recombinant yeast, process to convert biomass into ethanol and fermentation medium comprising said y

专利摘要:
DETOXICATION OF BIOMASS DERIVED ACETATE VIA METABOLIC CONVERSION IN ETHANOL, ACETONE, ISOPROPANOL OR ETHYL ACETATE. The present invention provides new metabolic pathways to detoxify biomass-derived acetate via metabolic conversion to ethanol, acetone, isopropanol or ethyl acetate. More specifically, the invention provides a recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more metabolic pathways constructed to obtain: (1) conversion of acetate to ethanol; (2) conversion of acetate to acetone; (3) conversion of acetate to isopropanol; or (4) conversion of acetate to ethyl acetate; in which one or more native and / or heterologous enzymes are activated, overloaded or unregulated. The invention also provides new organisms adapted to grow in the presence of inhibitory compounds, including, but not limited to acetate.
公开号:BR112012028290B1
申请号:R112012028290-5
申请日:2011-05-05
公开日:2021-02-02
发明作者:William Ryan Sillers；Hans Van Dijken；Steve Licht；Arthur J. Shaw Iv；Alan Benjamin Gilbert；Aaron Argyros；Allan C. Froehlich；John E. Mcbride；Haowen XU；David A. Hogsett；Vineet B. Rajgarhia
申请人:Lallemand Hungary Liquidity Management Llc.；
IPC主号:

专利说明:

U.S. GOVERNMENT SUPPORT
[001] This invention was partially made with government support under the Department of Energy Grants GO18103 and GO17057. The government has certain rights in the invention. BACKGROUND OF THE INVENTION
[002] Energy conversion, use and access sustain many among the great challenges of our time, including those associated with sustainability, environmental quality, safety and scarcity. New applications of emerging technologies are required to respond to these challenges. Biotechnology, one of the most powerful of emerging technologies, can give rise to important new energy conversion processes. Vegetable biomass and its derivatives are a resource for converting biological energy into useful forms for humanity.
[003] Among the forms of plant biomass, lignocellulosic biomass ("biomass") is particularly well suited for energy applications, due to its large-scale availability, low cost and environmentally favorable production. In particular, many cycles of energy production and use based on cellulosic biomass have almost zero greenhouse gas emissions on a life cycle basis. The main obstacle preventing the production of more widespread energy from biomass raw materials is the general absence of low-cost technology to overcome the recalcitrance of these materials for conversion into useful products. Lignocellulosic biomass contains carbohydrate fractions (for example, cellulose and hemicellulose) that can be converted into ethanol or other products, such as lactic acid and acetic acid. In order to convert these fractions, cellulose and hemicellulose must be essentially converted or hydrolyzed to monosaccharides; it is hydrolysis that has proven to be historically problematic.
[004] Biologically mediated processes are promising for energy conversion. Biomass processing schemes that involve enzymatic or microbial hydrolysis commonly involve four biologically mediated transformations: (1) the production of saccharolytic enzymes (cellulases and hemicellulases); (2) the hydrolysis of carbohydrate components present in the pretreated biomass into sugars; (3) the fermentation of hexose sugars (for example, glucose, mannose and galactose); and (4) the fermentation of pentose sugars (for example, xylose and arabinose). These four transformations occur in a single step in a process configuration called consolidated bioprocessing (CBP), which is distinguished from other less highly integrated configurations, in that it does not involve a dedicated process step for the production of cellulase and / or hemicellulase.
[005] CBP offers the potential for the lowest cost and highest effectiveness in relation to the processes that characterize the production of dedicated cellulase. The benefits result, in part, from capital costs, substrate and other raw materials and avoided utilities associated with cellulase production. In addition, several factors help achieve higher rates of hydrolysis, and consequently reduced reactor volume and capital investment using CBP, including enzyme-microbe synergy and the use of thermophilic organisms and / or complexed cellulase systems. In addition, cellulolytic microorganisms adhering to cellulose are likely to compete successfully for cellulose hydrolysis products such as non-adherent microbes, for example, contaminants, which can increase the stability of industrial processes based on the use of microbial cellulose. Progress in the development of microorganisms that enable CBP is being made through two strategies: construction of naturally occurring cellulolytic microorganisms to improve properties related to the product, such as yield and title; and construction of non-cellulolytic organisms that exhibit high yields and product titles to express a heterologous cellulase and hemicellulase system enabling the use of cellulose and hemicellulose.
[006] The biological conversion of lignocellulosic biomass into ethanol or other chemicals requires a microbial catalyst to be metabolically active during the extension of the conversion. For CBP, another requirement is placed on the microbial catalyst - it must also grow and produce enough cellulolytic enzymes and other hydrolytic enzymes, in addition to metabolic products. A significant challenge for a CBP process occurs when the lignocellulosic biomass contains inhibitory compounds for microbial growth, which is common in natural lignocellulosic raw materials. The most important inhibitory compound has been proven to be acetic acid (acetate), which is released during deacetylation of polymeric substrates. Acetate is particularly inhibitory to CBP processes, as cells must constantly expend energy to export acetate anions, which then diffuse free and back into the cell as acetic acid. These phenomena, combined with the typically low sugar release and energy availability during fermentation, limit the cellular energy that can be directed towards cell mass generation and enzyme production, which further decreases the sugar release.
[007] The removal of acetate before fermentation would significantly improve CBP dynamics; however, chemical and physical removal systems are typically very expensive or impractical for industrial applications. Thus, there is a need for an alternate acetate removal system for CBP that does not suffer from the same problems associated with these chemical and physical removal systems. As a new alternative, this invention describes the metabolic conversion of acetate to a less inhibitory compound, such as an uncharged solvent, including but not limited to, acetone, isopropanol, ethyl acetate or ethanol. Such a conversion would negate the more inhibitory effects of acetate, while also resulting in several process benefits described below. This invention also describes the adaptation of CBP organisms for growth in the presence of inhibitory compounds found in the processing of biomass, such as acetate. BRIEF SUMMARY OF THE INVENTION
[008] The invention is, in general, directed to the reduction or removal of acetate from biomass processing, such as CBP processing of lignocellulosic biomass. The invention is also, in general, directed to the adaptation of CBP organisms for growth in the presence of inhibitory compounds, including, but not limited to, acetate.
[009] One aspect of the invention relates to a recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more metabolic pathways engineered to convert acetate into ethanol, wherein said one or more native enzymes and / or heterologous are activated, overloaded or unregulated. In certain embodiments, acetate is produced as a by-product of biomass processing. In certain embodiments, the recombinant microorganism produces ethanol. In some embodiments, the recombinant microorganism produces an ethanol yield selected from: (a) at least about 1% more ethanol compared to that produced by a microorganism without activation, over-regulation or under-regulation of one or more more native and / or heterologous enzymes; (b) at least about 2% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (c) at least about 3% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (d) at least about 4% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (e) at least about 5% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (f) at least about 6% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (g) at least about 7% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (h) at least about 8% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (i) at least about 9% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (j) at least about 10% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (k) at least about 11% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (l) at least about 12% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (m) at least about 15% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (n) at least about 20% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (o) at least about 30% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (p) at least about 40% more ethanol than what is produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; or (q) at least about 50% more ethanol than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes.
[0010] In particular aspects, the engineered metabolic pathways comprise the steps of: (a) converting acetate to acetyl-CoA and (b) converting acetyl-CoA to ethanol. In certain embodiments, acetate is converted to acetyl-CoA via an acetyl-CoA transferase (ACS). In other embodiments, acetyl-CoA transferase (ACS) is encoded by an ACS1 polynucleotide. In some embodiments, acetate is converted to acetyl-P via an acetate kinase, and acetyl-P is converted to acetyl-CoA via a phosphotransacetylase. In other modalities, acetate kinase and phosphotransacetylase are from one or more of an Escherichia, Thermoanaerobacter, Clostridia or Bacillus species.
[0011] In some embodiments, acetyl-CoA is converted to acetaldehyde through an acetaldehyde dehydrogenase, and acetaldehyde is converted to ethanol through an alcohol dehydrogenase. In other modalities, acetaldehyde dehydrogenase comes from C. phytofermentans. In some embodiments, acetyl-CoA is converted to ethanol using a bifunctional acetaldehyde / alcohol dehydrogenase. In other modalities, bifunctional acetaldehyde / alcohol dehydrogenase is from E. coli, C. acetobutilicum, T. saccharolyticum, C. thermocellum or C. phytofermentans. In some modalities, bifunctional acetaldehyde / alcohol dehydrogenase is from E. coli, T. saccharolyticum, C. phytofermentans, Chlamydomonas reinhardtii, Piromyces SP E2 or Bifidobacterium adolescentis. In certain embodiments, bifunctional acetaldehyde / alcohol dehydrogenase is selected from SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 62 , SEQ ID NO: 64 or SEQ ID NO: 66.
[0012] In particular aspects, one or more unregulated native enzymes are encoded by a gpd1 polynucleotide, a gpd2 polynucleotide or either a gpd1 polynucleotide or a gpd2 polynucleotide.
[0013] In certain embodiments, the recombinant microorganism that converts acetate to ethanol is selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia pastoris, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utliis Arxula adeninivorans, Pichia stipitis, Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe, Candida albicans and Schwanniomyces occidentalis. In another embodiment, the recombinant microorganism is Saccharomyces cerevisiae.
[0014] Another aspect of the invention relates to a recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more metabolic pathways engineered to convert acetate to acetone, wherein said one or more native enzymes and / or heterologous are activated, over-regulated or under-regulated. In certain embodiments, acetate is produced as a by-product of biomass processing. In certain embodiments, the recombinant microorganism produces acetone.
[0015] In other embodiments, the recombinant microorganism produces an acetone yield selected from (a) at least about 0.05 times more acetone compared to that produced by a microorganism without activation, overloading or lack of regulation of one or more native and / or heterologous enzymes; (b) at least about 0.1 times more acetone than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (c) at least about 0.5 times more acetone than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (d) at least about 1.0 times more acetone than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; (e) at least about 2.0 times more acetone than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes; or (f) at least about 5.0 times more acetone than that produced by a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes.
[0016] In particular aspects, the engineered metabolic pathways comprise the steps of: (a) conversion of acetate to acetyl-CoA; (b) conversion of acetyl-CoA to acetoacetyl-CoA; (c) conversion of acetoacetyl-CoA to acetoacetate; and (d) conversion of acetoacetate to acetone. In some embodiments, the acetate is converted to acetyl-CoA via an acetyl-CoA synthetase. In other embodiments, acetyl-CoA synthetase is encoded by a polynucleotide selected from the group consisting of a yeast ACS1 polynucleotide and a yeast ACS2 polynucleotide. In certain embodiments, the yeast ACS1 polynucleotide is from Saccharomyces cerevisiae or Saccharomyces kluyveri. In certain embodiments, the yeast ACS2 polynucleotide is from Saccharomyces cerevisiae or Saccharomyces kluyveri. In some embodiments, the acetate is converted to acetyl-CoA via a CoA transferase.
[0017] In some embodiments, acetate is converted to acetyl-P via an acetate kinase, and acetyl-P is converted to acetyl-CoA via a phosphotransacetylase. In other embodiments, acetate kinase and phosphotransacetylase are from T. saccharolyticum. In some embodiments, acetate kinase is from T. saccharolyticum DSM 8691 (GenBank Access No ACA51668) and phosphotransacetylase is from T. saccharolyticum DSM 8691 (GenBank Access No ACA51669).
[0018] In some embodiments, acetyl-CoA is converted to acetoacetyl-CoA via a thiolase. In some embodiments, acetoacetyl-CoA is converted to acetoacetate via a CoA transferase. In some embodiments, the acetoacetate is converted to acetone via an acetoacetate decarboxylase. In other embodiments, thiolase, CoA transferase and acetoacetate decarboxylase are from C. acetobutilicum. In certain embodiments, the thiolase is from C. acetobutilicum or T. thermosaccharolyticum. In certain embodiments, the thiolase is selected from Thermosipho melanesiensis DSM 12029 (Access GenBank No YP_001306374), Kosmotoga olearia DSM 21960 (Access GenBank No YP_002940320) or Thermoanaerobacterium thermosaccharolyticum DSM 571 (Access GenBank No YP_49). In certain embodiments, CoA transferase is from a bacterial source. In other modalities, the bacterial source is selected from the group consisting of Thermoanaerobacter tengcongensis, Thermoanaerbacterium thermosaccharolyticum, Thermosipho africanus and Paenibacillus macerans. In certain modalities, CoA transferase is selected from Thermosipho melanesiensis DSM 12029 (GenBank Access No YP_001306376), Kosmotoga olearia DSM 21960 (GenBank Access No YP_002940319), Thermosipho melanesiensis DSM 12029 (GenBank Access Y60_Year_Year_Masia_Yoga_633075) GenBank access No YP_002940318) or combinations thereof. In certain embodiments, acetoacetate decarboxylase is from a bacterial source. In other modalities, the bacterial source is selected from the group consisting of C. acetobutilicum, Paenibacillus macerans, Acidothermus cellulolyticus, Bacillus amyloliquefaciens and Rubrobacter xylanophilus. In certain embodiments, Bacillus amyloliquefaciens is Bacillus amyloliquefaciens FZB42 BGSC 10A6 (GenBank access No YP_001422565).
[0019] In certain embodiments, the recombinant microorganism that converts acetate to acetone is Escherichia coli. In certain embodiments, the recombinant microorganism is a thermophilic or mesophilic bacterium. In other modalities, the thermophilic or mesophilic bacterium is a species of the genera Thermoanaerobacterium, Thermoanaerobacter, Clostridium, Geobacillus, Saccharococcus, Paenibacillus, Bacillus, Caldicellulosiruptor, Anaerocellum or Anoxibacillus. In other embodiments, the recombinant microorganism is selected bacteria from the group consisting of: Thermoanaerobacterium thermosulfurigenes, aotearoense Thermoanaerobacterium, Thermoanaerobacterium polysaccharolyticum, Thermoanaerobacterium zeae, Thermoanaerobacterium xylanolyticum, Thermoanaerobacterium saccharolyticum, Thermoanaerobium brockii, Thermoanaerobacterium thermosaccharolyticum, thermohydrosulfuricus Thermoanaerobacter, Thermoanaerobacter ethanolicus , Thermoanaerobacter Brocki Clostridium thermocellum, Clostridium cellulolyticum, Clostridium phytofermentans, Clostridium straminosolvens, Geobacillus thermoglucosidasius, stearothermophilus, Geobacillus, Saccharococcus caldoxilosilyticus, Saccharoccus thermophilus campinasensis Paenibacillus, flavothermus Bacillus kamchatkensis Anoxibacillus, gonensis Anoxibacillus, acetigenus Caldicellulosiruptor, saccharolyticus Caldicellulosiruptor, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor owensensis, Cal dicellulosiruptor lactoaceticus and Anaerocellum thermophilum. In other modalities, the microorganism is selected from the group consisting of Clostridium thermocellum and Thermoanaerobacterium saccharolyticum.
[0020] In other modalities, the recombinant microorganism is eukaryotic. In certain embodiments, the recombinant microorganism is a yeast selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia pastoris, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utliis, Arxula Pichia adeniniv, Arxula adichiniv Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe, Candida albicans and Schwanniomyces occidentalis. In other embodiments, the recombinant microorganism is Saccharomyces cerevisiae.
[0021] Another aspect of the invention relates to a recombinant microorganism comprising one or more native and / or heterologous enzymes that work in one or more metabolic pathways engineered to convert acetate to isopropanol, wherein said one or more native enzymes and / or heterologous are activated, over-regulated or under-regulated. In certain embodiments, acetate is produced as a by-product of biomass processing. In certain embodiments, the recombinant microorganism produces isopropanol.
[0022] In certain aspects, the engineered metabolic pathways comprise the steps of: (a) conversion of acetate to acetyl-CoA; (b) conversion of acetyl-CoA to acetoacetyl-CoA; (c) conversion of acetoacetyl-CoA to acetoacetate; (d) conversion of acetoacetate to acetone; and (e) converting acetone to isopropanol.
[0023] In some embodiments, the acetate is converted to acetyl-CoA through an acetyl-CoA synthetase. In other embodiments, acetyl-CoA synthetase is encoded by a polynucleotide selected from the group consisting of a yeast ACS1 polynucleotide and a yeast ACS2 polynucleotide.
[0024] In some embodiments, acetyl-CoA is converted to acetoacetyl-CoA via a thiolase.
[0025] In some embodiments, acetoacetyl-CoA is converted to acetoacetate via a CoA transferase. In other embodiments, CoA transferase is from a bacterial source. In certain embodiments, the bacterial source is selected from the group consisting of Thermoanaerobacter tengcongensis, Thermoanaerbacterium thermosaccharolyticum, Thermosipho africanus and Paenibacillus macerans.
[0026] In some embodiments, the acetoacetate is converted to acetone through an acetoacetate decarboxylase. In other embodiments, acetoacetate decarboxylase is from a bacterial source. In certain embodiments, the bacterial source is selected from the group consisting of C. acetobutilicum, Paenibacillus macerans, Acidothermus cellulolyticus, Bacillus amyloliquefaciens and Rubrobacter xylanophilus.
[0027] In some embodiments, acetone is converted to isopropanol through an alcohol dehydrogenase.
[0028] In certain embodiments, the recombinant microorganism that converts acetate to isopropanol is selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia pastoris, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodoisma, Candida Arxula adeninivorans, Pichia stipitis, Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe, Candida albicans and Schwanniomyces occidentalis. In other embodiments, the recombinant microorganism is Saccharomyces cerevisiae.
[0029] In certain embodiments, the recombinant microorganism that converts acetate to isopropanol is selected from a thermophilic or mesophilic bacterium. In some modalities, the thermophilic or mesophilic bacterium is a species of the genera Thermoanaerobacterium, Thermoanaerobacter, Clostridium, Geobacillus, Saccharococcus, Paenibacillus, Bacillus, Caldicellulosiruptor, Anaerocellum or Anoxibacillus. In some embodiments, the recombinant microorganism is selected bacteria from the group consisting of: Thermoanaerobacterium thermosulfurigenes, Thermoanaerobacterium aotearoense, Thermoanaerobacterium polysaccharolyticum, Thermoanaerobacterium zeae, Thermoanaerobacterium xylanolyticum, Thermoanaerobacterium saccharolyticum, Thermoanaerobium brockii, Thermoanaerobacterium thermosaccharolyticum, thermohydrosulfuricus Thermoanaerobacter, Thermoanaerobacter ethanolicus , Thermoanaerobacter Brocki Clostridium thermocellum, Clostridium cellulolyticum, Clostridium phytofermentans, Clostridium straminosolvens, Geobacillus thermoglucosidasius, stearothermophilus, Geobacillus, Saccharococcus caldoxilosilyticus, Saccharoccus thermophilus campinasensis Paenibacillus, flavothermus Bacillus kamchatkensis Anoxibacillus, gonensis Anoxibacillus, acetigenus Caldicellulosiruptor, saccharolyticus Caldicellulosiruptor, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor owensensis, Ca ldicellulosiruptor lactoaceticus and Anaerocellum thermophilum. In certain embodiments, the recombinant microorganism is Thermoanaerobacterium saccharolyticum.
[0030] In other respects, the engineered metabolic pathways for converting acetate to isopropanol comprise the steps of: (a) converting acetate to acetyl-P and acetyl-P to acetyl-CoA; (b) conversion of acetyl-CoA to acetoacetyl-CoA; (c) conversion of acetoacetyl-CoA to acetoacetate; (d) conversion of acetoacetate to acetone; and (e) converting acetone to isopropanol. In some respects, one or more native enzymes that are not regulated in the recombinant microorganism that produces isopropanol are selected from phosphotransacetylase, acetate kinase or both.
[0031] In some embodiments, the acetate is converted to acetyl-P through an acetate kinase; and acetyl-P is converted to acetyl-CoA via a phosphotransacetylase. In certain embodiments, acetate kinase and phosphotransacetylase are from T. saccharolyticum. In certain embodiments, acetate kinase is from T. saccharolyticum DSM 8691 (GenBank Access No ACA51668) and phosphotransacetylase is from T. saccharolyticum DSM 8691 (GenBank Access No ACA51669).
[0032] In some embodiments, acetyl-CoA is converted to acetoacetyl-CoA via a thiolase. In certain embodiments, the thiolase is selected from Thermosipho melanesiensis DSM 12029 (Access GenBank No YP_001306374), Kosmotoga olearia DSM 21960 (Access GenBank No YP_002940320) or Thermoanaerobacterium thermosaccharolyticum DSM 571 (Access GenBank No YP_49).
[0033] In some embodiments, acetoacetyl-CoA is converted to acetoacetate via a CoA transferase. In certain embodiments, CoA transferase is from a bacterial source. In some embodiments, CoA transferase is selected from Thermosipho melanesiensis DSM 12029 (GenBank Access No YP_001306376), Kosmotoga olearia DSM 21960 (GenBank Access No YP_002940319), Thermosipho melanesiensis DSM 12029 (GenBank Access Y60_Year_960975963 GenBank access No YP_002940318) or combinations thereof.
[0034] In some embodiments, the acetoacetate is converted to acetone through an acetoacetate decarboxylase. In certain embodiments, acetoacetate decarboxylase is from a bacterial source. In some embodiments, acetoacetate decarboxylase is Bacillus amyloliquefaciens FZB42 BGSC 10A6 (GenBank access No YP_001422565).
[0035] In some embodiments, acetone is converted to isopropanol through an alcohol dehydrogenase. In certain embodiments, alcohol dehydrogenase is a secondary alcohol dehydrogenase (adhB) from T. ethanolicus.
[0036] Another aspect of the invention relates to a recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more metabolic pathways engineered to convert acetate to ethyl acetate, wherein said one or more native and / or heterologous enzymes are activated, overloaded or unregulated. In certain embodiments, acetate is produced as a by-product of biomass processing. In certain embodiments, the recombinant microorganism produces ethyl acetate.
[0037] In certain aspects, the engineered metabolic pathways comprise the steps of: (a) converting acetate to acetyl-CoA and (b) converting acetyl-CoA and ethanol to ethyl acetate. In some embodiments, the acetate is converted to acetyl-CoA via an acetyl-CoA synthetase. In other embodiments, acetyl-CoA synthetase is encoded by a polynucleotide selected from the group consisting of a yeast ACS1 polynucleotide and a yeast ACS2 polynucleotide.
[0038] In some embodiments, acetate is converted to acetyl-P via an acetate kinase, and acetyl-P is converted to acetyl-CoA via a phosphotransacetylase.
[0039] In some embodiments, acetyl-CoA and ethanol are converted to ethyl acetate through an alcohol acetyltransferase. In other embodiments, alcohol acetyltransferase is encoded by a yeast ATF1 polynucleotide.
[0040] In some embodiments, the recombinant microorganism that converts acetate to ethyl acetate is a thermophilic or mesophilic bacterium. In other modalities, the thermophilic or mesophilic bacterium is a species of the genera Thermoanaerobacterium, Thermoanaerobacter, Clostridium, Geobacillus, Saccharococcus, Paenibacillus, Bacillus, Caldicellulosiruptor, Anaerocellum or Anoxibacillus. In certain embodiments, the microorganism is one selected bacteria from the group consisting of: Thermoanaerobacterium thermosulfurigenes, Thermoanaerobacterium aotearoense, Thermoanaerobacterium polysaccharolyticum, Thermoanaerobacterium zeae, Thermoanaerobacterium xylanolyticum, Thermoanaerobacterium saccharolyticum, Thermoanaerobium brockii, Thermoanaerobacterium thermosaccharolyticum, thermohydrosulfuricus Thermoanaerobacter, Thermoanaerobacter ethanolicus, Thermoanaerobacter Brocki Clostridium thermocellum, Clostridium cellulolyticum, Clostridium phytofermentans, Clostridium straminosolvens, Geobacillus thermoglucosidasius, stearothermophilus, Geobacillus, Saccharococcus caldoxilosilyticus, Saccharoccus thermophilus campinasensis Paenibacillus, flavothermus Bacillus kamchatkensis Anoxibacillus, gonensis Anoxibacillus, acetigenus Caldicellulosiruptor, saccharolyticus Caldicellulosiruptor, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor owensensis , Caldicellulosiru ptor lactoaceticus and Anaerocellum thermophilum. In particular aspects, the recombinant microorganism is selected from the group consisting of Clostridium thermocellum and Thermoanaerobacterium saccharolyticum.
[0041] In other modalities, the recombinant microorganism is eukaryotic. In certain embodiments, the recombinant microorganism is a yeast selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia pastoris, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utliis, Arxula Pichia adeniniv, Arxula adichiniv Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe, Candida albicans and Schwanniomyces occidentalis. In other embodiments, the recombinant microorganism is Saccharomyces cerevisiae.
[0042] In other aspects of the invention, one or more unregulated native enzymes of the recombinant microorganisms of the invention are encoded by a gpd1 polynucleotide, a gpd2 polynucleotide or both a gpd1 polynucleotide and a gpd2 polynucleotide. In certain aspects, the recombinant microorganisms of the invention further comprise a native and / or heterologous gpd1 polynucleotide operably linked to a native gpd2 polynucleotide promoter or a native and / or heterologous gpd2 polynucleotide operably linked to a native gpd1 polynucleotide promoter.
[0043] In further aspects of the invention, the recombinant microorganisms of the invention further comprise a mutation in a hydrogenase. In some embodiments, the hydrogenase is an hfs hydrogenase from T. saccharolyticum. In certain embodiments, the mutation in an hfs hydrogenase from T. saccharolyticum is selected from: (a) a deletion of an adenine at position 2219 in hfsA (or 1545) from GenBank Access No GQ354412; (b) a deletion of an adenine at position 2954 in hfsB (or 1546) from GenBank Access No GQ354412; (c) a deletion of an adenine at position 2736 in hfsB (or 1546) from GenBank Access No GQ354412; (d) a deletion of an adenine at position 4272 in hfsC (or 1547) from GenBank Access No GQ354412; (e) a deletion of a guanine at position 5386 in hfsD (or 1548) from GenBank Access No GQ354412; (f) a deletion of a guanine at position 5980 in hfsD (or 1548) from GenBank Access No GQ354412; (g) a deletion of an adenine at position 5514 in hfsD (or 1548) from GenBank Access No GQ354412; (h) or combinations of one or more between (a) to (g).
[0044] Another aspect of the invention relates to a recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more metabolic pathways engineered to convert acetate into ethanol, wherein said one or more native enzymes and / or heterologous is a bifunctional acetaldehyde / alcohol dehydrogenase. In some modalities, bifunctional acetaldehyde / alcohol dehydrogenase is from E. coli, C. acetobutilicum, T. saccharolyticum, C. thermocellum or C. phytofermentans. In other modalities, bifunctional acetaldehyde / alcohol dehydrogenase is from E. coli, T. saccharolyticum, C. phytofermentans, Chlamydomonas reinhardtii, Piromyces SP E2 or Bifidobacterium adolescentis. In other embodiments, bifunctional acetaldehyde / alcohol dehydrogenase is selected from SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 62 , SEQ ID NO: 64, or SEQ ID NO: 66.
[0045] The invention also relates to a process for converting biomass to ethanol, acetone, isopropanol or ethyl acetate comprising contacting biomass with a recombinant microorganism of the invention. In some respects, biomass comprises lignocellulosic biomass. In some modalities, lignocellulosic biomass is selected from the group consisting of grass, switchgrass, cordgrass, ryegrass, yellow grass, mixed prairie grass, miscanthus, sugar processing residues, sugarcane bagasse, straw sugar cane, agricultural residues, rice straw, rice husks, barley straw, corn cobs, cereal straw, wheat straw, canola straw, oat straw, oat husks, corn fiber, forage, residues from soybean harvest, residues from corn harvest, forest residues, recycled wood pulp fiber, paper sludge, sawdust, hardwood, softwood, agave and combinations thereof. In certain embodiments, biomass is corn paste or corn starch.
[0046] In certain aspects, the process reduces or removes acetate from the consolidated bioprocessing medium (CBP). In some embodiments, the reduction or removal of acetate occurs during fermentation. In certain aspects, the process requires less neutralizing base to maintain pH during fermentation compared to a microorganism without activation, over-regulation or under-regulation of one or more native and / or heterologous enzymes, as described in this report.
[0047] The invention further relates to a fermentation medium comprising one or more recombinant microorganisms of the invention.
[0048] The invention also relates to an engineered metabolic pathway to reduce or remove acetate from the consolidated bioprocessing medium (CBP) using the recombinant microorganisms of the invention.
[0049] In certain respects, the recombinant microorganism comprising one or more native and / or heterologous enzymes that function in one or more of the engineered metabolic pathways described in this report is a strain of yeast that has improved tolerance and robustness for growth in presence of a biomass inhibitor, including but not limited to, acetate and other CBP by-products.
[0050] In some embodiments, the recombinant microorganism is a strain of yeast having a specific growth rate (h-1) in the presence of acetate selected from: a) at least about 0.02, b) at least at least about 0.04, c) at least about 0.06, d) at least about 0.08, e) at least about 0.1, f) at least about 0.12 or g) at least about 0.14. In particular aspects, the recombinant microorganism is a strain of yeast selected from M1360, M1361 or M1362. In some respects, the recombinant microorganism is the strain of yeast M1927. In some respects, the specific growth rate (h-1) is obtained using a medium comprising xylose.
[0051] In some embodiments, the recombinant microorganism is a strain of yeast having an optical density in the presence of acetate selected from: (a) at least about 0.2, (b) at least about 0, 3, (c) at least about 0.4, (d) at least about 0.5 or (e) at least about 0.6. In particular aspects, the recombinant microorganism is the yeast strain M1339. In some respects, optical density is obtained using a medium comprising xylose.
[0052] In some embodiments, the recombinant microorganism is a yeast strain having a theoretical anaerobic biomass yield (%), in pressures of 5%, 7% or 9% of solid equivalents, selected from: a) at least about 10%; b) at least about 20%; c) at least about 30%; d) at least about 40%; e) at least about 50%; f) at least about 60%; g) at least about 70%; h) at least about 80%; i) at least about 90%; or j) at least about 100%. In particular aspects, the recombinant microorganism is selected from the yeast strain M1360, M1443 or M1577.
[0053] In some embodiments, the recombinant microorganism is a yeast strain having a specific growth rate (h-1) in the presence of 5-hydroxymethylfurfural and furfural selected from: a) at least about 0.05 , b) at least about 0.1, c) at least about 0.15 or d) at least about 0.2. In particular aspects, the recombinant microorganism is the strain of yeast M1715 or M1577. In some respects, the specific growth rate (h-1) is obtained using a medium comprising xylose.
[0054] In some embodiments, the recombinant microorganism is a yeast strain having a biomass yield (g / g), in pressures of 13%, 15% or 17% of solid equivalents, selected from: a) at least about 0.02; b) at least about 0.04; c) at least about 0.06; or d) at least about 0.08. In particular aspects, the recombinant microorganism is selected from the yeast strain M1760, M1818 or M1819.
[0055] The invention also relates to yeast strains that have improved tolerance and robustness for growth in the presence of a biomass inhibitor. In some embodiments, the yeast strain adapted for growth in the presence of acetate has a specific growth rate (h-1) in the presence of a biomass inhibitor selected from: a) at least about 0.005, b) at at least about 0.01, c) at least about 0.02, d) at least about 0.04, e) at least about 0.06, f) at least about 0.08, g) at least at least about 0.1, h) at least about 0.12, or i) at least about 0.14. In some embodiments, the biomass inhibitor comprises acetate. In other modalities, the yeast strain is selected from M1339, M1360, M1361 or M1362. In some embodiments, the specific growth rate (h-1) is obtained using a medium comprising xylose.
[0056] In some embodiments, the yeast strain adapted for growth in the presence of a biomass inhibitor has a theoretical biomass yield (%), in pressures of 5%, 7% or 9% of solid equivalents, selected from of: a) at least about 10%; b) at least about 20%; c) at least about 30%; d) at least about 40%; e) at least about 50%; f) at least about 60%; g) at least about 70%; h) at least about 80%; i) at least about 90%; or j) at least about 100%. In some embodiments, the biomass inhibitor comprises acetate. In other modalities, the yeast strain is selected from M1360, M1443 or M1577.
[0057] In some embodiments, the yeast strain adapted for growth in the presence of a biomass inhibitor has a specific growth rate (h-1) selected from: a) at least about 0.05, b) at least about 0.1, c) at least about 0.15 or d) at least about 0.2. In some embodiments, the biomass inhibitor comprises acetate. In other modalities, the yeast strain is selected from M1715 or M1577. In some embodiments, the specific growth rate (h-1) is obtained using a medium comprising xylose.
[0058] In some embodiments, the yeast strain adapted for growth in the presence of a biomass inhibitor has a biomass yield (g / g), in pressures of 13%, 15%, or 17% of solid equivalents, selected from: a) at least about 0.02; b) at least about 0.04; c) at least about 0.06; or d) at least about 0.08. In some embodiments, the biomass inhibitor comprises acetate. In other embodiments, the yeast strain according to claim 93, wherein said yeast strain is selected from M1760, M1818 or M1819.
[0059] In some embodiments, the yeast strain adapted for growth in the presence of a biomass inhibitor produces an ethanol yield selected from: (a) at least about 1% more ethanol compared to that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (b) at least about 5% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (c) at least about 10% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (d) at least about 20% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (e) at least about 30% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (f) at least about 40% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (g) at least about 50% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (h) at least about 60% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (i) at least about 70% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (j) at least about 80% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (k) at least about 90% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor; (l) at least about 95% more ethanol than that produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor. In some embodiments, the yeast strain is selected from M1927 or M2108. In other modalities, the yeast strain is M2108.
[0060] In some embodiments, the yeast strain adapted for growth in the presence of a biomass inhibitor, in a simultaneous saccharification and fermentation (SSF) carried out at 38 ° C, produces an increased ethanol yield compared to an ethanol yield produced by a microorganism that has not been adapted for growth in the presence of the biomass inhibitor. In certain embodiments, the increased ethanol yield is selected from: (a) at least about 1%; (b) at least about 5%; (c) at least about 10%; (d) at least about 20%; (e) at least about 30%; (f) at least about 40%; (g) at least about 50%; (h) at least about 60%; (i) at least about 70%; (j) at least about 80%; (k) at least about 90%; (l) at least about 95%.
[0061] In certain aspects, the acetate present in the biomass inhibitor is an amount selected from a) at least about 0.1 g / L; b) at least about 1 g / L; c) at least about 2 g / L; d) at least about 3 g / L; e) at least about 4 g / L; f) at least about 5 g / L; g) at least about 6 g / L; h) at least about 7 g / L; or i) at least about 8 g / L. In other respects, the acetate present in the biomass inhibitor is an amount selected from a) at least about 0.01% (w / v); b) at least about 0.1% (w / v); c) at least about 0.2% (w / v); d) at least about 0.3% (w / v); e) at least about 0.4% (w / v); f) at least about 0.5% (w / v); g) at least about 0.6% (w / v); h) at least about 0.7% (w / v); or i) at least about 0.8% (w / v).
[0062] The invention also relates to methods for producing yeast strains adapted for growth in the presence of a biomass inhibitor. In some embodiments, the method of producing a yeast strain of the invention adapted for growth in the presence of a biomass inhibitor, comprises continuously incubating a yeast strain in the presence of the biomass inhibitor. In other embodiments, the biomass inhibitor comprises acetate.
[0063] The invention also relates to a yeast strain adapted for growth in the presence of a biomass inhibitor produced by a process. In some embodiments, a yeast strain of the invention adapted for growth in the presence of a biomass inhibitor is produced by a process comprising continuously incubating a yeast strain in the presence of the biomass inhibitor. In other embodiments, the biomass inhibitor comprises acetate.
[0064] Another aspect of the invention relates to a method for generating a recombinant yeast host cell comprising at least one gene of interest, wherein said method comprises: a) generating a nucleotide sequence that is capable of homologous recombination with a yeast host cell and comprising said at least one gene of interest, at least one positive selection marker, and at least one negative selection marker; b) transforming a yeast host cell with said nucleotide sequence to obtain a first population of transformants of said yeast host cell; c) selecting for resistance to said at least one positive selection marker to obtain yeast host cells transformed with said nucleotide sequence; d) transforming the yeast host cells from c) with a second nucleotide sequence capable of removing said at least one positive selection marker and said at least one negative selection marker from the yeast host cell; and e) select for resistance to 5-fluorodeoxyuridine (FUDR) to obtain transformed yeast host cells recombinant with said at least one gene of interest, wherein said negative selection marker comprises the thymidine kinase gene from the Herpes Simples, which creates sensitivity to 5-fluorodeoxyuridine (FUDR). In some aspects, the method further comprises transforming the yeast host cell from c) with a nucleotide sequence that is capable of homologous recombination with said yeast host cell and comprising said at least one gene of interest, a second marker positive selection, and at least one negative selection marker. In some respects, the yeast host cell is S. cerevisiae. BRIEF DESCRIPTION OF THE DRAWINGS / FIGURES
[0065] Figure 1 represents the glycolysis pathway.
[0066] Figure 2 shows a schematic representation of the glycolysis / fermentation pathway.
[0067] Figure 3 presents a schematic representation of the proposed pathways and genetic changes during the absorption of acetate in ethanol.
[0068] Figure 4A shows a schematic representation of the proposed bacterial pathway from acetate to acetone.
[0069] Figure 4B shows a schematic representation of the proposed yeast route from acetate to acetone.
[0070] Figure 5A represents the overall reaction stoichiometry of the proposed bacterial pathway from acetate to acetone.
[0071] Figure 5B represents the vector pMU1299 - pAcet # 3 for the conversion of acetate to acetone in T. saccharolyticum and E. coli.
[0072] Figure 6 is a graphical representation that represents the growth of strains M1254 and M1339 in xylose in the presence of acetate.
[0073] Figure 7 is a graphical representation that represents the specific growth rate of strains M1360, M1361, M1362, M1254 and M1339 in xylose in the presence of acetate, nine other acids and five aldehydes. The acids include lactic, 2-furoic, ferulic, 3,4-dihydroxybenzoic, 3,5-dihydroxybenzoic, gallic, homovanilic, siringic and vanillic acid; aldehydes include furfural, 5-hydroxymethylfurfural (HMF), 3,4-dihydroxybenzaldehyde, syringaldehyde and vanillin.
[0074] Figure 8 is a graphical representation that represents the performance of M1360 strain grown at 40 ° C in Industrial Fermentation Medium (IFM), as measured by the use of glucose (g / L) and ethanol production (g / L ).
[0075] Figure 9 is a graphical representation that represents the theoretical biomass yield (%) of strains M1360, M1443 and M1577 under process conditions in presses of 5%, 7% and 9% of solid equivalents.
[0076] Figure 10 is a graphical representation that represents the specific growth rate of strains M0509, M1577 and M1715 in xylose and xylose in the presence of HMF and furfural inhibitors.
[0077] Figure 11A is a graphical representation that represents the biomass yield (g / g) of strains M1760, M1818 and M1819 in a press test.
[0078] Figure 11B is a graphical representation that represents the ethanol yield (g / L) of strains M1760, M1818 and M1819 in a press test.
[0079] Figure 12 shows a schematic representation of a proposed engineered way to convert acetate to acetone.
[0080] Figure 13 represents the vector pMU22627 for the conversion of acetate to acetone in T. saccharolyticum.
[0081] Figure 14 is a graphical representation that represents the metabolic results of a hemicellulose wash fermentation derived from lignocellulosic material with the M2212 strain of T. saccharolyticum.
[0082] Figure 15 is a graphical representation that represents glucose consumption and ethanol production from a fermentation with the strains M1442 and M2212 of T. saccharolyticum.
[0083] Figure 16 is a graphical representation that represents the consumption of acetate and the production of acetone from a fermentation with the strains M1442 and M2212 of T. saccharolyticum.
[0084] Figure 17 is a graphical representation that represents the pH of a fermentation with strains M1442 and M2212 from T. saccharolyticum.
[0085] Figure 18 presents a schematic representation of a proposed engineered way to convert acetate into isopropanol.
[0086] Figure 19 represents the vector pMU2741 for the conversion of acetate to isopropanol.
[0087] Figure 20A is a graphical representation that represents the metabolic results of a minimal medium fermentation comprising glucose and acetate with strains M2108, M2433 and M2488 from S. cerevisiae.
[0088] Figure 20B is a graphical representation that represents the growth rate (hr-1) of a minimum medium fermentation comprising glucose and acetate with strains M2108, M2433 and M2488 from S. cerevisiae.
[0089] Figure 21A is a graphical representation that represents the ethanol production (g / L) of a fermentation using simultaneous saccharification and fermentation (SSF) with strains M2108 and M2488 from S. cerevisiae.
[0090] Figure 21B is a graphical representation representing the production of glycerol (g / L) and acetate production (g / L) from a fermentation using SSF with strains M2108 and M2488 from S. cerevisiae.
[0091] Figure 22 is a graphical representation representing the ethanol production (g / L) from a fermentation using SSF with the strains M2108, M2433 and M2488 from S. cerevisiae.
[0092] Figure 23A is a graphical representation representing the production of ethanol (g / L) and the use of xylose (g / L) from a wash fermentation with strains M2108, M2433 and M2488 from S. cerevisiae.
[0093] Figure 23B is a graphical representation representing the production of acetate (g / L) and the production of glycerol (g / L) from a wash fermentation with strains M2108, M2433 and M2488 from S. cerevisiae.
[0094] Figure 24A is a graphical representation representing ethanol production (g / L) and increase in yield (%) of a fermentation using SSF with strains M2108, M2433, M2488 and M2556 from S. cerevisiae.
[0095] Figure 24B is a graphical representation representing the production of acetate (g / L) and the production of glycerol (g / L) from a fermentation using SSF with strains M2108, M2433, M2488 and M2556 from S. cerevisiae .
[0096] Figure 25 presents graphs that represent the metabolic results of a fermentation using Verduyn medium with the strains M139, M2668, M2669 and M2670 from S. cerevisiae.
[0097] Figure 26A is a graphical representation representing the ethanol production (g / L) from a fermentation using 25% corn paste solids with the strains M139, M2085, M2158 and M2326 from S. cerevisiae.
[0098] Figure 26B is a graphical representation that represents the use of acetate (g / L) from a fermentation using 25% corn paste solids with strains M139 and M2158 from S. cerevisiae.
[0099] Figure 27 is a graphical representation that represents the metabolic results of a fermentation using corn fiber washes with strains M2108, M2488 and M2556 from S. cerevisiae.
[00100] Figure 28 is a graphical representation that represents the concentrations of xylose, acetate and ethanol (g / L) from the adaptation of the M1927 chemostat in washing liquid from hardwood.
[00101] Figure 29 is a graphical representation that represents the ethanol production (g / L) from a washing liquid fermentation with the S. cerevisiae strains M1818 and M1927.
[00102] Figure 30 is a graphical representation that represents the ethanol production (g / L) from a washing liquid fermentation with S. cerevisiae strains M1927 and M2108.
[00103] Figure 31 is a graphical representation that represents the ethanol production (g / L) from a washing liquid fermentation with strains M1927 and M2108 from S. cerevisiae.
[00104] Figure 32 is a graphical representation that represents the production of ethanol (g / L) and the consumption of sugar (g / L) from a fermentation using SSF with strains M1927 and M2108 from S. cerevisiae.
[00105] Figure 33 is a graphical representation that represents ethanol production (g / L) and increase in yield (%) of a fermentation using SSF with strains M2390 and M2739 from S. cerevisiae.
[00106] Figure 34 is a graphical representation representing the production of glycerol (g / L) and the use of acetic acid (g / L) from a fermentation using SSF with the strains M2390 and M2739 from S. cerevisiae.
[00107] Figure 35 is a schematic representation that illustrates homologous recombination using a thymidine kinase (TDK) counter-selection method. DETAILED DESCRIPTION OF THE INVENTION
[00108] Aspects of the present invention refer to the construction of a microorganism to detoxify biomass-derived acetate by means of metabolic conversion to ethanol, acetone, isopropanol or ethyl acetate. To overcome the inhibitory effects of acetate, acetate can be converted to a less inhibitory compound that is a product of bacterial or yeast fermentation, as described in this report. Less inhibitory compounds, such as ethanol, acetone, isopropanol or ethyl acetate, can be easily recovered from the fermentation medium. The additional advantages of the present invention over existing means for reducing acetate include: • Reduced cost compared to chemical or physical systems for removing acetate; • Reduction of losses in sugar yield (washing) compared to chemical or physical acetate removal systems; • Reduced demand for the addition of base during fermentation; • Reduced global fermentation cost; • Improved pH control; and • Reduced costs, including capital, operation and environment, for the treatment of wastewater and water recycling. Definitions
[00109] The term "heterologous" when used in reference to a polynucleotide, gene, polypeptide or enzyme refers to a polynucleotide, gene, polypeptide or enzyme not normally found in the host organism. "Heterologist" also includes a native coding region, or portion thereof, that is reintroduced into the original organism in a form that is different from the corresponding native gene, for example, not in its natural location in the organism's genome. The polynucleotide or heterologous gene can be introduced into the host organism, for example, by gene transfer. A heterologous gene can include a native coding region that is a portion of a chimeric gene including non-native regulatory regions that is reintroduced into the native host. The foreign genes can comprise native genes inserted into a non-native organism or chimeric genes.
[00110] The term "heterologous polynucleotide" is intended to include a polynucleotide that encodes one or more polypeptides or portions or fragments of polypeptides. A heterologous polynucleotide can be derived from any source, for example, eukaryotes, prokaryotes, viruses or fragments of synthetic polynucleotides.
[00111] The term "promoter" or "substitute promoter" is intended to include a polynucleotide that can transcriptionally control a gene of interest that it does not transcriptionally control in nature. In certain embodiments, the transcriptional control of a substitute promoter results in an increase in the expression of the gene of interest. In certain embodiments, a substitute promoter is placed 5 'to the gene of interest. A substitute promoter can be used to replace the natural promoter, or it can be used in addition to the natural promoter. A substitute promoter may be endogenous with respect to the host cell, in which it is used, or it may be a heterologous polynucleotide sequence introduced into the host cell, for example, exogenous with respect to the host cell, in which it is used.
[00112] The terms "gene (s)" or "polynucleotide" or "polynucleotide sequence (s)" are intended to include nucleic acid molecules, for example, polynucleotides that include an open reading frame encoding a polypeptide, and it can also include non-coding regulatory sequences and introns. In addition, the terms are intended to include one or more genes that map a functional locus. In addition, the terms are intended to include a specific gene for a selected purpose. The gene can be endogenous to the host cell or it can be recombinantly introduced into the host cell, for example, as a plasmid maintained episomally or a plasmid (or fragment thereof) that is stably integrated into the genome. In addition to the plasmid form, a gene, for example, can be in the form of linear DNA. In certain embodiments, the gene or polynucleotide is involved in at least one step in the bioconversion of an acetate to an uncharged solvent, including but not limited to, acetone, isopropanol, ethyl acetate or ethanol. Consequently, the term is intended to include any gene encoding a polypeptide, such as the enzymes acetate kinase (ACK), phosphotransacetylase (PTA), lactate dehydrogenase (LDH), pyruvate formate lyase (PFL), aldehyde dehydrogenase (ADH) and / or alcohol dehydrogenase (ADH), acetyl-CoA transferase (ACS), acetaldehyde dehydrogenase, acetaldehyde / alcohol dehydrogenase, glycerol-3-phosphate dehydrogenase (GPD), acetyl-CoA synthetase, thiolase, CoA transferase, acetoacetate decarboxylase, enzymes D-xylose pathway, such as xylose isomerase and xylulokinase, enzymes in the L-arabinose pathway, such as L-arabinose isomerase and L-ribulose-5-phosphate 4-epimerase. The term gene is also intended to cover all copies of a particular gene, for example, all of the DNA sequences in a cell that encodes a product of the particular gene.
[00113] The term "transcriptional control" is intended to include the ability to modulate gene expression at the level of transcription. In certain embodiments, transcription, and thus the expression of the gene, is modulated by replacing or adding a substitute promoter near the 5 'end of the coding region of a gene of interest, thereby resulting in the expression of the altered gene. In certain embodiments, the transcriptional control of one or more genes is constructed to result in the optimal expression of such genes, for example, in a desired ratio. The term also includes inducible transcriptional control, as recognized in the art.
[00114] The term "expression" is intended to include the expression of a gene at least at the level of mRNA production.
[00115] The term "expression product" is intended to include the resulting product, for example, a polypeptide, from an expressed gene.
[00116] The term "increased expression" is intended to include a change in gene expression at least at the level of increased mRNA production and, preferably, at the level of polypeptide expression. The term "increased production" is intended to include an increase in the amount of a polypeptide expressed, at the level of the enzyme activity of the polypeptide, or a combination thereof, as compared to the native production of, or the enzyme activity of, the polypeptide.
[00117] The terms "activity", "activities", "enzyme activity" and "enzyme activities" are used interchangeably and are intended to include any functional activity normally attributed to a selected polypeptide when produced under favorable conditions. Typically, the activity of a selected polypeptide encompasses the total enzyme activity associated with the produced polypeptide. The polypeptide produced by a host cell and having enzymatic activity may be located in the cell's intracellular space, associated with the cell, secreted in the extracellular medium or a combination thereof. Techniques for determining total activity as compared to secreted activity are described in this report and are known in the art.
[00118] The term "xylanolitic activity" is intended to include the ability to hydrolyze glycosidic bonds in oligopentoses and polipentoses.
[00119] The term "cellulolytic activity" is intended to include the ability to hydrolyze glycosidic bonds in oligohexoses and polyhexoses. Cellulolytic activity can also include the ability to depolymerize or not to branch cellulose and hemicellulose.
[00120] As used in this report, the term "lactate dehydrogenase" or "LDH" is intended to include enzymes capable of converting pyruvate to lactate. It is understood that LDH can also catalyze hydroxybutyrate oxidation. LDH includes those enzymes that correspond to the Enzyme Commission Number 1.1.1.27.
[00121] As used in this report, the term "alcohol dehydrogenase" or "ADH" is intended to include enzymes capable of converting acetaldehyde to an alcohol, such as ethanol. ADH also includes enzymes capable of converting acetone to isopropanol. ADH includes those enzymes that correspond to the Enzyme Commission Number 1.1.1.1.
[00122] As used in this report, the term "phosphotransacetylase" or "PTA" is intended to include enzymes capable of converting acetyl phosphate to acetyl-CoA. PTA includes those enzymes that correspond to the Enzyme Commission Number 2.3.1.8.
[00123] As used in this report, the term "acetate kinase" or "ACK" is intended to include enzymes capable of converting acetate to acetyl phosphate. ACK includes those enzymes that correspond to the Enzyme Commission Number 2.7.2.1.
[00124] As used in this report, the term "pyruvate formiato liase" or "PFL" is intended to include enzymes capable of converting pyruvate to acetyl-CoA and formate. PFL includes those enzymes that correspond to the Enzyme Commission Number 2.3.1.54.
[00125] As used in this report, the term "acetaldehyde dehydrogenase" or "ACDH" is intended to include enzymes capable of converting acetyl-CoA to acetaldehyde. ACDH includes those enzymes that correspond to the Enzyme Commission Number 1.2.1.3.
[00126] As used in this report, the term "acetaldehyde / alcohol dehydrogenase" is intended to include enzymes capable of converting acetyl-CoA into ethanol. Acetaldehyde / alcohol dehydrogenase includes those enzymes that correspond to the Enzyme Commission Numbers 1.2.1.10 and 1.1.1.1.
[00127] As used in this report, the term "glycerol-3-phosphate dehydrogenase" or "GPD" is intended to include enzymes capable of converting dihydroxyacetone phosphate to glycerol-3-phosphate. GPD includes those enzymes that correspond to the Enzyme Commission Number 1.1.1.8.
[00128] As used in this report, the term "acetyl-CoA synthetase" or "ACS" is intended to include enzymes capable of converting acetate to acetyl-CoA. Acetyl-CoA synthetase includes those enzymes that correspond to the Enzyme Commission Number 6.2.1.1.
[00129] As used in this report, the term "thiolase" is intended to include enzymes capable of converting acetyl-CoA to acetoacetyl-CoA. Thiolase includes those enzymes that correspond to the Enzyme Commission Number 2.3.1.9.
[00130] As used in this report, the term "CoA transferase" is intended to include enzymes capable of converting acetate and acetoacetyl-CoA into acetoacetate and acetyl-CoA. CoA transferase includes those enzymes that correspond to the Enzyme Commission Number 2.8.3.8.
[00131] As used in this report, the term "acetoacetate decarboxylase" is intended to include enzymes capable of converting acetoacetate to acetone and carbon dioxide. Acetoacetate decarboxylase includes those enzymes that correspond to the Enzyme Commission Number 4.1.1.4.
[00132] As used in this report, the term "alcohol acetyltransferase" is intended to include enzymes capable of converting acetyl-CoA and ethanol into ethyl acetate. Acetyltransferase alcohol includes those enzymes that correspond to the Enzyme Commission Number 2.3.1.84.
[00133] The term "pyruvate decarboxylase activity" is intended to include the ability of a polypeptide to enzymatically convert pyruvate to acetaldehyde and carbon dioxide (for example, "pyruvate decarboxylase" or "PDC"). Typically, the activity of a selected polypeptide encompasses the total enzyme activity associated with the produced polypeptide, comprising, for example, higher affinity for the enzyme substrate, thermostability, stability at different pHs, or a combination of these attributes. PDC includes those enzymes that correspond to the Enzyme Commission Number 4.1.1.1.
[00134] The term "ethanological" is intended to include the ability of a microorganism to produce ethanol from a carbohydrate as a fermentation product. The term is intended to include, but is not limited to, naturally occurring ethanological organisms, ethanological organisms with naturally occurring or induced mutations, and ethanological organisms that have been genetically modified.
[00135] The terms "ferment" and "fermentation" are intended to include the enzymatic process (for example, cellular or acellular, for example, a purified mixture of lysate or polypeptide) by which ethanol is produced from a carbohydrate, in in particular, as a fermentation product.
[00136] The term "secreted" is intended to include the movement of polypeptides into the periplasmic space or extracellular medium. The term "increased secretion" is intended to include situations, in which a given polypeptide is secreted at an increased level (that is, in excess of the naturally occurring amount of secretion). In certain embodiments, the term "increased secretion" refers to an increase in the secretion of a given polypeptide that is at least about 10% or at least about 100%, 200%, 300%, 400%, 500%, 600 %, 700%, 800%, 900%, 1000% or more, as compared to the naturally occurring level of secretion.
[00137] The term "secretory polypeptide" is intended to include any polypeptide (s), alone or in combination with other polypeptides, that facilitate the transport of another polypeptide from the intracellular space of a cell to the extracellular medium. In certain embodiments, the secretory polypeptide (s) encompass all necessary and sufficient secretory polypeptides to communicate secretory activity to a Gram-negative or Gram-positive host cell or a yeast host cell. Typically, secretory proteins are encoded in a single region or locus that can be isolated from one host cell and transferred to another host cell using genetic engineering. In certain embodiments, the secretory polypeptide (s) are derived from any bacterial cell having secretory activity or any yeast cell having secretory activity. In certain embodiments, the secretory polypeptide (s) are derived from a host cell having Type II secretory activity. In certain embodiments, the host cell is a thermophilic bacterial cell. In certain embodiments, the host cell is a yeast cell.
[00138] The term "derived from" is intended to include the isolation (in whole or in part) of a polynucleotide segment from an indicated source or the purification of a polypeptide from an indicated source. The term is intended to include, for example, direct cloning, PCR amplification or artificial synthesis of or based on a sequence associated with the indicated polynucleotide source.
[00139] The term "thermophilic" means an organism that thrives at a temperature of around 45 ° C or higher.
[00140] The term "mesophilic" means an organism that thrives at a temperature of about 20 to 45 ° C.
[00141] The term "organic acid" is recognized in the art. “Organic acid”, as used in this report, also includes certain organic solvents, such as ethanol. The term "lactic acid" refers to organic acid 2-hydroxypropionic acid in the form of an acid or free salt. The salt form of lactic acid is referred to as "lactate", regardless of the neutralizing agent, that is, calcium carbonate or ammonium hydroxide. The term "acetic acid" refers to organic acid methanecarboxylic acid, also known as ethanoic acid, in the form of an acid or free salt. The salt form of acetic acid is referred to as "acetate".
[00142] Certain embodiments of the present invention provide the "insertion", (for example, the addition, integration, incorporation or introduction) of certain particular polynucleotide genes or sequences within thermophilic or mesophilic microorganisms, such insertion of genes or sequences of particular polynucleotides may include "genetic modification (s)" or "transformation (s)", such that strains resulting from said thermophilic or mesophilic microorganisms can be "genetically modified" or "transformed" . In certain modalities, strains can be of bacterial, fungal or yeast origin.
[00143] Certain embodiments of the present invention provide the "inactivation" or "deletion" of certain particular polynucleotide genes or sequences within thermophilic or mesophilic microorganisms, such "inactivation" or "deletion" of particular polynucleotide genes or sequences cover "genetic modification (s)" or "transformation (s)", such that strains resulting from said thermophilic or mesophilic microorganisms can be "genetically modified" or "transformed". In certain modalities, strains can be of bacterial, fungal or yeast origin.
[00144] The term "CBP organism" is intended to include microorganisms of the invention, for example, microorganisms that have properties suitable for CPF.
[00145] In one aspect of the invention, particular polynucleotide genes or sequences are inserted to activate the activity for which they encode, such as the expression of an enzyme. In certain embodiments, enzymes encoding genes in the metabolic production of ethanol, for example, enzymes that metabolize pentose and / or hexose sugars, can be added to a mesophilic or thermophilic organism. In certain embodiments of the invention, the enzyme can confer the ability to metabolize a pentose sugar and be involved, for example, in the D-xylose pathway and / or L-arabinose pathway. In certain embodiments of the invention, enzymes encoding genes in converting acetate into an uncharged solvent, including but not limited to, acetone, isopropanol, ethyl acetate or ethanol, can be added to a mesophilic or thermophilic organism.
[00146] In one aspect of the invention, particular polynucleotide genes or sequences are partially, substantially or completely suppressed, silenced, inactivated or regulated, in order to inactivate the activity for which they encode, such as the expression of an enzyme. Deletions provide maximum stability because there is no opportunity for a reverse mutation to restore function. Alternatively, genes can be partially, substantially or completely suppressed, silenced, inactivated or regulated by inserting nucleic acid sequences that disrupt the function and / or expression of the gene (for example, P1 transduction or other methods known in the art) . The terms "eliminate", "elimination" and "knockout" are used interchangeably with the terms "deletion", "partial deletion", "substantial deletion" or "complete deletion". In certain modalities, strains of thermophilic or mesophilic microorganisms of interest can be engineered by homologous homologous recombination to knock out the production of organic acids. In other embodiments, RNAi or antisense DNA (asDNA) can be used to silence, inactivate, or partially, substantially or completely regulate a particular gene of interest.
[00147] In certain modalities, the targeted genes for deletion or inactivation, as described in this report, may be endogenous to the native strain of the microorganism, and thus, may be referred to as “native gene (s)” or “endogenous gene (s)”. An organism is in "a native state" if it has not been genetically constructed or otherwise manually manipulated in a way that intentionally alters the organism's genetic and / or phenotypic constitution. For example, wild-type organisms may be in a native state. In other modalities, the targeted gene (s) for deletion or inactivation may be non-native to the organism.
[00148] Similarly, the enzymes of the invention, as described in this report, may be endogenous to the native strain of the microorganism, and thus, may be referred to as "native" or "endogenous".
[00149] The term "overloaded" means increased activity, for example, increased enzyme activity of the enzyme, as compared to activity in a native host organism.
[00150] The term "regulated" means decreased activity, for example, decrease in enzyme activity of the enzyme, as compared to activity in a native host organism.
[00151] The term "activated" means expressed or metabolically functional.
[00152] The term "adapted for growth" means the selection of an organism for growth under conditions, in which the organism does not grow or in which the organism grows slowly or minimally. Thus, an organism that is said to be adapted for growth under the selected condition, grows better than an organism that has not been adapted for growth under the selected conditions. Growth can be measured by any methods known in the art, including, but not limited to, measuring optical density or specific growth rate.
[00153] The term "biomass inhibitors" means the inhibitors present in biomass that inhibit the processing of biomass by organisms, including but not limited to, CBP organisms. Biomass inhibitors include, but are not limited to, acids, including without limitation, acetic, lactic, 2-furoic, 3,4-dihydroxybenzoic, 3,5-dihydroxybenzoic, vanyl, homovanilic, syringic, gallic acids and ferulic; aldehydes, including without limitation, 5-hydroxymethylfurfural, furfural, 3,4-hydroxybenzaldehyde, vanillin, and syringaldehyde. Biomass inhibitors include products removed from pretreated cellulosic material or produced as a result of treatment or processing of cellulosic material, including but not limited to, inhibitors removed from pretreated mixed hardwood or any other pretreated biomass. Biomass
[00154] Biomass can include any type of biomass known in the art or described in this report. The terms "lignocellulosic material", "lignocellulosic substrate" and "cellulosic biomass" mean any type of biomass comprising cellulose, hemicellulose, lignin or combinations thereof, such as but not limited to wood biomass, forage grasses, herbaceous crops of energy, vegetable biomass other than wood, agricultural residues, forest residues, sludge from paper production and / or residual paper sludge, sludge from waste water treatment, municipal solid waste, corn fiber from vegetables from corn ethanol production dry and wet and sugar processing residues. The terms “hemicellulosic”, “hemicellulosic portions” and “hemicellulosic fractions” mean the elements without lignin, without cellulose of the lignocellulosic material, such as, but not limited to, hemicellulose (that is, comprising xyloglucan, xylan, glucuronoxylan, arabinoxylan, arabinoxylan, man , glucomannan, and galactoglucomannan, inter alia), pectins (e.g., homogalacturonans, rhamnogalacturonan I and II, and xylogalacturonan), and proteoglycans (e.g. arabinogalactan-protein, extensin and proline-rich proteins).
[00155] In a non-limiting example, lignocellulosic material may include, but is not limited to, wood biomass, such as recycled wood pulp fiber, sawdust, hardwood, softwood and combinations thereof; grams, such as switchgrass, cordgrass, ryegrass, yellow grass, miscanthus or a combination thereof; sugar processing residues, such as, but not limited to, sugarcane bagasse; agricultural waste, such as, but not limited to rice straw, rice husks, barley straw, corn cobs, cereal straw, wheat straw, canola straw, oat straw, oat husks and corn fiber; fodder, such as, but not limited to, soybean crop residues, corn crop residues; succulent, such as, but not limited to, Agave; and forest residues, such as, but not limited to, recycled wood pulp fiber, sawdust, hardwood (for example, poplar, oak, maple, birch, willow), softwood or any combination thereof. The lignocellulosic material may comprise a kind of fiber; alternatively, lignocellulosic material may comprise a mixture of fibers that originate from different lignocellulosic materials. Other lignocellulosic materials are agricultural residues, such as cereal straw, including wheat straw, barley straw, canola straw and oat straw; corn fiber; fodder, such as corn harvest residues and soy harvest residues; grams, such as switchgrass, yellow grass, cordgrass and miscanthus; or combinations thereof.
[00156] Paper sludge is also a viable raw material for the production of lactate or acetate. Paper sludge is a solid residue that arises from pulp removal and papermaking, and is typically removed from the wastewater process in a primary clarifier. At a final cost of $ 30 / wet ton, the cost of sludge disposal is equal to $ 5 / ton of paper that is produced for sale. The cost of eliminating wet sludge is a significant incentive to convert the material to other uses, such as conversion to ethanol. The processes provided by the present invention are widely applicable. In addition, saccharification and / or fermentation products can be used to produce ethanol or added chemicals of greater value, such as organic acids, aromatics, esters, acetone and intermediate polymers. Acetate
[00157] Acetate is produced from acetyl-CoA in two reaction steps catalyzed by phosphotransacetylase (PTA) and acetate kinase (ACK). The reactions mediated by these enzymes are shown below: PTA reaction: acetyl-CoA + phosphate = CoA + acetyl phosphate (EC 2.3.1.8) ACK reaction: ADP + acetyl phosphate = ATP + acetate (EC 2.7.2.1)
[00158] Both C. thermocellum and C. cellulolyticum manufacture acetate under standard fermentation conditions and have well-noted genes encoding PTA and ACK (see Table 7 of the International Order No PCT / US2009 / 064128, which is incorporated, as a reference, in this report). Consolidated Bioprocessing
[00159] Consolidated bioprocessing (CBP) is a processing strategy for cellulosic biomass that involves consolidating four biologically mediated events in a single process step: enzyme production, hydrolysis, hexoses fermentation and pentose fermentation. The implementation of this strategy requires the development of microorganisms that use cellulose, hemicelluloses, and other biomass components, also producing a product of interest in sufficiently high yields and concentrations. CBP's feasibility is supported by kinetic and bioenergetic analysis. See, van Walsum and Lynd (1998) Biotech. Bioeng. 58: 316. Xylose Metabolism
[00160] Xylose is a 5-carbon monosaccharide that can be metabolized into useful products by a variety of organisms. There are two main pathways of xylose metabolism, each unique in the characteristic enzymes they use. One route is called “Xylose Reductase-Xylitol Dehydrogenase” or via XR-XDH. Xylose reductase (XR) and xylitol dehydrogenase (XDH) are the two main enzymes used in this method of xylose degradation. XR, encoded by the XYL1 gene, is responsible for the reduction of xylose in xylitol and is added by cofactors NADH or NADPH. Xylitol is then oxidized to xylulose by XDH, which is expressed through the XYL2 gene, and carried out exclusively with the NAD + cofactor. Because of the variation in cofactors required in this route and the degree to which they are available for use, an imbalance can result in an overproduction of xylitol by-product and a desirable ineffective ethanol production. The variation in the expression of the XR and XDH enzyme levels was tested in the laboratory in an attempt to optimize the effectiveness of the xylose metabolism pathway.
[00161] The other pathway for xylose metabolism is called the "Xylose Isomerase" (XI) pathway. The XI enzyme is responsible for the direct conversion of xylose to xylulose, and did not proceed through an xylitol intermediate. Both pathways create xylulose, although the enzymes used are different. After the production of xylulose, both XR-XDH and XI pathways proceeded through the enzyme xylulokinase (XK), encoded in the XKS1 gene, to further modify xylulose in xylulose-5-P where it then enters the pentose phosphate pathway for another catabolism.
[00162] Studies on the flow through the pentose phosphate pathway during xylose metabolism revealed that limiting the speed of this step can be beneficial to the effectiveness of fermentation in ethanol. Modifications to this flow that can improve ethanol production include a) reducing phosphoglucose isomerase activity, b) deleting the GND1 gene, and c) deleting the ZWF1 gene (Jeppsson et al., 2002). Since the pentose phosphate pathway produces additional NADPH during metabolism, limiting this step will help to correct the imbalance already evident between cofactors NAD (P) H and NAD + and will reduce the xylitol by-product. Another experiment that compares the two xylose metabolism pathways revealed that the XI pathway was better able to metabolize xylose to produce maximum ethanol yield, while the XR-XDH pathway achieved a much faster rate of ethanol production (Karhumaa et al., Microb Cell Fact. 2007 Feb 5; 6: 5). See also International Publication No. WO 2006/009434, which is incorporated in full in this report as a reference. Arabinose Metabolism
[00163] Arabinose is a 5-carbon monosaccharide that can be metabolized into useful products by a variety of organisms. L-Arabinose residues are found widely distributed among many heteropolysaccharides from different plant tissues, such as arabinans, arabinogalactans, xylans and arabinoxylans. The Bacillus species in the soil participates in the early stages of the decomposition of plant material, and B. subtilis secretes three enzymes, an endo-arabanase and two arabinosidases, capable of releasing arabinosil and L-arabinose oligomers from the plant cell.
[00164] Three pathways for the metabolism of L-arabinose in microorganisms have been described. Many bacteria, including Escherichia coli, use arabinose isomerase (AraA; EC 5.3.1.4), ribulokinase (AraB; EC 2.7.1.16), and ribulose phosphate epimerase (AraD; EC 5.1.3.4) to sequentially convert L-arabinose to D- xylulose-5-phosphate through L-ribulose and L-ribulose 5-phosphate. See, for example, Sa-Nogueira I, et al., Microbiology 143: 957 - 69 (1997). D-xylulose-5-phosphate then enters the pentose phosphate pathway for another catabolism. In the second way, L-arabinose is converted to L-2-keto-3-deoxyarabonate (L-KDA) by the consecutive action of enzymes arabinose dehydrogenase (ADH), arabinolactone (AL), and arabinonate dehydratase (AraC). See, for example, Watanabe, S, et al., J. Biol. Chem. 281: 2612 - 2623 (2006). L-KDA can be further metabolized in two alternative ways: 1) conversion of L-KDA to 2-ketoglutarate by means of 2-ketoglutaric semialdehyde (KGSA) by L-KDA dehydratase and KGSA dehydrogenase or 2) conversion of L-KDA into pyruvate and glycolaldehyde by L-KDA aldolase. In the third, fungal pathway, L-arabinose is converted to D-xylulose-5-phosphate through L-arabinitol, L-xylulose and xylitol, by enzymes, such as NAD (P) H (AR) dependent aldose reductase, L-arabinitol 4-dehydrogenase (ALDH), L-xylulose reductase (LXR), xylitol dehydrogenase (XylD), and xylulokinase (XylB). These, and additional proteins involved in metabolism and regulation of arabinose, can be found at http://www.nmpdr.org/FIG/wiki/rest.cgi/NmpdrPlugin/SeedViewer page=Subsystems; subsystem = L-Arabinose_utilization, visited on March 21, 2011, which is fully incorporated as a reference in this report.
[00165] The AraC protein regulates the expression of its own synthesis and the other genes in the Ara system. See, Schleif, R., Trends Genet. 16 (12): 559 - 65 (2000). In E. coli, AraC protein regulates positively and negatively the expression of proteins necessary for the absorption and catabolism of L-arabinose sugar. AraC homologues, such as RhaR and RhaS proteins regulating the rhamnose operon, have been identified, which contain regions homologous to the AraC DNA binding domain (Leal, TF and Sa-Nogueira, I., FEMS Microbiol Lett. 241 (1): 41 - 48 (2004)). Such arabinose regulatory proteins are referred to as the AraC / XylS family. See also, Mota, L.J., et al., Mol. Microbiol. 33 (3): 476 - 89 (1999); Mota, L.J., et al., J. Bacteriol. 183 (14): 4190 - 201 (2001).
[00166] In E. coli, the transport of L-arabinose across the cytoplasmic membrane of E. coli requires the expression of the high affinity transport operation, araFGH, a protein-dependent binding system in the low affinity transport operation, araE, or a protonic sympathizer. Additional arabinose carriers include those identified from K. marxianus and P. guilliermondii, disclosed in U.S. Patent No. 7,846,712, which is incorporated by reference in this report.
[00167] In some embodiments, the recombinant microorganisms of the invention have the ability to metabolize arabinose using one or more of the above enzymes. Glycerol Reduction
[00168] Anaerobic growth conditions require the production of endogenous electron acceptors, such as the coenzyme nicotinamide adenine dinucleotide (NAD +). In cellular redox reactions, NAD + / NADH coupling plays a vital role as a reservoir and carrier of reduction equivalents. Ansell, R., et al., EMBO J. 16: 2179 - 87 (1997). The production of cellular glycerol, which generates a NAD +, serves as a redox valve to remove excess by reducing energy during anaerobic fermentation in yeast. Glycerol production is, however, an energetically wasteful process that uses ATP and results in the loss of a reduced 3-carbon compound. Ansell, R., et al., EMBO J. 16: 2179 - 87 (1997). To generate glycerol from a starting glucose molecule, glycerol 3-phosphate dehydrogenase (GPD) reduces dihydroxyacetone phosphate to glycerol 3-phosphate and glycerol 3-phosphatase (GPP) dephosphoryl glycerol 3-phosphate to glycerol. However, being energetically wasteful, glycerol production is a necessary metabolic process for anaerobic growth, as the deletion of GPD activity completely inhibits growth under anaerobic conditions. See, Ansell, R., et al., EMBO J. 16: 2179 - 87 (1997).
[00169] GPD is encoded by two isogens, gpd1 and gpd2. GPD1 encodes the major isoform in anaerobically growing cells, while GPD2 is required for the production of glycerol in the absence of oxygen, which stimulates its expression. Pahlman, A-K., Et al., J. Biol. Chem. 276: 3555 - 63 (2001). The first step in converting dihydroxyacetone phosphate to glycerol by GPD is rate control. Guo, Z.P., et al., Metab. Eng. 13: 49 - 59 (2011). GPP is also encoded by two isogens, gpp1 and gpp2. The deletion of GPP genes interrupts growth when replaced in anaerobic conditions, demonstrating that GPP is important for cellular tolerance to osmotic and anaerobic stress. See, Pahlman, A-K., Et al., J. Biol. Chem. 276: 3555 - 63 (2001).
[00170] Because glycerol is a major by-product of anaerobic ethanol production, many efforts have been made to delete cell glycerol production. However, due to the reduction equivalents produced by glycerol synthesis, deletion of the glycerol synthesis pathway cannot be done without compensation for this valuable metabolic function. Attempts have been made to delete glycerol production and build alternate electron acceptors. Lidén, G., et al., Appl. Env. Microbiol. 62: 3894 - 96 (1996); Medina, V.G., et al., Appl. Env. Microbiol. 76: 190 - 195 (2010). Lidén and Medina deleted the gpd1 and gpd2 genes and tried to circumvent the formation of glycerol using additional carbon sources. Lidén constructed a xylose reductase from Pichia stipitis on a S. cerevisiae gpd1 / 2 deletion strain. The activity of xylose reductase facilitates the anaerobic growth of the strain suppressed by glycerol in the presence of xylose. See, Lidén, G., et al., Appl. Env. Microbiol. 62: 3894 - 96 (1996). Medina constructed an acetylaldehyde dehydrogenase, mhpF, from E. coli in a S. cerevisiae gpd1 / 2 deletion strain to convert acetyl-CoA into acetaldehyde. The activity of acetylaldehyde dehydrogenase facilitated the anaerobic growth of the glycerol deletion strain in the presence of acetic acid, but not in the presence of glucose as the only carbon source. Medina, V.G., et al., Appl. Env. Microbiol. 76: 190 - 195 (2010); see also EP 2277989. Medina noted several problems with the mhpF containing strain that need to be resolved prior to industrial implementation, including significantly reduced growth and product formation rates compared to yeast comprising GPD1 and GPD2.
Thus, in some embodiments of the invention, recombinant host cells comprise a deletion or alteration of one or more glycerol-producing enzymes. Additional deletions or changes to modulate glycerol production include, but are not limited to, construction of a pyruvate formate lyase in a recombinant host cell, and are described in U.S. Order No. 61 / 472,085, which is incorporated by reference in this report. Microorganisms
[00172] The present invention includes multiple strategies for the development of microorganisms with the combination of substrate utilization and product formation properties required for CPF. The “native cellulolytic strategy” involves building naturally occurring cellulolytic microorganisms to improve product-related properties, such as yield and titration. The “recombinant cellulolytic strategy” involves natively building non-cellulolytic organisms that exhibit high yields and product titrations to express a heterologous cellulase system that allows the use of cellulose or the use of hemicellulose or both.
[00173] Many bacteria have the ability to ferment simple hexose sugars in a mixture of acid and pH-neutral products through the process of glycolysis. The glycolytic pathway is abundant and comprises a series of enzymatic steps through which a 6-carbon glucose molecule is broken down, through multiple intermediates, into two 3-carbon pyruvate molecules. This process results in the net generation of ATP (biological energy supply) and the reduced NADH cofactor.
[00174] Pyruvate is an important intermediate compound of metabolism. For example, under aerobic conditions, pyruvate can be oxidized to acetyl coenzyme A (acetyl-CoA), which then enters tricyclic carboxylic acid (TCA), which in turn generates synthetic precursors, CO2, and reduced cofactors. The cofactors are then oxidized through the donation of hydrogen equivalents, through a series of enzymatic steps, to oxygen, resulting in the formation of water and ATP. This energy formation process is known as oxidative phosphorylation.
[00175] Under anaerobic conditions (no oxygen available), fermentation occurs, in which the degradation products of organic compounds serve as donors and acceptors of hydrogen. Excessive NADH from glycolysis has been oxidized in reactions that involve the reduction of organic substrates in products, such as lactate and ethanol. In addition, ATP has been regenerated from the production of organic acids, such as acetate, in a process known as substrate phosphorylation. Therefore, the fermentation products of glycolysis and pyruvate metabolism include a variety of organic acids, alcohols and CO2.
[00176] More optional anaerobes metabolize pyruvate aerobically through pyruvate dehydrogenase (PDH) and tricyclic carboxylic acid (TCA). Under anaerobic conditions, the main energy pathway for pyruvate metabolism is via the pyruvate-formate-lyase (PFL) pathway to provide formate and acetyl-CoA. Acetyl-CoA was later converted to acetate, by means of phosphotransacetylase (PTA) and acetate kinase (ACK) with the co-production of ATP, or reduced in ethanol by means of acetalaldehyde dehydrogenase (AcDH) and alcohol dehydrogenase (ADH). In order to maintain a balance of reduction equivalents, excess NADH produced from glycolysis was reoxidized to NAD + by lactate dehydrogenase (LDH) during the reduction of pyruvate to lactate. NADH can also be reoxidated by AcDH and ADH during the reduction of acetyl-CoA in ethanol, but this is a minor reaction in cells with a functional LDH. Host Cells
The host cells useful in the present invention include any prokaryotic or eukaryotic cells; for example, microorganisms selected from bacterial cells, algae and yeast. Among the host cells suitable for the present invention are microorganisms, for example, from the genera Aeromonas, Aspergillus, Bacillus, Escherichia, Kluyveromyces, Pichia, Rhodococcus, Saccharomyces and Streptomyces.
[00178] In some embodiments, host cells are microorganisms. In one embodiment, the microorganism is a yeast. According to the present invention, the yeast host cell can be, for example, from the genera Saccharomyces, Kluyveromyces, Candida, Pichia, Schizosaccharomyces, Hansenula, Kloeckera, Schwanniomyces and Yarrowia. The yeast species as host cells may include, for example, S. cerevisiae, S. bulderi, S. barnetti, S. exiguus, S. uvarum, S. diastaticus, K. lactis, K. marxianus or K. fragilis. In some embodiments, the yeast is selected from the group consisting of Saccharomyces cerevisiae, Schizzosaccharomyces pombe, Candida albicans, Pichia pastoris, Pichia stipitis, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodozyma, Candida utilis, Arxula adeninyoromy, , Schizosaccharomyces pombe and Schwanniomyces occidentalis. In a particular embodiment, the yeast is Saccharomyces cerevisiae. In another modality, the yeast is a thermotolerant Saccharomyces cerevisiae. The selection of an appropriate host is considered within the scope of the one skilled in the art from the teachings in this report.
[00179] In some embodiments, the host cell is an oil cell. The host oil cell can be a yeast oil cell. For example, the yeast host oil cell can be from the genera Blakeslea, Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella, Mucor, Phycomyces, Pythium, Rhodosporidum, Rhodotorula, Trichosporon or Yarrowia. In accordance with the present invention, the host oil cell may be a host cell of oil microalgae. For example, the oleaginous microalgae host cell can be from the genera Thraustochytrium or Schizochytrium. Biodiesel can then be produced from triglycerides produced by oilseed organisms using conventional lipid transesterification processes. In some particular embodiments, host oil cells can be induced to secrete synthesized lipids. The modalities using oil host cells are advantageous, as they can produce biodiesel from lignocellulosic raw materials which, in relation to oilseed substrates, are cheaper, can be grown more densely, have carbon dioxide emissions with a cycle of shorter life and can be grown on marginal land.
[00180] In some embodiments, the host cell is a thermotolerant host cell. Thermotolerant host cells can be particularly useful in simultaneous saccharification and fermentation processes allowing externally produced cellulases and ethanol-producing host cells to perform optimally in similar temperature ranges.
[00181] Thermotolerant host cells may include, for example, Issatchenkia orientalis host cells, Pichia mississippiensis, Pichia mexicana, Pichia farinosa, Clavispora opuntiae, Clavispora lusitaniae, Candida mexicana, Hansenula polymorphaces and Kluyveromyces. In some embodiments, the thermotolerant cell is a strain of S. cerevisiae, or another strain of yeast, which has been adapted to grow at high temperatures, for example, by selecting for growth at high temperatures in a cytostat.
[00182] In some particular embodiments, the host cell is a Kluyveromyces host cell. For example, the Kluyveromyces host cell may be a host cell for K. lactis, K. marxianus, K. blattae, K. phaffii, K. yarrowii, K. aestuarii, K. dobzhanskii, K. wickerhamii K. thermotolerans or K waltii. In one embodiment, the host cell is a host cell for K. lactis or K. marxianus. In another embodiment, the host cell is a host cell for K. marxianus.
[00183] In some embodiments, the thermotolerant host cell can grow at temperatures above about 30 ° C, about 31 ° C, about 32 ° C, about 33 ° C, about 34 ° C, about 35 ° C, about 36 ° C, about 37 ° C, about 38 ° C, about 39 ° C, about 40 ° C, about 41 ° C or about 42 ° C. In some embodiments of the present invention, the thermotolerant host cell can produce ethanol from cellulose at temperatures above about 30 ° C, about 31 ° C, about 32 ° C, about 33 ° C, about 34 ° C, about 35 ° C, about 36 ° C, about 37 ° C, about 38 ° C, about 39 ° C, about 40 ° C, about 41 ° C, about 42 ° C or about 43 ° C, or about 44 ° C or about 45 ° C or about 50 ° C.
[00184] In some embodiments of the present invention, the thermotolerant host cell can grow at temperatures from about 30 ° C to 60 ° C, about 30 ° C to 55 ° C, about 30 ° C to 50 ° C , about 40 ° C to 60 ° C, about 40 ° C to 55 ° C or about 40 ° C to 50 ° C. In some embodiments of the present invention, the thermotolerant host cell can produce ethanol from cellulose at temperatures of about 30 ° C to 60 ° C, about 30 ° C to 55 ° C, about 30 ° C to 50 ° C , about 40 ° C to 60 ° C, about 40 ° C to 55 ° C or about 40 ° C to 50 ° C.
[00185] In some embodiments, the host cell has the ability to metabolize xylose. Detailed information regarding the development of technology using xylose can be found in the following publications: Kuyper M et al. FEMS Yeast Res. 4: 655 - 64 (2004), Kuyper M et al. FEMS Yeast Res. 5: 399 - 409 (2005), and Kuyper M et al. FEMS Yeast Res. 5: 925 - 34 (2005), which are incorporated in this report as a reference in their entirety. For example, the use of xylose can be performed in S. cerevisiae by heterologously expressing the xylose isomerase gene, XylA, for example, from the anaerobic fungus Piromyces sp. E2, overexpressing five S. cerevisiae enzymes involved in the conversion of xylulose to glycolytic intermediates (xylulokinase, ribulose 5-phosphate isomerase, ribulose 5-phosphate epimerase, transcetolase and transaldolase) and deleting the GRE3 gene encoding aldose reductase to minimize the production of aldose reductase xylitol.
[00186] Host cells may or may not contain antibiotic markers.
[00187] In certain modalities, the host cell is a microorganism that is a species of the genera Thermoanaerobacterium, Thermoanaerobacter, Clostridium, Geobacillus, Saccharococcus, Paenibacillus, Bacillus, Caldicellulosiruptor, Anaerocellum or Anoxibacillus. In certain embodiments, the host cell is a selected bacterium from the group consisting of: Thermoanaerobacterium thermosulfurigenes, aotearoense Thermoanaerobacterium, Thermoanaerobacterium polysaccharolyticum, Thermoanaerobacterium zeae, Thermoanaerobacterium xylanolyticum, Thermoanaerobacterium saccharolyticum, Thermoanaerobium brockii, Thermoanaerobacterium thermosaccharolyticum, thermohidrosulfuricus Thermoanaerobacter, Thermoanaerobacter ethanolicus, Thermoanaerobacter Brocki Clostridium thermocellum, Clostridium cellulolyticum, Clostridium phytofermentans, Clostridium straminosolvens, Geobacillus thermoglucosidasius, stearothermophilus, Geobacillus, Saccharococcus caldoxilosilyticus, Saccharoccus thermophilus campinasensis Paenibacillus, flavothermus Bacillus kamchatkensis Anoxibacillus, gonensis Anoxibacillus, acetigenus Caldicellulosiruptor, saccharolyticus Caldicellulosiruptor, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor owensensis, Caldicellulosi ruptor lactoaceticus and Anaerocellum thermophilum. In certain embodiments, the host cell is Clostridium thermocellum, Clostridium cellulolyticum or Thermoanaerobacterium saccharolyticum. Codon Optimized Polynucleotides
[00188] The polynucleotides that encode heterologous enzymes described in this report can be optimized at the codon. As used in this report, the term “codon-optimized coding region” means a coding region for nucleic acids that has been adapted for expression in the cells of a given organism by replacing at least one, or more than one, or a number significant, codons with one or more codons that are most often used in the genes of such an organism.
[00189] In general, highly expressed genes in an organism are prone to codons that are recognized by the most abundant tRNA species in that organism. A measurement of this slope is the "codon adaptation index" or "CAI", which measures the extent to which the codons used to encode each amino acid in a particular gene are those that occur most frequently in a highly expressed gene reference set from an organism.
[00190] The CAI of optimized sequences in the codon of the present invention corresponds to between about 0.8 and 1.0, between about 0.8 and 0.9, or about 1.0. A codon-optimized sequence can be further modified for expression in a particular organism, depending on such biological constraints of the organism. For example, large rounds of "As" or "Ts" (for example, rounds greater than 3, 4, 5, 6, 7, 8, 9 or 10 consecutive bases) can be removed from the strings if they are known to negatively effect the transcript. In addition, specific restriction enzyme sites can be removed for molecular cloning purposes. Examples of such restriction enzyme sites include PacI, AscI, BamHI, BglII, EcoRI and XhoI. In addition, the DNA sequence can be checked for direct repetitions, inverted repetitions and mirror repetitions with lengths of ten bases or more, which can be modified manually by replacing codons with "best seconds" codons, that is, codons that occur at the second highest frequency in the particular organism for which the sequence is to be optimized.
[00191] Deviations in the nucleotide sequence that comprise the codons that encode the amino acids of any polypeptide chain take into account variations in the sequence that encodes the gene. Since each codon consists of three nucleotides, and nucleotides comprising DNA are restricted to four specific bases, there are 64 possible combinations of nucleotides, 61 of which encode amino acids (the remaining three codons encode signals that end the translation). The “genetic code” that shows that codons encode such amino acids is reproduced in this report as Table 1. As a result, many amino acids are designated in more than one codon. For example, the amino acids alanine and proline are encoded by four triplets, serine and arginine by six, while tryptophan and methionine are encoded by only one triplet. This degeneration allows the base DNA composition to vary over a wide range without changing the amino acid sequence of the proteins encoded by the DNA. TABLE 1: The Standard Genetic Code

[00192] Many organisms show an inclination to use particular codons to encode the insertion of a particular amino acid in a growing peptide chain. Codon preference or codon inclination, differences in codon usage between organisms, are provided through the degeneration of the genetic code, and are well documented among many organisms. Codon tilt often correlates with the translation efficiency of messenger RNA (mRNA), which, in turn, is believed to be dependent, inter alia, on the properties of the codons to be translated and the availability of RNA molecules transfer tRNAs. The predominance of tRNAs selected in a cell is, in general, a reflection of the codons most frequently used in the synthesis of peptides. Consequently, genes can be adapted for optimal gene expression in a given organism based on codon optimization.
[00193] Given the large number of gene sequences available for a wide variety of animal, plant and microbial species, it is possible to calculate the relative frequencies of the use of the codon. Codon usage tables are readily available, for example, at http://www.kazusa.or.jp/codon/(visited on December 18, 2009), and these tables can be adapted in a number of ways. See Nakamura, Y., et al. “Codon usage tabulated from the international DNA sequence databases: status for the year 2000”, Nucl. Acids Res. 28: 292 (2000). The codon usage tables for yeast, calculated from GenBank Release 128.0 [February 15, 2002], are reproduced below as Table 2. This table uses mRNA nomenclature, and therefore, instead of thymine (T) that is found in DNA, the tables use uracil (U) that is found in RNA. The table has been adapted so that the frequencies are calculated for each amino acid, and not for all 64 codons. TABLE 2: Codon Use Table for Saccharomyces cerevisiae Genes




[00194] Using these tables or similar tables, a person of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment from an optimized coding region in the codon encoding the polypeptide, but which uses ideal codons for a given species. Coding regions optimized on the codon can be designated by several different methods.
[00195] In one method, a codon usage table is used to find the most frequent single codon used for any given amino acid, and that the codon is used each time the particular amino acid appears in the polypeptide sequence. For example, referring to Table 2 above, for leucine, the most common codon is UUG, which is used 27.2% of the time. Thus, all leucine residues in a given amino acid sequence would determine the UUG codon.
[00196] In another method, the actual frequencies of the codons are randomly distributed throughout the coding sequence. Thus, using this method for optimization, if a hypothetical polypeptide sequence shows 100 leucine residues, referring to Table 2 for the frequency of use in S. cerevisiae, about 5, or 5% of the leucine codons would be CUC, about 11, or 11% of the leucine codons would be CUG, about 12, or 12% of the leucine codons would be CUU, about 13, or 13% of the leucine codons would be CUA, about 26, or 26% of the leucine codons would be UUA, and about 27, or 27% of leucine codons would be UUG.
[00197] These frequencies would be randomly distributed across all leucine codons in the coding region encoding the hypothetical polypeptide. As will be understood by those of ordinary skill in the art, the distribution of codons in the sequence can vary significantly using this method; however, the sequence always encodes the same polypeptide.
[00198] When using the above methods, the term "about" is used precisely to include partial percentages of codon frequencies for a given amino acid. As used in this report, “about” is defined as one amino acid more or one amino acid less than the value provided. The value of the total number of amino acids is rounded up if the partial frequency of use is 0.50 or greater, and is rounded down if the partial frequency of use is 0.49 or less. Using again the example of the frequency of use of leucine in human genes for a hypothetical polypeptide having 62 leucine residues, the partial frequency of use of the codon would be calculated by multiplying 62 by the frequencies for the various codons. Thus, 7.28 percent of 62 is equal to 4.51 UUA codons, or “about 5”, that is, 4, 5, or 6 UUA codons, 12.66 percent of 62 is equal to 7.85 UUG codons or “about 8”, that is, 7, 8, or 9 UUG codons, 12.87 percent of 62 is equal to 7.98 CUU codons, or “about 8”, that is, 7, 8 , or 9 CUU codons, 19.56 percent of 62 is equal to 12.13 CUC codons or “about 12”, that is, 11, 12, or 13 CUC codons, 7.00 percent of 62 is equal to 4.34 CUA codons or “about 4”, that is, 3, 4, or 5 CUA codons, and 40.62 percent of 62 is equal to 25.19 CUG codons, or “about 25”, that is , 24, 25, or 26 CUG codons.
[00199] Codons randomly determined at a frequency optimized to encode a given polypeptide sequence can be manually prepared by calculating codon frequencies for each amino acid, and then determining the codons for the polypeptide sequence at random. In addition, various algorithms and computer programs are readily available to those of ordinary skill in the art. For example, the “EditSeq” function in the Lasergene Package, available from DNAstar, Inc., Madison, WI, the back-translation function in VectorNTI Suite, available from InforMax, Inc., Bethesda, MD, and the “back translation” in the GCG - Wisconsin Package, available from Accelrys, Inc., San Diego, CA. In addition, several sources are publicly available for coding region sequences optimized in the codon, for example, the “back-translation” function at http://www.entelechon.com/bioinformatics/backtranslation.php lang=eng (visited at 18 December 2009) and the “backtranseq” function available at http://emboss.bioinformatics.nl/cgi-bin/emboss/backtranseq (visited on 18 December 2009). The construction of a rudimentary algorithm to determine codons based on a given frequency can also be easily accomplished with basic mathematical functions through a person of ordinary skill in the technique.
[00200] Several options are available for synthesizing coding-optimized regions in the codon designated by any of the methods described above, using standard and routine molecular biology manipulations well known to those of ordinary skill in the art. In one method, a series of pairs of complementary oligonucleotides of 80 to 90 nucleotides each in length and spanning the length of the desired sequence is synthesized by standard methods. These pairs of oligonucleotides are synthesized, such that under annealing, they form double-stranded fragments of 80 to 90 base pairs, containing cohesive ends, for example, each oligonucleotide in the pair is synthesized to span 3, 4, 5, 6 , 7, 8, 9, 10, or more bases in addition to the region that is complementary to the other oligonucleotide in par. The single-stranded ends of each pair of oligonucleotides ring with the single-stranded end of another pair of oligonucleotides. The oligonucleotide pairs are left annular, and approximately five to six between these double strand fragments are then left annular through the single cohesive strand ends, and then they are ligated and cloned into a cloning vector. standard bacterial, for example, a TOPO® vector available from Invitrogen Corporation, Carlsbad, CA. The construct is then sequenced using standard methods. Several of these constructs consisting of 5 to 6 fragments of 80 to 90 linked base pair fragments, that is, fragments of about 500 base pairs, are prepared, such that the desired total sequence is represented in a series of constructs of plasmid. The inserts of these plasmids are then cut with appropriate restriction enzymes and ligated to form the final construct. The final construct is then cloned into a standard bacterial cloning vector and sequenced. Additional methods would be immediately apparent to the qualified technician. In addition, gene synthesis is commercially available.
[00201] In additional embodiments, a full length polypeptide sequence is optimized at the codon for a given species resulting in an optimized coding region at the codon encoding the total polypeptide, and then nucleic acid fragments from the optimized coding region at codon, which encode fragments, variants, and derivatives of the polypeptide are prepared from the coding region optimized in the original codon. As would be well understood by those of ordinary skill in the art, if the codons are randomly determined for the full-length coding region based on their frequency of use in a given species, fragments of nucleic acid that encode fragments, variants, and non-derivatives they would necessarily be completely optimized at the codon for the given species. However, such sequences are still much closer to the use of the codon of the desired species in relation to the use of the native codon. The advantage of this method is that the synthesis of optimized nucleic acid fragments in the codon that encode each fragment, variant, and derivative of a supplied polypeptide, although routine, would be time consuming and result in significant cost. Transposons
[00202] To select foreign DNA that has entered a host, it is preferable that the DNA is stably maintained in the organism of interest. With respect to plasmids, there are two processes by which this can occur. One is through the use of replicative plasmids. These plasmids have origins of replication that are recognized by the host and allow the plasmids to be replicated as stable, autonomous, extrachromosomal elements that are partitioned during cell division into daughter cells. The second process occurs through the integration of a plasmid in the chromosome. This predominantly happens through homologous recombination and results in the insertion of the total plasmid, or parts of the plasmid, into the host chromosome. Thus, the plasmid and selectable marker (s) are replicated as an integral part of the chromosome and secreted into daughter cells. Therefore, to verify that plasmid DNA enters a cell during a transformation event through the use of selectable markers, the use of a replicative plasmid or the ability to recombine the plasmid on the chromosome is required. These qualifiers cannot always be satisfied, especially when handling organisms that do not have a set of genetic tools.
[00203] One way to avoid problems with respect to markers associated with the plasmid is through the use of transposons. A transposon is a mobile DNA element, defined by mosaic DNA sequences that are recognized by an enzymatic mechanism referred to as a transposase. The function of transposase is to randomly insert transposon DNA into the target host or DNA. A selectable marker can be cloned into a transposon using standard genetic engineering. The resulting DNA fragment can be linked to the transposase mechanism in an in vitro reaction and the complex can be introduced into target cells through electroporation. Stable insertion of the marker into the chromosome requires only the function of the transposase mechanism and alleviates the need for homologous recombination or replicative plasmids.
[00204] The random nature associated with transposon integration has the added advantage of action as a form of mutagenesis. Libraries can be created, which comprise amalgamation of transposon mutants. These libraries can be used in screenings or selections to produce mutants with desired phenotypes. For example, a CBP organism's transposon library can be screened for the ability to produce more ethanol, or less lactic acid and / or more acetate. Native cellulosic strategy
[00205] Cellulosic microorganisms that occur naturally are starting points for the development of CBP organism through the native strategy. Anaerobic and facultative anaerobics are of particular interest. The primary objective is to build biomass-derived acetate detoxification in an uncharged solvent, including, but not limited to, acetone, isopropanol, ethyl acetate or ethanol. The metabolic construction of mixed acid fermentations in relation, for example, to the production of ethanol, was successful in the case of mesophilic, non-cellulosic and enteric bacteria. Recent developments in appropriate gene transfer techniques take into account this type of work that must be experimented with cellulosic bacteria. Recombinant cellulosic strategy
[00206] Non-cellulosic microorganisms with desired product-forming properties are starting points for the development of CBP organism through the recombinant cellulosic strategy. The primary objective of such developments is to build a heterologous cellulase system that allows growth and fermentation in pre-treated lignocellulose. The heterologous production of cellulases was primarily continued with bacterial hosts producing ethanol in high yield (engineered strains of E. coli, Klebsiella oxytoca and Zymomonas mobilis) and the yeast Saccharomyces cerevisiae. Cellulase expression in K. oxytoca strains resulted in increased hydrolysis yields - but not growth without added cellulase - for microcrystalline cellulose, and anaerobic growth in amorphous cellulose. Although dozens of saccharolytic enzymes have been functionally expressed in S. cerevisiae, anaerobic growth in cellulose as the result of such expression has not been definitively demonstrated.
[00207] Aspects of the present invention refer to the use of thermophilic or mesophilic microorganisms as hosts for modification through the native cellulosic strategy. Its potential in biotechnology process applications stems from its ability to grow at relatively high temperatures with high metabolic rates present, production of physically and chemically stable enzymes, and high yields of final products. Major groups of thermophilic bacteria include eubacteria and archeobacteria. Thermophilic eubacteria include: phototropic bacteria, such as cyanobacteria, purple bacteria and green bacteria; Gram-positive bacteria, such as Bacillus, Clostridium, lactic acid bacteria, and Actinomyces; and other eubacteria, such as Thiobacillus, spirochete, Desulfotomaculum, Gram-negative aerobes, Gram-negative anaerobes, and Thermotoga. Within archeobacteria are considered methanogens, extreme thermophiles (a term recognized in the art), and Thermoplasma. In certain embodiments, the present invention relates to Gram-negative organotrophic thermophils of the Thermus genera, Gram-positive eubacteria, such as the Clostridium genera, and also comprising rods and coconuts, genera in a group of eubacteria, such as Thermosipho and Thermotoga, genera of Archeobacteria, such as Thermococcus, Thermoproteus (in the form of a stick), Thermofilum (in the form of a stick), Pyrodictium, Acidianus, Sulfolobus, Pyrobaculum, Pyrococcus, Thermodiscus, Staphylothermus, Desulfurococcus, Some examples of thermophilic or mesophilic (including bacteria, prokaryotic microorganism and fungi), which may be suitable for the present invention include, but are not limited to: Clostridium thermosulfurogenes, Clostridium cellulolyticum, Clostridium thermocellum, Clostridium thermohydrosulfuricum, Clostridium thermoacetic, Clostridium thermoacetic thermosaccharolyticum, Clostridium tartarivorum, Clostridium thermocellulaseum, Clostridium phytofermentans, Clostridium straminosolvens, Thermoanaerobacterium thermosaccarolyticum, Thermoanaerobacterium saccharolyticum, acetoetilicus, Thermoanaerobium Thermobacteroides brockii, Methanobacterium thermoautotrophicum, Anaerocellum thermophilium, Pyrodictium occultum, neutrophilus Thermoproteus, Librum Thermofilum, Thermothrix thioparus, Desulfovibrio thermophilus, Thermoplasma acidophilum, Hydrogenomonas thermophilus, Thermomicrobium roseum, Thermus flavas, Thermus ruber, Pyrococcus furiosus, Thermus aquaticus, Thermus thermophilus, Chlorofl Lexus aurantiacus, Thermococcus litoralis, Pyrodictium abyssi, Bacillus stearothermophilus, Cyanidium caldarium, Mastigocladus laminosus, calidissima Chlamydothrix, Chlamydothrix penicillata, Thiothrix carnea, Phormidium tenuissimum, Phormidium geysericola, Phormidium subterraneum, Phormidium bijahensi, filiformis Oscillatoria, lividus Synechococcus, aurantiacus Chloroflexus, Pyrodictium brockii , Thiobacillus thiooxidans, Sulfolobus acidocaldarius, Thiobacillus thermophilica, Bacillus stearothermophilus, hamathensis Cercosulcifer, Vahlkampfia reichi, Cyclidium Citrullus, Dactylaria gallopava, Synechococcus lividus, elongatus Synechococcus, Synechococcus Minervae, Synechocystis aquatilus, thermalis Aphanocapsa, terebriformis Oscillatoria, Oscillatoria amphibia, Oscillatoria germinata, Oscillatoria okenii, Phormidium laminosum, Phormidium parparasiens, Symploca thermalis, Bacillus acidocaldarias, Bacillus coagulans, Bacillus thermocatenalatus, Bacillus licheniformis, Bacillus pamilas, Bac illus macerans, circulans Bacillus, Bacillus laterosporus, brevis Bacillus, Bacillus subtilis, Bacillus sphaericus, Desulfotomaculum nigrificans, Streptococcus thermophilus, Lactobacillus thermophilus, bulgaricus, Lactobacillus, Bifidobacterium thermophilum, Streptomyces fragmentosporus, thermonitrificans Streptomyces, Streptomyces thermovulgaris, Pseudonocardia thermophila, Thermoactinomyces vulgaris, Thermoactinomyces sacchari , Thermoactinomyces candidas, Thermomonospora curvata, Thermomonospora viridis, Thermomonospora citrina, thermodiastatica Microbispora, Microbispora areata, Microbispora bispora, dichotomica Actinobifida, Actinobifida chromogena, Micropolispora caesia, Micropolispora faeni, Micropolispora cectivugida, cabrobrunea Micropolispora, Micropolispora thermovirida, viridinigra Micropolispora, Methanobacterium thermoautothropicum, Caldicellulosiruptor acetigenus, Caldicellulosiruptor saccharolyticus, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor owensensis, Caldic ellulosiruptor lactoaceticus, variants thereof, and / or progenies thereof.
[00208] In particular embodiments, the present invention relates to thermophilic bacteria selected from the group consisting of Clostridium cellulolyticum, Clostridium thermocellum and Thermoanaerobacterium saccharolyticum.
[00209] In certain embodiments, the present invention relates to thermophilic bacteria selected from the group consisting of Fervidobacterium gondwanense, Clostridium thermolacticum, Moorella sp. and Rhodothermus marinus.
[00210] In certain embodiments, the present invention relates to thermophilic bacteria of the genera Thermoanaerobacterium or Thermoanaerobacter, including, but not limited to, the species selected from the group consisting of: Thermoanaerobacterium thermosulfurigenes, Thermoanaerobacterium aotearoense, Thermoanaerobacterium polisacchareaticum, xylanolyticum, Thermoanaerobacterium saccharolyticum, Thermoanaerobium brockii, Thermoanaerobacterium thermosaccharolyticum, Thermoanaerobacter thermohydrosulfuricus, Thermoanaerobacter ethanolicus, Thermoanaerobacter brockii, variants of the same and progenies thereof.
[00211] In certain embodiments, the present invention relates to microorganisms of the genera Geobacillus, Saccharococcus, Paenibacillus, Bacillus and Anoxibacillus, including, but not limited to the species selected from the group consisting of: Geobacillus thermoglucosidasius, Geobacillus stearothermophilus, Saccharococcus caldoxilosilyticus, Saccharoccus thermophilus, Paenibacillus campinasensis, Bacillus flavothermus, Anoxibacillus kamchatkensis, Anoxibacillus gonensis, variants thereof, and their progenies.
[00212] In certain embodiments, the present invention relates to mesophilic bacteria selected from the group consisting of Saccharophagus degradans; Flavobacterium johnsoniae; Fibrobacter succinogenes; Clostridium hungatei; Clostridium phytofermentans; Clostridiuma cellulolyticum; Clostridium aldrichii; Clostridium termitididis; Acetivibrio cellulolyticus; Acetivibrio ethanolgignens; Acetivibrio multivorans; Bacteroides cellulosolvens; and Alkalibacter saccharofomentans, variants thereof and progenies thereof. Development of the organism through the native cellulosic strategy
[00213] A method for the development of the organism for CBP starts with organisms that naturally use cellulose, hemicellulose and / or other biomass components, which are then genetically constructed to enhance the yield and tolerance of the product. For example, Clostridium thermocellum is a thermophilic bacterium that has among the highest reported cellulose utilization rates. Other organisms of interest are thermophiles that use xylose, such as Thermoanaerobacterium saccharolyticum and Thermoanaerobacterium thermosaccharolyticum. The production of organic acid may be responsible for the low concentrations of ethanol produced, in general, associated with these organisms. Thus, one objective is to eliminate the production of acetic and lactic acid in these organisms through metabolic construction. Substantial efforts have been devoted to the development of gene transfer systems for the target organisms described above and multiple isolates of C. thermocellum from nature have been characterized. See McLaughlin et al. (2002) Environ. Sci. Technol. 36: 2122. The metabolic construction of thermophilic and saccharolytic bacteria is an active area of interest, and the knockout of lactate dehydrogenase in T. saccharolyticum has recently been reported. See Desai et al. (2004) Appl. Microbiol. Biotechnol. 65: 600. The knockout of acetate kinase and phosphotransacetylase in this organism is also possible. Development of the organism through the recombinant cellulosic strategy
[00214] An alternative method for the development of the organism for CBP involves conferring the ability to grow on lignocellulosic materials in microorganisms that naturally present high yield and product tolerance through the expression of a heterologous cellulosic system and, perhaps, other characteristics . For example, Saccharomyces cerevisiae was built to express two dozen different saccharolytic enzymes. See Lynd et al. (2002) Microbiol. Mol. Biol. Rev. 66: 506.
[00215] Considering that cellulosic hydrolysis has been addressed in the literature primarily in the context of an enzymatically oriented intellectual paradigm, the CBP processing strategy requires that cellulosic hydrolysis be seen in terms of a microbial paradigm. This microbial paradigm naturally leads to an emphasis on different fundamental problems, organisms, cellulosic systems, and applied milestones compared to those of the enzymatic paradigm. In this context, C. thermocellum was a model organism because of its high growth rate on cellulose together with its potential usefulness for CBP.
[00216] In certain embodiments, organisms useful in the present invention may be applicable to the process known as simultaneous saccharification and fermentation (SSF), which is intended to include the use of said microorganisms and / or one or more recombinant hosts (or extracts of them, including purified or non-purified extracts) for the degradation or contemporary depolymerization of a complex sugar (ie cellulosic biomass) and bioconversion of such sugar residue into ethanol through fermentation. Ethanol production
[00217] According to the present invention, a recombinant microorganism can be used to produce ethanol from biomass, which is referred to in this report as lignocellulosic material, lignocellulosic substrate or cellulosic biomass. Methods for producing ethanol can be carried out, for example, by contacting the biomass with a recombinant microorganism, as described in this report, and as described in International Application No PCT / US2009 / 002902, International Application No PCT / US2009 / 003972, International Order No PCT / US2009 / 003970, International Order No PCT / US2009 / 065571, International Order No PCT / US2009 / 069443, International Order No PCT / US2009 / 064128, International Order No PCT / IB2009 / 005881, US Order No 61 / 116,981, US Order No. 61 / 351,165 and US Order No. 61 / 420,142, the contents of which are fully incorporated by reference in this report.
[00218] In addition, to produce ethanol, the recombinant microorganisms described in this report can be combined, as recombinant host cells or as metabolic pathways engineered into recombinant host cells, with the recombinant microorganisms described in International Application No PCT / US2009 / 002902, International Order No PCT / US2009 / 003972, International Order No PCT / US2009 / 003970, International Order No PCT / US2009 / 065571, International Order No PCT / US2009 / 069443, International Order No PCT / US2009 / 064128, International Order In PCT / IB2009 / 005881, US Order No. 61 / 351.165 and US Order No. 61 / 420.142, the contents of which are incorporated by reference in this report. The recombinant microorganism, as described in this report, can also be constructed with the enzymes and / or metabolic pathways described in International Order No PCT / US2009 / 002902, International Order No PCT / US2009 / 003972, International Order No PCT / US2009 / 003970, International Order No PCT / US2009 / 065571, International Order No PCT / US2009 / 069443, International Order No PCT / US2009 / 064128, International Order No PCT / IB2009 / 005881, US Order No 61 / 351,165, and US Order No 61 /420,142, the contents of which are incorporated as reference in this report.
[00219] Numerous cellulosic substrates can be used, according to the present invention. The substrates for the cellulose activity tests can be divided into two categories, soluble and insoluble, based on their solubility in water. Soluble substrates include cellodextrins or derivatives, carboxymethylcellulose (CMC), or hydroxyethylcellulose (HEC). Insoluble substrates include crystalline cellulose, microcrystalline cellulose (Avicel), amorphous cellulose, such as cellulose swollen with phosphoric acid (PASC), pigmented or fluorescent cellulose and pre-treated lignocellulosic biomass. These substrates are, in general, highly ordered cellulosic material and, thus, only sparingly soluble.
[00220] It will be evaluated that the suitable lignocellulosic material can be any raw material that contains soluble and / or insoluble cellulose, where the insoluble cellulose can be in a crystalline or non-crystalline form. In various modalities, lignocellulosic biomass comprises, for example, wood, maize, corn harvest residues, sawdust, tree bark, leaves, agricultural and forest residues, grasses, such as switchgrass, ruminant digestion products, municipal waste, effluents from paper mills, newspapers, cardboard or combinations thereof.
[00221] In some embodiments, the invention is directed to a method for hydrolyzing a cellulosic substrate, for example, a cellulosic substrate, as described above, by contacting the cellulosic substrate with a recombinant microorganism of the invention. In some embodiments, the invention is directed to a method for hydrolyzing a cellulosic substrate, for example a cellulosic substrate, as described above, by contacting the cellulosic substrate with a coculture comprising yeast cells that express heterologous cellulases.
[00222] In some embodiments, the invention is directed to a method for fermenting cellulose. Such methods can be carried out, for example, by culturing a host cell or co-culture in a medium that contains insoluble cellulose to allow saccharification and fermentation of the cellulose.
[00223] The production of ethanol according to the present invention can be carried out at temperatures of at least about 30 ° C, about 31 ° C, about 32 ° C, about 33 ° C, about 34 ° C, about 35 ° C, about 36 ° C, about 37 ° C, about 38 ° C, about 39 ° C, about 40 ° C, about 41 ° C, about 42 ° C , about 43 ° C, about 44 ° C, about 45 ° C, about 46 ° C, about 47 ° C, about 48 ° C, about 49 ° C, or about 50 ° C. In some embodiments of the present invention, the thermotolerant host cell can produce ethanol from cellulose at temperatures above about 30 ° C, about 31 ° C, about 32 ° C, about 33 ° C, about 34 ° C , about 35 ° C, about 36 ° C, about 37 ° C, about 38 ° C, about 39 ° C, about 40 ° C, about 41 ° C, about 42 ° C, or about 43 ° C, or about 44 ° C, or about 45 ° C, or about 50 ° C. In some embodiments of the present invention, the thermotolerant host cell can produce ethanol from cellulose at temperatures from about 30 ° C to 60 ° C, about 30 ° C to 55 ° C, about 30 ° C to 50 ° C, about 40 ° C to 60 ° C, about 40 ° C to 55 ° C or about 40 ° C to 50 ° C.
[00224] In some embodiments, methods for producing ethanol may comprise contacting a cellulosic substrate with a recombinant microorganism or co-culture of the invention and additionally contacting the cellulosic substrate with externally produced cellulase enzymes. Exemplary externally produced cellulase enzymes are commercially available and are known to those of skill in the art.
[00225] In some embodiments, the methods comprise producing ethanol at a particular rate. For example, in some embodiments, ethanol is produced at a rate of at least about 0.1 mg per hour per liter, at least about 0.25 mg per hour per liter, at least about 0.5 mg per hour per liter, at least about 0.75 mg per hour per liter, at least about 1.0 mg per hour per liter, at least about 2.0 mg per hour per liter, at least about 5.0 mg per hour per liter, at least about 10 mg per hour per liter, at least about 15 mg per hour per liter, at least about 20.0 mg per hour per liter, at least about 25 mg per hour per liter at least about 30 mg per hour per liter, at least about 50 mg per hour per liter, at least about 100 mg per hour per liter, at least about 200 mg per hour per liter, at least about 300 mg per hour per liter, at least about 400 mg per hour per liter, or at least about 500 mg per hour per liter.
[00226] In some embodiments, the host cells of the present invention can produce ethanol at a rate of at least about 0.1 mg per hour per liter, at least about 0.25 mg per hour per liter, at least about 0.5 mg per hour per liter, at least about 0.75 mg per hour per liter, at least about 1.0 mg per hour per liter, at least about 2.0 mg per hour per liter, at least about 5.0 mg per hour per liter, at least about 10 mg per hour per liter, at least about 15 mg per hour per liter, at least about 20.0 mg per hour per liter, at least about 25 mg per hour per liter, at least about 30 mg per hour per liter, at least about 50 mg per hour per liter, at least about 100 mg per hour per liter, at least about 200 mg per hour per liter , at least about 300 mg per hour per liter, at least about 400 mg per hour per liter, or at least about 500 mg per hour per liter more than a control strain (devoid of heterologous cellulases) and grown under the same conditions. In some embodiments, ethanol can be produced in the absence of any externally added cellulases.
[00227] Ethanol production can be measured using any method known in the art. For example, the amount of ethanol in the fermentation samples can be assessed using HPLC analysis. Many ethanol test kits are commercially available which use, for example, tests based on the alcohol oxidase enzyme. Methods for determining ethanol production are within the scope of those skilled in the art from the teachings in this report. The U.S. Department of Energy (DOE) provides a method for calculating the theoretical yield of ethanol. Consequently, if the weight percentages of C6 sugars are known (ie, glucan, galactan, mannan), the theoretical ethanol yield in gallons per dry ton of total C6 polymers can be determined by applying a conversion factor, such as follows: (1.11 pounds of C6 sugar / pound of polymeric sugar) x (0.51 pounds of ethanol / pound of sugar) x (2000 pounds of ethanol / ton of polymeric C6 sugar) x (1 gallon of ethanol / 6 , 55 pounds of ethanol) x (1/100%), where the factor (1 gallon of ethanol / 6.55 pounds of ethanol) is taken as the specific gravity of ethanol at 20 ° C.
[00228] And if the weight percentages of C5 sugars (ie, xylan, arabinan) are known, the theoretical ethanol yield in gallons per dry ton of total C5 polymers can be determined by applying a conversion factor, such as follows: (1,136 pounds of C5 sugar / pound of polymeric C5 sugar) x (0.51 pounds of ethanol / pound of sugar) x (2000 pounds of ethanol / ton of polymeric C5 sugar) x (1 gallon of ethanol / 6, 55 pounds of ethanol) x (1/100%), where the factor (1 gallon of ethanol / 6.55 pounds of ethanol) is taken as the specific gravity of ethanol at 20 ° C.
[00229] It follows that the addition of the theoretical ethanol yield in gallons per dry ton of total C6 polymers to the theoretical ethanol yield in gallons per dry ton of total C5 polymers provides the total theoretical ethanol yield in gallons per dry ton of raw material. cousin.
[00230] Through the application of this analysis, DOE provides the following examples of theoretical ethanol yield in gallons per dry ton of raw material: corn grain, 124.4; corn harvest residues, 113.0; rice straw, 109.9; cotton gin garbage, 56.8; forest thinning, 81.5; hardwood sawdust, 100.8; bagasse, 111.5; and mixed paper, 116.2. It is important to note that these are theoretical yields. The DOE warns that depending on the nature of the raw material and the process used, the actual yield can be 60% to 90% of the theoretical, and also states that “obtaining high yield can be expensive, however, the lower the yield processes more often the cost can be effective. ” (Ibid.) TDK counter-selection
[00231] In the field of genetic engineering, cells containing a construction event are often identified through the use of positive selections. This is done by creating a genetic link between the positive selection encoded by a dominant marker, such as an antibiotic resistant gene, the desired genetic modification, and the target loci. Once the modifications are identified, it is often desirable to remove the dominant marker, so that it can be reused during subsequent genetic engineering events.
[00232] However, if a dominant marker also does not have a counter-selection, a gene that expresses a protein that confers a counter-selection, must be genetically linked to the dominant marker, the desired genetic modification and the target locus. To avoid such limitations, the methods of the invention include linking and / or designating a transformation associated with recombination between the thymidine kinase (TDK) gene from Herpes simplex Virus Type 1 (GenBank Access No AAA45811; SEQ ID NO: 84 ) and one or more antibiotic resistant genes. See, for example, Figure 35. Examples of such antibiotic resistant genes include, but are not limited to, aminoglycoside phosphotransferase (Kan; G418 resistant), nourseotrichin acetyltransferease (Nat; nourseotrichin resistant), hygromycin B phosphotransferase (hph; resistant) hygromycin B), or a Sh ble 1 gene product (ble; Zeocin resistant). Using such counter-selection methods with linked positive / negative selectable markers, as described below in Example 4, transformants comprising the desired genetic modification were obtained in several different yeast strains, including the S. cerevisiae M139, M2390 strains, and several strains of hardwood described in this report. EXEMPLIFICATION
[00233] The described invention will be more easily understood by reference to the following examples, which are merely included for purposes of illustrating certain aspects and modalities of the present invention and are not intended to limit the invention. EXAMPLE 1 Detoxification of Lignocellulosic Material Through In Vivo Acetate Absorption and Ethanol Formation
[00234] Acetate is a major inhibitor of cell growth and is present in large quantities in substrates derived from biomass. When converting lignocellulosic materials to ethanol, a large portion of cellular energy must be expended to avoid the harmful effects of acetic acid. Because of these effects, cell growth and other important phenotypes are slowed down resulting in a sub-ideal process.
[00235] In order to overcome the inhibitory effects of acetate, it is desired to convert acetate from an inhibitory compound into a less inhibitory compound, for example, ethanol, which is also the primary product produced during yeast fermentation. Attempts to overcome the inhibitory effects of acetate relied on the activity of the endogenous gene for the conversion of acetate to acetyl-CoA, a metabolic intermediate before the formation of ethanol, without success. Recently, it has been shown that a glycerol deletion mutant can be constructed in yeast to convert acetate into a less inhibitory compound. See Medina, V.G., et al., Appl. Environ. Microbiol., Published online prior to printing on Nov. 13, 2009. The glycerol deletion mutant cannot regenerate NAD +, and is therefore unable to grow anaerobically. Through the introduction of an enzyme from E. coli, an acetaldehyde dehydrogenase (MhpF), the yeast strain was able to grow anaerobically, although much slower than the non-engineered strain. Because the growth of this deletion mutant has been significantly inhibited, it requires further optimization before such a strain can still be used in an industrial process.
[00236] The present Example probably overcomes the obstacles to acetate absorption and ethanol formation during anaerobic growth, by providing new pathways (see Figure 3) for the conversion of acetate to ethanol that has not been previously described. These pathways significantly improve this process through the introduction of additional enzyme activities through the conversion of acetate to acetyl-CoA, as well as the introduction of heterologous enzymes from other microbial sources to improve this first conversion. Additionally, the heterologous introduction of a bifunctional acetaldehyde / alcohol dehydrogenase allows the direct conversion of ethanol from acetyl-CoA with a single enzyme, with the promise of a significant increase in formation kinetics in vivo.
[00237] The conversion of acetate to ethanol, according to this Example, is as follows: 1) Conversion of acetate to acetyl-CoA
[00238] Acetate is converted into yeast in acetyl-CoA using an acetyl-CoA transferase (ACS). Endogenous activity during anaerobic fermentation is probably carried out by the enzyme ACS2. By transforming the yeast host cell with and expressing the highest affinity of the ACS1 enzyme during fermentation or by increasing the expression of the ACS2 enzyme, greater acetate absorption and activity can be achieved. See Figure 3, (i). Heterologous activity can also be achieved by introducing acetate into acetyl-CoA by converting the genes from other organisms, such as E. coli.
[00239] Alternate pathways from acetate to acetyl-CoA can be obtained by expressing the typical bacterial system of phosphotransacetylase (PTA) and acetate kinase (ACK). See Figure 3, (ii). These two enzymes can act sequentially to produce acetyl-CoA from acetate. Due to the difference in cofactors between PTA / ACK and ACS, this pathway may have higher activity in vivo when heterologously expressed. The sources for PTA and ACK can be sourced from a wide variety of bacterial sources, including, but not limited to species of Escherichia, Thermoanaerobacter, Clostridia and Bacillus. 2) Conversion of acetyl-CoA to ethanol
[00240] The conversion of acetyl-CoA to acetaldehyde by the enzyme MhpF was recently used with the present problems discussed above. See, Figure 3, (iii). By replacing this activity with an improved acetaldehyde dehydrogenase (for example, from C. phytofermentans or another source) or a bifunctional acetaldehyde / alcohol dehydrogenase (AADH), the in vivo reaction kinetics can be increased, providing improved strain growth hostess. See, Figure 3, (iv). Sources for bifunctional alcohol / aldehyde dehydrogenase can originate from a variety of microbial sources, including, but not limited to E. coli, C. acetobutilicum, T. saccharolyticum, C. thermocellum or C. phytofermentans. 3) Deletion or alteration of glycerol-forming genes
[00241] The deletion or alteration of glycerol-forming genes can enhance the absorption of acetate through the enzymatic pathways mentioned above. The deletion of gpd1, gpd2, or both genes and / or deletion of gpp1, gpp2, or both genes can be used to eliminate glycerol formation and enhance ethanol yield. See, Figure 3, (v). However, complete elimination of glycerol may not be practical for an industrial process. See Guo, ZP., Et al., Metab. Eng. 13:49 - 59 (2011). Thus, instead of completely removing any, all or some combination of these glycerol-forming genes, one or more of these genes can be altered or unregulated to reduce glycerol formation and enhance ethanol yield. EXAMPLE 2 Biomass Derived Acetate Detoxification Via Metabolic Conversion to Acetone, Isopropanol or Ethyl Acetate
[00242] As described in this report, acetic acid is an inevitable pre-treatment and hydrolysis product, and very harmful to fermentation organisms, especially in the industrially relevant pH range 4 to 5. Removing acetic acid before fermentation through chemical or physical methods is prohibitively expensive or results in loss of sugar yield (washing). By building a pathway to convert acetic acid to acetone, isopropanol or ethyl acetate in ethanol-producing organisms, acetic acid toxicity can be reduced and an easily recovered by-product can be produced. In addition, converting acetate to a solvent will reduce the demand for base addition, lowering the overall fermentation cost and making pH control more controllable and robust. Such considerations become especially important on an industrial scale. In addition, removing acetate will decrease the amount of organic compounds spent on wastewater treatment, which will also result in lower capital and operating costs for water recycling.
[00243] However, very little is known about the use of metabolic conversion to detoxify acetate from lignocellulosic biomass. In one example, acetic acid was aerobically removed from the spent sulfite liquid in the wood using a mutant yeast. Schneider, H., Enz. Micr. Technol. 19:94 - 98 (1996). The mutant yeast, however, was unable to grow into sugars, and another strain was required to convert hydrolyzed sugars into ethanol anaerobically. The routes that can be used include those that have different purposes in different host organisms, as described in the art. For example, the metabolic conversion of acetate to acetone has been demonstrated in C. acetobutilicum and related organisms (native converters) and in E. coli (built to include the acetone pathway). See, for example, Bermejo, L.L., et al., Appl. Environ. Microbiol. 64 (3): 1079 - 85 (1998). The production of isopropanol from carbohydrates also occurs naturally in organisms related to C. acetobutilicum, and the carbohydrate-isopropanol route was engineered in E. coli and yeast. See, for example, U.S. Patent Application Publication No. 2008/0293125. Ethyl acetate is a product of some yeast and bacterial fermentations and is an important flavor enhancing compound. However, ethyl acetate is considered undesirable at high levels during alcoholic fermentations and as such, attempts have been made to modify its production. These metabolic pathways were not used to detoxify acetate from lignocellulosic biomass.
[00244] This Example describes the new use of these metabolic pathways to detoxify lignocellulosic biomass and derived hydrolysates and the incorporation of these pathways in an ethanol-producing organism. The ethanol-producing organism can be bacterial or fungal, or it can be a consolidated bioprocessing organism (CBP) that also produces cellulases and other hydrolytic enzymes. 2.1 Construction of Acetate-Acetone Pathways on Bacterial and Yeast Platforms
[00245] Acetic acid is freely diffused in the cell during the hydrolysis of acetylated polysaccharides, where its conversion into acetone involves four main steps: (i) activation of extracellular acetate to acetyl-CoA, (ii) condensation of acetyl-CoA to acetoacetyl -CoA, (iii) transfer of CoA resulting in acetyl-CoA and acetoacetate, and (iv) decarboxylation of acetoacetate in acetone. See Figures 4A and 4B. In yeast, four enzymatic steps are involved (two enzymes are native and two are engineered from a bacterial source). See Figure 4B.
[00246] In bacteria, the conversion involves five enzymatic steps, in which acetic acid is activated in acetyl-CoA through acetate kinase (ack) (Figure 12 (1)), phosphotransacetylase (pta) (Figure 12 (2)), and a CoA transferase semi-reaction (ctfA ctfB) (Figure 12 (4)). Two acetyl-CoA molecules are then converted to acetoacetyl-CoA via thiolase (thl) (Figure 12 (3)), acetoacetate via the other CoA transferase (ctfA ctfB) semi-reaction (Figure 12 (4)), and finally into acetone and CO2 through acetoacetate decarboxylase (adc) (Figure 12 (5)). Although the synthetic pathway shares a common intermediate with the ethanol production pathway, carbohydrate for ethanol production remains highly linked, due to the requirement for the generation of equilibrium NAD (P) + / NAD (P) H. Hydrogenases (Figure 12 (6)) act to decouple electron acceptor regeneration and ethanol formation, resulting in the production of acetic acid via the acetate kinase and reversible phosphotransacetylase pathway. (i) Activation of extracellular acetate in acetyl-CoA
[00247] The first step in acetate metabolism is the conversion of acetate to acetyl-CoA. See Figures 4A and 4B. In E. coli and yeast this can be done via acetyl-CoA synthetase (acetate + ATP + CoA ^ acetyl-CoA + AMP + PPi). The constitutive expression of this enzyme can be complicated as in E. coli and S. cerevisiae, the functioning of this enzyme is subject to complex regulatory circuits. See Wolfe, A.J., Micr. Mol. Biol. Rev. 69:12 - 50 (2005); van den Berg, M.A., et al., J. Biol. Chem. 271: 28953 - 28959 (1996), respectively. In E. coli, acetate activation can also be performed via acetate kinase and phosphotransacetylase, as both reactions are reversible. In one aspect, acetyl-CoA synthetase is used. (ii) Condensation of acetyl-CoA to acetoacetyl-CoA
[00248] This step can occur through native enzymes in yeast, for example, Erg10, or in bacteria, for example, thiolase in bacteria, or through genes isolated from C. acetobutilicum or T. thermosaccharolyticum. (iii) CoA transfer
[00249] This step is specific to the reaction of acetoacetyl-CoA + acetate θ acetoacetate + acetyl-CoA and was only characterized in organisms similar to C. acetobutilicum. Other CoA transferases perform similar reactions and can be engineered to perform this reaction. Such other CoA transferases include, but are not limited to, those from bacterial sources of Thermoanaerobacter tengcongensis, Thermoanaerbacterium thermosaccharolyticum, Thermosipho africanus and Paenibacillus macerans. (iv) Decarboxylation of acetoacetate in acetone
[00250] This step can be performed by the acetoacetate decarboxylase found in C. acetobutilicum, Paenibacillus macerans, Acidothermus cellulolyticus, Bacillus amyloliquefaciens and Rubrobacter xylanophilus or other bacteria. Eukaryotic acetoacetate decarboxylases can also be used to construct this pathway.
[00251] To use the above route, enzymes to metabolize the conversion of acetate to acetone in T. saccharolyticum and E. coli were engineered in pMU1299. See Figure 5B. Plasmid pMU1299 replicates in yeast and E. coli and integrates into the genome of T. saccharolyticum at the L-ldh locus. pMU1299 comprises the native T. saccharolyticum pta and ack genes directed by the native pta promoter and C. acetobutilicum thiolase1 genes, CoA transferase (ctfAB), and decarboxylase acetoacetate (adc) directed by the C. thermocellum cbp promoter. Plasmid or genomic integration is selected for resistance to kanamycin in bacteria, and the plasmid is maintained in yeast by complementing ura3.
[00252] pMU1299 was transformed into E. coli and acetone production was determined. Cultures were grown at 37 ° C in LB medium supplemented with 25 g / L glucose and 4 g / L sodium acetate for 170 hours. The results from pMU1299 in E. coli were compared to a control strain that carries plasmid pMU433, which has only the genes pta, ack, and kanR. The stoichiometry of the global reaction is shown in Figure 5A. The fermentation results are shown in Table 3. Compared to the sample medium only, acetate levels decrease, acetone is produced and an additional 3 g / L of glucose is consumed by the strains that carry pMU1299. Table 3. Fermentation of E. coli from Acetic Acid to Acetone
(v) .1 Decrease in Acetic Acid Production Via PTA and ACK Through Spontaneous Hydrogenase Mutations
[00253] As discussed above, the synthetic acetic acid route in acetone shares a common intermediate (acetyl-CoA) with the ethanol production route. In the latter, the production of carbohydrate in ethanol remains highly linked, due to the requirement to balance the generation of NAD (P) + / NAD (P) H. Hydrogenases (Figure 12 (6)) act to decouple the electron acceptor regeneration and ethanol formation, resulting in the production of acetic acid through the acetate kinase and reversible phosphotransacetylase pathway. Thus, to increase the conversion of exogenous acetic acid to acetone and to reduce the intracellular production of acetic acid, hydrogenases can be manipulated using, for example, mutagenesis.
[00254] During the growth adaptation of the ethanological strain Δldh, Δpta and Δack M0863, spontaneous hydrogenase hfs mutations were introduced. The M0863 strain was derived from the M0355 strain, a strain of T. saccharolyticum engineered to have deletion-free deletions of the genes of L-lactate dehydrogenase ldh, phosphotransacetylase pta and acetate kinase ack, the construction of which is described in Shaw et al., AEM 77: 2534 - 2536 (2011). Subsequently, the M0355 strain was treated with nitrosoguanidine and screened for improved growth in steam-pretreated hardwood hydrolyzate through several rounds of mutagenesis and selection (Panlabs Biologics, Taipei, Taiwan). A population enriched for growth in hardwood hydrolyzate was then inoculated into a cytostat (Kacmar et al., J. of Biotechnology 126: 163 - 172 (2006)) and selected for the increased growth rate in a cell culture population fixed. A strain isolated from cytostat selection via plating on a solid medium containing agar was designated M0863.
[00255] Hydrogenase hfs mutations have been characterized and are described in Shaw et al., J. Bact. 191: 6457 - 64 (2009), fully incorporated as a reference in this report, examples of which are shown in Table 4 below. Table 4. Spontaneous hfs hydrogenase mutations in T. saccharolyticum


These mutations were then reintroduced into the T. saccharolyticum wild type by means of a non-replicating plasmid with two regions of homology to the T. saccharolyticum chromosome flanking a kanamycin resistance marker (kanR). The upstream homology region, containing mutations in hfsB and hfsD, was generated by PCR from the chromosomal DNA of the M0863 strain of T. saccharolyticum. The downstream region was also generated by PCR from the chromosomal DNA of M0863, but showed no deviations from the wild type sequence. The plasmid was constructed by cloning yeast homology and transformed into T. saccharolyticum after a protocol of natural competence (Shaw et al., AEM 76: 4713 - 4719 (2010)). The transformants were screened for the presence of the kanR marker through colony PCR and then for the presence of hfsB and hfsD mutations through DNA sequencing. Since the incorporation of hfs mutations is dependent on the location of homologous crossover recombination, it was expected that a certain percentage of the kanR transformants would present the h08s and hfsD loci of M0863, while another would present the wild-type hfsB and hfsD loci. A strain with the M0863 locus was identified and designated M2204, and a strain with the wild type locus was identified and designated M2205.
[00257] M2204, M2205, and wild-type strains were incubated in 10 mL of TSC7 medium initially containing 30.4 mM cellobiosis at 55 ° C under an atmosphere of 95% nitrogen and 5% carbon dioxide in capped tubes with anaerobic butyl. The inoculum was 5% v / v from a culture overnight, and the flasks were incubated for 48 hours without shaking. Lactic acid, acetic acid and ethanol from the metabolites were measured using high performance liquid chromatography (HPLC) with an Aminex HPX-87H column (Bio-Rad Laboratories, Hercules CA) and a refractive index detector. As shown in Table 5 below, the M2204 strain, containing the M0863 hfs sequence, was dramatically reduced in acetic acid compared to the WT and M2205 strains. The results are the average of four fermentations in individual flasks. Table 5. Mutations in hydrogenase hfs decrease the production of acetic acid.
(vi) 2 Acetone production in T. saccharolyticum
[00258] To use the above pathway to produce acetone in T. saccharolyticum, several genes were screened in a strain of T. saccharolyticum engineered to metabolize the conversion of acetate to acetone.
[00259] Plasmids were generated via cloning of yeast homology, as described by Shanks et al., AEM 72: 5027 - 5036 (2006). The genes of interest for the acetone production pathway were introduced downstream of a recombinant copy of the T. saccharolyticum pta and ack genes and their native promoter, which created an operon of the synthetic gene for the transcription of the genes in the acetone pathway. . In addition to the transcription that occurs from the pta promoter, the genes of interest were cloned with their native promoter and sequences upstream from Shine-Delgarno, or their cbp promoter and Shine-Delgarno sequence from C. thermocellum (Genbank HQ157351) or its adhE promoter and Shine-Delgarno sequence from T. saccharolyticum (Genbank EU313774). In some cases, transcription has been confirmed in engineered strains via real-time reverse transcriptase PCR. Plasmids were designed to replicate, using a gram positive replication origin, see WO / 2010/075529, integrally incorporated as a reference in this report, or to integrate into the T. saccharolyticum chromosome at the ldh locus using the same homology regions flanking ldh, as described in Shaw et al., AEM 77: 2534 - 2536 (2011), fully incorporated as a reference in this report.
[00260] The plasmids were transformed into T. saccharolyticum after a protocol of natural competence (Shaw et al., AEM 76: 4713 - 4719 (2010)) and selected for resistance to the antibiotic kanamycin or erythromycin (Shaw et al., J Bact 191: 6457 - 64 (2009)). Antibiotic-resistant transformants were screened via colony PCR or plasmid miniprep for appropriate chromosomal integration or maintenance of the replicating plasmid, respectively.
[00261] Acetone was detected by high performance liquid chromatography (HPLC) with an Aminex HPX-87H column (Bio-Rad Laboratories, Hercules CA) and a refractive index and UV260nm detector operating in series to distinguish acetone from ethanol from near-elution . Alternatively, acetone was detected directly in the fermentation cultures by means of the Rothera test, in which 5 ml of the fermentation medium were saturated with ammonium sulfate (NH4) 2SO4, followed by the addition of 50 mg of sodium nitroprusside and by mixing . 1 mL of 18 M NH4OH was then added as a top layer, and acetone was detected by generating a red to purple band formation within 2 min to 1 hour at the fermentation medium and 18 M NH4OH interface. screening are shown in Table 6 below. Table 6. Screening for genes involved in acetone production


[00262] Plasmid pMU2627 (Figure 13; SEQ ID NO: 1), containing T. saccharolyticum pta and ack encoding phosphotransferase and acetate kinase, T. melanesiensis ctfA and ctfB encoding CoA transferase acetate, T. thermosaccharolyticum thl encoding thiolase, and B amyloliquefaciens adc encoding acetoacetate decarboxylase, was integrated into the chromosome of the M1442 strain of T. saccharolyticum, (an ethanological strain containing spontaneous mutations derived from M0863 in hydrogenase). Lee et al., Biomass and Bioenergy 35: 626 - 636 (2011). pMU2627 was generated via cloning of yeast homology, as described by Shanks et al. AEM 72: 5027 - 5036 (2006) from plasmid pMU433, which showed the regions of homology targeting ldh, from T. saccharolyticum pta and ack, from the kanR antibiotic resistant gene, from the origin of replication p15A E. coli, from origin of S. cerevisiae CEN / ARS of replication and of the S. cerevisiae ura3 gene. Primers X12406, X12407, X12408, X12409, X13293 and X13294 were used to amplify the specified gene targets and create 5 'tails of homology for binding the yeast to SnaB1 restricted digested pMU433. See, Table 7 below. Table 7. Primers used in the construction of pMU2726 and pMU2741

[00263] M2212 was inoculated (in OD600 = 0.36) in TSC7 medium (Table 8) and fermented at 51 ° C in a batch fed with untreated hemicellulose enriched with 34% v / v containing acetylated xylan in a concentration of 147 g / L of carbohydrates. The pH was maintained at 5.8 using 5 M potassium hydroxide. The total carbohydrates fed were 50 g / L. The batch fermentation was fed at 20% v / v of the batch during the first 26 hours and then increased to 3% v / v per day at a final concentration of 34% in 140 hours. The results of fermentation, measurement of xylose, ethanol, acetate, and acetone, are shown in Figure 14. Table 8. TSC7 medium

[00264] A comparison of the acetone production of the engineered M2212 strain and the precursor M1442 ethanological strain was performed on 100 g / L of maltodextrin and 10 g / L of acetic acid. The strains were grown in pressure flasks containing TSC7 medium with 4 g / L (NH4) 2SO4 and without a pH control. As shown in Figure 15, M2212 had a higher consumption of maltodextrin (reported as glucose units) and ethanol production compared to the parent strain. M2212 converted the acetic acid in the medium to acetone, as shown in Figure 16, and also maintained a pH in the range of 5.6 to 5.9 (Figure 17). The precursor ethanological strain, however, did not produce detectable acetone (Figure 16) and the excess of acetic acid in the medium caused a drop in pH during the course of fermentation (Figure 17). Thus, this Example shows that a strain of T. saccharolyticum engineered to convert acetate to acetone, also produces an increased ethanol yield and prevents a decrease in pH caused by excess acetic acid in the fermentation medium. The data shown in Figures 15 to 17 are from replicated fermentations, with standard deviations of <1 g / L. 2.2 Construction of Yeast to Metabolize Acetic Acid in Anaerobically Isopropanol
[00265] This metabolic pathway is engineered off the acetate pathway into acetone using an additional final step to convert acetone to isopropanol, as follows: 2.3 acetate +2 CoA + 2 ATP ^ 2 acetyl-CoA 2 acetylCoA ^ acetoacetyl-CoA + CoA acetoacetyl-CoA ^ acetoacetate acetoacetate ^ acetone + CO2 acetone + NADH ^ isopropanol
[00266] The introduction of these reactions in yeast will not only eliminate the need for pH control (when urea is used as a nitrogen source), but probably will also enhance the alcohol yield. The reduction equivalents that are formed in excess during the formation of biomass can be used to reduce acetone, and the formation of glycerol (from sugar) is no longer necessary. The requirement for ATP is not a problem, since the amount is relatively small compared to the total amount formed. Even this small amount of ATP for isopropanol synthesis will be beneficial, since it requires extra alcohol production at the cost of biomass formation. Additions of acetone to anaerobic yeast cultures showed that acetone decreases with the appearance of isopropanol. To date, 200 mg / L of isopropanol has been produced in this way. This illustrates the endogenous activity of acetone activity in isopropanol in vivo in yeast. A concomitant decrease in glycerol formation is observed, suggesting that the NADH required at this stage can reduce the reduction equivalents typically produced during glycerol formation. 2.3 Construction of T. saccharolyticum to metabolize Acetic Acid In Isopropanol
[00267] This metabolic pathway engineered out of the acetate pathway in acetone to produce isopropanol. See, Figure 18. The synthetic acetone pathway described above has been modified in the following ways: addition of a secondary alcohol dehydrogenase (adhB) from T. ethanolicus, deletion of pta and ack and targeted integration of the synthetic pathway into the native adhE locus of T. saccharolyticum, which eliminates the formation of ethanol. With these modifications, the following stoichiometry was predicted, with a ΔG0 = -188 kJ / rxn at pH 7: Glucose + 2 Acetate ^ 2 Isopropanol + 4 CO2 + 2 H2.
[00268] Plasmid pMU2741 (Figure 19; SEQ ID NO: 2) was constructed via yeast homology cloning, as described by Shanks et al., AEM 72: 5027 - 5036 (2006) with primers X12406, X12407, X12408 , X12409, X13293, X13294, X12411, and X12412. See Table 7. It contains the T. melanesiensis ctfA and ctfB genes that encode CoA transferase acetate, the T. thermosaccharolyticum thl gene that encodes thiolase, the B. amyloliquefaciens adc gene that encodes acetoacetate decarboxylase and the T adhB gene ethanolicus encoding secondary alcohol dehydrogenase (GenBank Access No TEU49975). It was transformed into the M0355 strain, a Δldh Δpta Δack strain described in Shaw et al., AEM 77: 2534 - 2536 (2011), with a wild type hydrogenase gene that does not have spontaneous mutations. The transformants were screened for their fermentation profile through anaerobic growth in TSC7 medium at 55 ° C for 72 hours without stirring. Several transformants followed the predicted stoichiometry, an example of which (strain 4A) is shown below in Table 9. Table 9. Isopropanol production in an engineered T. saccharolyticum strain

2.4 Construction of Yeast and Bacteria to convert Acetate and Ethanol to Ethyl Acetate
[00269] Each step of this metabolic pathway can proceed, as follows: acetate + CoA + ATP = acetyl-CoA + AMP + H2O acetyl-CoA + ethanol = ethyl acetate + CoA
[00270] With the global reaction proceeding: acetate + ethanol + ATP θ ethyl acetate + H2O + AMP.
[00271] Acetate and ethanol can be formed during hydrolysis and fermentation and the enzymes needed for this route include activation of acetate in acetyl-CoA (see acetone section 1 above), and an alcohol acetyltransferase to convert acetyl-CoA and ethanol to acetate of ethyl. Yeast contains native acetyl-CoA synthetases and a native alcohol acetyltransferase (ATF1), which, when overexpressed, has been shown to reduce acetate levels from 0.5 g / L to 0.2 g / L during an alcoholic fermentation. Lilly, et al., Appl. Environ. Microbiol. 66: 744 - 53 (2000). EXAMPLE 3 Construction of Yeast Strains with Improved Tolerance in Acetate and Other CBP By-Products
[00272] As described in this report, a large portion of cellular energy must be expended to avoid the harmful effects of acetic acid during the conversion of lignocellulosic materials into ethanol. Because of these effects, cell growth and other important phenotypes are slowed, resulting in a sub-ideal process. Additional acid by-products and other organic by-products, including aldehydes, can also be added to the sub-ideal processing of lignocellulosic materials.
[00273] The present invention describes several engineered ways to overcome the inhibitory effects of biomass inhibitors, including, but not limited to, acetate and other CBP by-products, by converting the acetate into a less inhibitory compound, such as that described in this report. To improve the ability of yeast strains to grow in the presence of a biomass inhibitor, yeast strains have been engineered, which have increased growth tolerance to biomass inhibitors. 1) Adaptation of Yeast Strains to Acetate and Other By-Products in Pre-treated Cellulosic Crude Material
[00274] M1254 is a previously isolated yeast strain based on high tolerance to hydrolyzate. See the International Order In PCT / US2009 / 065571, the contents of which are incorporated as reference in this report. The use of increased xylose in the presence of inhibitors is critical to the performance of the yeast platform. M1254 was therefore developed in the cytostat using a feed medium containing 2 g / L of yeast extract, 2 g / L of peptone, 2 g / L of xylose, and 8 g / L of acetate at pH 5.4 and at 39.8 ° C. After approximately 10 days of continuous cultivation in the cytostat, a sample was taken and M1339 was isolated as a single colony from the heterogeneous population. M1339 was selected based on the growth tests described below.
[00275] M1339 was further adapted in the cytostat in medium containing 5 g / L of xylose, 10 acids based on hydrolyzate (1 g / L of lactic, 8 g / L of acetic, 30 mg / L of 2-furoico, 2.5 mg / L of 3,4-dihydroxybenzoic, 2.5 mg / L of 3,5-dihydroxybenzoic, 5 mg / L of vanilic, 2.5 mg / L of homovanilic, 15 mg / L syringe, 17.5 mg / L of gallic and 15 mg / L of ferulic) and five aldehydes (175 mg / L of 5-hydroxymethylfurfural, 150 mg / L of furfural, 6 mg / L of 3,4-hydroxybenzaldehyde, 12 mg / L vanillin and 27 mg / L syringaldehyde) at pH 5.4 and 40 ° C. This adaptation led to the isolation of M1360, M1361 and M1362.
[00276] M1360 was further adapted into a chemostat containing 0.1 g / L of glucose, 5 g / L of xylose, 0.4 g / L of furfural and 0.4 g / L of 5-hydroxymethylfurfural. After selection, M1499 was isolated. M1499 was later adapted into separate chains, as follows.
[00277] An adaptation chain started with a selection of chemostat based on medium containing 10 g / L of yeast extract, 20 g / L of peptone, 20 g / L of xylose, supplemented with soluble inhibitors removed from the mixed hardwood pre-treated at 35 ° C. This selection of chemostat resulted in the identification of the M1646 strain. M1646 was subsequently adapted in a chemostat again to soluble inhibitors obtaining water by rinsing through the pre-treated mixed hardwood, including acetate, and supplemented only with 6.7 g / L of nitrogen based yeast without amino acids at 35 ° C. After selection, M1715 was isolated. M1715 was then adapted to 5 g / L of xylose and 6.7 g / L of nitrogen based yeast at 40 ° C in the cytostat, in order to guarantee strong thermotolerance, and the resulting strain was M1760. Starting from M1646, an additional selection strategy was implemented involving starting with 10 g / L of M1646 and performing repeated batch fermentation of washing liquid from the pretreated hard wood, which includes acetate, with the transfer of all cells from one batch fermentation to the next. After a series of transfers, M1819 was isolated from these fermentations.
[00278] Starting from M1499 again, M1499 was adapted into a chemostat with 5 g / L of yeast extract, 5 g / L of peptone, 5 g / L of xylose and 8 g / L of acetate at a feed pH of 5.4 and 35 ° C. Therefore, acetate was the only inhibitor in this selection and becomes more inhibitory, since the pH in the chemostat was lower than in the feed medium. After weeks of selection, M1577 was isolated. M1577 was later adapted into a chemostat containing 6.7 g / L of nitrogen based yeast without amino acids and 20 g / L of xylose with soluble inhibitors supplemented from pretreated hardwood, which includes acetate. The resulting strain from this selection is M1818.
[00279] The M1818 strain was further adapted in batch batch culture using washing liquid from pre-treated hardwood, which includes acetate and other biomass derived inhibitors. Adaptations were carried out at 39 ° C, pH 6.5, with 6.7 g / L of nitrogen based yeast without amino acids as the medium. After adaptation, colonies derived from the plating of the growth medium were screened for their performance in the medium containing washing liquid, and the M1927 strain was identified as the exceptional performance. M1927 was adapted to the wash generated from pre-treated mixed hard wood at 38 ° C. The wash was supplemented with 5 g / L of xylose, 6.7 g / L of yeast nitrogen base without amino acids and ergosterol / Tween 80 in standard concentrations and adjusted to pH 5.5 using calcium hydroxide. During the first 100 h, the chemostat feed medium was slowly increased in the wash concentration. Ultimately, the feed medium reached 33% of washing and the growth rate was 0.076 h-1. See Figure 28. Samples were regularly taken from the chemostat and performance tracked by HPLC and offline pH measurement. No pH control was implemented and the effluent pH was approximately 5.2 throughout the adaptation. In total, the adaptation took almost 900 hours and 97 generations. A sample was taken at approximately 450 h and plated for single colonies. From the single colonies, almost all colonies have been improved with respect to M1927. Six colonies were screened in total in duplicate, and 11 out of 12 screenings resulted in higher ethanol titers and lower residual xylose compared to fermentations with M1927. All fermentations are inoculated with approximately 0.03 g / L of DCW and thus significant fermentation only occurs in combination with substantial growth in the wash. Colonies screened after adaptation showed higher fermentation rates and titers compared to M1927. M2108 has emerged as the high-performance colony. 2) Analysis of Yeast Strains with Improved Growth and Performance Profiles
[00280] To evaluate the adaptation of yeast strains to inhibitors in pre-treated cellulosic crude material, growth tests were performed. The yeast strains were grown in xylose in the presence of acetate or in the presence of acetate, nine other acids based on hydrolyzate, and five aldehydes (see above). Growth tests involved inoculating 96-well plates and cultivation at specified temperatures with agitation in a BioTek Synergy 2 plate reader. The initial optical density (OD) for all strains tested was standardized at the same OD, typically at OD = 0.03 , with a minimum of 3 measurements replicated per strain. OD was measured every 15 minutes at an absorbance of 600 nm. The specific growth rate was calculated using the standard technique to determine the coefficient of a line with the best fit for a semi-log batch of optical density over time. All growth assays that follow used this method to determine the specific growth rate were used to identify more tolerant strains.
[00281] Yeast strains M1339 and M1254 were grown in xylose at pH 5.4 and 39 ° C for 48 hours in the presence of acetate (8 g / L). The growth rate, as measured at an absorbance of 600 nm, was monitored every 15 minutes during the incubation period. As shown in Figure 6, the yeast strain M1339 showed improved tolerance and grew faster in the presence of acetate compared to the yeast strain M1254. The growth rate of M1339 in this condition is increased 3 times over the growth rate of M1254 in this complex medium containing 2 g / L of yeast extract, 2 g / L of peptone, 2 g / L of xylose and 8 g / L of acetate at pH 5.4.
[00282] Yeast strains M1360, M1361, M1362, M1254 and M1339 were grown in xylose at pH 5.4 and 40 ° C for 48 hours in the presence of acetate, nine other acids based on hydrolyzate, and five aldehydes (see above). The specific growth rate, as measured at an optical density of 600 nm using a BioTek Synergy 2 plate reader, was calculated from the coefficient of a line adjusted to a batch of optical density semilog over time. As shown in Figure 7, the yeast strains M1360, M1361, and M1362 showed improved growth tolerance in the presence of acetate and other inhibitors compared to the yeast strains M1254 and M1339. The specific growth rate increased dramatically in this toxic medium for M1360, M1361, and M1362, representing a 16-fold increase in the growth rate for M1360 compared to M1254, which grows slowly in this medium. The specific growth rate of the yeast strains M0509, M1577 and M1715 in xylose or xylose and 5-hydroxymethylfurfural (0.4 g / L) and furfural (0.4 g / L) inhibitors was also measured. As shown in Figure 10, strains M1577 and M1715 showed increased growth rates compared to the previous strain M0509.
[00283] To assess the performance of improved yeast strains under process conditions, glucose utilization, ethanol production and biomass yield were measured. The M1360 yeast strain was inoculated (60 mg / L) in a medium containing 150 g / L of glucose, 3 g / L of corn maceration liquid, 1.23 g / L of magnesium sulfate heptahydrate, 1 , 1 or 2.2 g / L of diamonium phosphate (DAP), supplemented with trace metals (0.1 mg / L of potassium iodide, 1 mg / L of boric acid, 3 mg / L of iron sulphate hepta -hydrate, 4.5 mg / L dehydrated calcium chloride, 0.4 mg / L disodium molybdenum dihydrate, 0.3 mg / L copper (II) sulfate pentahydrate, 0.3 mg / L of cobalt (II) chloride hexahydrate, 0.84 mg / L of manganese chloride dihydrate, 4.5 mg / L of zinc sulphate heptahydrate, 15 mg / L of ethyldiaminetetraacetate) and vitamins (0.05 mg / L of biotin, 1 mg / L of calcium pantothenate, 1 mg / L of nicotinic acid, 25 mg / L of myo-inositol, 1 mg / L of thiamine hydrochloride, 1 mg / L of pyridoxol hydrochloride and 0.2 mg / L of para-aminobenzoic acid) and grown at 40 ° C at pH 5.0. Glucose utilization (g / L) and ethanol production (g / L) were measured over a period of 72 hours. As shown in Figure 8, glucose utilization was rapid in the presence or absence of 2 x DAP and ethanol production was high.
[00284] The improved performance of the yeast strains M1360, M1443 and M1577 under process conditions was also measured using a press test. Briefly, the press test first requires the removal of liquid from the pre-treated substrate by applying pressure to a batch of solid substrate in a hydraulic press. The liquid compressed from the solids is defined as pressed, and the pressed contains the concentration of soluble inhibitors present in the substrate. For example, if the substrate had 50% moisture content and 50% solid content before the press, the created press is defined as 50% solid equivalents. Therefore, a press of 25% solid equivalents would have a medium in which half of the liquid was pressed. Typically, a strain is inoculated at 0.1 g / L dry cell weight with 6.7 g / L nitrogen based yeast without amino acids and 20 g / L sugar (glucose or xylose) at pH 5.0 in a flask anaerobic sealed. The strains are then incubated for 24 hours before terminal concentrations of dry cell weight, sugar and ethanol are measured. Thus, the yield of anaerobic biomass can be determined based on the sugar consumed; The theoretical anaerobic biomass yield is 0.1 g of biomass / g of sugar consumed.
[00285] The yield of anaerobic biomass in 20 g / L of glucose from strains M1360, M1443 and M1577 in presses of 5%, 7%, and 9% of solid equivalents was measured. M1443 is a CBP derivative of M1360, which was constructed to express Saccharomycopsis fibuligera beta-glucosidase, T. emersonii cellobiohydrolase I and Chrysosporium lucknowense cellobiohydrolase II. Figure 9 shows the results of each strain in the various presses of solid equivalents. The strains M1360 and M1443 provided similar theoretical biomass yields in presses of 5% and 7% of solid equivalents; however, in the presses of 9% solid equivalents, the M1360 strain showed a theoretical biomass yield about 3 times lower compared to M1443. See, Figure 9. By comparison, the M1577 strain provided at least about 3 times the theoretical biomass yield compared to the M1360 or M1443 strains in pressures of 5%, 7%, or 9% solid equivalents. See, Figure 9. Strains M1760, M1818 and M1819 were also evaluated using a press-on assay in 13%, 15%, and 17% solid equivalents using 20 g / L of xylose as the carbon source. See, Figure 11A (biomass yield (g / g)) and 11B (ethanol production (g / L)). Thus, the adapted strains demonstrate high anaerobic biomass yields and improved performance under process conditions, when the inhibitor mixture is compressed out of the solids used in the process.
[00286] The M1818 strain was compared directly against M1927 during the fermentation of the washing liquid batch from pretreated hard wood. In addition, M1927 was compared directly against M2108 in a similar experimental configuration after this new strain was derived. Figures 29 and 30 show the comparison of the performance of the strain under these conditions. When a concentrated washing liquid (via evaporation of the washing) was fermented at 20% of the final fermentation volume at pH 6, 35 ° C with nitrogen based yeast medium (6.7 g / L), M1927 clearly showed a better performance in relation to the parental strain M1818, creating> 30% more ethanol in 72 hours. Figure 29. When M2108 was compared to M1927 in a similar way, except under more severe conditions (25% v / v wash fermentation, pH 5.5, 38 ° C)> 30% increase in ethanol titer was observed . Figure 30.
[00287] In addition to these tests, M2108 was compared to M1927 in terms of its ability to tolerate higher wash concentrations. See Figure 31. In these tests, a toxic liquid MS928 was used in different v / v concentrations from 20% to 60% with yeast extract (10 g / L) and peptone medium (20 g / L) present . Fermentations were carried out at 35 ° C. In washdown concentrations greater than 30%, M2108 performed significantly better than M1927, producing a 40% increase in ethanol titer in 40% v / v of the wash, and a 4.5-fold increase in titer in 60% v / v of the wash, where M1927 grew only minimally. Figure 31.
[00288] Finally, Figure 32 demonstrates the positive impact that the adaptation against the washing liquid presented in the SSF process to convert the insoluble cellulosic solids from the pretreatment process. In this report, M1927 and M2108 were compared in terms of their performance at 35 ° C and 38 ° C during a fed batch, 22% solids (final) of SSF substrate pretreated with MS887 (solids, material containing glucan) at pH and temperature controlled, agitated bioreactors (1 L reactions). The fermentations were carried out at 35 ° C and 38 ° C, pH 5.0, using 12 g / L of corn maceration liquid and 0.5 g / L of DAP (diamonium phosphate) as components of the medium and loading 2 mg of TS cellulase enzyme per g of solids in the reactor. The substrate pretreated with MS887 was fed for 48 h, and ammonium hydroxide was used for pH control. Both strains showed satisfactory performance at a lower temperature, fermenting all the sugar that was released in ethanol. Figure 32. At 38 ° C, M2108 was able to ferment all the sugar in ethanol and demonstrated an increased yield, due to the higher hydrolysis temperature. M1927 was not able to ferment at the highest temperature and the sugar started to accumulate between 48 and 96 hours. Figure 32. These data adjustments indicate that the adaptation process has significantly improved the performance of these strain bottoms to convert lignocellulosic derived materials into ethanol. EXAMPLE 4 Engineered Yeast Strains for Ethanol Production
[00289] The present example describes the construction of recombinant yeast strains that convert acetic acid to ethanol and the analysis of such strains under industrial process conditions. 4.1 Construction of the Δura3, M1901 strain
[00290] The starting background strain for the recombinant yeast strains was an Δura3 auxotrophic strain, M1901, derived from M139, which is a high performance ethanological from the distillery industry (Anchor Yeast, Cape Town, South Africa ). See, for example, Borneman, et al., FEMS Yeast Res. 8 (7) 1185 - 95 (2008). The URA3 gene was deleted by transforming a PCR fragment (using primers X11276 and X11279, see Table 10 below) containing only upstream and downstream regulatory sequences without the coding sequences (SEQ ID NO: 81). The resulting transformants were plated on 5-FOA, a drug commonly used in yeast genetics to select against the URA3 gene. Colonies were selected from 5-FOA plates and the deletion was confirmed by colony PCR. Table 10. Primers used for the construction of yeast strains




Table 11. Strains and Plasmids used in this Example.


4.2 Construction of a Δura3Δgpd1Δgpd2, M1991 strain.
[00291] The gpd1 and gpd2 genes were suppressed by transforming M1901 with PCR fragments corresponding to the 5 'upstream region, G418 resistance cassette, Clonat resistance cassette (two antibiotic markers are used to delete gene copies from diploid strains), K. lactis URA3 cassette (for negative selection), and 3 'regions downstream of each locus. The 5 'gpd1 region was generated using the X11824 and X11825 primers, the 3' gpd1 region using the X11828 and X11829 primers, antibiotic markers were amplified using X11826 and X11656, K. lactis ura3 gene using X11657 and X11827, region of gpd2 5 'using X11816 and X11817 and gpd2 3' region using X11819 and X11821. See Table 10 above. Transformants were selected on double antibiotic plates. The markers were removed by transformation with PCR flanks for the upstream and downstream regions and then selected in FOA for the removal of the K. lactis ura3 gene. Colonies were screened by PCR for appropriate deletions at each locus. The sequences of the deleted gpd1 and gpd2 loci are shown below.
[00292] GPD1 deletion sequence (SEQ ID NO: 82; a small portion of the coding sequence deleted was not represented in bold below, represented by deletion Δ between t543 and g542): tacaaacgcaacacgaaagaacaaaaaaagaagaaaacagaaggccaagacagggtcaatgaga ctgttgtcctcctactgtccctatgtctctggccgatcacgcgccattgtccctcagaaacaaatcaaacacccacaccc cgggcacccaaagtccccacccacaccaccaatacgtaaacggggcgccccctgcaggccctcctgcgcgcggc ctcccgccttgcttctctccccttccttttctttttccagttttccctattttgtccctttttccgcacaacaagtatcagaatgggttc atcaaatctatccaacctaattcgcacgtagactggcttggtattggcagtttcgtagttatatatatactaccatgagtgaa actgttacgttaccttaaattctttctccctttaattttcttttatcttactctcctacataagacatcaagaaacaattgtatattgt acaccccccccctccacaaacacaaatattgataatataaagatgtctgctgctgctgatagΔtctacatgaagat tagatttattggagaaagataacatatcatactttcccccacttttttcgaggctcttctatatcatattcataaattagcattat gtcatttctcataactactttatcacgttagaaattacttattattattaaattaatacaaaatttagtaaccaaataaatataa ataaatatgtatatttaaattttaaaaaaaaaatcctatagagcaaaaggattttccattataatattagctg tacacctcttc cgcattttttgagggtggttacaacaccactcattcagaggctgtcggcacagttgcttctagcatctggcgtccgtatgta tgggtgtattttaaataataaacaaagtgccacaccttcaccaattatgtctttaagaaatggacaagttccaaagagctt gcccaaggctcgacaaggatgtactttggaatatctatattcaagtacgtggcgcgcatatgtttgagtgtgcacacaat aaaggtt
[00293] GPD2 deletion sequence (SEQ ID NO: 83; entire coding sequence has been deleted, deletion represented by Δ between C486 and c485): atagccatcatgcaagcgtgtatcttctaagattcagtcatcatcattaccgagtttgttttccttcacatgatga agaaggtttgagtatgctcgaaacaataagacgacgatggctctgccattgttatattacgcttttgcggcgaggtgccg atgggttgctgaggggaagagtgtttagcttacggacctattgccattgttattccgattaatctattgttcagcagctcttctc taccctgtcattctagtattttttttttttttttttggttttacttttttttcttcttgcctttttttcttgttactttttttctagttttttttccttccacta agctttttccttgatttatccttgggttcttctttctactcctttagattttttttttatatattaatttttaagtttatgtattttggtagattca attctctttccctttccttttccttcgctccccttccttatcΔctctgatctttcctgttgcctctttttcccccaaccaatttatcattat acacaagttctacaactactactagtaacattactacagttattataattttctattctctttttctttaagaatctatcattaacgt taatttctatatatacataactaccattatacacgctattatcgtttacatatcacatcaccgttaatgaaagatacgacacc ctgtacactaacacaattaaataatcgccataaccttttctgttatctatagcccttaaagctgtttcttcgagctttttcactgc agtaattctccacatgggcccagccactgagataagagcgctatgttagtcactac tgacggctctccagtcatttatgtg attttttagtgactcatgtcgcatttggcccgtttttttccgctgtcgcaacctatttccattaacggtgccgtatggaagagtc atttaaaggcaggagagagagattactcatcttcattgggcgatgggggggggggggggggggggggggggggggggggggggggggggg
[00294] The M1991 strain was transformed with a PCR product that amplifies the wild type ura3 gene (primers X10876 and X10877; see Table 10 above). The strains were selected in uracil minus the medium and screened by PCR to confirm the reintroduction of the wild type ura3 gene. 4.4 Analysis of acetaldehyde dehydrogenases and acetaldehyde / alcohol bifunctional dehydrogenases.
[00295] The test for various acetaldehyde dehydrogenases (ADHs) and bifunctional acetaldehyde / alcohol dehydrogenases (AADHs) was performed using a ura3 selection plasmid overexpressing the target genes. The genes were amplified from genomic DNA (E. coli, C. phytofermentans, T. saccharolyticum, Bifidobacterium adolescentis) or from synthesized genes optimized at the codon (Piromyces SP E2 and Chlamydomonas reinhardtii). Plamids were transformed in M1991 using standard techniques and selected in uracil minus the medium. An in vivo screening assay was developed using minimal YNB medium buffered with acetate at about pH 5.0. This pH is almost the pKa of acetic acid and allows sufficient transport of acetic acid in the cell for conversion to ethanol. When anaerobically grown in this medium, Δgpd1Δgpd2 strains (eg M2032) cannot ferment glucose, due to the cell's inability to recycle NAD + during glycolysis. The introduction of a functional ADH or AADH allows the regeneration of NAD + through the conversion of acetic acid to ethanol. Strains that show anaerobic growth and increased ethanol yields by eliminating the formation of absorption of glycerol and acetic acid are demonstrated to functionally express ADHs or AADHs. See Table 12 below. Table 12. Product formation, use of acetate and growth rates of ADH and AADH s in a glycerol deletion strain.


[00296] The positive growth rates and enhanced ethanol yields of strains expressing ADH / AADH demonstrate the functionality of ADH / AADHs. The lower growth rate and ethanol titre of the Chlamydomonas reinhardtii AADH (Table 12) is potentially due to a mitochondria targeting sequence predicted in the upstream portion of this gene. Removing this sequence can enhance the growth rate and ethanol titre of this strain.
[00297] A second comparison of several ADH / AADHs was carried out under fermentation conditions using Verduyn medium at controlled pH, biostat fermenters spread with nitrogen conducted at 35 ° C. As shown in Table 13 below and in Figure 25, strains expressing AADH from Piromyces SP E2 and AADH from B. adolescentis performed better than ADH mhpF from E. coli, which does not show robust growth. Table 13. Summary of strain performance in batch reactors.
4.5 Ethanol production using industrial yeast strains.
[00298] After the identification of ADH and AADHs suitable for the conversion of acetate to ethanol, the yeast tolerant to industrial acetic acid was engineered to replace the formation of glycerol with the conversion of acetate derived from lignocellulose into ethanol. The precursor strain M2108 (a robust strain that uses adapted xylose, created as described in Example 3) was used to create two derivatives, M2433, a Δgpd1 strain expressing four copies of Piromyces SP E2 AADH, and M2488, a Δgpd1Δgpd2 strain expressing eight copies of Piromyces SP E2 AADH. M2433 was created by transforming PCR products that were constructed using yeast via homologous recombination to create a cassette that replaces each of the two copies of GPD1 with two copies of Piromyces SP E2 AADH, a positive selection marker (the markers) KanMX or CloNat - one for each GPD1 locus on each copy of the chromosome), and a negative selection marker, the thymidine kinase gene (TDK) from the herpes simplex virus (GenBank Access No AAA45811; SEQ ID NO: 84 ), which creates sensitivity to the drug 5-fluorodeoxyuridine (FUDR). This results in a total of four copies of the AADH being overexpressed. PCR products that were generated for this cassette are shown below in Table 14. These products were transformed by electroporation into M2108, first selection for resistance to the CloNat drug and confirmation of correct integration via PCR, and subsequently transformation with the same products, except using the KanMX marker instead of the CloNat marker and drug selection G418 and CloNat. Again, these strains were checked by PCR for the correct genotype. After this stage, the resistant double strain was transformed with two PCR products that are capable of removing the markers via homologous recombination. These products were created with primer pairs X14180 / X14179 and X14180 / X14178. See Table 10. After transformation with these fragments, colonies were selected for resistance to FUDR and confirmed for sensitivity to G418 and CloNat, as verified via PCR for correct integration. The resulting strain was called M2433. Table 14. PCR products generated for the overexpression of GPD1 knockout and AADH of Piromyces created in M2108.

[00299] After GPD1 was cleanly replaced in M2108, further modifications were made to cleanly replace GPD2 with two copies (on each chromosome, thus, four copies in total) of Piromyces SP E2 AADH, in a manner exactly analogous to that described above . Table 15 below contains the PCR fragments that were generated for this step. The same steps were taken, as described above, with two transformation steps to create the double GPD2 substitution, followed by a transformation to clear the antibiotic and negative selection markers using the same two clean fragments from the above. The strain with suppressed GPD1 and GPD2 and eight copies of the overexpressed Piromyces SP E2 AADH was called M2488. Table 15. PCR products generated to create GPD2 overexpression


[00300] M2108, M2433 and M2488 were examined for ethanol yield, glycerol production and use of acetate. Strains were grown in sealed flasks purged with nitrogen to establish anaerobic conditions, and several different media were used. The mean minimum glucose (Figure 20A) consisted of 6.7 g / L of nitrogen based yeast, 25 g / L of glucose, 2 g / L of acetic acid, 20 mg / L of egosterol, and 420 mg / L of tween 80. Minimum xylose medium was the same as stated above, except that xylose was replaced in place of glucose. The YPD and YPX media contained yeast extract (10 g / L), peptone (20 g / L), acetate (2 g / L), 20 mg / L of egosterol, 420 mg / L of tween 80 and 20 g / L of glucose (YPD) or 20 g / L of xylose (YPX). The pH of the medium was adjusted to 5.0 for the minimum medium (no pH adjustment was made for YP-based medium), and the growth experiments were carried out at 35 ° C.
[00301] Figure 20A shows the product titles and increases in yield for these strains when grown in this minimal medium with glucose and acetate. M2433 has a partial glycerol deletion pathway and produced about half of the glycerol in the parental strain, while M2488 did not produce glycerol. Figure 20A. The M2488 strain used more acetate than M2433 and showed a greater increase in ethanol yield. Figure 20A. Nevertheless, a partial deletion of the glycerol pathway still showed an increase in ethanol yield, a decrease in glycerol formation and an increase in the use of acetate, compared to the precursor M2108. See, Figure 20A. However, the deletion strains showed reduced growth compared to the precursor M2108 in various media (YPD, YPX, YMX). See, Figure 20B.
[00302] Strains M2488 and M2433 were then compared to M2108 using simultaneous saccharification and fermentation (SSF) on a small scale (20 mL of total volume) to determine whether increased ethanol yields and use of acetate can be obtained with lignocellulosic material. The SSF conditions were as follows: the final solids loading was 20% (w / w) of substrate MS737 (an insoluble substrate derived from pretreatment of hard wood with water), 5 mg of AB Enzyme Cellulase preparation / g TS, 1% v / v inoculum, 35 ° C, pH 5.5 controlled with 5 g / L CaCO3. The medium used was yeast extract (10 g / L) and peptone (20 g / L) and the reactions were carried out in 150 ml pressure flasks purged with nitrogen sealed by combining all the above ingredients in a batch culture , gentle mixing at 125 rpm on a shaker and sampling for 144 hours. Figures 21A and 21B show the final levels of ethanol, glycerol and acetate from an SSF comparing M2488 and M2108. The ethanol titer was increased (Figure 21A) and the glycerol production was decreased (Figure 21B) for M2488 compared to the precursor strain M2108. Regardless of having a background of Δgpd1Δgpd2, some glycerol was detected in M2488, which was probably released from the lignocellulosic material and introduced by the enzymes used for hydrolysis. Significantly, final acetate levels were lower in the M2488 strain demonstrating the conversion of acetate derived from lignocellulose to ethanol under industrial processing conditions. 4.6 Ethanol production using hardwood processing medium
[00303] A large-scale SSF, comprising glucose / cellulose, was performed to compare ethanol production between the gpd deletion strains M2433 and M2488 and the precursor strain M2108 under industrially relevant conditions for hardwood processing. The SSF conditions were as follows: the final solids loading was 22% (w / w) of substrate MS0944 (an insoluble substrate derived from pretreatment of hard wood with water), 6 mg of AB Enzyme Cellulase preparation / g TS, 0.5 g / L of dry cell weight inoculum, 35 ° C, pH 5.0 controlled with 5 M NH4OH. The batch fed was carried out for 50 hours with five equal feedings at times 0, 18, 26, 42 and 50 hours. The medium used was 12 g / L of corn maceration liquid (CSL) and 0.5 g / L of diamonium phosphate (DAP). The reaction was carried out in a reaction size of 1 kg (about 1 L of volume) in a bioreactor controlled from the pH and temperature of Sartorius for 168 hours. As shown in Figure 22, M2433 and M2488 also worked in a sartisfactory way, providing a 6% increase in yield over M2108, representing an improvement of about 3 gallons of ethanol produced per ton of biomass. Such strains of gpd deletion showed that a similar increase in yield over the precursor strain was unexpected, given the differences observed between M2433 and M2488 grown in minimal medium with glucose. The gpd deletion strains also required less neutralizing base (12.1 g of NH4OH 5 M for M2433 and 9.4 g of NH4OH 5 M for M2488) to maintain the pH in the fermentation process compared to M2108 (15.6 g of 5M NH4OH).
[00304] The gpd deletion strains were also examined in a wash fermentation, which comprises xylose / hemicellulose. The batch conditions fed from the wash were as follows: the CS 0944 wash from a pretreatment of hard wood with water was concentrated by evaporation to bring the concentration of sugar (glucose + xylose) to 164 g / L. 2 g / L of dry cell weight were used as an inoculum to start the fermentation of the fed batch, the temperature was controlled at 35 ° C and the pH was adjusted and controlled at 6.5 with 15 M NH4OH. The volume of the starting batch at time 0 it was 575 ml and the wash consisted of 17.4% (v / v). The wash feed started in 3 hours in the fermentation, and continued at 0.14 ml / min for the first 15 h and then the feed rate was adjusted to 0.1 ml / min for the rest of the feed until 72 h. The concentration of the final wash after feeding was 53% (v / v) and the final volume was 1000 mL. The medium used was 12 g / L CSL and 0.5 g / L DAP. As shown in Figure 23A, during the wash fermentation, M2433 produced about a 12% yield increase in ethanol compared to M2108, which represents an improvement of about 1.4 gallons of ethanol produced per ton of biomass. M2488, the Δgpd1Δgpd2 bottoms, produced significantly less ethanol compared to M2108 (Figure 23A), despite the maintenance of lower concentrations of glycerol and acetate compared to M2108 and M2433 (Figure 23B), demonstrating that a double gpd deletion strain it is not robust enough under the washing processing conditions. Thus, given the differences in robustness between the M2433 and M2488 deletion strains in different biomass processing media, a qualified person can select a strain that provides the ideal production profile for the biomass processing media.
[00305] Another set of strains was created to examine the yield benefits in a GPD1 / 2 wild-type fund during the fermentation of carbohydrates through S. cerevisiae. The strains were engineered, which overexpress four copies of Piromyces SP E2 AADH at the FCY1 locus. This was done in a very similar way to the one described above. The PCR products were generated and transformed, which allowed the yeast strain to create an insertion via homologous recombination. The fragments used for this transformation are provided in Table 16 below. After transformation, strains were selected for resistance to 5-fluorocytosine, which is toxic to cells that have an intact FCY1 locus. Strains with replacement of the two copies of FCY1 by the AADH gene cassettes from Piromyces SP E2 were confirmed by PCR. This procedure was performed in M2108 (generating M2556), as well as in M2390 (generating M2739). Table 16. PCR products used to replace the FCY1 locus with 2

[00306] An SSF was performed to compare ethanol production in these newly created non-gpd deletion strains against that produced by the wild type strain, M2108, as well as the GPD1 (M2433) and GPD1 and GPD2 (M2488) deletion strains . Small-scale SSF (20 mL total volume) was used to determine whether increased ethanol yields and acetate utilization can be achieved with lignocellulosic material. The small-scale SSF conditions were described above: the final solids loading was 20% (w / w) of substrate MS737 (an insoluble substrate derived from pretreatment of hard wood with water), 5 mg of AB preparation Cellulase enzyme / g TS, 1% v / v inoculum, 35 ° C, pH 5.5 controlled with CaCO3 5 g / L. The medium used was yeast extract (10 g / L) and peptone (20 g / L) and the reactions were carried out in 150 ml pressure flasks purged with nitrogen sealed by combining all the above ingredients in a batch culture , gentle mixing at 125 rpm on a shaker and sampling for 144 hours. As shown in Figure 24A, M2556 produced more ethanol compared to the gpd deletion strain, while all three produced more ethanol compared to the precursor strain M2108. M2556 showed an increase of about 9% in ethanol yield, while M2433 and M2488 showed an increase of about 6.5% and about 5.5% in ethanol yield, respectively. M2556 also produced more glycerol and used less acetate compared to the gpd deletion strain, but M2556 showed lower levels of glycerol and acetate compared to M2108. Figure 24B. Figures 33 and 34 show the results for an M2390 derivative expressing AADH. This strain, M2739, showed the same ability to increase ethanol yield, and to take acetate, in SSF with 20% solids using pretreated hardwood in small sealed 20 mL bottles, compared to the parental strain M2390. Figures 33 and 34. These results show that AADH overexpression is applicable to multiple strains with an industrial background. Overall, these results demonstrate that improvements in ethanol yield can be obtained by building an improved AADH in a host cell, in the presence or absence of gpd deletions. Overexpression of AADH can also lead to concomitant decreases in acetate and glycerol in SSF, without deleting gpd. 4.7 Ethanol production using corn processing medium 4.7.1 Corn paste
[00307] The amount of fermentable substrate available for the industrial production of ethanol through S. cerevisiae is limited to the glucose released during the pulping process and / or enzymatic hydrolysis through the addition of amylase enzymes. In this process, a small amount of acetate, between 0.2 to 0.5 g / L, is produced. The addition of a bifunctional ADH can allow the absorption of this acetate and conversion to ethanol resulting in a higher ethanol yield. Additionally, acetate can act as an electron sink during anaerobic or microaerobic growth considering the reduction of glycerol and increased ethanol yield. See U.S. Order No. 61 / 472,085, incorporated in its entirety as a reference in this report.
[00308] A shake flask fermentation analysis was performed using 25% corn paste solids to compare the glycerol deletion mutant M2085 (gpd1Δgpd2Δfdh1Δfdh2Δ) with M2158 (fcyΔ :: ADHE gpd1Δ :: ADHE gpd2Δfdh1Δfdh2) glycerol deletion containing 8 copies of a bifunctional E. coli ADH (SEQ ID NO: 51). The flasks were tested multiple times or tested only at the end point (“sample only”). The analysis of ethanol levels indicates that the expression of AADH allowed increased ethanol yield when fermentations were experimented multiple times. See, Figure 26A. Because sampling involves removing air retention, a temporary aerobic or microaerobic medium can be created. When air retention was left during the course of fermentation, no benefit from AADH expression was observed. Figure 26B shows the absorption of acetate through M2158, but not by the wild type strain. The slight increase in acetate at the end of fermentation was probably a result of cell lysis and is usually seen with all strains. 4.7.2 Corn Fiber
[00309] The acetate present in the corn fiber is not accessible after the paste and enzymatic hydrolysis through the amylases used in the industry. However, this acetate can be released if the fiber that remains after distillation is hydrolyzed. To determine whether the acetate generated by corn fiber hydrolysis can be converted into ethanol, the strains M2556 (contain the Piromyces SP E2 bifunctional ADH) and M2488 (contain the gpd1 and gpd2 deletions, in addition to the expression of the bifunctional ADH of Piromyces SP E2) were inoculated in fermentations containing 30% corn fiber wash solids. The experiments were carried out in shaken flasks capped with air retention and tested in 24 and 96 hours, in order to measure the metabolites by HPLC. As shown in Figure 27, strains containing AADH are shown to remove acetate from hydrolyzed fiber resulting in a reduction in glycerol levels. Incorporation as a Reference
[00310] All published U.S. Patents and U.S. Patent Applications cited in this report are incorporated by reference. Equivalents
[00311] Those skilled in the art will recognize, or be able to determine, using no more than routine experimentation, many equivalents to the specific modalities of the invention described in this report. It is intended that such equivalents are covered by the following claims.

权利要求:
Claims (6)
[0001]
1. Recombinant yeast CHARACTERIZED by the fact that it comprises one or more native enzymes and one or more heterologous enzymes that work in one or more metabolic pathways engineered to convert acetate into ethanol, in which said one or more native and / or heterologous enzymes are activated, overloaded or unregulated, wherein at least one of said one or more native enzymes is a glycerol-3-phosphate dehydrogenase (GPD) which is unregulated and encoded by a gpd1 polynucleotide, a gpd2 polynucleotide, or both a gpd1 polynucleotide and one polynucleotide gpd2, wherein at least one of said one or more heterologous enzymes is a bifunctional acetaldehyde / alcohol dehydrogenase, and wherein said bifunctional acetaldehyde / alcohol dehydrogenase is derived from E. coli, C. aceto-butylicum, T. saccharolyticum, C. thermocellum C. phytofermentans, Chlamydomonas reinhardtii, Piromyces SP E2, Bifidobacterium adolescentis, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, SEQ ID NO: 62, SEQ ID NO: 64 or SEQ ID NO: 66.
[0002]
2. Recombinant yeast, according to claim 1, CHARACTERIZED by the fact that one of the so-called engineered metabolic pathways comprises the following steps: (a) conversion of acetate to acetyl-CoA and (b) conversion of acetyl-CoA to ethanol , wherein said acetate is converted to acetyl-CoA by an acetyl-CoA transferase (ACS), or wherein said acetate is converted to acetyl-P by an acetate kinase; and said acetyl-P is converted to acetyl-CoA by a phosphotansacetylase.
[0003]
3. Recombinant yeast, according to claim 1, CHARACTERIZED by the fact that said yeast is selected from the group consisting of Saccharomyces cerevisiae, Kluyveromyces lactis, Kluyveromyces marxianus, Pichia pastoris, Yarrowia lipolytica, Hansenula polymorpha, Phaffia rhodo Candida utliis, Arxula adeninivorans, Pichia stipitis, Debaryomyces hansenii, Debaryomyces polymorphus, Schizosaccharomyces pombe, Candida albicans and Schwanniomyces occidentalis.
[0004]
4. Recombinant yeast according to claim 1, CHARACTERIZED by the fact that it additionally comprises a native and / or heterologous gpd1 polynucleotide operably linked to a native gpd2 promoter polynucleotide, a native gpd2 polynucleotide and / or operably linked heterologous to a native gpd1 promoter polynucleotide, or a mutation in a hydrogenase.
[0005]
5. Process for converting biomass into ethanol CHARACTERIZED by the fact that it comprises contacting the biomass with a recombinant yeast, as defined in claim 1.
[0006]
6. Fermentation medium CHARACTERIZED by the fact that it comprises one or more recombinant yeasts, as defined in claim 1.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20200095613A1|2020-03-26|Method for acetate consumption during ethanolic fermentation of cellulosic feedstocks

---

BR112012028290B1|2021-02-02|recombinant yeast, process to convert biomass into ethanol and fermentation medium comprising said yeast

---

US11034967B2|2021-06-15|Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors

---

EP3033413B1|2020-06-24|Methods for the improvement of product yield and production in a microorganism through glycerol recycling

---

US20200270657A1|2020-08-27|Production of malonyl-coa derived products via anaerobic pathways

---

CN105121637B|2019-12-24|Electron-consuming ethanol production pathway replacing glycerol formation in saccharomyces cerevisiae

---

US8435770B2|2013-05-07|Gene knockout mesophilic and thermophilic organisms, and methods of use thereof

---

US20120149077A1|2012-06-14|Mesophilic and Thermophilic Organisms Modified to Produce Acrylate, and Methods of Use Thereof

---

EP3298133B1|2019-09-25|Acetate consuming yeast cell

---

Scully et al.2017|Recent advances in genetic engineering of thermophilic ethanol producing bacteria

---

CA3119639A1|2020-05-22|Synergistic bacterial and yeast combinations

同族专利:

---

公开号 | 公开日

---

CA2798452A1|2011-11-10|

---

US20130273555A1|2013-10-17|

---

WO2011140386A3|2012-01-05|

---

US9605269B2|2017-03-28|

---

BR112012028290A2|2015-09-22|

---

CA2798452C|2019-09-03|

---

WO2011140386A2|2011-11-10|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

AT325196T|1998-07-10|2006-06-15|Fluxome Sciences As|METABOLICALLY MODIFIED MICROBIAL CELL WITH CHANGED METABOLITE GENERATION|

---

US7109010B2|2000-11-22|2006-09-19|Nature Works Llc|Methods and materials for the synthesis of organic products|

---

WO2004085627A1|2003-03-26|2004-10-07|Forskarpatent I Syd Ab|New saccharomyces cerevisiae strains utilizing xylose|

---

SE0400815D0|2004-03-26|2004-03-26|Forskarpatent I Syd Ab|Traits in recombinant xylose-growing Saccharomyces cerevisiae strains using genome-wide transcription analysis|

---

DK1781772T3|2004-07-16|2017-01-09|Dsm Ip Assets Bv|Metabolic MODIFICATION of xylose-fermenting eukaryotic cells|

---

WO2007143245A2|2006-06-01|2007-12-13|Midwest Research Institute|An l-arabinose fermenting yeast|

---

US20080293086A1|2006-09-18|2008-11-27|Cobalt Technologies, Inc. A Delaware Corporation|Real time monitoring of microbial enzymatic pathways|

---

CN101528936A|2006-10-31|2009-09-09|代谢探索者公司|Process for the biological production of 1,3-propanediol from glycerol with high yield|

---

CA2715093A1|2006-12-01|2008-11-27|Gevo, Inc.|Engineered microorganisms for producing n-butanol and related methods|

---

EP2147111A4|2007-04-18|2010-06-23|Gevo Inc|Engineered microorganisms for producing isopropanol|

---

WO2009012210A2|2007-07-13|2009-01-22|Regents Of The University Of Minnesota|Ethanol-producing microorganisms and methods of using|

---

BRPI0813710B1|2007-07-23|2018-10-09|Dsm Ip Assets Bv|A method of identifying a heterologous polypeptide having enzymatic activity to convert pyruvate, acetaldehyde or acetate to acetyl-coa in the yeast cell cytosol, vector for the expression of heterologous polypeptides in yeast, recombinant yeast cell and method of producing a fermentation product.|

---

WO2009013160A2|2007-07-23|2009-01-29|Dsm Ip Assets B.V.|Butanol production in a eukaryotic cell|

---

US20110081697A1|2007-09-27|2011-04-07|Chaogang Liu|Progressive Fermentation of Lignocellulosic Biomass|

---

EP2060632A1|2007-10-29|2009-05-20|Technische Universität Berlin|Method of modifying a yeast cell for the production of ethanol|

---

SG186645A1|2007-12-13|2013-01-30|Glycos Biotechnologies Inc|Microbial conversion of oils and fatty acids to high-value chemicals|

---

DE102008004253B4|2008-01-14|2011-07-28|Butalco Gmbh|Increased production of acetyl coenzyme A|

---

US8163516B2|2008-02-08|2012-04-24|Algenol Biofuels Inc.|Selection of ADH in genetically modified cyanobacteria for the production of ethanol|

---

EP2255004B1|2008-02-20|2014-04-30|Nagarjuna Fertilizers And Chemicals Limited|Genetically transformed microorganism for biomass fermentation|

---

PL2262901T3|2008-03-05|2019-04-30|Genomatica Inc|Primary alcohol producing organisms|

---

US20110111473A1|2008-05-09|2011-05-12|University Of Georgia Research Foundation, Inc|Yeast cells and methods for increasing ethanol production|

---

BRPI0911966B1|2008-05-11|2018-11-13|Univ Stellenbosch|polynucleotide encoding a cellobiohydrolase|

---

CA2724036C|2008-05-11|2018-09-25|Mascoma Corporation|Construction of protrophic/celluloytic yeast strains expressing tethered and secreted cellulases|

---

CA2729924C|2008-07-07|2018-05-29|Mascoma Corporation|Isolation and characterization of schizochytrium aggregatum cellobiohydrolase i |

---

CN102143972A|2008-07-07|2011-08-03|马斯科马公司|Heterologous expression of termite cellulases in yeast|

---

NZ590750A|2008-07-28|2012-12-21|Univ Massachusetts|Methods and compositions for improving the production of products in microorganisms, especially clostridium phytofermentans|

---

US20120094343A1|2008-11-12|2012-04-19|Mascoma Corporation|Gene Knockout Mesophilic and Thermophilic Organisms, and Methods of Use Thereof|

---

CA3092340A1|2008-11-21|2010-05-27|Universiteit Stellenbosch|Yeast expressing cellulases for simultaneous saccharification and fermentation using cellulose|

---

US9206434B2|2008-12-23|2015-12-08|Enchi Corporation|Heterologous biomass degrading enzyme expression in thermoanaerobacterium saccharolyticum|

---

WO2010075504A2|2008-12-23|2010-07-01|Gevo, Inc.|Engineered microorganisms for the production of one or more target compounds|

---

EP2277989A1|2009-07-24|2011-01-26|Technische Universiteit Delft|Fermentative glycerol-free ethanol production|

---

BR112012003883A2|2009-08-21|2015-09-01|Mascoma Corp|Production of propanols alcohols and polyols in consolidated bioprocessing organisms.|

---

BR112012012492A2|2009-11-24|2019-09-24|Gevo Inc|Methods for Increasing Dihydroxy Acid Dehydratase Activity to Improve Fuel, Chemical and Amino Acid Production|

---

WO2011090753A2|2009-12-29|2011-07-28|Butamax Advanced Biofuels Llc|Alcohol dehydrogenases useful for fermentive production of lower alkyl alcohols|

---

WO2011140386A2|2010-05-05|2011-11-10|Mascoma Corporation|Detoxification of biomass derived acetate via metabolic conversion to ethanol, acetone, isopropanol, or ethyl acetate|

---

WO2011150318A1|2010-05-28|2011-12-01|Codexis, Inc.|Acetate-resistant yeast strain for the production of a fermentation product|

---

EP2576762A4|2010-06-03|2013-12-04|Mascoma Corp|Yeast expressing saccharolytic enzymes for consolidated bioprocessing using starch and cellulose|

---

BR112012031639A2|2010-06-11|2015-11-24|Regentes Of The University Of California|synthetic pathways for biofuel synthesis|

---

CA2807561A1|2010-08-06|2012-02-09|Mascoma Corporation|Production of malonyl-coa derived products via anaerobic pathways|

---

WO2012138942A1|2011-04-05|2012-10-11|Mascoma Corporation|Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors|

---

US8663970B1|2012-09-11|2014-03-04|National Chung Cheng University|Recombinant thermotolerant yeast with a substitute heat shock protein 104 promoter|

---

US10513716B2|2012-10-15|2019-12-24|Genomatica, Inc.|Microorganisms and methods for production of specific length fatty alcohols and related compounds|

---

EP2917343A2|2012-11-09|2015-09-16|Lallemand Hungary Liquidity Management LLC|Method for acetate consumption during ethanolic fermentation of cellulosic feedstocks|

---

WO2015041940A2|2013-09-19|2015-03-26|Shell Oil Company|Novel yeast strains|CA3092340A1|2008-11-21|2010-05-27|Universiteit Stellenbosch|Yeast expressing cellulases for simultaneous saccharification and fermentation using cellulose|

---

WO2011140386A2|2010-05-05|2011-11-10|Mascoma Corporation|Detoxification of biomass derived acetate via metabolic conversion to ethanol, acetone, isopropanol, or ethyl acetate|

---

CA2807561A1|2010-08-06|2012-02-09|Mascoma Corporation|Production of malonyl-coa derived products via anaerobic pathways|

---

CA2822654A1|2010-12-22|2012-06-28|Mascoma Corporation|Genetically modified clostridium thermocellum engineered to ferment xylose|

---

WO2012138942A1|2011-04-05|2012-10-11|Mascoma Corporation|Methods for the improvement of product yield and production in a microorganism through the addition of alternate electron acceptors|

---

CN104024419A|2011-10-24|2014-09-03|丰田自动车株式会社|Method for producing ethanol that uses recombinant yeast|

---

CA2857247C|2011-11-30|2019-07-23|Dsm Ip Assets B.V.|Yeast strains engineered to produce ethanol from acetic acid and glycerol|

---

CA2857498A1|2011-11-30|2013-09-26|Mascoma Corporation|Engineering an increase in ethanol production by altering cofactor specificity|

---

US9085781B2|2012-07-23|2015-07-21|Edeniq, Inc.|Acetate resistance in yeast based on introduction of a mutant HAA1 allele|

---

CN104797708A|2012-08-29|2015-07-22|拉勒曼德匈牙利流动性管理有限责任公司|Expression of enzymes in yeast for lignocellulose derived oligomer CBP|

---

EP2917343A2|2012-11-09|2015-09-16|Lallemand Hungary Liquidity Management LLC|Method for acetate consumption during ethanolic fermentation of cellulosic feedstocks|

---

US20160002674A1|2013-02-27|2016-01-07|Toyota Jidosha Kabushiki Kaisha|Method for producing ethanol using recombinant yeast|

---

WO2014151318A2|2013-03-15|2014-09-25|Mascoma Corporation|Methods for regulating nitrogen metabolism during the production of ethanol from corn by metabolically engineered yeast strains|

---

US20160194669A1|2013-08-15|2016-07-07|Lallemand Hungary Liquidity Management Llc|Methods for the improvement of product yield and production in a microorganism through glycerol recycling|

---

WO2015041940A2|2013-09-19|2015-03-26|Shell Oil Company|Novel yeast strains|

---

JP6447583B2|2016-06-24|2019-01-09|トヨタ自動車株式会社|Recombinant yeast and method for producing ethanol using the same|

---

BR112019013121A2|2016-12-22|2019-12-10|Lallemand Hungary Liquidity Man Llc|sulfite tolerance in recombinant yeast host cells|

---

JP6879111B2|2017-08-02|2021-06-02|トヨタ自動車株式会社|Recombinant yeast and method for producing ethanol using it|

---

WO2021104673A1|2019-11-29|2021-06-03|Lallemand Hungary Liquidity Management Llc|Process for displacing an exogenous enzyme|

---

WO2021104672A1|2019-11-29|2021-06-03|Lallemand Hungary Liquidity Management Llc|Yeast expressing heterologous glucoamylase|

---

WO2021163780A1|2020-02-21|2021-08-26|Braskem S.A.|Production of ethanol with one or more co-products in yeast|

法律状态:
2016-12-20| B25A| Requested transfer of rights approved|Owner name: LALLEMAND HUNGARY LIQUIDITY MANAGEMENT LLC. (HU) |

---

2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-06-11| B07A| Technical examination (opinion): publication of technical examination (opinion) [chapter 7.1 patent gazette]|

---

2020-05-26| B25G| Requested change of headquarter approved|Owner name: LALLEMAND HUNGARY LIQUIDITY MANAGEMENT LLC. (HU) |

---

2020-08-25| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application [chapter 6.1 patent gazette]|

---

2020-12-22| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-02-02| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 05/05/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US33165710P| true| 2010-05-05|2010-05-05|

---

US61/331,657|2010-05-05|

---

US35113310P| true| 2010-06-03|2010-06-03|

---

US61/351,133|2010-06-03|

---

PCT/US2011/035416|WO2011140386A2|2010-05-05|2011-05-05|Detoxification of biomass derived acetate via metabolic conversion to ethanol, acetone, isopropanol, or ethyl acetate|

---