• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    BIOCATALITIC OXIDATION PROCESS WITH ALKL GENE PRODUCT. The present invention refers to a biocatalytic process for the oxidation of organic compounds with the aid of an alkL gene product, as well as microorganisms used in this process.
    公开号:BR112012027051B1
    申请号:R112012027051-6
    申请日:2011-03-15
    公开日:2021-05-18
    发明作者:Markus Pötter；Andreas Schmid；Bruno Bühler；Hans-Georg Hennemann；Mattijs Kamiel Julsing；Steffen Schaffer；Thomas Haas；Manfred Schrewe；Sjef Cornelissen；Martin Roos；Harald Häger
    申请人:Evonik Operations Gmbh；
    IPC主号:
    专利说明:

    Field of Invention
    [0001] Object of the invention is a biocatalytic process for the oxidation of organic compounds with the aid of an alkL gene product as well as microorganisms employed in this process. State of the Art
    [0002] For example the Pseudomonas putida OCT plasmid contains an alkL gene. This plasmid further encodes gene products that are responsible for alkane degradation. These alkane degradation genes are arranged on the Pseudomonas OCT plasmid in two alk operons; the first encodes the products of the genes AlkB, AlkF, AlkG, AlkH, AlkJ, AlkK, and AlkL, the second AlkS and AlkT, with AlkS playing a regulatory role in the expression of the first alk operon. For a detailed overview and function of other genes of these alk operons see Chen et al., J Bacteriol. 1995 Dec, 177(23):6894-901.
    [0003] Furthermore, from EP277674 is known a microbiological process for terminal hydroxylation of nonpolar aliphatic compounds with 6 to 12 C atoms, such as the preparation of 1-octanol, by means of microorganisms of the Pseudomonas putida type, which are resistant against apolar phases, and, among others, the plasmid that presents pGEc47 of alkL genes is used, which equally carries both alk operons of Pseudomonas putida. The control of the alkL gene is under the control of the native operon promoter and is therefore transcribed and translated together with alkB, alkF, alkG, alkH, alkJ and alkK.
    [0004] WO2002022845 describes a process for preparing N-benzyl-4-hydroxypiperidine by hydroxylation of N-benzyl-4-piperidine by E. coli cells, which carry the above-mentioned plasmid pGEc47.
    [0005] EP0502524 describes a microbiological process for terminal hydroxylation of ethyl groups in penta-ring or hexa-ring heterocyclics with the aid of the production of various products of the genes of alk operons, such as through the plasmid pGEc41, which encodes the gene product of alkB, alkG, alkH, alkT and alkS, but not from alkL. The same patent application further describes a plasmid pGMK921, which like pGEc41 contains the genes alkB, alkG, alkH, alkT and alkS, but not alkL, whose expression is possible but not only through the induction of alkane from the promoter native, but also by induction of IPTG from the tac promoter (compare also with US5306625).
    [0006] Schneider et al. describe in Appl Environ Microbiol. out. 1998; 64(10):3784-90 a bioconversion of saturated fatty acids to their w-1-hydroxy-fatty acids, w-2-hydroxy-fatty acids, and w-3-hydroxy-fatty acids in E. coli with o aid of a Cytochrom P-450BM-3 mono-oxygenase and the aforementioned plasmid pGEc47.
    [0007] Favre-Bulle et al. describe in Nature Bio/Technology 9, 367-371 (April 1991) a process for preparing 1-octanic acids by biotransformation of octane with an E. coli bacterium that carries pGEc47. Both alk operons are fully expressed in the described process.
    [0008] The same approach is pursued by Rothen et al., in Biotechnol Bioeng. 1998 May 20;58(4):356-65.
    [0009] The disadvantage of the described prior art is that gene products, which are not capable of any essential contribution to the due process of oxidation, are produced superfluously from those cells employed as biocatalysts and thus reduce their performance.
    [00010] In addition, the co-synthesized alk gene products eventually unnecessarily recover the enzymatic activities that are harmful to the formation of the desired products, with which the intermediate product is lost forming unwanted by-products. In the desired w-hydroxylation of an organic radical, the alkJ gene product leads to the formation of a corresponding aldehyde. For example, in the concomitant presence of the alkH gene product, the resulting aldehyde is further oxidized to form carboxylic acid. Thus in EP0502524 for the production of the desired hydroxylated process product only the gene product of alkB, alkG and alkT is required, with which for example the alkF, alkJ, alkH and alkS genes are superfluous. The disadvantage here is that, in addition, the synthesis of other gene products places high demands on the host's metabolic capacity. AlkJ e.g. is a FAD-containing enzyme (Chen et al., J. Bacteriol, (1995), 6894-6901). The host's pool of FAD, however, through production is already burdened by the indispensable production of alkT, which also contains FAD. Since the ability to synthesize FAD, for example, in E. coli is limited and is equally necessary for existential cell metabolism, it is avoidable that the cell is loaded with unnecessary production of alkJ.
    [00011] Furthermore the gene products of alkB, alkJ and alkH are always from the cytoplasmic membrane or are associated with the cytoplasmic membrane. In this scope, the respiratory chain is also located. An excessive production of membrane proteins leads to changes in the cell membrane until the membrane vesicles that migrate to the cytosol dissolve. (Nieboer et al., Molecular Microbiology (1993) 8(6), 1039-1051). Finally, this leads to early cell lysis (Wubbolts et al., Biotechnolgy and Bioengineering (1996), Vol 52, 301-308), even more so in the fermentation of high-density cells indispensable for industrial processes.
    [00012] Similarly in Schneider et al. alkB, alkF, alkG, alkH, alkJ, alkK, alkS and alkT gene products are unnecessarily synthesized, as the enzyme actually employed for the desired reaction is cytochrome P-450BM-3 monooxygenase.
    [00013] In view of industrial processes, the use of coders of plasmid metabolic pathways is difficult. With increasing volume size of fermenters, the use of antibiotics to maintain a selection pressure that improves plasmid stability is, on the one hand, very expensive, and on the other, critical in effluents. Large fermentations therefore almost always take place without any dose of antibiotics.
    [00014] To further ensure the genetic stability of artificial oxidative metabolic pathways it is desirable to integrate the genes used in the genome of the host organism. Such a preparation is all the better the smaller the integrated gene construct. Since the minimal gene set (Minimal-Gen-Set) alkBGTL observed here is already of considerable size, any other non-essential nucleotide sequence should be avoided.
    [00015] In addition to reducing the necessary initial molecular biological work, and increasing its probability of success, in a construct as small as possible, the genomic stability of the host organism is also advantageous.
    [00016] It was the task of the invention to provide a process that can overcome at least one of the disadvantages mentioned in the prior art. Description of the Invention
    [00017] It was surprisingly found that the process described below and cells modified by genetic technology, contribute to solving the set of tasks.
    [00018] Object of the present invention are therefore a process for preparing an oxidized organic substance, using an alkL gene product as described in claim 1, as well as the recombinant cells employed in this process.
    [00019] Another object of the invention is the use of an alkL gene product to increase the oxidation rate.
    [00020] The advantages are the optimal use of resources present in the process, for example in view of cell metabolism, in particular under fermentation conditions of high cell density.
    [00021] The present invention describes a process for the oxidation of an organic substance using at least one oxidizing enzyme and at least one alkL gene product, characterized by the fact that the alkL gene product is prepared independently of at least one other product gene encoded by alk operon, containing the alk gene.
    [00022] The alk gene described in the context of this invention encodes protein sequences, which are named analogously with alkX. If several alkX, alkY and alkZ genes are described simultaneously, then the nomenclature alkXYZ and/or analogously in AlkXYZ proteins is used.
    [00023] Under the term "oxidation of an organic substance" in the context of the present invention can be understood for example a hydroxylation or epoxidation, the conversion of an alcohol into an aldehyde or ketone, the conversion of an aldehyde into a carboxylic acid or a hydration of a double bond. Also summarized here below are also multi-step oxidation processes, as they can be achieved in particular by employing various oxidizing enzymes, such as for example the hydroxylation of an alkyl radical at various locations, for example at w and w-1 , catalyzed by various monooxygenases.
    [00024] Under the term "with the use of at least one oxidizing enzyme and at least one alkL gene product" in the context of the present invention can be understood the target preparation of enzymes and gene products, and in a way, as each enzyme or individual gene product, considered by themselves, are not found free in nature. This can occur for example by heterologous production or an overproduction of the proteins employed in a cell or by the preparation of at least partially purified proteins; also included here is a modified context compared to the enzyme found free in nature, namely in the way in which the natural cell including the enzyme has been modified so that it for example produces other proteins in the modified form, such as attenuated or reinforced or provided with point mutations.
    [00025] Under the term "alkL gene product" in the context of the present invention are understood proteins, which satisfy at least one of the following two conditions: 1.) The protein is identified as a member of the OmpW-Proteine superfamily of proteins ( Proteinfamilie 3922 in the „Conserved Domain Database“ (CDD) of the „National Center for Biotechnology Information“ (NCBI)), this arrangement being by an alignment of the amino acid sequence of the protein with the database entries present in the NCBI CDD , which were deposited until 03.22.2010, using the standard search parameters, a value of E („e-value”) less than 0.01 and using the algorithm „blastp 2.2.23+", 2.) in a search for conserved protein domains contained in the standard amino acid sequence in question NCBI CDD (Version 2.20) by means of RPS-BLAST, the presence of the domain „OmpW, Outer membrane protein W” (COG3047) with an E-value („e-value”) less than 1 x 10 -5 (in English „domain hit”).
    [00026] Under the term "independent of at least one other encoded alk operon gene product, containing the alk gene" in the context of the present invention is understood a preparation of the alkL gene product, which is independent of at least one other alk gene product, which is linked in the naturally occurring form to the appearance of the alkL- gene product. For example, in an operon comprising the alkBFGHJKL genes, the alk gene products, respectively from alkBFGHJ and K, are linked to the appearance of the alkL gene product, as these are prepared through the same promoter.
    [00027] All percentages indicated (%) are, when nothing different is indicated, percentage by mass.
    [00028] The process according to the invention is used, depending on the oxidizing enzyme used, for the oxidation of any organic substances that are accepted by this oxidizing enzyme as a substrate, and the preferred organic substances are selected from the group that contains and from preferably consists of alkanes, alkenes, alkynes, alcohols, aldehydes, ketones, carboxylic acids, carboxylic acid esters, amines and epoxides branched or unbranched, preferably unbranched, saturated or unsaturated, preferably saturated, if appropriate substituted, being which preferably have from 3 to 22, in particular from 6 to 18, even more preferred from 8 to 14, especially 12 carbon atoms.
    [00029] Organic substances particularly preferred in the process according to the invention are selected from the group containing, preferably consisting of carboxylic acids and their corresponding esters, in particular with 3 to 22, preferably 6 to 18, particularly preferred 8 to 14, carbon atoms, in particular unbranched carboxylic acids of alkanes, in particular lauric acid and its esters, in particular lauric acid methylester and lauric acid ethylester, decanic acid, decanic acid ester, myristic acid, and myristic acid ester, unsubstituted alkanes having 3 to 22, preferably 6 to 18, particularly preferred 8 to 14 carbon atoms, preferably unbranched, in particular selected from the group containing, preferably consisting of octane, decane, dodecane and tetradecane, alkenes unsubstituted with 3 to 22, preferably 6 to 18, particularly preferred 8 to 14, carbon atoms, preferably unbranched. iced, in particular selected from the group containing, preferably consisting of, trans-oct-1-ene, trans-non-1-ene, trans-dec-1-ene, trans-undec-1-ene, trans- dodec-1-ene, trans-tridec-1-ene, trans-tetrade-1-cene, cis-oct-1-ene, cis-non-1-ene, cis-dec-1-ene, cis-undec- 1-ene, cis-dodec-1-ene, cis-tridec-1-ene, cis-tetrade-1-cene, trans-oct-2-ene, trans-non-2-ene, trans-dec-2- ene, trans-undec-2-ene, trans-dodec-2-ene, trans-tridec-2-ene and trans-tetradec-2-ene, trans-oct-3-ene, trans-non-3-ene, trans-dec-3-ene, trans-undec-3-ene, trans-dodec-3-ene, trans-tridec-3-ene and trans-tetradec-3-ene, trans-oct-4-ene, trans- non-4-ene, trans-dec-4-ene, trans-undec-4-ene, trans-dodec-4-ene, trans-tridec-4-ene, trans-tetradec-4-ene, trans-dec- 5-ene, trans-undec-5-ene, trans-dodec-5-ene, trans-tridec-5-ene, trans-tetradec-5-ene, trans-dodec-6-ene, trans-tridec-6- ene, trans-tetradec-6-ene and trans-tetradec-7-ene, particularly preferred consisting of trans-oct-1-ene, trans-dec-1-ene, tra ns-dodec-1-ene, trans-tetrade-1-cene, cis-oct-1-ene, cis-dec-1-ene, cis-dodec-1-ene, cis-tetrade-1-cene, trans- oct-2-ene, trans-dec-2-ene, trans-dodec-2-ene and trans-tetradec-2-ene, trans-oct-3-ene, trans-dec-3-ene, trans-dodec- 3-ene and trans-tetradec-3-ene, trans-oct-4-ene, trans-dec-4-ene, trans-dodec-4-ene, trans-tetradec-4-ene, trans-dec-5- ene, trans-dodec-5-ene, trans-tetradec-5-ene, trans-dodec-6-ene, trans-tetradec-6-ene and trans-tetradec-7-ene, monovalent alcohols, unsubstituted with 3 to 22, preferably 6 to 18, particularly preferred 8 to 14, carbon atoms, preferably unbranched, in particular selected from the group containing, preferably consisting of, 1-octanol, 1-nonanol, 1-decanol, 1 -undecanol, 1-dodecanol, 1-tridecanol and 1-tetradecanol, particularly preferred consisting of 1-octanol, 1-decanol, 1-dodecanol and 1-tetradecanol aldehydes unsubstituted with 3 to 22, preferably 6 to 18, particularly preferred 8 to 14, atoms of carbon, preferably unbranched, in particular selected from the group containing, preferably consisting of, octanal, nonanal, decanal, dodecanal and tetradecanal, unsubstituted amines, monovalent with 3 to 22, preferably 6 to 18, particularly preferred 8 up to 14 carbon atoms, preferably unbranched, in particular selected from the group containing, preferably consisting of 1-amino-octane, 1-amino-nonane, 1-amino-decane, 1-amino-undecane, 1- amino-dodecane, 1-amino-tridecane and 1-amino-tetradecane, particularly preferred consisting of 1-amino-octane, 1-amino-decane, 1-amino-dodecane and 1-amino-tetradecane, as well as substituted compounds, which in particular carry as further substituents one or more hydroxy, amino, keto, carboxyl, cyclopropyl or epoxy functions, in particular selected from the group containing, preferably consisting of, 1,8-octanediol, 1,9-nonanediol, 1,10-decanediol, 1,11-undecanediol, 1,12-dodecanediol, 1,13-t ridecandiol, 1,14-tetradecanediol, 8-amino-[1-octanol], 9-amino-[1-nonanol], 10-amino-[1-dodecanol], 11-amino-[1-undecanol], 12- amino-[1-dodecanol], 13-amino-[1-tridecanol], 14-amino-[1-tetradecanol], 8-hydroxy-[1-octanal], 9-hydroxy-[1-nonanal], 10- hydroxy-[1-decanal], 11-hydroxy-[1-undecanal], 12-hydroxy-[1-dodecanal], 13-hydroxy-[1-tridecanal], 14-hydroxy-[1-tetradecanal], 8- amino-[1-octanal], 9-amino-[1-nonanal], 10-amino-[1-decanal], 11-amino-[1-undecanal], 12-amino-[1-dodecanal], 13- amino-[1-tridecanal], 14-amino-[1-tetradecanal], 8-hydroxy-[1-octanic acid], 9-hydroxy-[1-nonanic acid], 10-hydroxy-[1-decanic acid] , 11-hydroxy-[1-undecanic acid], 12-hydroxy-[1-dodecanic acid], 13-hydroxy-[1-undecanic acid], 14-hydroxy-[1-tetradecanic acid], 8-acid methylester hydroxy-[1-octanic], 9-hydroxy-[1-nonanic] acid methylester, 10-hydroxy-[1-decanic] acid methylester, 11-hydroxy-[1-undecanic] acid methylester, acid methylester 12-hydroxy-[1-dodecan ico], 13-hydroxy-[1-undecanic] acid methylester, 14-hydroxy-[1-tetradecanic] acid methylester, 8-hydroxy-[1-octanic] acid ethylester, 9-hydroxy-[ 1-nonanic], 10-hydroxy-[1-decanic] acid ethylester, 11-hydroxy-[1-undecanic] acid ethylester, 12-hydroxy-[1-dodecanic] ethylester, 13-hydroxy-acid ethylester [1-undecanic] and 14-hydroxy-[1-tetradecanic acid ethylester], particularly preferred consisting of, 1,8-octanediol, 1,10-decanediol, 1,12-dodecanediol, 1,14-tetradecanediol, 8 -amino-[1-octanol], 10-amino-[1-dodecanol], 12-amino-[1-dodecanol], 14-amino-[1-tetradecanol], 8-hydroxy-[1-octanal], 10 -hydroxy-[1-decanal], 12-hydroxy-[1-dodecanal], 14-hydroxy-[1-tetradecanal], 8-amino-[1-octanal], 10-amino-[1-decanal], 12 -amino-[1-dodecanal], 14-amino-[1-tetradecanal], 8-hydroxy-[1-octanic acid], 10-hydroxy-[1-decanic acid], 12-hydroxy-[1-dodecanic acid ], 14-hydroxy-[1-tetradecanic acid], 8-hydroxy-[1-octanilic acid methylester co], 10-hydroxy-[1-decanic acid methylester], 12-hydroxy-[1-dodecanic acid methylester], 14-hydroxy-[1-tetradecanic acid methylester], 8-hydroxy-[ 1-octanic], 10-hydroxy-[1-decanic] acid ethylester, 12-hydroxy-[1-dodecanic] acid ethylester and 14-hydroxy-[1-tetradecanic] acid ethylester, being lauric acid and its esters, in particular lauric acid methylester and lauric acid ethylester are preferred.
    [00030] With the process according to the invention, depending on the oxidizing enzymes used and the organic substance, various oxidation products can be prepared, in particular alcohols, aldehydes, ketones and carboxylic acids.
    [00031] These oxidation products can be obtained for example by the process according to the invention by converting one of the following listed organic substances: - alkane/alkene/alkyne into alcohol (for example with a monooxygenase) - alcohol into aldehyde (eg with an alcohol dehydrogenase or alcohol oxidase) - alcohol in ketone (eg with an alcohol dehydrogenase or alcohol oxidase) - aldehyde in carboxylic acid (eg with an aldehyde dehydrogenase) - epoxide in cyanohydrin (eg with a halohydrin) -dehalogenase)
    [00032] In this context it is preferred to prepare alcohols and aldehydes, in particular w-alcohols, very particularly w-hydroxy-carboxylic alcohols with the process according to the invention, especially in the form of a hydroxylation reaction.
    [00033] In the process according to the invention, organic substances, in particular carboxylic acids and carboxylic acid esters, are advantageously oxidized in the w position.
    [00034] In the process according to the invention all oxidizing enzymes known to the expert can be employed, since the function of the alkL gene product prepared is independent of this. Such enzymes have long been known to the skilled person under the term oxidoreductase and can be found in the EC 1.X.X.X class of enzymes of the systematic nomenclature of the enzyme committee of the International Union of Biochemistry and Molecular Biology.
    [00035] As oxidizing enzyme, an alkane monooxygenase, a xylol monooxygenase, an aldehyde dehydrogenase, an alcohol oxidase or an alcohol dehydrogenase, preferably an alkane monooxygenase, are preferably employed in the process according to the invention.
    [00036] An appropriate gene for a xylol monooxygenase is, for example, the xylM gene or the xylA gene, and a plasmid containing these two genes has the accession number to GENBANK No. M37480.
    [00037] A particularly preferred alkane monooxygenase in this context is characterized by the fact that it is a cytochrome P450 monooxygenase, in particular a cytochrome P450 monooxygenase from yeast, in particular Pichia, Yarrowia and Candida, for example from Candida tropicalis or Candida maltosa, or from plants, for example from Cicer arietinum L., or from mammals, for example from Rattus norvegicus, in particular CYP4A1. The genetic sequences of the appropriate cytochrome P450 monooxygenases from Candida tropicalis are for example disclosed in WO-A-00/20566, while the genetic sequences of the appropriate chickpea cytochrome P450 monooxygenases can be deduced from, for example, Barz et al. in "Cloning and characterization of eight cytochrome P450 cDNAs from chickpea (Cicer arietinum L.) cell suspension cultures", Plant Science, Vol. 155, pages 101-108 (2000).
    [00038] Another preferred alkane monooxygenase is encoded from the alkB gene of the alk operons of Pseudomonas putida GPo1.
    [00039] Isolation of the alkB gene sequence is, for example, described by van Beilen et al. in "Functional Analysis of Alkane Hydroxylases from Gram-Negative and Gram-Positive Bacteria", Journal of Bacteriology, Vol. 184 (6), pages 1733-1742 (2002). Other homologues of the alkB gene can also be deduced from van Beilen et al. in Oil & Gas Science and Technology, Vol. 58 (4), pages 427-440 (2003).
    [00040] Furthermore, preferred alkane monooxygenases are those of the alkB gene products, which are encoded from alkB genes of organisms selected from the group of gram negative bacteria, in particular from the group of Pseudomonas, from the genus Pseudomonas, in particular Pseudomonas mendocina , from the genus Oceanicaulis, preferably Oceanicaulis alexandrii HTCC2633, from the genus Caulobacter, preferably Caulobacter sp. K31, from the genus Marinobacter, preferably Marinobacter aquaeolei, particularly preferred Marinobacter aquaeolei VT8, from the genus Alcanivorax, preferably from Alcanivorax borkumensis, from the genus Acetobacter, Achromobacter, Acidiphilium, Acidovorax, Aeromicrobium, Alkalilimnicola, Alkallimicola, Azoromonadales Azospirillum, Azotobacter, Bordetella, Bradyrhizobium, Burkholderia, Chlorobium, Citreicella, Clostridium, Colwellia, Comamonas, Conexibacter, Congregibacter, Corynebacterium, Cupriavidus, Cyanothece, Delftia, Desulfomicrothriller,Glaccoter, Debacter, Debactersulfo-Sone Grimontia, Hahella, Haloterrigena, Halothiobacillus, Hoeflea, Hyphomonas, Janibacter, Jannaschia, Jonquetella, Klebsiella, Legionella, Limnobacter, Lutiella, Magnetospirillum, Mesorhizobium, Methylibium, Methylibium, Methylobacterium, Nitlomonassobacterium, Nostobacterium, Mytillobacterium Novosphingobium, Octadecabacter, Paracoc cus, Parvibaculum, Parvularcula, Peptostreptococcus, Phaeobacter, Phenylobacterium, Photobacterium, Polaromonas, Prevotella, Pseudoalteromonas, Pseudovibrio, Psychrobacter, Psychroflexus, Ralstonia, Rhodobacter, Rhodococcus, Rhodobacter, Rosedobacter, Rosedobacter Ruegeria, Sagittula, Shewanella, Silicibacter, Stenotrophomonas, Stigmatella, Streptomyces, Sulfitobacter, Sulfurimonas, Sulfurovum, Synechococcus, Thalassiobium, Thermococcus,monospora, Thioalka-livibrio, Thiobacter, tsusbrio, Thiobacillus, or particularly preferred is Thermomona, thiobacillus, tsubrio, thiomona, thyospira, thiospira Alcanivorax borkumensis, Oceanicaulis alexandrii HTCC2633, Caulobacter sp. K31 and Marinobacter aquaeolei VT8. In this context it is advantageous when in addition to AlkB alkG and alkT gene products are prepared; these may either be the isolable gene products by the controlling organism of the alkB gene product, or else alkG and alkT may originate from Pseudomonas putida GPo1.
    A preferred alcohol dehydrogenase is, for example, the enzyme encoding the alkJ gene (EC 1.1.99.8), in particular the enzyme encoding the alkJ gene from Pseudomonas putida GPo1 (van Beilen et al., Molecular Microbiology, (1992) 6(21), 3121-3136). The gene sequences of the genes of Pseudomonas putida GPo1, Alcanivorax borkumensis, Bordetella parapertussis, Bordetella bronchiseptica or Roseobacter denitrificans can, for example, be consulted in the KEGG genetic database (Kyoto Encyclopedia of Genes and Genomes). Furthermore, the preferred alcohol dehydrogenases are those encoded, which are encoded from the alkJ genes of selected organisms from the gram-negative bacteria group, in particular from the Pseudomonad group, beyond the Pseudomonas genus, particularly Pseudomonas mendocina, from the Oceanicaulis genus, preferably Oceanicaulis alexandrii HTCC2633, of the genus Caulobacter, preferably Caulobacter sp. K31, from the genus Marinobacter, preferably Marinobacter aquaeolei, particularly preferred Marinobacter aquaeolei VT8, from the genus Alcanivorax, preferably from the genus Alcanivorax borkumensis, from the genus Acetobacter, Achromobacter, Acidiphilium, Acidovorax, Aeromicrobium, Alkalilimnicola, Alkalilimnicola, Alterobacus, Amonazolummatos Azotobacter, Bordetella, Bradyrhizobium, Burkholderia, Chlorobium, Citreicella, Clostridium, Colwellia, Comamonas, Conexibacter, Congregibacter, Corynebacterium, Cupriavidus, Cyanothece, Delftia, Desulfomicrobium, Desulfonatronospira, Francis, Ethiobacter, Dethiobacter Haloterrigena, Halothiobacillus, Hoeflea, Hyphomonas, Janibacter, Jannaschia, Jonquetella, Klebsiella, Legionella, Limnobacter, Lutiella, Magnetospirillum, Mesorhizobium, Methylibium, Methylbacterium, Metilophaga, Mycobacterium, Neisseria, No. vibaculum, Parvularcula, Peptostreptococcus, Phaeobacter, Phenylobacterium, Photobacterium, Polaromonas, Prevotella, Pseudoalteromonas, Pseudovibrio, Psychrobacter, Psychroflexus, Ralstonia, Rhodobacter, Rhodococcus, Rhodoferax, Rhodoferax, Rhodomicroses, Sylpis Stenotrophomonas, Stigmatella, Streptomyces, Sulfitobacter, Sulfurimonas, Sulfurovum, Synechococcus, Thalassiobium, Thermococcus, Thermomonospora, Thioalkalivibrio, Thiobacillus, Thiomicrospira, Thiomonas, Tsukamurella, Vibrio or Xanthomonas.
    [00042] The alkL gene products preferably employed in the process according to the invention are characterized by the fact that the production of the alkL gene product in the native host is induced by dicyclopropylketone; in this context, furthermore, the expression of the alkL gene as part of a gene cluster, for example in a Regulon such as an operon, is preferred.
    [00043] alkL gene products employed in the process according to the invention are preferably encoded from alkL genes of organisms selected from the group of gram negative bacteria, in particular from the group containing, preferably consisting of Pseudomonads, in particular from Pseudomonas putida, in particular Pseudomonas putida GPo1 and P1, Azotobacter, Desulfitobacterium, Burkholderia, preferably Burkholderia cepacia, Xanthomonas, Rhodobacter, Ralstonia, Delftia and Rickettsia, The genus Oceanicaulis, preferably Oceanicaulis, preferably alexandriii HTCC2633, genus Cabaculoter . K31, the genus Marinobacter, preferably Marinobacter aquaeolei, particularly preferred Marinobacter aquaeolei VT8 and the genus Rhodopseudomonas.
    [00044] It is advantageous when the alkL gene product comes from an organism other than the oxidizing enzyme used according to the invention.
    [00045] In this context, the alkL gene products encoded by the alkL genes of Pseudomonas putida GPo1 and P1, which are reproduced by Seq ID No. 1 and Seq ID No. 3, as well as proteins with polypeptide sequence Seq ID No. 2 are particularly preferred. or Seq ID No. 4 or with a polypeptide sequence wherein up to 60%, preferably up to 25%, particularly preferred up to 15%, especially up to 10, 9, 8, 7, 6, 5, 4, 3 are modified , 2.1 % of the amino acid radicals to Seq ID No. 2 or Seq ID No. 4 by deletion, insertion, substitution or a combination thereof, and further at least 50%, preferably 65%, particularly preferred 80%, in particular more than 90% of the protein activity with the respective reference sequence Seq ID No 2 or Seq ID No4, and below 100% of the activity of the reference protein the increased activity of the cells used as biocatalysts, therefore the amount of material converted per unit of time relative to quantity and cell used (Units per gram of cell dry weight [U/gCDW]) is understood in comparison with the activity of the biocatalyst without the presence of the reference protein, and therefore in a system, as described in the examples of execution in which the alkBGT gene products of P. putida GPo1 are used as oxidizing enzymes for the conversion of lauric acid methylester to 12-hydroxylauric acid methylester in an E. coli cell. A selection method for determining the oxidation rate can be deduced from the running examples.
    [00046] For the definition of the unit, the usual definition in enzyme kinetics applies here. 1 Biocatalyst unit converts 1 µmol of substrate per minute into product. 1 U = 1 µmol/min
    [00047] Amino acid radical modifications of an indicated polypeptide sequence which do not lead to any essential modification of the properties and function of the indicated polypeptide are known to the skilled person. Thus, for example, many amino acids can often be easily substituted for one another; Examples of such appropriate amino acid substitutions are: Ala for Ser; Arg for Lys; Asn for Gln or His; Asp for Glu; Cys for Ser; Gln for Asn; Glu by Asp; Gly by Pro; His for Asn or Gln; Ile by Leu or Val; Read by Met or Val; Lys for Arg or Gln or Glu; Met by Leu or Ile; Phe by Met or Leu or Tyr; Be by Thr; Thr for Ser; Trp by Tyr; Tyr by Trp or Phe; Val for Ile or Leu. It is also known that modifications in particular at the N- or C-terminus of a polypeptide in the form of, for example, amino acid insertions or amino acid deletions often have no essential influence on the function of the polypeptide.
    [00048] A preferred process according to the invention is characterized in that the other gene product is selected at least from the group consisting of AlkB, AlkF, AlkG, AlkH, AlkJ, and AlkK, in particular consisting of AlkF, AlkG, AlkH, AlkJ, and AlkK, and other gene products in particular are selected from the group consisting of preference of gene combinations: alkBF, alkBG, alkFG, alkBJ, alkFJ, alkGJ, alkBH, alkFH, alkGH, alkJH, alkBK , alkFK, alkGK, alkJK, alkHK, alkBFG, alkBFJ, alkBFH, alkBFK, alkBGJ, alkFGJ, alkBGH, alkFGH, alkBGK, alkFGK, alkBJH, alkFJH, alkGJB, alkHK, alkFJ , alkBGJK, alkBGHK, alkBFGJ, alkBFGH, alkFGJH, alkBFGK, alkFGJK, alkGJHK, alkBFJH, alkBFJK, alkFJHK, alkBFHK, alkBFGJH, alkBFGJK and alkJK in particular alkBFGJK.
    [00049] It is advantageous for the process according to the invention, when the oxidizing enzyme and the alkL gene product are provided by a microorganism. Hereby both enzymes can be respectively separated in a microorganism or together in a microorganism, the latter being preferred. Therefore the process according to the invention is preferably characterized in that it is provided in at least one micro-organism or in a medium surrounding a micro-organism that produces the oxidizing enzyme and the alkL gene product.
    [00050] In this context it is preferred that the oxidizing enzyme and the alkL gene product are prepared in at least one microorganism by recombination.
    [00051] The following achievements to form recombinant products refer both to the oxidizing enzyme and also to the alkL gene product.
    [00052] Basically a recombinant production can be achieved by increasing the number of copies of the gene sequence or gene sequences that encode the protein, employ a modified promoter, modify the use of the gene codon in different ways, increase the half-life of the mRNA or enzyme, modify the regulation of gene expression or utilize a gene or allele encoding a corresponding protein and if appropriate combine these measures. Cells with such a genetic makeup are, for example, prepared by transformation, transduction, conjugation or a combination of these methods, with a vector containing the desired gene, an allele of that gene or parts thereof, and a promoter which enables expression of the gene. Heterologous expression is made possible in particular by the integration of the gene or alleles into the chromosome of cells or into an extrachromosomal replicator vector.
    [00053] An overview of the possibilities of recombinant production in cells of the example of isocitrate lyases is given in EP0839211, which is here introduced as a reference and its disclosure content, in view of the possibilities of recombinant production in cells, forms a part of the disclosure of the present invention.
    [00054] The preparation or production or expression of all proteins or genes mentioned above and below is done with the aid of one-dimensional and two-dimensional gel electrophoresis and subsequently proven by optical identification of the protein concentration with the corresponding gel evaluator software . When the verified expression capacity is based solely on an increase in the expression of the corresponding gene, then the quantification of recombinant expression can be more simply determined by a comparison of the one-dimensional and two-dimensional protein separations between wild-type cells and gene cells. technologically modified. A common method for preparing protein gels by corineiform bacteria and for protein identification is the procedure described by Hermann et al. (Electrophoresis, 22: 1712.23 (2001) Protein concentration can also be determined by Western-Blot hybridization with an antibody specific for the protein to be proven (Sambrook et al., Molecular Cloning: a laboratory manual, 2nd Ed. Cold). Spring Harbor Laboratory Press, Cold Spring Harbor, NY USA, 1989), and then analyzed by optical evaluation with the corresponding software for determination of concentration (Lohaus and Meyer (1989) Biospektrum, 5: 32-39; Lottspeich (1999) , Angewandte Chemie 111: 2630-2647).
    [00055] If the recombinant expression is carried out with the increase of the synthesis of a protein, it increases, for example, the number of copies of said genes or the promoter region and the regulatory region or the binding site of the ribosomes are changed, which is found flow above the gene structure. Through inducible promoters it is additionally possible to increase expression at any time. Furthermore, the so-called "Enhancers", which cause an improved interaction between RNA-Polymerase and DNA, can also be attributed as regulatory sequences for the protein's genes, causing an increased gene expression. Through measures to extend the useful life of nRNA, expression is also improved.
    [00056] To increase the recombinant expression of the respective genes are used for example episomal plasmids. As plasmids or vectors, all available forms of execution for this purpose are considered in principle. This type of plasmids and vectors can for example be deduced from the brochures of the firms Novagen, Promega, New England Biolabs, Clontech or Gibco BRL. Other preferred plasmids and vectors can be found in: Glover, D.M. (1985), DNA cloning: a practical approach, Vol. I-III, IRL Press Ltd., Oxford; Rodriguez, R.L. and Denhardt, D.T (eds) (1988), Vectors: a survey of molecular cloning vectors and their uses, 179-204, Butterworth, Stoneham; Goeddel, D.V. (1990), Systems for heterologous gene expression, Methods Enzymol. 185, 3-7; Sambrook, J.; Fritsch, E.F. und Maniatis, T. (1989), Molecular cloning: a laboratory manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York.
    [00057] The plasmid vector, which contains a gene to be amplified, is then converted by conjugation or transformation into the desired strain. The conjugation method is for example described by Schafer et al., Applied and Environmental Microbiology 60: 756-759 (1994). Methods for transformation are, for example, described by Thierbach et al., Applied Microbiology and Biotechnology 29: 356-362 (1988), Dunican und Shivnan, Bio/Technology 7: 1067-1070 (1989) and Tauch et al., FEMS Microbiology Letters 123: 343-347 (1994). After homologous recombination through a cross-over event, the resulting strain contains at least two copies of the gene in question.
    [00058] It is therefore preferred to employ recombinant microorganisms in the process according to the invention, due to the good genetic accessibility the microorganism is preferably selected from the group of bacteria, in particular from gram negative, particularly from the group containing, preferably consisting of E. coli, Pseudomonas sp., Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas acidovorans, Pseudomonas aeruginosa, Acidovorax sp., Acidovorax temperans, Acinetobacter sp., Burkholderia sp., Cyanobakterien sp, Klebsiella sp. . and Rhizobium meliloti, with E. coli being particularly preferred.
    [00059] The cells employed in the process according to the invention are also constituents of the present invention.
    [00060] Thus, the object of the present invention are microorganisms that have been modified by genetic technology of this type and that synthesize at least one oxidizing enzyme of an organic substance and, reinforcing at least one alkL gene product, which is another object of this present invention. invention the alkL gene product that is independently synthesized by the gene product encoding an alk operon containing alkL gene.
    [00061] Preferred oxidizing enzymes are in this context the same oxidizing enzymes which are preferably employed in the process according to the invention; the analog is valid for the preferred alkL gene products, preferably for the gene product encoding the alk operons containing the alkL gene, preferably organic substances, as well as preferred microorganisms.
    [00062] It is still an object of the present invention the use of an alkL gene product, preferably in a microorganism, to increase the oxidation rate of at least one oxidizing enzyme of an organic substance, characterized by the fact that the use of alkL gene product occurs independently of at least one other alk-encoding gene product through the operon containing the alkL gene.
    [00063] In this context, oxidation is preferably the oxidation of an organic substance to form an aldehyde or an alcohol, in particular an alcohol. Thus in this context preferably the rate of hydroxylation is increased, in particular at the w-position of carboxylic acids, preferably referring to the conversion of carboxylic acids and their esters to form the corresponding w-hydroxyethylated compounds, in particular dodecanic acid methylester to form dodecanic acid hydroxide methylesters, preferred oxidizing enzymes are in this context the same oxidizing enzymes which are preferably employed in the process according to the invention; the analog is valid for preferred alkL gene products, preferably gene products encoded by the alk operon containing the alkL gene, preferably organic substances, and preferably microorganisms.
    [00064] In the examples given below, the present invention is described by way of examples, without the invention, whose scope of application is given from the description as a whole and the claims, being limited to the embodiments mentioned in the examples.
    [00065] The following figures are part of the examples: Figure 1: E. coli plasmids „pBT10_alkL” Examples: Comparative Example 1: Expression vector for the alkane hydroxylase system AlkBGT from Pseudomonas putida GPo1 without alkL
    [00066] Starting from pCOM systems (Smits et al., 2001 Plasmid 64:16-24) the construct pBT10 (Seq ID No5) was prepared, which contains the three components of alkane hydroxylase (AlkB), rubredoxin (AlkG ) and Rubredoxin Reductase (AlkT) from Pseudomonas putida. For the expression of the three genes, the sequence of alkBFG genes under the control of the alkB promoter and that of the alkT genes under those of the alkS promoter was prepared.
    [00067] To facilitate the cloning of alkB and alkG, the alkF gene that lies between them was amplified and cloned together with alkB and alkG. AlkF has no meaning for the reaction to be catalyzed.
    [00068] A detailed description of the preparation of the pBT10 vector can be found in WO2009077461. Example 1: Expression vector for the AlkBGT alkane hydroxylase system from Pseudomonas putida GPo1 with alkL
    [00069] In another preparation the targeted alkL gene was cloned into the alkBFG operon, to be able to synthesize enzymes together with the minimum rate necessary for oxidation.
    [00070] In addition the alkL gene of pGEc47 (Eggink et al., 1987, J Biol Chem 262, 17712-17718) by PCR was amplified.
    [00071] The P1 and P2 primers used for this contain for cloning in the SalI cut-off site of plasmid pBT10 outside the target sequence also SalI cut-off sites. In forward-primer P1 a stop codon was also built behind the Sall cut-off site to terminate a possible translation of the alkH radicals. P1 ACGCGTCGACCTGTAACGACAACAAAACGAGGGTAG (Seq ID No6) P2 ACGCGTCGACCTGCGACAGTGACAGACCTG (Seq ID No7)
    [00072] For amplification, Finnzyme Phusion Polymerase (New England Biolabs) was used.
    [00073] According to the manufacturer's instruction, 34 μL of H2O, 10 μL of 5x Phusion HF Puffer buffer solution, 1 μL of dNTPs (10 mM each), 1.25 μL of P1, 1.25 μL of P2 (for an End-Primer concentration of 0.5 μM), 2μL of plasmid pGEc47 solution (150 ng/μL) and 0.5 μL of Phusion Polymerase were used in thin-walled PCR-Eppendorf containers for PCR.
    [00074] The following PCR program was programmed according to the polymerase manufacturer's suggestion: [98°C / 30 s], ([98°C / 10 s] [72°C / 60 s]) 30x, [72°C / 10 min]
    [00075] The PCR product originated with a length of 754 bp was purified with the aid of "peqGOLD cycle pure Kits" (PEQLAB Biotechnology GmbH, Erlangen) according to the manufacturer's instructions and phosphorylated with T4 polynucleotide kinase. μL of the PCR product solution obtained with 2 μL of ATP solution (100 mM), 2 μL of kinase - buffer solution and 1 μL of T4 polynucleotide kinase and incubated for 20 minutes at 37°C. Then the enzyme was killed by heating at 75°C for 10 minutes.
    [00076] The PCR product thus prepared was then joined according to the manufacturer's instructions in the pSMART vector of the Lucigen company. 2μL of the coupling preparation were transformed by heat shock (42°C for 45sec) into chemically competent E.coli DH5 α cells.
    [00077] After overnight incubation in selected colonies on kanamycin plates, it was cultivated in liquid culture (5 mL of LB medium with 30 μg/mL of kanamycin) overnight at 37°C and plasmids were isolated with the aid of peqGOLD Miniprep Kits (PEQLAB Biotechnologie GmbH (Erlangen)).
    [00078] By restriction dissociation with SalI and followed by a gel electrophoresis correctly linked plasmids were identified.
    [00079] Such a plasmid was prepared in greater quantity and dissociated in with SalI. The generated 693 bp fragment was isolated by purification from an agarose gel (peqGOLD Gel Extraction Kit).
    [00080] Plasmid pBT10 was also prepared in greater quantity, dissociated with SalI and the ends dephosphorylated with alkaline phosphatase (calf intestine phosphatase [alkaline], CIP) (NEB) dephosphorylated.
    [00081] These procedures were performed at the same time in a reaction vessel. In addition, 13.3 μL of plasmid DNA were mixed with 4 μL of buffer solution, 19.2 μL of water, 2 μL of alkaline phosphatase and 1.5 μL of SalI (NEB) and incubated for 2h at 37°C Ç. The cut and dephosphorylated vector was also purified on an Agarose gel as described above.
    [00082] To adjust the correct proportions of vector and Insert in the union, the concentrations of the corresponding DNA solutions were verified by electrophoresis in agarose gel.
    [00083] For ligation 10 µL of cut vector DNA solution was mixed with 5 µL of Insert DNA solution so that the DNA mass ratio was 1:5, reacted with 2 µL of Ligase buffer solution, 1 μL of water as well as 1 μL of Ligase, then incubated for 2h at 22°C and then overnight at 4°C.
    [00084] 5 μL of this preparation was transformed by electroporation into E. coliDH5α cells.
    [00085] Kanamycin resistant colonies were grown in 5 ml of LB medium with antibiotic overnight and plasmids were prepared as described above.
    [00086] The restriction dissociation of plasmid DNA from 5 clones by EcoRV showed in three cases respectively bands at 8248Bp, 2234Bp and 1266Bp. This sample verified the correct cloning of alkL.
    [00087] The plasmid obtained was named pBT10_alkL (see Figure 1) and presents Seq ID No8. Example 2: Conversion of lauric acid methylester to ^-hydroxylauric acid methylester
    [00088] For biotransformation, plasmids pBT10 or pBT10_alkL were transformed by heat shock at 42°C for 2 minutes into chemically competent strains of E. coli W3110 (Hanahan D, DNA cloning: A practive approach. IRL Press, Oxford, 109 -135). For the synthesis of hydroxylauric acid methylester, E. coli W3110-pBT10 and W3110-pBT10_alkL were grown overnight at 30°C and 180 rpm in 100 ml of M9 Medium (6g/L of Na2HPO4, 3 g/L of KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 2 mM MgSO4, 0.1 mM CaCl2, 0.5% glucose) with 30 mg/L kanamycin and by centrifugation. A part of the biomass was sterilely re-suspended in 250 mL of M9 Medium with 0.5% glucose and 30 mg/L kanamycin at an OD450 = 0.2 and cultured in shake vessels at 30°C and 180 rpm. The expression of the alk genes after a growth time of 4 h was induced by addition of 0.025% (v/v) of dicyclopropylketone and the culture was shaken for another 4 hours under the same conditions. The cells were then centrifuged, the cell pellet was resuspended in KPi buffer solution (50 mM, pH 7.4) and introduced into a bioreactor tempered at 30°C. A biomass concentration of about 1.8 g CDW/L was adjusted. Under strong agitation (1500 min-1) and an air flow of 2 vvm (volume per volume and minute) was added to the lauric acid methylester substrate at a ratio of 1:2 in relation to the cell suspension (100 ml of cell suspension, 50 ml of lauric acid methylester). The temperature was kept constant at 30°C.
    [00089] The formation of hydroxylauric acid methylester was proven by GC analysis of the reaction preparation. In addition, a sample was taken after 0 minutes as a negative control and after 150 minutes with an injection, through the ascending tube of the reactor and centrifuged in a 2 mL Eppendorf container in a tabletop centrifuge at 13200 rpm for phase separation for 5 minutes. The organic phase was analyzed by gas chromatography (Thermo Trace GC Ultra). As columns served a Varian Inc. FactorFourTM VF-5m, length: µm, inner diameter: 0.25 mm. Analysis conditions:
    320 °C
    [00090] The formation rates measured for 12-hydroxylauric acid methylester can then be converted to the biocatalyst activity and be referred to the cell mass employed.
    [00091] In the linearity region of the conversion kinetics applies, for the activity: Activity [U] = amount of converted matter [μmol] / time [min]
    [00092] This usual unit for the description of the enzyme "U" is a measure for the capacity of such a biocatalyst at the start of the reaction.

    [00093] The initial activity can be increased around the factor 26.7 by the additionally expressed alkL.
    权利要求:
    Claims (12)
    [0001]
    1. Process for oxidizing an organic substance, characterized in that it employs at least one oxidizing enzyme and at least one alkL gene product, in which the alkL gene product is made available independently of at least one other gene product encoded by alk operon which contains the alkL gene and which in a naturally occurring form is coupled to the formation of the alkL gene product, wherein the additional gene product is selected from at least one of the group consisting of AlkF, AlkG and AlkH, and wherein the alkL gene product is selected from the group consisting of proteins encoded by the alkL genes of Pseudomonas putida GPo1 and P1, which are given by SEQ ID No: 1 and SEQ ID No: 3, and proteins with the polypeptide sequence SEQ ID No: 2 or SEQ ID No: 4.
    [0002]
    2. Process according to claim 1, characterized in that the organic substance is selected from the group consisting of alkanes, alkenes, alkynes, alcohols, aldehydes, ketones, carboxylic acids, carboxylic acid esters, amines and epoxides branched or unbranched, saturated or unsaturated, optionally substituted, in which they preferably have from 3 to 22, in particular from 6 to 18, even more preferred from 8 to 14, very particularly 12 carbon atoms.
    [0003]
    3. Process according to claim 1 or 2, characterized in that the organic substance is selected from the group consisting of carboxylic acids and their corresponding esters, unsubstituted alkanes with 3 to 22 carbon atoms, unsubstituted alkenes with 3 to 22 carbon atoms, unsubstituted monohydric alcohols with 3 to 22 carbon atoms, unsubstituted aldehydes with 3 to 22 carbon atoms, unsubstituted monobasic amines with 3 to 22 carbon atoms, as well as substituted compounds, which they carry, as other substituents, in particular one or more hydroxyl, amino, keto, carboxyl, cyclopropyl or epoxy functions.
    [0004]
    4. Process according to at least one of claims 1 to 3, characterized in that the organic substance is oxidized to form an alcohol, an aldehyde, a ketone or an acid.
    [0005]
    5. Process according to at least one of claims 1 to 4, characterized in that the organic substance, in particular a carboxylic acid or a carboxylic acid ester, is oxidized in the w position.
    [0006]
    6. Process according to at least one of claims 1 to 5, characterized in that the oxidizing enzyme is an alkane monooxygenase, a xylene monooxygenase, an aldehyde dehydrogenase, an alcohol oxidase or an alcohol dehydrogenase, of preferably an alkane monooxygenase.
    [0007]
    7. Process according to claim 6, characterized in that the alkane monooxygenase is a cytochrome-P450-monoxygenase, in particular a cytochrome-P450-monoxygenase from Candida, for example from Candida tropicalis, or from plants, for example from Cicer arietinum L..
    [0008]
    8. Process according to claim 6, characterized in that the alkane monooxygenase is an alkB gene product, which is encoded from an alkB gene of organisms selected from the group of gram-negative bacteria, in particular from the group of Pseudomonads, in particular Pseudomonas putida GPo1.
    [0009]
    9. Process according to claim 6, characterized in that alcohol dehydrogenase is the alcohol dehydrogenase encoded by the alkJ gene, in particular the alcohol dehydrogenase encoded by the alkJ gene of the group of gram-negative bacteria, in particular of the group of Pseudomonas, in particular Pseudomonas putida GPo1.
    [0010]
    10. Process according to any one of claims 1 to 9, characterized in that it is performed in at least one microorganism or in a medium involving at least one microorganism.
    [0011]
    11. Process according to claim 10, characterized in that the microorganism is selected from the group of bacteria, in particular gram-negative, in particular from the group that contains E. coli, Pseudomonas sp., Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas acidovorans, Pseudomonas aeruginosa, Acidovorax sp., Acidovorax temperans, Acinetobacter sp., Burkholderia sp., cyanobacterium, Klebsiella sp., Salmonella sp., Rhizobium sp. and Rhizobium meliloti.
    [0012]
    12. Use of an alkL gene product, characterized by the fact that it is to increase the oxidation rate of at least one enzyme that oxidizes an organic substance, in which the use of the alkL gene product occurs independently of at least one gene product encoded by alk operon which contains the alkL gene and which in a naturally occurring form is coupled to the formation of the alkL gene product, wherein the additional gene product is selected from at least one of the group consisting of AlkF, AlkG and AlkH, and wherein the alkL gene product is selected from the group consisting of proteins encoded by the alkL genes of Pseudomonas putida GPo1 and P1, which are given by SEQ ID NO: 1 and SEQ ID NO: 3, and proteins with the polypeptide sequence SEQ ID NO: 2 or SEQ ID NO: 4.
    类似技术:
    公开号 | 公开日 | 专利标题
    BR112012027051B1|2021-05-18|biocatalytic oxidation process with alkl gene product, and use of an alkl gene product
    Marc et al.2017|Over expression of GroESL in Cupriavidus necator for heterotrophic and autotrophic isopropanol production
    Armengaud et al.1999|A functional 4-hydroxysalicylate/hydroxyquinol degradative pathway gene cluster is linked to the initial dibenzo-p-dioxin pathway genes in Sphingomonas sp. strain RW1
    US20070031951A1|2007-02-08|Method for the production of resveratrol in a recombinant bacterial host cell
    US20110151530A1|2011-06-23|Enzymatic production of 2-hydroxy-isobutyrate |
    RU2710714C2|2020-01-10|Compositions and methods for biological production of lactate from c1-compounds using transformants of lactate dehydrogenase
    Hume et al.2009|FadD from Pseudomonas putida CA-3 is a true long-chain fatty acyl coenzyme A synthetase that activates phenylalkanoic and alkanoic acids
    US20180355394A1|2018-12-13|Bioconversion of short-chain hydrocarbons to fuels and chemicals
    Park et al.2006|Characterization of styrene catabolic genes of Pseudomonas putida SN1 and construction of a recombinant Escherichia coli containing styrene monooxygenase gene for the production of |-styrene oxide
    US20210261991A1|2021-08-26|Biosynthetic production of gamma-lactones
    CN113557259A|2021-10-26|Biosynthetic production of gamma-lactones and delta-lactones using cytochrome P450 enzymes with sub-terminal hydroxylase activity
    JPWO2018199112A1|2020-04-23|Transformed microorganism and its use
    WO2019056071A1|2019-03-28|Recombinant microorganisms
    JP2006500005A|2006-01-05|Use of xylene monooxygenase for the oxidation of substituted polycyclic aromatic compounds
    US8735110B2|2014-05-27|Pseudomonas aeruginosa strain developed for improving fatty acid content, and method of manufacturing the same
    WO2018199111A1|2018-11-01|Transgenic microorganism capable of producing muconic acid, and use thereof
    Berg et al.2021|-3-Hydroxybutyryl-CoA dehydrogenase from the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in Nitrosopumilus maritimus
    WO2014090923A1|2014-06-19|Process for producing 3-hydroxytyrosol from 3,4-dihydroxyphenylacetic acid|employing a carboxylic acid reductase
    EP3529258A1|2019-08-28|Cells and method for producing rhamnolipids using alternative glucose transporters
    WO2018077700A1|2018-05-03|Rhamnolipid-producing cell having reduced glucose dehydrogenase activity
    Ryder2008|DNA Sequence Analysis of a Bioluminescent Marine Bacterium
    WO2011055715A1|2011-05-12|Hydroxy fatty acid analogues and method for producing same
    同族专利:
    公开号 | 公开日
    EP2560987A1|2013-02-27|
    CN102947328A|2013-02-27|
    BR112012027051A2|2016-12-06|
    DE102010015807A1|2011-10-20|
    RU2573900C2|2016-01-27|
    CA2796777A1|2011-10-27|
    CN106279380A|2017-01-04|
    TWI588257B|2017-06-21|
    WO2011131420A1|2011-10-27|
    JP2013528361A|2013-07-11|
    MY169996A|2019-06-19|
    EP2560987B1|2019-02-20|
    TW201207105A|2012-02-16|
    JP5936601B2|2016-06-22|
    RU2012148996A|2014-05-27|
    HUE044453T2|2019-10-28|
    US9200043B2|2015-12-01|
    CA2796777C|2018-08-28|
    ES2725823T3|2019-09-27|
    US20130052700A1|2013-02-28|
    CN106279380B|2021-05-28|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    NL8700085A|1987-01-15|1988-08-01|Rijksuniversiteit|METHOD FOR PREPARING COMPOUNDS WITH TERMINAL HYDROXYL OR EPOXY GROUP; USEFUL MICROORGANISMS FOR THAT.|
    US5242816A|1990-07-10|1993-09-07|Lonza Ltd.|Microbiological oxidation of alkyl groups in heterocycles|
    IE75349B1|1991-03-07|1997-08-27|Lonza Ag|A process for the terminal hydroxylation of ethyl groups on aromatic 5- or 6-membered heterocyclic compounds|
    DK0839211T3|1995-07-13|2001-09-03|Basf Ag|Process for the preparation of riboflavin by microorganisms with altered isocitrate lyase activity|
    CA2293737A1|1997-07-21|1999-01-28|E.I. Du Pont De Nemours And Company|Transformed yeast strains and their use for the production of monoterminal and diterminal aliphatic carboxylates|
    AU5917799A|1998-10-05|2000-04-26|Cognis Corporation|Cytochrome p450 monooxygenase and nadph cytochrome p450 oxidoreductase genes andproteins related to the omega hydroxylase complex of and m ethods relating thereto|
    DE19951768A1|1999-10-27|2001-05-03|Basf Ag|Microbiological process for the production of aromatic aldehydes and / or carboxylic acids|
    EP1188837A1|2000-09-18|2002-03-20|Eidgenössische Technische Hochschule Zürich|Process for preparing N-substituted 4-hydroxypiperidines by enzymatic hydroxylation|
    DE10054347A1|2000-11-02|2002-05-08|Degussa|Process for the catalytic hydrogenation of organic compounds and supported catalysts therefor|
    DE10142621A1|2001-08-31|2003-03-20|Degussa|Processing of the ammoximation products of ketones by liquid-liquid extraction in a ternary solvent system|
    DE10142620A1|2001-08-31|2003-03-20|Degussa|Ammoximation of ketones and processing by pervaporation / vapor permeation|
    EP1350788A3|2002-03-28|2003-11-12|Degussa AG|Process for preparing hexamethylenediamine from butadiene|
    EP1350761A1|2002-03-28|2003-10-08|Degussa AG|Process for the production of hydrogen peroxide|
    DE50213288D1|2002-05-31|2009-04-02|Evonik Degussa Gmbh|A supported ruthenium catalyst and process for hydrogenating an aromatic amine in the presence of said catalyst|
    DE10231119A1|2002-07-10|2004-02-05|Degussa Ag|Process for increasing the selectivity of the hydrogenation of 4,4'-diaminodiphenylmethane to 4,4'-diaminodicyclohexylmethane in the presence of an N-alkyl-4,4'-diaminodiphenylmethane|
    DE10247495A1|2002-10-11|2004-04-22|Degussa Ag|Process for the epoxidation of cyclic alkenes|
    EP1424332A1|2002-11-26|2004-06-02|Degussa AG|Process for the purification of crude propene oxide|
    US6878836B2|2003-06-18|2005-04-12|Degussa Ag|Process for the epoxidation of propene|
    AT387417T|2004-12-20|2008-03-15|Evonik Degussa Gmbh|PROCESS FOR RECOVERING METHANOL|
    DE102006017760A1|2006-03-24|2007-09-27|Ufz-Umweltforschungszentrum Leipzig-Halle Gmbh|Enzymatic preparation of 2-hydroxy-2-methylcarboxylic acid comprises producing 3-hydroxycarboxylic acid in aqueous reaction solution, incubating the obtained solution and converting to 2-hydroxy-2-methylcarboxylic acid|
    US8372595B2|2006-05-11|2013-02-12|Evonik Industries Ag|Method for obtaining a microbial strain for production of sphingoid bases|
    DE102006025821A1|2006-06-02|2007-12-06|Degussa Gmbh|An enzyme for the production of Mehylmalonatsemialdehyd or Malonatsemialdehyd|
    DE102007021199B4|2006-07-17|2016-02-11|Evonik Degussa Gmbh|Compositions of organic polymer as matrix and inorganic particles as filler, process for their preparation and their use and moldings produced therewith|
    DE102007005072A1|2007-02-01|2008-08-07|Evonik Degussa Gmbh|Process for the fermentative production of cadaverine|
    DE102007015583A1|2007-03-29|2008-10-02|Albert-Ludwigs-Universität Freiburg|An enzyme for the production of methylmalonyl-coenzyme A or ethylmalonyl-coenzyme A and its use|
    DE102007031689A1|2007-07-06|2009-01-08|Evonik Goldschmidt Gmbh|enzyme preparations|
    DE102007035646A1|2007-07-27|2009-01-29|Evonik Goldschmidt Gmbh|About SIC and via carboxylic acid ester groups linked linear polydimethylsiloxane-polyoxyalkylene block copolymers, a process for their preparation and their use|
    DE102007052463A1|2007-11-02|2009-05-07|Evonik Degussa Gmbh|Fermentative recovery of acetone from renewable resources using a new metabolic pathway|
    DE102007060705A1|2007-12-17|2009-06-18|Evonik Degussa Gmbh|ω-aminocarboxylic acids or their lactams, producing, recombinant cells|
    DE102008004725A1|2008-01-16|2009-07-23|Evonik Goldschmidt Gmbh|Process for the heterogeneously catalyzed preparation of carboxylic acid derivatives|
    DE102008004726A1|2008-01-16|2009-07-23|Evonik Goldschmidt Gmbh|Process for the enzymatic production of carboxylic acid esters|
    DE102008000266A1|2008-02-11|2009-08-13|Evonik Goldschmidt Gmbh|The invention relates to the use of foam stabilizers, which are produced on the basis of renewable raw materials, for the production of polyurethane foams|
    DE102008002090A1|2008-05-30|2009-12-03|Evonik Degussa Gmbh|Unsaturated dicarboxylic acids from unsaturated cyclic hydrocarbons and acrylic acid by metathesis, their use as monomers for polyamides, polyesters, polyurethanes and further conversion to diols and diamines|
    DE102008002715A1|2008-06-27|2009-12-31|Evonik Röhm Gmbh|2-hydroxyisobutyric acid producing recombinant cell|
    DE102008040193A1|2008-07-04|2010-01-07|Evonik Röhm Gmbh|Process for the preparation of free carboxylic acids|
    DE102008040415A1|2008-07-15|2010-01-21|Evonik Röhm Gmbh|Thermal salt splitting of ammonium carboxylates|
    DE102008041754A1|2008-09-02|2010-03-04|Evonik Goldschmidt Gmbh|enzyme preparations|
    DE102009000592A1|2009-02-04|2010-08-05|Evonik Degussa Gmbh|Process for the preparation of amino-group-bearing, multicyclic ring systems|
    DE102009000662A1|2009-02-06|2010-08-12|Evonik Degussa Gmbh|Process for the preparation of aldehydes and ketones from primary and secondary alcohols|
    DE102009000661A1|2009-02-06|2010-08-12|Evonik Degussa Gmbh|Preparing -2,6-dioxabicyclo--octan-4,8-dione, comprises oxidizing dianhydrohexitols or their corresponding hydroxy ketones with oxygen-containing gas in the presence of catalyst composition containing e.g. a nitroxyl radical|
    DE102009009580A1|2009-02-19|2010-08-26|Evonik Degussa Gmbh|Process for the preparation of free acids from their salts|
    DE102009015211A1|2009-03-31|2010-10-14|Evonik Goldschmidt Gmbh|Self-crosslinking polysiloxanes in coatings of enzyme immobilizates|
    DE102009002371A1|2009-04-15|2010-10-21|Evonik Goldschmidt Gmbh|Process for the preparation of odorless polyether alcohols by means of DMC catalysts and their use in cosmetic and / or dermatological preparations|
    DE102009002811A1|2009-05-05|2010-11-11|Evonik Degussa Gmbh|Enzymatic process for the preparation of aldehydes|
    DE102009027394A1|2009-07-01|2011-01-05|Evonik Degussa Gmbh|Use of isocyanates based on renewable raw materials|
    DE102009027392A1|2009-07-01|2011-01-05|Evonik Degussa Gmbh|Composition based on diisocyanates from renewable raw materials|
    DE102009046623A1|2009-11-11|2011-05-12|Evonik Röhm Gmbh|Use of a protein homologous to a MeaB protein to increase the enzymatic activity of a 3-hydroxycarboxylic acid CoA mutase|
    DE102009046626A1|2009-11-11|2011-05-12|Evonik Degussa Gmbh|Candida tropicalis cells and their use|
    DE102010014680A1|2009-11-18|2011-08-18|Evonik Degussa GmbH, 45128|Cells, nucleic acids, enzymes and their use, as well as methods for producing sophorolipids|
    DE102009046910A1|2009-11-20|2011-05-26|Evonik Degussa Gmbh|Process for the processing of a material stream containing laurolactam for the recovery of all valuable components contained by combination of crystallization with downstream distillation|
    EP2361255B1|2009-12-23|2014-06-11|Evonik Degussa GmbH|Sweetener and method for the production thereof|
    DE102010002809A1|2010-03-12|2011-11-17|Evonik Degussa Gmbh|Process for the preparation of linear alpha, omega-dicarboxylic acid diesters|
    DE102010026196A1|2010-06-25|2011-12-29|Evonik Degussa Gmbh|Synthesis of omega-aminocarboxylic acids and their esters from unsaturated fatty acid derivatives|
    DE102010032484A1|2010-07-28|2012-02-02|Evonik Goldschmidt Gmbh|Cells and methods for producing rhamnolipids|
    DE102011004465A1|2010-09-10|2012-03-15|Evonik Degussa Gmbh|Process for direct amination of secondary alcohols with ammonia to primary amines|
    DE102010043470A1|2010-11-05|2012-05-10|Evonik Degussa Gmbh|Composition of polyamides with low concentration of carboxylic acid amide groups and electrically conductive carbon|
    DE102011075162A1|2010-12-08|2012-06-14|Evonik Degussa Gmbh|A process for the homogeneous-catalyzed, highly selective direct amination of primary alcohols with ammonia to primary amines at high volume ratio of liquid to gas phase and / or high pressures|
    RU2013142804A|2011-02-21|2015-03-27|Эвоник Дегусса Гмбх|METHOD FOR DIRECT AMINATION OF AMMONIA ALCOHOLS TO PRIMARY AMINES USING THE CATALYTIC SYSTEM BASED ON XANTHOS|
    DE102011015150A1|2011-03-25|2012-09-27|Evonik Degussa Gmbh|Syntesis of alpha, omega-dicarboxylic acids and their esters from unsaturated fatty acid derivatives|
    DE102011110959A1|2011-08-18|2013-02-21|Evonik Degussa Gmbh|Pichia ciferrii cells and their use|
    DE102011084518A1|2011-10-14|2013-04-18|Evonik Industries Ag|Use of a multilayer film with polyamide and polyester layers for the production of photovoltaic modules|
    DE102013203470A1|2013-03-01|2014-09-04|Evonik Industries Ag|Process for the preparation of ketones from epoxides|DE102006025821A1|2006-06-02|2007-12-06|Degussa Gmbh|An enzyme for the production of Mehylmalonatsemialdehyd or Malonatsemialdehyd|
    DE102009009580A1|2009-02-19|2010-08-26|Evonik Degussa Gmbh|Process for the preparation of free acids from their salts|
    DE102009046623A1|2009-11-11|2011-05-12|Evonik Röhm Gmbh|Use of a protein homologous to a MeaB protein to increase the enzymatic activity of a 3-hydroxycarboxylic acid CoA mutase|
    DE102009046626A1|2009-11-11|2011-05-12|Evonik Degussa Gmbh|Candida tropicalis cells and their use|
    DE102010014680A1|2009-11-18|2011-08-18|Evonik Degussa GmbH, 45128|Cells, nucleic acids, enzymes and their use, as well as methods for producing sophorolipids|
    DE102011004465A1|2010-09-10|2012-03-15|Evonik Degussa Gmbh|Process for direct amination of secondary alcohols with ammonia to primary amines|
    DE102010043470A1|2010-11-05|2012-05-10|Evonik Degussa Gmbh|Composition of polyamides with low concentration of carboxylic acid amide groups and electrically conductive carbon|
    DE102011075162A1|2010-12-08|2012-06-14|Evonik Degussa Gmbh|A process for the homogeneous-catalyzed, highly selective direct amination of primary alcohols with ammonia to primary amines at high volume ratio of liquid to gas phase and / or high pressures|
    MX344165B|2011-02-16|2016-12-07|Evonik Degussa Gmbh|Liquid cation exchanger.|
    RU2013142804A|2011-02-21|2015-03-27|Эвоник Дегусса Гмбх|METHOD FOR DIRECT AMINATION OF AMMONIA ALCOHOLS TO PRIMARY AMINES USING THE CATALYTIC SYSTEM BASED ON XANTHOS|
    EP2697231B1|2011-04-12|2015-02-18|Evonik Degussa GmbH|Continuously usable method for manufacturing carbonyl compounds using a nitroxyl radical based catalyst|
    HUE032045T2|2011-07-20|2017-08-28|Evonik Degussa Gmbh|Oxidation and amination of secondary alcohols|
    DE102011110945A1|2011-08-15|2013-02-21|Evonik Degussa Gmbh|Biotechnological synthesis of organic compounds with alkIL gene product|
    DE102011084518A1|2011-10-14|2013-04-18|Evonik Industries Ag|Use of a multilayer film with polyamide and polyester layers for the production of photovoltaic modules|
    EP2602328A1|2011-12-05|2013-06-12|Evonik Industries AG|Method of Oxidation of alkanes employing an AlkB alkane 1-monooxygenase|
    EP2607490A1|2011-12-22|2013-06-26|Evonik Industries AG|Method for improved separation of a hydrophobic organic solution from an aqueous culture medium|
    EP2620504A1|2012-01-25|2013-07-31|Evonik Industries AG|Process for oxidizing alkenes employing the Pseudomonas putida GPo1 AlkB monooxygenase|
    EP2631298A1|2012-02-22|2013-08-28|Evonik Industries AG|Biotechnological method for producing butanol and butyric acid|
    EP2639308A1|2012-03-12|2013-09-18|Evonik Industries AG|Enzymatic omega-oxidation and -amination of fatty acids|
    EP2647696A1|2012-04-02|2013-10-09|Evonik Degussa GmbH|Method for aerobic production of alanine or a compound arising using alanine|
    DE102012207921A1|2012-05-11|2013-11-14|Evonik Industries Ag|Multi-stage synthesis process with synthesis gas|
    EP2700448A1|2012-08-21|2014-02-26|Evonik Industries AG|Branched fatty acids as liquid cation exchangers|
    EP2706076B1|2012-09-07|2014-12-17|Evonik Industries AG|Hardening compounds on the basis of epoxide resins without benzyl alcohol|
    EP2730655A1|2012-11-12|2014-05-14|Evonik Industries AG|Process for converting a carboxylic acid ester employing BioH-deficient cells|
    EP2733215A1|2012-11-20|2014-05-21|Evonik Industries AG|Process for producing alpha,omega-diols from alkanes or 1-alkanols employing a CYP153 alkane hydroxylase|
    EP2746400A1|2012-12-21|2014-06-25|Evonik Industries AG|Preparation of amines and diamines from a carboxylic acid or dicarboxylic acid or a monoester thereof|
    EP2746397A1|2012-12-21|2014-06-25|Evonik Industries AG|Production of omega amino fatty acids|
    EP2759598A1|2013-01-24|2014-07-30|Evonik Industries AG|Process for preparing alpha, omega alkanediols|
    CN103757019B|2013-12-23|2015-12-30|青岛蔚蓝生物集团有限公司|The recombinant expression system of a kind of promotor and expression foreign protein|
    US9487804B2|2014-02-13|2016-11-08|William Marsh Rice University|Hydroxy- and dicarboxylic-fat synthsis by microbes|
    EP2944697A1|2014-05-13|2015-11-18|Evonik Degussa GmbH|Method of producing nylon|
    WO2016053648A1|2014-09-29|2016-04-07|Ciris Energy, Inc.|Expression of heterologous microbial oxidative enzymes to increase the amount of biologically labile organic carbon from pretreated coal|
    CA2937594A1|2015-02-26|2016-08-26|Evonik Degussa Gmbh|Alkene production|
    WO2017085111A1|2015-11-17|2017-05-26|Evonik Degussa Gmbh|Biocatalytic oxidation|
    EP3173478A1|2015-11-25|2017-05-31|Evonik Degussa GmbH|Biotechnological production of omega-functionalised carboxylic acids and esters thereof|
    ES2803208T3|2015-12-17|2021-01-25|Evonik Operations Gmbh|A genetically modified acetogenic cell|
    EP3336180A1|2016-07-04|2018-06-20|Evonik Degussa GmbH|Mutant alkb gene|
    EP3490969B1|2016-07-27|2020-07-22|Evonik Operations GmbH|N-acetyl homoserine|
    DE102017104648B4|2017-03-06|2019-05-09|Helmholtz-Zentrum Für Umweltforschung Gmbh - Ufz|Process for the bioreactive extraction of oxygen generated from a reaction space, and use of phototrophic microorganisms in the production of hydrogen|
    CN107022513A|2017-03-17|2017-08-08|河北美邦工程科技股份有限公司|A kind of method that recombinant escherichia coli strain produces long-chain biatomic acid|
    TWI701040B|2018-03-19|2020-08-11|國立臺灣大學|Applications of a protein and a whole-cell catalytic system containing the protein and the whole-cell catalytic system|
    KR102289044B1|2020-03-23|2021-08-11|건국대학교 산학협력단|Gene construct for producing hydroxy fatty acid methyl ester and method for producing the hydroxide fatty acid methyl ester using the same|
    法律状态:
    2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|
    2019-07-09| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NAO 10196/2001, QUE MODIFICOU A LEI NAO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUAANCIA PRA VIA DA ANVISA. CONSIDERANDO A APROVAA AO DOS TERMOS DO PARECER NAO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NAO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDAANCIAS CABA-VEIS. |
    2020-03-10| B07G| Grant request does not fulfill article 229-c lpi (prior consent of anvisa) [chapter 7.7 patent gazette]|
    2020-05-12| B25D| Requested change of name of applicant approved|Owner name: EVONIK OPERATIONS GMBH (DE) |
    2020-06-16| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|
    2020-12-22| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|
    2021-04-06| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|
    2021-05-18| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 15/03/2011, OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF |
    优先权:
    申请号 | 申请日 | 专利标题
    DE102010015807.0|2010-04-20|
    DE102010015807A|DE102010015807A1|2010-04-20|2010-04-20|Biocatalytic oxidation process with alkL gene product|
    PCT/EP2011/053834|WO2011131420A1|2010-04-20|2011-03-15|Biocatalytic oxidation process with alkl gene product|
    [返回顶部]