Example 47 - Circular permutation
[00460] Two circularly exchanged (CP) versions of the L27V variant were made: CP84 and CP95. The number designation refers to the N-terminal residue (for example, “84” indicates the N-terminus of the new version of CP).
[00461] To create the circular permutations, the previous N- and C-termini are fused with no ligand ("no CP84 ligand" (SEQ ID NOs: 97 and 98) and "no CP95 ligand" (SEQ ID NOs: 105 and 106)) or an amino acid linker 5 (“CP84 5AA linker” (SEQ ID NOs: 99 and 100) and “CP95 5AA linker” (SEQ ID NOs: 107 and 108)), 10 (“CP84 10AA linker” (SEQ ID NOs: 101 and 102) and “CP95 10AA binder” (SEQ ID NOs: 109 and 110)) or 20 (“CP84 20AA binder” (SEQ ID NOs: 103 and 104) and “CP95 20AA binder” (SEQ ID NOs : 111 and 112)), (GSSGG) n (SEQ ID NO: 113) between the ends of the N- and C-termini. (note: L27V starts with phenylalanine at the N-terminus, that is, MVF. The “MV” is present in the construct with “no ligand”, but not in constructs with “ligand”). Once circularly exchanged, the CP L27V variants were cloned into the pF1K vector. E. coli cells were transformed with the CP vector and developed in minimal media using the standard deviation induction protocol previously described. For each CP construct, cells were grown in 8 wells of a 96-well plate. After induction, the 8 wells of each sample were pooled and 10 μL lysed in 40 μL of lysis buffer (100 mM MES pH 6.0, 0.3X PLB, 0.3 mg / mL lysozyme, 0.003 U / μL DNase I, and 0.25% TERGITOL® NP-9 (v / v)). The lysates were then diluted 1: 100 (CP versions with ligand) or 1: 1000 (non-CP versions) in the lysis buffer. The CP version without binder has not been diluted. Lysates or dilutions with lysate were tested in triplicate in 50 μL of assay reagent (previously described). Luminescence was measured as previously described (FIG. 72). Example 48 - Identification of additional locations for circular permutation
[00462] To identify the additional CP sites, determine the impact of the CP sites on luciferase activity and investigate the use of a "string" between the fragments, the CP constructs were made with a circular permutation done on approximately each 3rd location (i.e., amino acid) of the L27V variant (see FIG. 73E). One skilled in the art would understand that other locations, for example, the 1st and 2nd locations, could also be tested and used in circular exchanged OgLuc variants described here using the methods described here. For example, the L27V variant has been found to be particularly tolerant of circular permutation, particularly in situations where a relatively large binding domain is placed between the exchanged fragments (e.g., cAMP / RIIbB based sensors). At each site, the linker GSSGG-GSSGG-EPTT-ENLYFQS-DN-GSSGG-GSSGG (SEQ ID NO: 328) was added. The underlined sequence refers to a TEV protease recognition site. The purpose of the ligand is to provide a chord large enough between the two variant fragments so that they can associate in a way that produces a functional luciferase enzyme. The TEV protease recognition site was used to provide a means of breaking the rope (in the presence of TEV protease) so that its importance for maintaining activity could be investigated. The use of the TEV protease recognition site created a way to predict which CP sites would be useful for protein complementation (PCA) assays or for biosensor applications (for example, insertion of a response element between the sites of CP).
[00463] The activity that is seen before the cleavage of VTE represents how the two halves of the variant enzyme behave in a tied state. The binding of VTE to the recognition site causes cleavage, thereby separating the two halves of the variant enzyme. Samples that were cleaved with VTE would represent the uninduced state and provide an indication of how much antecedent could be expected. The lower activity after VTE cleavage indicates that the two halves cannot come together without induction. Samples showing a large loss in activity after VTE cleavage indicate sites that would work in applications with PCA and biosensor. In the case of PCA, the two halves of the variant enzyme would be fused to the binding partners that are able to join (string) after an induced binding event. In the case of a biosensor, the two halves would "come together" after a conformational change induced by bonding occurs. An example for PCA would be to merge one half of L27V to FRB and the other half to FKBP. The two halves would be brought close with exposure to rapamycin (Banaszynski et al., J. Am. Chem. Soc, 127 (13): 4715- 4721 (2005)). An example of a biosensor application would be to insert a cyclic AMP binding domain (for example, RIIbB) between the CP sites and to induce a conformational change by cyclic AMP binding to the binding domain.
[00464] Once each CP L27V construct was made, the CP enzyme was expressed in wheat germ, E. coli and mammalian cells and digested with TEV protease to investigate luciferase activity.
[00465] 1. For wheat germ analysis, the CP constructs were expressed using the TnT® T7 Coupled Wheat Germ Extract System (Promega Corp.) according to the manufacturer's instructions. The TnT® reactions were then diluted 1: 100 in 1X PBS + 0.1% gelatin and 20 μL added to 25 μL of TEV reaction reagent (5 μL 20X ProTEV buffer (Promega Corp.), 1 μL of 100 mM DTT and 2 μL of 10 U ProTEV Plus (Promega Corp.)). The volume of the digestion reactions was brought to 100 μL with water and incubated at 30 ° C for 60 min. Control samples without TEV protease were also prepared. 10 μL of the digested samples were then added to 40 μL of DMEM to a final volume of 50 μL and tested in 50 μL of test reagent (as previously described; 100 μM PBI-3939). Luminescence was measured as previously described (FIGS. 73A-D).
[00466] 2. For analysis in mammalian cells, HEK293 cells were transfected with the CP L27V variants using a reverse transfection protocol. Briefly, 1 ng of CP L27V plasmid DNA was mixed with 1 μg of vehicle DNA and added to cells in a well of a 12-well plate. The cells were then incubated for 16 hours at 37 ° C, 5% CO2. Cell lysates were then prepared by removing the media from the cells, washing them in 1X PBS, and adding 1 ml of 1X PLB. The lysates were then diluted 1:10 in 1X PBS with 0.1% gelatin. 40 μL of the diluted lysate was then used in a digestion of TEV protease as described above. 10 μL of digestion was mixed with 40 μL of DMEM without phenol red and 50 μL of assay reagent (previously described; 100 μM PBI-3939) added. Luminescence was measured as previously described (FIG. 73H).
[00467] 3. For E. coli analysis, E. coli cultures, which express the CP L27V variants, were grown overnight at 30 ° C. These cultures were used (1: 100 diluted in LB + antibiotic) to make new starting cultures for possible induction. The starting cultures were incubated at 37 ° C with shaking for 2.5 hours (OD600 is approximately 0.5). The rhamnose (final concentration of 0.2%) was added, the cultures moved to 25 ° C and incubated with shaking for 18 hours.
[00468] To create lysates, 50 μL of 0.5X FASTBREAK ™ Cell Lysis Reagent (Promega Corp.) was added to 950 μL of induced cultures and mixtures incubated for 30 min at 22 ° C. 50 μL of the lysed culture was then digested with TEV protease as described above and incubated at room temperature for 2 hours.
[00469] For analysis, lysates were diluted 1: 10,000 in HaloTag® Mammal Purification Buffer (Promega Corp.) and 50 μL tested in 50 μL of test reagent (as previously described; 100 μM PBI-3939). Baseline and VTE-induced luminescence was measured at 5 min time points (FIG. 73F) and the response (FIG. 73G) was determined as previously described.
[00470] FIGS. 73A-D show the basal luminescence of various constructs of CP-TEV protease L27V expressed in wheat germ extract. FIG. 73E summarizes the derived CP variants that responded to the TEV protease (the response is decreased), indicating that the CP variants can be used as VTE sensors, that is, they are indicative of “fixation dependency”. Variants showing at least a 1.2-time change were still validated as significant using the Student Test (unpaired p-values; confidence level of 0.03). These results indicate that each CP variant is capable of generating luminescence.
[00471] Several constructs of CP-TEV protease L27V have been expressed in HEK293 cells. The reverse transfection protocol, previously described, was used to transfer 1 ng of DNA / well with 1 μg of vehicle DNA. Each cell sample was grown in 1 mL of media in a 12-well plate. Cell lysates were prepared by removing the media and adding 1 ml of 1X PLB. The samples were diluted 1:10 in 1X PBS + 0.1% gelatin. 40 μL of the dilution sample were configured for VTE digestion. 10 μL of the digestion reaction was added to 40 μL of DMEM without phenol red and 50 μL of PBI-3939 as previously described. FIG. 73H shows the luminescence of the various constructs of CP-TEV protease L27V expressed in HEK293 cells.
[00472] The data in FIGS. 73A-H demonstrate that the L27V variant can be circularly interchanged in several different locations and have different dependencies with respect to the length of the string. Mammalian cell data and wheat germ data show similar fold reduction with VTE cleavage. CP L27V variants that are more string-dependent, that is, more sensitive to TEV protease cleavage, are potential candidates for PCA. CP L27V variants that are less string dependent may be potential candidates for self-supplementation / dimerization tests. EXAMPLE 49 - PROTEIN COMPLEMENTATION TESTS
[00473] Protein Complementation Assays (PCA) provide a means to detect the interaction of two biomolecules, for example, polypeptides. The PCA uses two fragments of the same protein, for example, an enzyme, which when brought in close proximity to each other, can constitute a functional, active protein. An OgLuc variant of the present invention can be separated into two fragment (s) at a separation tolerant site (s). Then, each fragment of the separated OgLuc variant can be fused to a pair of polypeptides of interest believed to interact, for example, FKBP and FRB. If the two polypeptides of interest actually interact, the OgLuc variants can then come in close proximity to each other to reconstitute the functional, active OgLuc variant. The activity of the reconstituted OgLuc variant can then be detected and measured using either a native or known celenterazine or a new celenterazine of the present invention. In another example, the split OgLuc variant can be used in a more general complementation system similar to lac-Z (Langley et al., PNAS, 72: 1254-1257 (1975)) or ribonuclease S (Levit and Berger, J Biol, Chem., 251: 1333-1339 (1976)). Specifically, an OgLuc variant fragment (designated “A”) known to complement with another OgLuc variant fragment (“B”) can be fused to a target protein, and the resulting fusion can be monitored by luminescence in a cell or in a cell lysate containing fragment B. The origin of fragment B could be the same cell (on the chromosome or another plasmid), or it could be a lysate or purified protein derived from another cell. This same fusion protein (fragment A) could be captured or immobilized using a fusion between fragment B and a polypeptide, such as HALOTAG® capable of attaching itself to a solid support. The luminescence can then be used to successfully demonstrate the capture or the amount of material captured. Methods for protein supplementation can be performed in accordance with Published Order US 2005/0153310, incorporated herein by reference.
[00474] 1. Constructs 9B8 opt PCA were performed as follows: -p9B8PCA 1/4 = pF5A / Met- [9B8 opt (51-169)] - GGGGSGGGSS-FRB (SEQ ID NOs: 331 and 332) & pF5A / FKBP-GGGSSGGGSG- [9B8 opt (1-50)] (SEQ ID NOs: 337 and 338) -p9B8PCA 1/2 = pF5A / Met- [9B8 opt (51-169)] - GGGGSGGGSS-FRB (SEQ ID NOs: 331 and 332) & pF5A / [9B8 opt (1-50)] - GGGGSGGGSS-FRB (SEQ ID NOs: 333 and 334) -p9B8PCA 2/3 = pF5A / [9B8 opt (1-50)] - GGGGSGGGSS-FRB (SEQ ID NOs: 333 and 334) & pF5A / FKBP-GGGSSGGGSG- [9B8 opt (51-169)] (SEQ ID NOs: 335 and 336) -p9B8PCA 3/4 = pF5A / FKBP-GGGSSGGGSG- [9B8 opt ( 51-169)] (SEQ ID NOs: 335 and 336) & pF5A / FKBP-GGGSSGGGSG- [9B8 opt (1-50)] (SEQ ID NOs: 337 and 338)
[00475] The PCA constructs were transfected into HEK293 cells (15,000 cells / well) in a 96-well plate using FUGENE® HD according to the manufacturer's instructions. The cells were then incubated at 37 ° C, 5% CO2. After transfection, the medium in the cells was replaced with CO2-independent medium with 10% FBS. Assay reagent with 20 μM PBI-3939 was then added, and luminescence measured in a Varioskan Flash at 28 ° C. 100 μM rapamycin was then added to the wells, and luminescence was continuously measured for 1 hour. The doubling response was calculated by dividing the entire luminescence of a well given by the pre-rapamycin treatment luminescence for the same well (FIG. 74).
[00476] 2. To demonstrate the use of the OgLuc variants in the PCA, the fragments of the L27V02A variant were complemented with FKBP or FRB, and the interaction between FKBP and FRB measured.
[00477] Table 42 lists the various Protein Complementation (PCA) constructs performed and tested. “2/3” designates the complementing pairs of the variant where 1) the “old” C-terminal of L27V02A (“old” = original C-terminal of L27V02A) is the C-terminal partner of FKBP; and 2) the "old" N-terminal of L27V02A is the N-terminal partner of FRB. “1/4” designates the pairs of the variant where 1) the “old” N-terminal of L27V02A is the C-terminal partner of FKBP; and 2) the "old" C-terminal of L27V02A is the N-terminal partner of FRB. For all constructs, FKBP was located at the N-terminal of L27V02. One fragment, and FRB, were located at the C-terminal of the L27V02 fragment. For example, PCA constructs were performed with separate sites at position 157 (see Table 42, “2/3” and “1/4” #s 11 and 12 (SEQ ID NOs: 288-295)), 103 (see Table 42, “2/3” and “1/4” #s 9 and 10 (SEQ ID NOs: 296-303)), and 84 (see Table 42, “2/3” and “1/4” #s 7 and 8 (SEQ ID NOs: 304-315)). Other PCA constructs were performed (SEQ ID NOs: 343-426 and 428-440) (See Table 21) Table 42
Table 21





[00478] The complementation pairs described in Table 42 were cloned into the vector pF4Ag as previously described. The PCA constructs (900 μL) were then expressed in a rabbit reticulocyte lysate (RRL; Promega Corp.) or wheat germ extract (Promega Corp.) following the manufacturer's instructions. 1.25 μL of the expression reactions for each PCA pair was mixed with 10 μL of 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS, 2 mM EDTA, 20% glycerol, 20 mM DTT, pH 7.5) and 7.5 μL of water, and 18 μL transferred to wells of a 96-well plate. 2 μL of 5 μM of Rapamycin (final concentration of 0.5 μM) were added and incubated for 10 min at room temperature).
[00479] After incubation, 100 μL of PBI-3939 (50X original solution diluted 1X in assay buffer) and incubated for 3 min at room temperature. Luminescence was measured as previously described (FIG. 76A-B: wheat germ; FIG. 76C-D: rabbit reticulocyte; FIG. 76E-F: cell-free system [which system WG or RRL ]; FIG 76G: HEK293 cells).
[00480] FIG. 76A-G shows the luminescence of several L27V protein complementing pairs (PCA): an L27V fragment from each pair has been fused to either FKBP or FRB using a 2/3 configuration (FIGS. 76A and 76C) or a 1 / 4 (FIGS. 76B and 76D) as described, and the interaction of FKBP and FRB monitored in wheat germ (FIGS. 76A and 76B) and rabbit reticulocyte lysate (RRL) (FIGS. 76C and 76D); and the luminescence of several negative protein complementation (PCA) controls (FIG. 76E). The luminescence of various L27V protein complementations using a 1/4 configuration in a cell-free (RRL) system (FIG. 76F) and HEK293 cells (FIG. 76G) was measured. The data in FIGS. 76A-G demonstrate that a variety of different deletions, that is, small fragments of the L27V variant, are functional.
[00481] 3. To demonstrate the use of PCA constructs for cell-based PCA, the constructs were transfected into HEK293 cells and tested with PBI-4377. Plasmid DNAs (5 ng) from each PCA pair (6, 12, 55, 84, and 103) were mixed with 40 ng of carrier DNA (pGEM-3fz) and 5 μL of OPTI-MEM® and incubated at room temperature for 5 min. FUGENE® HD (0.15 μL) was then added and incubated again for 15 min. DNA transfection mixtures were added to 100 μL of HEK293 cells. (1.5x105 cells / mL) in DMEM with 10% FBS (without antibiotics), transferred to wells of a 95-well plate, and incubated overnight at 37 ° C, 5% CO2.
[00482] After transfection, the medium was removed and replaced with CO2-independent medium with 20 μM or 50X PBI-4377 and incubated at 37 ° C without CO2 regulation for 2 h. Luminescence was measured, 10 μL rapamycin added, and luminescence measured again every 2 min for 2 h (FIGS. 76A-C).
[00483] 4. To demonstrate the use of PCA constructs to identify inhibitors of protein-protein interactions, the constructs described in # 2 of this example were used.
[00484] The complementation pairs, 103 “2/3”, 157 “2/3”, 103 “1/4” and 157 “1/4” described in Table 42 were cloned into the pF4Ag vector, as previously described. The PCA constructs (25 μL) were then expressed in rabbit reticulocyte lysate (RRL; Promega Corp.) according to the manufacturer's instructions. 1.25 μL of the expression reactions for each PCA pair was mixed with 10 μL of the 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS, 2 mM EDTA, 20% glycerol, 20 mM DTT , pH 7.5) and 7.5 μL of water, and 16.2 μL transferred to wells of a 96-well plate. Rapamycin was examined with various amounts of FK506. To the reactions, the FRB-FKBP binding inhibitor, FK506 (10X) was added, and the reactions incubated at room temperature for 10 min. 15 nM rapamycin (10X stock solution) was added to obtain a final concentration of 1.5 nM rapamycin and incubated for 2 h at room temperature. After incubation, 100 μL of PBI-3939 (50X original solution diluted 1X in assay buffer) and incubated for 3 min at room temperature. Luminescence was measured on a GLOMAX® luminometer. FIG. 77 demonstrates that the PCA constructs described here in this document can be used to identify inhibitors of protein-protein interactions.
[00485] 5. To demonstrate the use of PCA constructs in a lytic format, the complementation pairs, 103 “2/3”, 157 “2/3”, and 103 “1/4” were transfected into HEK293 cells and tested with PBI-3939. 0.5 ng of plasmid from each PCA pair was mixed with 5 μL of OPTI-MEM® and 49 ng pGEM-3zf (Promega Corp.). The sample mixture was incubated at room temperature for 5 min. 0.15 μL of FUGENE® HD was then added to the sample mixture and incubated at room temperature for 15 min. 100 μL of HEK293 cells in DMEM with 10% FBS (without antibiotics) at a concentration of 1.5x105 cells / mL were added for each sample mixture. The cell sample was then transferred to a well in a 96-well plate and incubated at 37 ° C, 5% CO2 overnight.
[00486] The following day, 11.1 μL of 10 μM of Rapamycin (Final Concentration of 1 μM) was added to half of the wells and 11.1 μL of water was added to the other half of the wells. The 96-well plates incubated at 37 ° C for 1 hr. 100 μL of test reagent + PBI-3939 (2 μL of 50X PBI-3939 mixed with 98 μL of test reagent, previously described) were added to each well and the plates were incubated at 37 ° C for 4 min. Luminescence was measured in a GLOMAX® luminometer at 37 ° C with an integration time of 0.5 s and 1 reading. (FIG. 76H). Example 50 - OgLuc cAMP biosensor
[00487] The OgLuc variants of the present invention can be linked to the light output not only through concentration, but also through the modulation of enzymatic activity. For example, a cAMP biosensor can be developed by incorporating a cAMP binding domain from Protein Kinase A into a circularly exchanged OgLuc variant. An OgLuc variant of the present invention can be exchanged circularly at a site tolerable to such permutation by methods known in the art (for example, Published Application US 2005/0153310). The circularly exchanged chimeric OgLuc variant protein can function as an intracellular biosensor for cAMP when expressed in mammalian cells. After cAMP binding to the biosensor, the biosensor undergoes a conformational change that creates an active luciferase enzyme. The treatment of cells with forskolin, an activator for adenylate cyclase should result in an increase in luminescence with increased concentrations of forskolin. Similar iosensors for targets including, but not limited to, calcium (Ca + 2), cGMP, and proteases such as caspases and tobacco etch virus (TEV) can be developed by incorporating the appropriate binding domain or cleavage site for each in the circularly exchanged OgLuc variant.
[00488] The usefulness of OgLuc as a biosensor was demonstrated through the analysis of the 9B8 opt variant in the context of a cAMP sensor. Circularly exchanged constructs containing the Protein Kinase-A RIIβB subunit flanked by the sequences of the OgLuc variant were performed and expressed in a cell-free system, as described in Order PCT / US2007 / 008176, except the sites for the circular permutation that were chosen as described below. The nascent protein was tested in the presence and absence of cAMP. The response to cAMP is defined as the ratio of the (+) cAMP / (-) cAMP activity.
[00489] A structural model for OgLuc was created, based on similarities to certify the fatty acid binding proteins of known structure, previously described in PCT / US2010 / 33449. The model precedes an ordered sequence of the structural motifs of the standard protein; a-helix and β-leaf. The transition regions between these structural elements, such as circular permutation, were chosen. (see Table 43).
[00490] 1. The model for expression of the biosensor constructs consisted of: C-terminal OgLuc sequence, RIIβB sequence, N-terminal OgLuc sequence in plasmid pF5 (Promega orp.). The TNT® T7 Coupled Wheat Germ Extract System (Promega Part # L4140) was used to transfer the construct. The TNT® Wheat Germ Extract Reaction included 25 μL TNT® Wheat Germ Extract (L411A), 2 μL TNT® Reaction Buffer (L462A), 1 μL Amino Acid Blend, Complete (L446A), 1 μL of RNasin® (40 U / μL) (N2615), 1 μL of TNT® T7 RNA Polymerase (L516A), 1.0 μg of DNA model and water without nuclease to reach a total of 50 μL. The reaction mixture was incubated at 30 ° C for 120 min.
[00491] An OgLuc activity assay was performed by adding 50 μL of OgLuc translational mixture, 50 μL of Glo OgLuc Reagent (100 mM MES (pH 6.0), 1 mM CDTA, 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v / v), 0.025% MAZU® DF 204, and 20 μM PBI-3939) with or without 100 μM cAMP, and by performing a kinetic reading for 30 min (TECAN® INFINITE® F500 Plate Reader). The Response is determined by dividing the luminescence generated by the biosensor with cAMP by the luminescence generated by the biosensor without cAMP (Table 43). Table 43: Response of Circular Exchanged OgLuc Biosensors to cAMP

[00492] 2. A 9B8opt cAMP biosensor circularly exchanged at the CP 51 site was created as described in 1. The biosensor was then transfected into HEK293 cells (15,000 cells / well) using FUGENE® HD according to the manufacturer's instructions in a 96-well plate and incubated overnight at 37 ° C, 5% CO2. After transfection, the medium was removed and replaced with CO2-independent medium with 10% FBS. The cells were then incubated for 2 h at 37 ° C, 5% CO2 and after which, varying amounts of FSK were added. The cells were then incubated for 3 h at 37 ° C, 5% CO2. 6 μM of PBI-3939 was then added, and luminescence measured after 13 min (FIG. 78).
[00493] 3. Circularly swapped (“CP”; for example, CP6 refers to the old residue 6 being the new residue 1 after Met) and Direct division (“SS”; for example, SS6 refers to a sensor oriented as indicated below: OgLuc (1-6) -RIIβb binding site (SEQ ID NOs: 441 and 442) -OgLuc (7-169)) versions of L27V were used as cAMP biosensors (SEQ ID NOs: 467-574 ). CP (SEQ ID NOs: 467-498 and 555-574) and SS (SEQ ID NOs: 499-554) versions of the L27V variant were divided as previously described and expressed in rabbit reticulocyte lysate (RRL; Promega Corp.) according to the manufacturer's instructions. The linker sequence between the C-terminal of the RIIβb binding site and the OgLuc luciferase sequence was GGGTCAGGTGGATCTGGAGGTAGCTCTTCT (SEQ ID NO: 575). The binding sequence between the N-terminal of the RIIβb binding site and the OgLuc luciferase sequence was AGCTCAAGCGGAGGTTCAGGCGGTTCCGGA (SEQ ID NO: 576) 3.75 μL of the expression reactions were mixed with 1.25 μL 4X cAMP (final concentration 1 nM-0.1 mM), and incubated at room temperature for 15 min. After incubation, 100 μL of PBI-3939 (50X original solution diluted in 1X assay buffer) and incubated for 3 min at room temperature. Luminescence was measured on a GLOMAX® luminometer (FIGS. 79A-B). Luminescence was also measured for the CP and SS versions of the L27V variant expressed in HEK293 cells and treated with forskolin, as previously described (FIGS. 79C-D). FIGS. 79A-D demonstrate that the circularly exchanged and direct division versions of the OgLuc variants described here can be used as biosensors. Example 51 - Subcellular Distribution and Location
[00494] For the subcellular distribution of the analysis, U2OS cells were plated in 2x104 cells / cm2 glass bottom culture dishes in McCoy’s 5A medium (Invitrogen) containing 10% FBS. The cells were then incubated for 24 hours at 37 ° C, 5% CO2. The cells were then transfected with a 1/20 volume transfection mixture (FUGENE® HD and pF5A-CMV-L27V (the L27V variant (SEQ ID NO: 88) cloned into the pF5A vector with the CMV promoter (Promega Corp.)) or pGEM3ZF (Promega Corp .; negative control)) and incubated for 24 h at 37 ° C, 5% CO2. After incubation, the cell medium was replaced with Cθ2 independent medium with 0.5% FBS and 100 μM PBI-4378. After a 30 min incubation at 37 ° C, unfiltered images were captured in an Olympus LV200 bioluminescence microscope using a 60X objective (FIGS. 80A-B) for 25, 100, 1000, and 5000 ms.
[00495] To analyze the subcellular location, fusions of the L27V N-terminal with GPCR AT1R (Angiotensin type 1 receptor (SEQ ID NOs: 459 and 460)) with IL-6 secretion sequence (SEQ ID NOs: 461 and 462) or the transcription factor, Nrf2 (SEQ ID NO: 317), was performed using a GSSG ligand (SEQ ID NOs: 457 and 458) transfected into U2OS cells as described above (FIGS. 81A-C). FIG. 81C ("GPRC") shows the expression of a construct in which the IL6 signal sequence is upstream of the L27V variant sequence and AT1R is downstream of the L27V variant sequence. The L27V variant alone was also transfected (“Not fused”). After an imbucation of 24 h at 37 ° C, 5% CO2, the cell medium was replaced with CO2 independent medium with 0.5% FBS and equilibrated for 1 hour at 37 ° C in an unregulated CO2 atmosphere. A volume of medium equal to + 200 μM PBI-3939 was then added and unfiltered images were captured immediately on an Olympus LV200 bioluminescence miscroscope using a 60X or 150X objective (FIGS. 81A-C). For cells that express L27V only, PBI-3939 was washed out of the cells immediately before imaging. Example 52 - Monitoring Intracellular Signal Paths
[00496] This example provides two examples of new luciferase to monitor intracellular signal paths at the protein level (as opposed to the examples of response elements, which represent transcriptional activation). The 9B8opt variant (SEQ ID NO: 24) has been merged into IkB (Gross et al., Nature Methods 2 (8): 607-614 (2005)) (at the C-terminal, i.e., N-IkB- (9B8opt) -C)) or ODD (oxygen-dependent degradation domain of Hif-1-α (Moroz et al., PLoS One 4 (4): e5077 (2009)) (in the N-terminal, that is, N- (9B8opt ) -ODD-C)). IKB is known to be degraded in cells after stimulation with TNFa; therefore, the IKB- (9B8opt) construct could be used as a living cell TNFα sensor. ODD (Hif-1-α) is known to accumulate cells inside after stimulation with compound that induce hypoxia; therefore, the ODD- (9B8opt) construct could be used as a living cell hypoxia sensor.
[00497] Constructs containing fusions with IkB or ODD with 9B8opt (pF5A) are expressed in HEK293 cells through reverse transfection (5 ng (IkB) or 0.05 ng (ODD) DNA (mixed with carrier DNA for a total of 50 ng )) as previously described and incubated for 24 h at 37 ° C, 5% CO2. After transfection, the medium was replaced with CO2 independent medium containing 0.5% FBS and 20 μM PBI-4377 and left to equilibrate for 4 h at 37 ° C, atmospheric CO2. The cells were then exposed to a stimulus: TNFa for IkB cells that express fusion and phenanthroline for cells that express ODD fusion. DMSO (vehicle) was added to the control cells. For TNFa / IKB samples, 100 μg / mL of cycloheximide were added for approximately 15 min before adding a new protein stimulus. At indicated periods of time after treatment, cells were tested for luminescence. For data normalization, the RLU of each sample in a given period of time was divided by the RLU of the same sample immediately after stimulation. The double response for each sensor was then determined. (FIGS. 82A-C).
[00498] B. L27V was used to monitor the pathways of oxidative stress signals at the protein level. L27V or Renilla luciferase (Rluc) was fused to Nrf2 / NFE2L2 in an expression vector pF5K (at the C-terminal; i.e., N-Nrf2- (L27V) - C or N-Nrf2- (Rluc) -C). Keap1 is a negative regulator of Nrf2 (SEQ ID NO: 217). In order to accurately represent the reflection of Nrf2-L27V02 protein levels, Keap1, it was coexpressed to keep Nrf2 levels low (via ubiquitinization).
[00499] Nrf2-L27V or Nrf2-Rluc (5 ng, pF5K) and a Keap 1 HALOTAG®- (pFN21-HT7-Keap1 fusion protein (SEQ ID NO: 316); 50 ng) were expressed in HEK293 cells via transfection of cells at the time of sowing in 96-well plates, as previously described and incubated for 24 h at 37 ° C, 5% CO2. After transfection, the medium was replaced with fresh CO2-independent medium with 0.5% FBS and 20 μM PBI-4377 for L27V or 20 μM ENDUREN ™ (Promega Corp.) for Renilla luciferase, and the cells were equilibrated for 4 h at 37 ° C under atmospheric CO2. For kinetic analysis, 20 μM of D, L sulforaphane or vehicle (DMSO) were used. In FIG. 83A, luminescence was measured as previously described at indicated time periods after treatment. For data normalization, the luminescence of each sample in a given period of time was divided from the same sample immediately after stimulation (FIGS. 83B-C).
[00500] C. A comparison of the response of the Nrf2 sensor described in B and reporter Nrf2 (ARE) -Luc2P (Promega Corp.) was performed. Both the Nrf2 sensor and the reporter were analyzed as described in section B above. For the assay of the firefly reporter gene (Luc2P), the ONE-GLO ™ assay reagent was used. FIGS. 84A-B provide the normalized response of Nrf2-L27V in 2 h and Nrf2 (ARE) -Luc2P in 16 h. μL μM Example 53 - Evaluation of the OgLuc Variant as a Bioluminescent Reporter with BRET
[00501] Bioluminescence resonance energy transfer (BRET) allows the monitoring of protein-protein interactions. The transfer of intramolecular energy was analyzed between IV and an HT7 fusion partner where HT7 was previously labeled with a fluorophore, that is, TMR (excitation / emission (ex / em) of wavelength = 555/585 nm) or Rhodamine 110 (excitation / emission wavelength = 502/527 nm). 50 μL of a bacterial cell lysate containing the IV-HT7 fusion protein of Example 34 was incubated with or without 0.001-10 mM fluorophore ligand for 1 hour at room temperature. After incubation, 50 μL of RENILLA-GLO ™, which contains 22 μM of celenterazine-h, was added to 50 μL of the enzyme-ligand mixture, and the emission spectrum was recorded in 5 min. Example of IV-HT7 spectra with TMR (FIG. 83A) or Rhodamine 110 (“Rhod110”) (Fig. 85B) are shown indicating that BRET was greater when the ex / em of the ligand was closer to the luminescent peak of 460 nm of OgLuc, that is, with greater Rhodamine 110. These data show that the transfer of intramolecular energy can occur between the variants of OgLuc and a fluorophore in a fusion protein. Three different controls were used for comparison (data not shown): 1) a non-HT fusion, 2) an HT fusion that was not labeled with an HT ligand, and 3) a labeled HT fusion that was proteolytically cleaved at a TEV site between OgLuc and HT (which indicated proximity / distance involvement). BRET was not seen in the three different controls, suggesting that HT was involved in achieving BRET. BRET was higher for C1 + A4E and IV with a HT7 C-terminus compared to the HT7 N-terminus. Example 54 - Protein Proximity Assays for live cells or lytic formats
[00502] In one example, circularly exchanged (CP) or direct division (SS) OgLuc fusion proteins are applied to protein proximity measurements. OgLuc is exchanged or divided by inserting a protease substrate amino acid sequence (for example, TEV) to generate low bioluminescence. Inactive luciferase is trapped (for example, by means of genetic fusion) with a monitoring protein. A potential interacting protein is attached (for example, by means of genetic fusion) with a protease (for example, TEV). When the two monitor proteins interact or are in close enough proximity (for example, through a constitutive interaction, a drug stimulus or a path response), luciferase is cleaved to generate an increase in bioluminescence activity. The example can be applied to measurements of protein proximity in cells or biochemical assays. In addition, the high thermal stability of an OgLuc variant luciferase could allow measurements of antibody-antigen interactions in lysed cells or biochemical assays. Example 55 - Bioluminescent assays
[00503] 1. To demonstrate the use of an OgLuc variant in a bioluminescent assay to detect the caspase-3 enzyme, the 9B8 opt variant was used in a bioluminescent assay using a pro-celenterazine substrate comprising the DEVD cleavage sequence caspase-3. The purified caspase-3 enzyme was mixed with a sample of E. coli lysate expressing the 9B8 opt variant, which was prepared as described in Example 27, and diluted 10 times in a buffer containing 100 mM MES pH 6.0, 1 mM CDTA , 150 mM KCl, 35 mM thiourea, 2 mM DTT, 0.25% TERGITOL® NP-9 (v / v), 0.025% MAZU® DF 204, with or without 23.5 μM z-DEVD-celenterazine- h in 100 mM HEPES pH 7.5. The caspase-3 enzyme was incubated with the lysate sample for 3 h at room temperature, and the luminescence detected in a Turner MODULUS ™ luminometer for several periods of time. A sample containing only bacterial lysate and a sample containing only caspase-3 was used as controls. Three replicas were used. FIG. 86 and Table 44 demonstrate that 9B8 opt, and therefore other OgLuc variants of the present invention, can be used to detect an enzyme of interest. Table 44: Medium luminescence in RLU generated from bacterial lysates expressing the 9B8 opt variant incubated with or without purified aspase-3 using z-DEVD-celenterazine-h as a substrate.


[00504] 2. The L27V variant was used in a bioluminescent assay using a pro-celenterazine substrate comprising the cleavage sequence DEVD caspase-3. The purified caspase-3 enzyme (1 mg / mL) in 100 mM MES pH 6 (50 μL) was mixed with 227 nM of L27V02 variant and 47 μM of PBI-3741 (z-DEVD-celenterazine-h) in assay buffer (50 μL). The reactions were incubated for 3 h at room temperature and the luminescence detected as previously described. The assay with the L27V variant was compared to a firefly luciferase version of the assay, CASPASE-GLO® 3 / 7- Assay System (Caspase-Glo; Promega Corp.). Table 45 demonstrates that the L27V variant, and thus other OgLuc variants of the present invention, can be used in a bioluminescent assay with a pro-celenterazine substrate to detect an enzyme of interest. Table 45
Example 56 - Immunoassays
[00505] The OgLuc variants of the present invention are integrated into a variety of different immunoassay concepts. For example, a variant of OgLuc is genetically fused or chemically conjugated to a primary or secondary antibody to provide a method of detecting a particular analyte. As another example, a variant of OgLuc is genetically fused or chemically conjugated to protein A, protein G, protein G, or any other peptide or protein known to bind to Ig fragments, and this could then be used to detect a specific antibody bound to the particular analyte. As another example, a variant of OgLuc is genetically fused or chemically conjugated to streptavidin and used to detect a specific biotinylated antibody bound to a particular analyte. As another example, complementary fragments of an OgLuc variant are genetically fused or chemically conjugated to the primary and secondary antibodies, where the primary antibody recognizes a particular immobilized analyte, and the secondary antibody recognizes the primary antibody, all in a format similar to the ELISA. . . The activity of the OgLuc variant, that is, luminescence, is reconstituted in the presence of the immobilized analyte and used as a means to quantify the analyte.
[00506] As another example, complementary fragments of an OgLuc variant can be fused with two antibodies, where one antibody recognizes a particular analyte in an epitope, and the second antibody recognizes the analyte in a distinct epitope. The activity of the OgLuc variant would be reconstituted in the presence of the analyte. The method would be amenable to quantitation measurements of the analyte in a complex medium, such as a cell lysate or cell medium. As another example, complementary fragments of an OgLuc variant can be fused with two antibodies, one antibody that recognizes a particular analyte, regardless of modification, and the second antibody that recognizes only the modified analyte (for example, after post-modification) translational). The activity of the OgLuc variant would be reconstituted in the presence of the analyte only when it is modified. The method would be amenable to measurements of the modified analyte in a complex medium, such as a cell lysate. As another example, a variant of OgLuc can be combined with an analyte (eg, prostaglandins) and used in a competitive sandwich ELISA format. Example 57 - Dimerization test
[00507] This example demonstrates that the OgLuc circularly exchanged full-length variants can be fused to the respective binding partners, for example, FRB and FKBP, and used in a protein complementation assay. The main difference between the method described here and traditional protein complementation is that there was no complementation, but the dimerization of two full-length enzymes, for example, circularly exchanged OgLuc variants.
[00508] Briefly, the circularly exchanged reporter proteins similarly configured for low activity were fused to both fusion protein partners (See FIG. 87A). For example, each merger partner can be linked to the identically structured swapped reporters. The interaction of the merger partners brought the exchanged reporters in close proximity, thus allowing the reconstitution of a hybrid reporter with greater activity. The new hybrid reporter included portions of each of the circularly swapped reporters in order to reduce structural limitations.
[00509] Circularly swapped L27V variants of direct division CP84 and CP103 (N- (SS-169) - (1-SS1) -FRB-C and C- (1-SS1) - (SS-169) -FKBP) were cloned as previously described and expressed (25 μL) in rabbit reticulocyte lysate (RRL; Promega Corp.) according to the manufacturer's instructions. 1.25 μL of the expression reactions for each dimerization pair were mixed with 10 μL of 2X Binding Buffer (100 mM HEPES, 200 mM NaCl, 0.2% CHAPS, 2 mM EDTA, 20% glycerol, 20 mM DTT , pH 7.5) and 7.5 μL of water, and 18 μL transferred to wells of a 96-well plate. To the reactions, 2 μL of rapamycin (final concentration of 0 and 0.1-1000 nM) were added, and the reactions incubated at room temperature for 10 min. After incubation, 100 μL of PBI-3939 (50X original solution diluted 1X in assay buffer) and incubated for 3 min at room temperature. Luminescence was measured on a GLOMAX® luminometer (FIG. 87B) and the response was determined (FIG. 87C). FIGS. 87B-C demonstrate that the OgLuc variants of the present invention can be used to detect protein-protein interactions through a PCA-type dimerization assay. Example 58 - Intercellular half-life
[00510] The intracellular half-life of the OgLuc 9B8, 9B8 + K33N, V2, L27V, and V2 + L27M variants was determined. CHO cells (500,000) in 15100 mm plates in F12 medium with 10% FBS and 1X sodium pyruvate were transfected with 30 μL of 100 ng / μL of plasmid DNA containing 9B8, 9B8 + K33N, V2, L27V ( “V2 + L27V”) or V2 + L27M (all on the pF4A vector basis) using TRANSIT®-LT1 (Mirus) according to the manufacturer's instructions. The cells were then incubated for 6 h.
[00511] After incubation the medium was removed and 1 ml of Trypsin added to dissociate the cells from the plate. 3 ml of the F12 medium was then added, and the cells counted. The cells were then plated at 10,000 cells / well in 6 wells of a 96-well plate (6 wells / variant) and incubated overnight at 37 ° C. Samples were distributed on 3 plates. Each plate contained 6 replicates for different measurements of time periods.
[00512] After overnight incubation, the medium was removed from the cells for samples t = 0 and 100 μL of assay buffer (previously described; without substrate) was added. The sample was frozen on dry ice and stored at - 20 ° C. Cycloheximide (100 mg / ml) was diluted 1: 100 to a final concentration of 1 mg / ml in OPTI-MEM®. DMSO (100%) was also diluted 1: 100 (final concentration of 1%) in OPTI-MEM®. The diluted cycloheximide (1 mg / mL) was added (11 μL) to 3 replicates of each transfected variant sample and 11 μL of diluted DMSO (1%) was added to the other 3 replicates. The cells were then incubated at 37 ° C, 5% CO2 and removed at various times (ie. 0, 0.5, 0.9, 2.5, 4.3, and 6.2 h) and processed as samples t = 0.
[00513] For analysis, the samples were thawed at room temperature, and 10 μL assayed in 50 μL of assay reagent. Luminescence was measured on a GLOMAX® luminometer. At each time period, luminescence was measured for samples treated and not treated with cycloheximide. The RLU for cells treated with cycloheximide was normalized by the RLU for untreated cells.
[00514] The intracellular half-life of each variant was calculated by measuring the ratio between the luminescence of the cycloheximide (CHX) treated with the untreated, in each period of time. The ratio was then plotted ln (% treated to untreated) over time and the calculated half-life (Table 46). The OgLuc variants had an intracellular half-life of about 6-9 hours with a full-strength CMV promoter, but the half-lives were reduced with a CMV exclusion variant (d2). The presence of a PEST degradation signal combined with the full-strength CMV promoter significantly reduces half-life. Table 46

[00515] Another experiment was completed using the reverse transfection protocol described in Example 52 with HEK293 cells (data not shown). The results of this experiment indicate that the intracellular half-life for the L27V variant with PEST is 10 min. The L27V variant without signal degradation used in this experiment did not deteriorate over the course of the experiment. In this case, the deterioration was normalized for untreated cells at t = 0. Example 59 - Exposure of OgLuc Variants to Urea
[00516] Since firefly Luciferase is known to be relatively unstable, it is much more sensitive to urea exposure. To determine whether this was also the case with the OgLuc variants, the sensitivity of OgLuc to urea was determined. 5 μl of 45.3 μM L27V of enzyme were mixed with 100 μL of a urea solution (100 mM MOPS, pH 7.2, 100 mM NaCl, 1 mM CDTA, 5% glycerol and various concentrations of urea) and incubated for 30 min at room temperature. 5 μL of the urea enzyme solution + L27V was diluted 10,000 times in DMEM without phenol red + 0.1% PRIONEX®, 50 μL was mixed with 50 μL of assay reagent containing 100 μM PBI-3939 (previously described) and luminescence was read in 10 min. (FIG. 88). FIG. 88 indicated that L27V is resistant to urea or replicates to a functional enzyme very quickly after removal of urea. This suggests that L27V could be used as a reporter enzyme when chemical denaturing conditions are involved, for example, multiplexing under conditions where a denaturant is used to stop an enzymatic reaction before the reaction based on the OgLuc variant.
[00517] An original 0.31 mg / mL solution of the purified variant L27V was diluted 100,000 times in a buffer (PBS + 1 mM DTT + 0.005% IGEPAL) and incubated with 3 M urea for 30 min at 25 ° C and then mix a1: 1 (50 μL + 50 μL) with a test reagent containing 100 μM PBI-3939 (previously described). The reactions were then read on a TECAN® INFINITE® F500 luminometer, as previously described (for 100 min; 1 min of reading intervals) (FIG. 89). The results indicate that 3M of urea reduces the activity of the L27V variant by approximately 50%, however, after diluting the urea two times (up to a final concentration of 1.5 M) the activity increases, presumably due to duplication. Example 60 - Imaging of OgLuc Fusion Proteins
[00518] This example demonstrates the use of OgLuc and OgLuc variants for the translocation of monitor proteins in living cells, without the need for fluorescence excitation. Variants of OgLuc have been fused to the human glucocorticoid receptor (GRSEQ ID NOs: 451 and 452), human protein kinase C alpha (PKCa; SEQ ID NOs: 449 and 450) or LC3 (SEQ ID NOs: 577 and 578). To analyze the translocation of subcellular protein using bioluminescence imaging, HeLa cells were plated at 2x104 cells / cm2 in bottom glass culture plates (MatTek) in DMEM medium (Invitrogen) containing 10% FBS. The cells were then incubated for 24 hours at 37 ° C, 5% CO2. The cells were then transfected with the 1/20 volume transfection mixture (Fugene ® HD and DNA encoding L27V02-GR (SEQ ID NOs: 453 and 454) or L27V02 PKCalfa (SEQ ID NOs: 455 and 456)) and cloned into the pF5A vector (Promega Corp.) The plasmid DNA for L27V02-GR was diluted 1:20 in pGEM-3ZF (Promega Corp) to achieve adequate expression levels of L27V02-GR. Plasmid DNA for L27V02-LC3 and L27V02 from PKC alpha was used without dilution. The cells were then incubated for 24 hours at 37 ° C, 5% CO2. Cells transfected with fusion proteins were deprived of GR agonist for 20 hours using MEM medium, supplemented with 1% treated FBS of charcoal / dextran (Invitrogen). Twenty-four hours after transfection (for PKC alpha measurements) or 48 hours after transfection (for GR measurements), the cell medium was replaced with CO2-independent medium containing 100nM PBI-3939 immediately before imaging. Unfiltered images were immediately captured on an Olympus LV200 luminescence microscope using a 150X lens.
[00519] The translocation of Cytosol to the nucleus of the fusion protein L27V02-GR was obtained by stimulation with 0.5 mM dexamethasone for 15 min. The translocation of the cytosol-plasma membrane of the L27V02-PKC alpha fusion protein was achieved by stimulation with 100 nM PMA for 20 min. The transfected L27V02-LC3 fusion protein was either left untreated or treated with 50 mM Chloroquine in DMEM medium (Invitrogen) containing 10% FBS. L27V02- Glucocorticoid Receptor
[00520] In the absence of glucocorticoids, the glucocorticoid receptor (GR) is complexed with Hsp90 proteins and resides in the cytosol. After the interaction of GR with glucocorticoids, such as dexamethasone, GR proteins dissociate these protein complexes and translocate to the nucleus in order to regulate gene transcription. FIGS. 90A-B show the dexamethasone-induced cytosol bioluminescence imaging for the translocation of the L27V02 glucocorticoid receptor fusion proteins (GR) using the substrate PBI-3939 in HeLa cells. L27V02-PKCa
[00521] After treatment with phorbol esters, alpha PKC proteins are recruited to the plasma membrane and regulate cellular responses, including membrane dynamics and signal transduction. FIGS. 91A-B show imaging of bioluminescence induced by phorbol ester-induced Protein Kinase C alpha cytosol (PKC alpha) for the plasma membrane translocation of the OgLuc L27V02 PKC alpha fusions using PBI3939 substrate in U-2 OS cells. L27V-LC3
[00522] The association of autophagosome-processed LC-3 proteins represents a milestone in autophagy. The chloroquine treatment captures the autophagic flow at this stage resulting in the accumulation of LC-3 proteins in autophagosomes producing a punctuated subcellular distribution. FIGS. 92A-B show the bioluminescence imaging of the chloroquine-induced autophagy protein translocation of the OgLuc L27V-LC3 fusion proteins (SEQ ID NOs: 592 and 593), using PBI-3939 substrate in two representative HeLa cell samples. Table 47 - List of Provisions

权利要求:
Claims (14)
[0001]
1. Compound FEATURED by the fact that it presents the formula
[0002]
2. Composed, according to claim 1, CHARACTERIZED by the fact that R2 is
[0003]
3. Compound according to claim 1, CHARACTERIZED by the fact that R2 is C2-5 straight chain alkyl.
[0004]
4. A compound according to any one of claims 1 to 3, R3 CHARACTERIZED by the fact that R8 is
[0005]
5. Compound according to any one of claims 1 to 3, CHARACTERIZED by the fact that R8 is
[0006]
6. Compound FEATURED by the fact that it is selected from:
[0007]
7. Compound FEATURED by the fact that it presents the formula:
[0008]
8. Kit CHARACTERIZED by the fact that it comprises a compound as defined in any one of claims 1 to 7.
[0009]
9. Kit, according to claim 8, CHARACTERIZED by the fact that it also comprises a luciferase.
[0010]
10. Kit, according to claim 9, CHARACTERIZED by the fact that the luciferase is an Oplophorus or Renilla luciferase.
[0011]
11. Kit according to any one of claims 8 to 10, CHARACTERIZED by the fact that it also comprises a buffer reagent.
[0012]
12. Method for detecting luminescence in an in vitro sample CHARACTERIZED by the fact that it comprises: contacting an in vitro sample with a compound as defined in any one of claims 1 to 7; contact the sample in vitro with a luciferase using coelenterazine, if it is not present in the sample; and detect luminescence.
[0013]
13. Method according to claim 12, CHARACTERIZED by the fact that the in vitro sample contains live cells.
[0014]
14. Method according to claim 12, CHARACTERIZED by the fact that the in vitro sample contains a luciferase using coelenterazine.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112013010487B1|2021-02-02|coelenterazine compounds, kit comprising said compounds and method for detecting luminescence in an in vitro sample

同族专利:

---

公开号 | 公开日

---

JP6539689B2|2019-07-03|

---

KR20130084312A|2013-07-24|

---

US9139836B2|2015-09-22|

---

IL226114A|2018-04-30|

---

CA2815227A1|2012-05-10|

---

WO2012061530A3|2012-09-27|

---

US9938564B2|2018-04-10|

---

IL226114D0|2013-06-27|

---

IL258790A|2020-05-31|

---

BR112013010855A2|2017-06-27|

---

IL274316D0|2020-06-30|

---

WO2012061530A2|2012-05-10|

---

PT2635595T|2019-01-29|

---

ES2567410T3|2016-04-22|

---

SG10201608550SA|2016-12-29|

---

CN103370319A|2013-10-23|

---

AU2011323418B2|2017-07-27|

---

WO2012061529A1|2012-05-10|

---

EP2635582A1|2013-09-11|

---

EP2635595A2|2013-09-11|

---

KR101939553B1|2019-01-17|

---

US9951373B2|2018-04-24|

---

JP6752839B2|2020-09-09|

---

CA3081115A1|2012-05-10|

---

US9840730B2|2017-12-12|

---

CN103443121A|2013-12-11|

---

US10774364B2|2020-09-15|

---

AU2016213854B2|2018-01-04|

---

EP2635595B1|2019-01-09|

---

SG10201607774RA|2016-11-29|

---

US20140227759A1|2014-08-14|

---

SG189496A1|2013-05-31|

---

SG190104A1|2013-06-28|

---

US20120117667A1|2012-05-10|

---

JP2017176182A|2017-10-05|

---

CA2817102C|2020-07-28|

---

IL288070D0|2022-01-01|

---

WO2012061530A8|2013-06-06|

---

IL225867A|2018-07-31|

---

CN103370319B|2016-08-24|

---

ES2723773T3|2019-09-02|

---

AU2016213854A1|2016-09-01|

---

CN106148362A|2016-11-23|

---

KR101538624B1|2015-07-22|

---

DK2635582T3|2016-03-14|

---

JP6155424B2|2017-07-05|

---

JP6374420B2|2018-08-15|

---

CA2815227C|2019-03-26|

---

KR20130099997A|2013-09-06|

---

JP2014503485A|2014-02-13|

---

EP3498709A1|2019-06-19|

---

CN103443121B|2016-04-20|

---

US20120174242A1|2012-07-05|

---

IL225867D0|2013-07-31|

---

JP5889910B2|2016-03-22|

---

US20200399676A1|2020-12-24|

---

CN106148362B|2021-04-30|

---

JP2016145219A|2016-08-12|

---

JP2016144454A|2016-08-12|

---

US8809529B2|2014-08-19|

---

JP6574721B2|2019-09-11|

---

US8669103B2|2014-03-11|

---

AU2011323418A1|2013-05-30|

---

PL2635582T3|2016-08-31|

---

EP2635582B1|2016-01-27|

---

JP2014500011A|2014-01-09|

---

IL258790D0|2018-06-28|

---

US20150064731A1|2015-03-05|

---

US20140223590A1|2014-08-07|

---

US20160002703A1|2016-01-07|

---

US20180327810A1|2018-11-15|

---

PL2635595T4|2019-04-30|

---

DK2635595T3|2019-03-04|

---

SG10202103336SA|2021-04-29|

---

IL274316A|2021-12-01|

---

AU2011323419A1|2013-05-30|

---

BR112013010487A2|2016-11-22|

---

EP3498710A1|2019-06-19|

---

PL2635595T3|2019-04-30|

---

CA2817102A1|2012-05-10|

---

JP2018127459A|2018-08-16|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DE3477549D1|1983-08-17|1989-05-11|Allied Signal Inc|Gas generator and method of generating gas|

---

JPH0515398A|1991-07-15|1993-01-26|Nippon Oil & Fats Co Ltd|Quantification of oxidase enzyme|

---

US5368484A|1992-05-22|1994-11-29|Atari Games Corp.|Vehicle simulator with realistic operating feedback|

---

AT391769T|1994-01-03|2008-04-15|Promega Corp|MUTATED LUCIFERASES|

---

US6387675B1|1994-01-03|2002-05-14|Promega Corporation|Mutant luciferases|

---

GB9501170D0|1994-03-23|1995-03-08|Secr Defence|Luciferases|

---

JP3648763B2|1994-08-23|2005-05-18|日本油脂株式会社|Cypridina luciferin derivative and sugar hydrolase determination method|

---

GB9417593D0|1994-09-01|1994-10-19|Secr Defence|Luciferase labelling method|

---

US5670356A|1994-12-12|1997-09-23|Promega Corporation|Modified luciferase|

---

EP0804587B1|1995-01-20|2004-08-18|The Secretary of State for Defence|Mutant luciferases|

---

JPH08294397A|1995-04-27|1996-11-12|Nippon Oil & Fats Co Ltd|Measurement of immunologically active substance|

---

US5998204A|1997-03-14|1999-12-07|The Regents Of The University Of California|Fluorescent protein sensors for detection of analytes|

---

GB9707486D0|1997-04-11|1997-05-28|Secr Defence|Enzyme assays|

---

CA2285571C|1997-04-16|2008-12-02|Juridical Foundation The Chemo-Sero-Therapeutic Research Institute|Immunomodulatory molecules and process for producing the same|

---

US6602677B1|1997-09-19|2003-08-05|Promega Corporation|Thermostable luciferases and methods of production|

---

AU754312C|1997-09-19|2005-11-10|Promega Corporation|Thermostable luciferases and methods of production|

---

GB9823468D0|1998-10-28|1998-12-23|Secr Defence|Novel enzyme|

---

JP3694181B2|1999-01-05|2005-09-14|キッコーマン株式会社|Mutant luciferase, mutant luciferase gene, novel recombinant DNA and method for producing mutant luciferase|

---

CN100516223C|1999-10-26|2009-07-22|3M创新有限公司|Novel enzyme|

---

GB9925161D0|1999-10-26|1999-12-22|Secr Defence|Novel enzyme|

---

US20010046687A1|2000-03-31|2001-11-29|Dicesare Joseph L.|Method for the enhancement of luminescence intensity from a reaction between adenosine triphosphate and a luciferase/luciferin reactant system|

---

JP4613441B2|2000-04-26|2011-01-19|チッソ株式会社|Novel luciferase and photoprotein|

---

DE60142761D1|2000-04-26|2010-09-23|Chisso Corp|Oplophorus luciferase|

---

US7118878B1|2000-06-09|2006-10-10|Promega Corporation|Method for increasing luminescence assay sensitivity|

---

US7879540B1|2000-08-24|2011-02-01|Promega Corporation|Synthetic nucleic acid molecule compositions and methods of preparation|

---

US7268229B2|2001-11-02|2007-09-11|Promega Corporation|Compounds to co-localize luminophores with luminescent proteins|

---

WO2003066611A1|2002-02-01|2003-08-14|Promega Corporation|Bioluminescent protease assay|

---

AT513838T|2002-09-20|2011-07-15|Promega Corp|LUMINESCENT BASED METHODS AND PROBES FOR MEASURING THE CYTOCHROM P450 ACTIVITY|

---

EP1413584B1|2002-10-21|2005-03-02|AXXAM S.r.l.|Photoprotein with improved bioluminescence|

---

CA2508072A1|2002-12-23|2004-07-15|Promega Corporation|Protecting luciferase activity from luciferase enzyme interfering compounds using detergents for the accurate measurement of luciferase activity|

---

KR20050109934A|2003-01-31|2005-11-22|프로메가 코포레이션|Covalent tethering of functional groups to proteins|

---

US7429472B2|2003-01-31|2008-09-30|Promega Corporation|Method of immobilizing a protein or molecule via a mutant dehalogenase that is bound to an immobilized dehalogenase substrate and linked directly or indirectly to the protein or molecule|

---

EP2395358B1|2004-07-30|2017-03-29|Promega Corporation|Covalent tethering of functional groups to proteins|

---

WO2004072299A1|2003-02-12|2004-08-26|Promega Corporation|Methods and kits for dual enzymatic assays whereby light is quenched from luminescent reactions|

---

US20040178545A1|2003-03-14|2004-09-16|Cates Larry E.|System for optically analyzing a molten metal bath|

---

CA2541765A1|2003-10-10|2004-10-01|Promega Corporation|Luciferase biosensor|

---

AT443070T|2004-01-08|2009-10-15|Univ Zuerich|METAL COMPLEXES WITH VITAMIN B12 AS LIGAND|

---

US7553632B2|2004-01-22|2009-06-30|Promega Corporation|Luminogenic and nonluminogenic multiplex assay|

---

US7416854B2|2004-01-22|2008-08-26|Promega Corporation|Luminogenic and nonluminogenic multiplex assay|

---

US7425436B2|2004-07-30|2008-09-16|Promega Corporation|Covalent tethering of functional groups to proteins and substrates therefor|

---

US20070087400A1|2004-07-30|2007-04-19|Aldis Darzins|Covalent tethering of functional groups to proteins and substrates therefor|

---

US7728118B2|2004-09-17|2010-06-01|Promega Corporation|Synthetic nucleic acid molecule compositions and methods of preparation|

---

JP4639904B2|2005-03-30|2011-02-23|チッソ株式会社|Method for enhancing activity of luciferase having fluorescence activity|

---

JP3844082B2|2005-04-08|2006-11-08|キッコーマン株式会社|Thermostable firefly luciferase, thermostable firefly luciferase gene, novel recombinant DNA, and method for producing thermostable firefly luciferase|

---

EP1885875B1|2005-05-31|2019-05-22|Promega Corporation|Luminogenic and fluorogenic compounds and methods to detect molecules or conditions|

---

EP1935986B1|2005-05-31|2014-04-16|Promega Corporation|Luminogenic and fluorogenic compounds and methods to detect molecules or conditions|

---

US7495579B2|2005-06-13|2009-02-24|Sirota J Marcos|Traffic light status remote sensor system|

---

EP1915457A4|2005-08-17|2010-01-27|Yeda Res & Dev|Methods and compositions for determining a level of biologically active serum paraoxonase|

---

JP4999341B2|2005-09-06|2012-08-15|株式会社バイオエネックス|Mutant firefly luciferase, gene, recombinant vector, transformant, and method for producing mutant firefly luciferase|

---

EP2004813B1|2006-04-03|2015-06-03|Promega Corporation|Permuted and nonpermuted luciferase biosensors binding cyclic nucleotides|

---

JP2007306871A|2006-05-19|2007-11-29|Chisso Corp|Method for solubilizing encapulated form and method for refining the same|

---

EP2087107A2|2006-10-30|2009-08-12|Promega Corporation|Mutant hydrolase proteins with enhanced kinetics and functional expression|

---

WO2008086035A2|2007-01-10|2008-07-17|Promega Corporation|Split mutant hydrolase fusion reporter and uses thereof|

---

WO2008118445A1|2007-03-26|2008-10-02|Promega Corporation|Methods to quench light from optical reactions|

---

WO2009061413A2|2007-11-05|2009-05-14|Promega Corporation|Hybrid fusion reporter and uses thereof|

---

US9045730B2|2008-05-19|2015-06-02|Promega Corporation|Luciferase biosensors for cAMP|

---

EP2326953B1|2008-07-22|2018-03-21|Promega Corporation|Adp detection based luminescent phosphotransferase or atp hydrolase assay|

---

TWI375901B|2008-08-05|2012-11-01|Elan Microelectronics Corp|Touch screen and method for positioning coordinate|

---

US8546568B2|2009-02-09|2013-10-01|Jnc Corporation|Coelenterazine analogs and manufacturing method thereof|

---

EP2420573A1|2009-04-17|2012-02-22|National Institute of Advanced Industrial Science And Technology|Stable artificial bioluminescent enzyme having super-high brightness|

---

KR101665352B1|2009-05-01|2016-10-12|프로메가 코포레이션|Synthetic oplophorus luciferases with enhanced light output|

---

WO2011038219A1|2009-09-24|2011-03-31|Promega Corporation|Proteases having improved stability, solubility and activity|

---

JP5605727B2|2010-04-06|2014-10-15|Ｊｎｃ株式会社|Coelenterazine analogs and coelenteramide analogs|

---

EP3508570B1|2010-05-11|2020-07-22|Promega Corporation|Mutant protease biosensors with enhanced detection characteristics|

---

EP2611929B1|2010-09-01|2016-01-13|Promega Corporation|Oxidized glutathione assay|

---

US9284188B2|2010-09-03|2016-03-15|The Regents Of The University Of California|Cytosolic delivery of materials with endosome-disrupting colloids|

---

BR112013010855A2|2010-11-02|2017-06-27|Promega Corp|oplophorus-derived luciferases, novel coelenterazine substrates and methods of use|

---

CN103180324A|2010-11-02|2013-06-26|普罗美加公司|Coelenterazine derivatives and methods of using same|

---

US9273343B2|2011-09-02|2016-03-01|Promega Corporation|Compounds and methods for assaying redox state of metabolically active cells and methods for measuring NAD/NADH|CA2541765A1|2003-10-10|2004-10-01|Promega Corporation|Luciferase biosensor|

---

EP2004813B1|2006-04-03|2015-06-03|Promega Corporation|Permuted and nonpermuted luciferase biosensors binding cyclic nucleotides|

---

US9045730B2|2008-05-19|2015-06-02|Promega Corporation|Luciferase biosensors for cAMP|

---

KR101665352B1|2009-05-01|2016-10-12|프로메가 코포레이션|Synthetic oplophorus luciferases with enhanced light output|

---

EP3508570B1|2010-05-11|2020-07-22|Promega Corporation|Mutant protease biosensors with enhanced detection characteristics|

---

US9290794B2|2010-05-11|2016-03-22|Promega Corporation|Mutant protease biosensors with enhanced detection characteristics|

---

BR112013010855A2|2010-11-02|2017-06-27|Promega Corp|oplophorus-derived luciferases, novel coelenterazine substrates and methods of use|

---

CN103180324A|2010-11-02|2013-06-26|普罗美加公司|Coelenterazine derivatives and methods of using same|

---

US9056885B2|2011-11-21|2015-06-16|Promega Corporation|Carboxy X rhodamine analogs|

---

CN104853767B|2012-12-12|2017-04-05|普洛麦格公司|For capturing the compositionss and method of the cellular targets of bioactivator|

---

BR112015013710A2|2012-12-12|2018-11-21|Promega Corp|assay system, method for detecting binding of a bioactive agent to a cellular target, cell and method for detecting an interaction between a bioactive agent and a cellular target|

---

US10067149B2|2012-12-12|2018-09-04|Promega Corporation|Recognition of cellular target binding by a bioactive agent using intracellular bioluminescence resonance energy transfer|

---

JP6511720B2|2013-02-28|2019-05-15|Jnc株式会社|Codon optimized mutant shrimp luciferase gene and method of using the same|

---

US10168323B2|2013-03-15|2019-01-01|Promega Corporation|Compositions and methods for capture of cellular targets of bioactive agents|

---

EP2970412A4|2013-03-15|2016-07-27|Promega Corp|Activation of bioluminescence by structural complementation|

---

JP6604938B2|2013-03-15|2019-11-13|プロメガコーポレイション|Substrates for covalently anchoring proteins to functional groups or solid surfaces|

---

CN105392892A|2013-03-27|2016-03-09|六品科技公司|Recombinant phage and bacterial detection methods|

---

JP6040846B2|2013-04-08|2016-12-07|Jnc株式会社|Coelenterazine analog|

---

EP3011062A4|2013-06-19|2017-06-14|Sample6 Technologies Inc.|Phage-based bacterial detection assay|

---

CA2918038A1|2013-07-12|2015-01-15|The Children's Hospital Of Philadelphia|Aav vector and assay for anti-aavneutralizing antibodies|

---

CN105555964B|2013-07-18|2020-04-17|洛桑联邦理工学院|Means and methods for performing Bioluminescence Resonance Energy Transferanalysis in biological samples|

---

JP6484987B2|2013-10-21|2019-03-20|Jnc株式会社|Evil luciferase catalytic protein mutant gene and its usage|

---

WO2015067302A1|2013-11-05|2015-05-14|Ecole Polytechnique Federale De Lausanne |Sensor molecules and uses thereof|

---

JP6442825B2|2013-12-26|2018-12-26|Jnc株式会社|Evil luciferase catalytic protein mutant gene and its usage|

---

EP3099691B1|2014-01-29|2019-11-20|Promega Corporation|Pro-substrates for live cell applications|

---

US9790537B2|2014-01-29|2017-10-17|Promega Corporation|Quinone-masked probes as labeling reagents for cell uptake measurements|

---

JP6256118B2|2014-03-11|2018-01-10|Jnc株式会社|Chimeric gene of Evil luciferase catalytic protein and use thereof|

---

JP6265020B2|2014-04-16|2018-01-24|Jnc株式会社|Evil luciferase catalytic protein mutant gene and its usage|

---

JP6641297B2|2014-05-23|2020-02-05|プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ|Compositions and methods for stabilizing luminescent substrate|

---

JP6811173B2|2014-09-11|2021-01-13|プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ|Luciferase sequences that utilize infrared luminescent substrates to produce enhanced luminescence|

---

US20210403886A9|2014-09-12|2021-12-30|Promega Corporation|Internal protein tags|

---

US9969991B2|2014-09-12|2018-05-15|Promega Corporation|Internal protein tags|

---

WO2016098078A2|2014-12-19|2016-06-23|Novartis Ag|Dimerization switches and uses thereof|

---

US10571471B2|2015-02-05|2020-02-25|Promega Corporation|Luciferase-based thermal shift assays|

---

JP6876002B2|2015-06-05|2021-05-26|プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ|Cell-permeable, cell-compatible, and cleaveable linker for covalently anchoring functional elements|

---

CN107922428B|2015-06-25|2021-02-05|普洛麦格公司|Thienopyrrole compounds and their use as inhibitors of oplophorus-derived luciferase|

---

US20170029798A1|2015-07-27|2017-02-02|Cellivery Therapeutics, Inc.|Development of Improved Cell-PermeableParkin Recombinant Protein as a Protein-Based Anti-Neurodegenerative Agent for the Treatment of Parkinson's Disease-Associated Phenotypes by Utilizing BBB-Penetrating Protein Delivery System MITT, Enabled by Advanced Macromolecule Transduction Domain |

---

EP3416968A1|2016-02-15|2018-12-26|Promega Corporation|Coelenterazine analogues|

---

WO2017155036A1|2016-03-11|2017-09-14|国立研究開発法人産業技術総合研究所|Light-emitting enzyme protein|

---

US10634680B2|2016-04-26|2020-04-28|University Of Utah Research Foundation|Target-binding activated split reporter systems for analyte detection and related components and methods|

---

CN105968114B|2016-05-27|2018-11-09|山东大学|A kind of coelenterazine analog and the preparation method and application thereof|

---

WO2018022865A1|2016-07-28|2018-02-01|Promega Corporation|Coelenterazine analogues|

---

US10202584B2|2016-09-01|2019-02-12|The Regents Of The University Of California|Red-shifted luciferase-luciferin pairs for enhanced bioluminescence|

---

US10316070B2|2016-09-09|2019-06-11|Promega Corporation|Dual protected pro-coelenterazine substrates|

---

WO2018085367A1|2016-11-01|2018-05-11|Promega Corporation|Coelenterazine analogues tethered to energy acceptors|

---

EP3548470A1|2016-12-01|2019-10-09|Promega Corporation|5,5-disubstituted luciferins and their use in luciferase-based assays|

---

US10577370B2|2016-12-01|2020-03-03|Promega Corporation|Cell impermeable coelenterazine analogues|

---

EP3562823A1|2016-12-28|2019-11-06|Promega Corporation|Functionalized nanoluc inhibitors|

---

WO2018219953A1|2017-05-30|2018-12-06|Ecole polytechnique fédérale de Lausanne |Sensors, methods and kits for detecting nadph based on resonance energy transfer.|

---

WO2019010094A1|2017-07-06|2019-01-10|Promega Corporation|Serum stable pro-coelenterazine analogues|

---

CN108107209B|2017-09-19|2020-07-24|中国中医科学院医学实验中心|Optimization method for detecting content of secretory reporter protein and biological material used by optimization method|

---

JP2021523111A|2018-05-01|2021-09-02|プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ|Coelenterazine compounds as NanoLuc suicide substrates|

---

JP2021526530A|2018-06-01|2021-10-07|プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ|Inhibitor of bioluminescent complex derived from OPLOPHORUS luciferase|

---

US10962538B2|2018-06-14|2021-03-30|The Trustees Of Columbia University In The City Of New York|Assays using arrestin recruitment and unmodified receptors|

---

EP3829648A1|2018-07-27|2021-06-09|Promega Corporation|Quinone-containing conjugates|

---

JP2021534211A|2018-08-23|2021-12-09|プロメガ コーポレイションPromega Corporation|Coelenterazine analog|

---

SG11202103289SA|2018-10-03|2021-04-29|Promega Corp|Compositions and methods for stabilizing coelenterazine and analogs and derivatives thereof|

---

US11175228B2|2018-11-28|2021-11-16|Promega Corporation|Reactive peptide labeling|

---

EP3891503A2|2018-12-04|2021-10-13|Promega Corporation|Broad spectrum gpcr binding agents|

---

WO2020176755A1|2019-02-27|2020-09-03|University Of Virginia Patent Foundation|Atp-independent bioluminescent reporter variants to improve in vivo imaging|

---

AU2020308448A1|2019-06-24|2022-02-03|Promega Corporation|Modified polyamine polymers for delivery of biomolecules into cells|

---

US20210262941A1|2019-11-27|2021-08-26|Promega Corporation|Multipartite luciferase peptides and polypeptides|

---

WO2021119149A1|2019-12-10|2021-06-17|Promega Corporation|Compositions and methods for bioluminescent detection using multifunctional probes|

---

EP3882632A1|2020-03-18|2021-09-22|Universite De Bordeaux|Novel ion conducting channel fusion subunits and methods of use thereof|

---

EP3904508A1|2020-04-27|2021-11-03|Institut Pasteur|Luciferase linked immunosorbent assay|

---

WO2021237118A2|2020-05-22|2021-11-25|Promega Corporation|Enhancement of kinase target engagement|

---

WO2022047186A1|2020-08-28|2022-03-03|Promega Corporation|Target engagement assay for ras proteins|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-10-22| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-07-21| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2020-12-01| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-02-02| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 02/11/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US40942210P| true| 2010-11-02|2010-11-02|

---

US61/409,422|2010-11-02|

---

PCT/US2011/059017|WO2012061529A1|2010-11-02|2011-11-02|Novel coelenterazine substrates and methods of use|

---