method for eliminating or reducing a bacterial biofilm, variant of endolysin or variant of bacterioc

专利摘要:
METHOD OF REDUCING BIOFILMS The present invention relates to methods of eliminating, reducing or preventing bacterial biofilms through a fusion protein comprising an endolysin, an autolysin or a bacteriocin to which a membrane-bound peptide or LPS interrupts activity is fused. In addition, the present invention relates to fusion proteins for use as a medicine, in particular for the treatment or prevention of infections caused by Gram-positive and / or Gram-negative bacteria associated with bacterial biofilm, as a means for diagnosis, disinfectant or as a cosmetic substance. The present invention also relates to the removal or reduction or prevention of contamination by Gram-negative and / or Gram-positive bacteria associated with the bacterial biofilm of food material, of food processing equipment, of food processing plants, surface that come into contact with food, medical devices, surface in hospitals and surgery. In addition, the present invention relates to the use of said fusion protein as a means for diagnosis in medical diagnostics, of food or food or environmental products associated with bacterial biofilm.
公开号:BR112012026880B1
申请号:R112012026880-5
申请日:2011-04-27
公开日:2021-03-16
发明作者:Stefan Miller
申请人:Lysando Ag；
IPC主号:

专利说明:

[001] The present invention relates to methods of eliminating, reducing or preventing bacterial biofilms through a fusion protein that comprises an endolysin, an autolysin or a bacteriocin to which a peptide with membrane-breaking or LPS is fused. In addition, the present invention relates to fusion proteins for use as a medicament, in particular for the treatment or prevention of infections caused by Gram-positive and / or Gram-negative bacteria associated with bacterial biofilm, as a means for diagnosis, disinfectant or as a cosmetic substance. The present invention also relates to the removal or reduction or prevention of contamination by Gram-negative and / or Gram-positive bacteria associated with the bacterial biofilm of food material, of food processing equipment, of food processing plants, surfaces that come into contact with food, medical devices, surfaces in hospitals and surgery. In addition, the present invention relates to the use of said fusion protein as a means of diagnosis in the medical, food or food or environmental diagnosis associated with bacterial biofilm.
[002] Endolysins are peptideoglycan hydrolases encoded by bacteriophages (or bacterial viruses). They are synthesized during late gene expression in the lytic cycle of phage multiplication and mediate the release of progeny virions from infected cells through the degradation of bacterial peptideoglycan. They are β- (1,4) -glycosylases (lysozymes), transglycosylases, amidases or endopeptides. The antimicrobial application of endolysins was already suggested in 1991 by Gasson (GB2243611). Although the killing ability of endolysins has been known for a long time, the use of these enzymes as antibacterial agents has been ignored due to the success and dominance of antibiotics. It was only after the emergence of bacteria resistant to various antibiotics that this simple concept of combating human pathogenic agents with endolysins received interest. A compelling need to develop entirely new classes of antibacterial agents has emerged and the endolysins used as 'enzymes' - a hybrid term for 'enzymes' and 'anti-antibiotics' - have perfectly met this need. In 2001, Fischetti and collaborators demonstrated for the first time the therapeutic potential of bacteriophage Cl endolysin for group A streptococci (Nelson et al., 2001). Thus, several publications have established endolysins as an attractive and complementary alternative to control bacterial infections, particularly by Gram-positive bacteria. Subsequently different endolysins against other Gram-positive pathogens such as Streptococcus pneumoniae (Loeffler et al., 2001), Bacillus anthracis (Schuch et al., 2002), S. agalactiae (Cheng et al., 2005) and Staphylococcus aureus (Rashel et al., 2007) have been proven to be effective as enzyme antibiotics. Currently, the most important challenge of endolysin therapy is based on the insensitivity of Gram-negative bacteria to the exogenous action of endolysins, since the outer membrane protects the accession of peptideoglycan endolysins. This generally prevents the expansion of the range of efficient en-dolisinsins for important Gram-negative pathogens.
[003] Gram-negative bacteria have an outer membrane, with their characteristic asymmetric bilayer as a distinctive feature. The outer membrane bilayer consists of an inner monolayer that contains phospholipids (primarily phosphatidyl ethanolamine) and an outer monolayer that is mainly composed of a single glycolipid, lipopolysaccharide (LPS). There is an immense diversity of LPS structures in the bacterial realm and the LPS structure can be modified in response to prevailing environmental conditions. The stability of the LPS layer and the interaction between different LPS molecules are mainly achieved through the electrostatic interaction of divalent ions (Mg2 +, Ca2 +) with the anionic components of the LPS molecule (phosphate groups in lipid A and the nucleus internal and carboxyl groups of KDO). Therefore, cation-binding sites are essential for the integrity of the outer membrane (Vaara, 1992). Polycationic agents such as polymers of poly-L-lysine (of at least 20 residues) increase the permeability of the outer membrane by displacing these divalent stabilizing cations. In addition, they exercise a so-called 'self-promoted uptake' mechanism (Hancock and Wong, 1984). Due to their volume, they interrupt the normal barrier function of the external membrane and create transitory cracks, promoting their own uptake (Vaara and Vaara, 1983). In addition, the dense and orderly packaging of the hydrophobic group of lipid A, favored by the absence of unsaturated fatty acids, forms a rigid structure with high viscosity. This makes it less permeable to lipophilic molecules and gives additional stability to the outer membrane (OM).
[004] In contrast to Gram-negative bacteria, Gram-positive bacteria do not have an outer membrane. The cytoplasmic membrane is surrounded by a layer of peptideoglycan up to 25 nm thick (which is only up to 5 nm in Gram-negative bacteria) that forms the cell wall. The main purpose of the Gram-positive cell wall is to maintain the shape of the bacteria and act against the internal pressure in the bacterial cell. Peptideoglycan, or murein, is a polymer that consists of sugars and amino acids. The sugar component consists of alternating residues of N-acetylglucosamine bound in β- (1,4) and the residues of N-acetylmurâmyco acid make up the sugar components. A peptide chain of three to five amino acids is linked to N-acetylmuramic acid. The peptide chain can be cross-linked with the peptide chain of another strand, forming a layer similar to a 3D frame. The peptide chain may contain amino acid residues D and L and the composition may vary for different bacteria.
[005] Most Gram-negative bacteria, as well as many Gram-positive bacteria develop a bacterial biofilm. Biofilm is defined as an aggregate or an association of microorganisms, which adheres to the surface. Adherent bacteria are often surrounded and protected by an extracellular polymeric substance that is produced by Gram-negative and Gram-positive bacteria. Because of biofilm, bacteria are much more resistant to antimicrobial substances such as antibiotics, disinfectants and enzymes that degrade the cell wall. In addition, the treatment of biofilms is generally not possible because the extracellular polymeric substance protects itself against degradation by antimicrobial substances, disinfectants or substances that degrade biofilms.
[006] Thus, there is a need for methods of eliminating, reducing or preventing bacterial biofilms.
[007] This objective is resolved by the objective subject defined in the claims.
[008] The following figures illustrate the present invention.
[009] Figure 1 is a schematic view showing the plasmi-deal construction for the recombinant production of (POLI) n-gp144 ((POLI) n-KZ144). Previously, pEXP5CT / POLI-gp144 (pEXP5CT / POLI-KZ144) was constructed by a tail PCR (with the BamHI restriction site and the first polycation cassette in the 5 'tail primer). The plasmid was linearized with BamHI, dephosphorylated and ligated with a cassette containing projected BamHI ends. This cassette originates from the hybridization of two complementary oligonucleotides and encodes 9 post-loaded residues. An additional positive arginine residue is created at the junction site between the first and second cassettes, along with a serine. Longer variants of pEXP5CT / (POLI) n-gp144 (pEXP5CT / (POLI) n-KZ144) were constructed similarly through repeated cycles.
[010] Figure 2 shows the expression and secretion of POLI-gp144 by Pichia pastoris. An amount of 30 μL of supernatant from a P. pastoris X33 expression culture [after 1 day (square), 3 days (triangle) and 4 days (circle)] is added to 270 μL of P. aeruginosa PAO1p cells permeabilized with chloroform. The buffer conditions were the optimal enzymatic conditions of POLI-gp144 (KH2PO4 / K2HPO4) I = 120 mM pH 6.2). Subsequently, the optical density was recorded spectrophotometrically. A drop in optical density indicates the secretion of a mural enzyme by P. pastoris. As a negative control, P. pastoris X33 without expression plasmid is included (rhombus).
[011] Figure 3 shows in graphical form the antibacterial activity of the unmodified phiKZgp144 and ELgp188 endolysins, of the modified endo-lysine variants POLI-gp144 and POLI-gp188 that comprise a peptide comprising 9 post-loaded amino acid residues and the modified (POLI) 2-gp144 and (POLI) 2-gp188 variants which comprise a peptide comprising 18 amino acid residues loaded positively into Pseudomonas aeruginosa PAO1p cells. Error bars produce standard deviations from the mean.
[012] Figure 4 shows a photograph of an SDS-PAGE stained with Co-massie that shows the results of the expression and purification of the unmodified PSP3gp10 endolysin and its modified endolysin variant PKPSP3gp10. The LMW range refers to a size marker (LMW ladder). The following three ranges refer to the protein fractions of the purified protein in the Elution Buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) after Ni2 + affinity chromatography . The FT range refers to the flow and the W range refers to the disposal fractions. Only minor secondary bands are visible in the purified protein fractions, indicating the high purity of the recombinant proteins (> 90%).
[013] Figures 5 A to D show in graphical form the antibacterial activities of unmodified PSP3gp10 and modified PKPSP3gp10 in different compositions on several Gram-negative bacteria in exponential growth after an incubation at room temperature and without shaking. Each species of Gram-negative bacteria was incubated for 30 minutes with a composition comprising 0.5 mM EDTA, but without endolysin, with a composition comprising 1.315 μM of unmodified PSP3gp10, but without EDTA, with a composition comprising 1.315 μM of modified PKPSP3gp10, but without EDTA, with a composition comprising 1.315 μM of unmodified PSP3gp10 and 0.5 mM EDTA and with a composition comprising 1.315 μM of modified PKPSP3gp10 and 0.5 mM EDTA. In Figure 5 A the antibacterial activity on P. aeruginosa PAO1p cells is represented, in Figure 5 B the antibacterial activity on P. aeruginosa Br667 cells, in Figure 5 C the antibacterial activity on E.coli WK 6 cells and in Figure 5 D the antibacterial activity on Salmonella typhimurium cells. “Δ” provides the difference in activity between the respective PSP3gp10 and PKPSP3gp10 samples. Error bars produce standard deviations from the mean.
[014] Figure 6 shows a photograph of an SDS-PAGE stained with Co-massie that shows the results of the expression and purification of the unmodified P2gPO9 endolysin and its modified endolysin variant PKP2gPO9. The LMW range refers to a size marker (LMW ladder). The following three ranges refer to the protein fractions of the purified protein in Elution Buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) after Ni2 + affinity chromatography . The FT range refers to the flow and the W range refers to the disposal fractions. Only minor secondary bands are visible in the purified protein fractions, indicating the high purity of the recombinant protein (> 95%).
[015] Figures 7 A through F show in graphical form the antibacterial activities of unmodified P2gPO9 and modified P2gPO9 in different positions on several exponentially growing Gram-negative bacteria after an incubation at room temperature and without shaking. Each species of Gram-negative bacteria was incubated for 30 minutes with a composition comprising 0.5 mM EDTA, but without endolysin, with a composition comprising 1.315 μM of unmodified P2gPO9, but without EDTA, with a composition that comprises 1.315 μM of modified P2gPO9, but without EDTA, with a composition comprising 1.315 μM of unmodified P2gPO9 and 0.5 mM EDTA and with a composition comprising 1.315 μM of modified P2gPO9 and 0.5 mM EDTA. In Figure 7 A the antibacterial activity on P. aeruginosa PAO1p cells is represented, in Figure 7 B the antibacterial activity on P. aeruginosa Br667 cells, in Figure 7 C the antibacterial activity on E.coli WK 6 cells, in Figure 7 D the antibacterial activity on cells of Burkholdeia pseudomallei, in Figure 7 AND the antibacterial activity on cells of Pseudo-monas putida G1 and in Figure 7 F the antibacterial activity on cells of Salmo-nella typhimurium LT2 (SGSC N ° 2317). “Δ” provides the difference in activity between the respective P2gPO9 and PKP2gPO9 samples. Error bars produce standard deviations from the mean.
[016] Figure 8 shows a photograph of an SDS-PAGE stained with Co-massie that shows the results of the expression and purification of the unmodified OB-PgpLYS endolysin and its modified endolysin variant PKOBPgpLYS. The LMW range refers to a size marker (LMW ladder). The following three ranges refer to the protein fractions of the purified protein in Elution Buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) after Ni2 + affinity chromatography . The FT range refers to the flow and the W range refers to the disposal fractions. Only minor secondary bands are visible in the purified protein fractions, indicating the high purity of the recombinant proteins (> 90%).
[017] Figures 9 A through F show in a graphical representation the antibacterial activities of different compositions of unmodified OBPgpLYS and the modified PKOBPgpLYS on several Gram-negative bacteria in exponential growth after an incubation at room temperature and without shaking. Each species of Gram-negative bacteria was incubated for 30 minutes with a composition comprising 0.5 mM EDTA, but without endolysin, with a composition comprising 1.315 μM of unmodified OBPgpLYS, but without EDTA, with a composition comprising 1.315 μM of modified PKOBPgpLYS, but without EDTA, with a composition comprising 1.315 μM of unmodified OBPgpLYS and 0.5 mM EDTA and with a composition comprising 1.315 μM of modified PKOBPgpLYS and 0.5 mM EDTA. In Figure 9 A the antibacterial activity on Escherichia coli WK6 cells is represented, in Figure 9 B the antibacterial activity on Salmonella typhimurium LT2 cells (SGSC No. 2317), in Figure 9 C the antibacterial activity on Pseudomonas aeruginosa cells. PAO1p, in Figure 9 D the antibacterial activity on cells of Pseudomonas ae-ruginosa Br667, in Figure 9 AND the antibacterial activity on cells of Pseudo-monas putida G1 and in Figure 9 F the antibacterial activity on cells of Burkholderia pseudomallei '. “Δ” provides the difference in activity between the respective OBPgpLYS and PKOBPgpLYS samples. Error bars produce standard deviations from the mean.
[018] Figures 10 A and B show in a graphical representation the activities of reduction of biofilm of PoliKZ144 (Art-014) on a clinical isolate of mucoid growth of Pseudomonas aeruginosa 2573 (Source Uniklinikum Regens-burg, nicht no definiert). Pseudomonas aeruginosa 2573 was grown at least 24 hours at 37 ° C on a polystyrene microtiter plate to allow biofilm formation. In order to visualize the biofilm content, a coloration with violet crystal was performed. In Figure 10 A, the biofilm was then incubated with Alginate lyase (10u / mL) or PoliKZ144 (50μg / mL). The effect of both enzymes was compared with the untreated biofilm or the washed and reincubated biofilm in LB medium as controls. In Figure 10 B, the effect of PoliKZ144 was compared with the untreated biofilm or the biofilm washed and reincubated in LB medium as controls and strains of E. coli lab of mucoid growth to indicate nonspecific background staining.
[019] Figures 11 A to G show in graphical representation the biofilm reduction activities of various fusion proteins on different Gram-positive and Gram-negative strains. Staphylococcus aureus KS13 (A and B), Listeria monocytogenes Scott A (C), Acinetobacter baumannii DSMZ30007 (D), Pseudomonas aeruginosa 2572 (E, F) and Pseudomonas aeruginosa 2573 (G) were grown at least 24 hours at 37 ° C in a polystyrene microtiter plate to allow biofilm formation. To view the biofilm content, a violet crystal stain was performed. In Figure 11 A, the biofilm was then incubated with PK peptide (1.25 μg / well) or Ply2638 endolysin (25 μg / well) or the Ply2638-PK fusion protein (25 μg / well). The effect of the peptide, endolysin and fusion protein was compared with the untreated biofilm (one part of protein buffer to one part of 2x LB without NaCl) indicated by LB. In Figure 11 B, the biofilm was then incubated with the bacteriocin Lisostafina (18 μg / well) or the bacteriocin variant PK-Lisostafina (18 μg / well). The effect of bacteriocin and the bacteriocin variant was compared with the untreated biofilm (a part of protein buffer for a part of 2x LB without NaCl) indicated by LB. In Figure 11 C, the bio-film was then incubated with the modified Pentapeptide-Ply511 endolysin variant (25 μg / well). The effect of the modified endolysin variant was compared with the untreated biofilm (one part of protein buffer to one part of 2x LB without NaCl) indicated by LB. In Figures 11 D and E, the biofilm was then incubated with PK peptide (1.25 μg / well) or the OBP endolysin (25 μg / well) or the modified endolysin variant PK-OBP (25 μg / well). The effect of the peptide, endolysin and modified endolysin variant was compared with the untreated biofilm (one part of protein buffer to one part of 2x LB without NaCl) indicated by LB. In Figures 11 F and G, the biofilm was then incubated with endolysin KZ144 (50 μg / well) or the modified endolysin variant SMAP29-KZ144 (50 μg / well). The effect of the peptide, endolysin and modified endolysin variant was compared with the untreated biofilm (one part of protein buffer to one part of 2x LB without NaCl) indicated by LB.
[020] The term "protein" as used here refers synonymously to the term "polypeptide". The term "protein" as used here refers to a linear polymer of amino acid residues linked by peptide bonds in a specific sequence. The amino acid residues of a protein can be modified, for example, by covalent bonds of various groups such as carbohydrates and phosphate. Other substances may be more loosely associated with the polypeptide chains, such as heme or lipid, giving rise to conjugated proteins which are also understood by the term "protein" as used here. There are several ways in which folded polypeptide chains have been elucidated, in particular in relation to the presence of alpha helices and beta-pleated sheets. The term "protein" as used here refers to all four classes of proteins which are all alpha, all beta, alpha / beta and alpha plus beta. In addition, the term "protein" refers to a complex, where the complex refers to a homomer.
[021] The term "fusion protein" as used here refers to an expression product that results from the fusion of two nucleic acid sequences. Such a protein can be produced, for example, in recombinant DNA expression systems or through chemical crosslinking. In addition, the term "fusion protein" as used herein refers to a fusion of a first amino acid sequence, in particular an endolysin, an autolysin or a bacteriocin and / or another peptideoglycan hydrolase, with a second or a sequence additional amino acid. The second or an additional amino acid sequence is preferably a peptide, in particular a cationic, apolicatonic, hydrophobic, amphipathic and / or antimicrobial peptide. Preferably, said second and / or an additional amino acid sequence is foreign and is not substantially homologous to any domain of the first amino acid sequence.
[022] The term “modified endolysin variant” is used here synonymously with the term “endolysin variant”. Both terms refer to a fusion protein comprising an endolysin and a peptide, in particular a cationic, polycationic, hydrophobic, amphipathic and / or antimicrobial peptide.
[023] The term “modified bacteriocin variant” is used here synonymously with the term “bacteriocin variant”. Both terms refer to a fusion protein comprising a bacteriocin and a peptide, in particular a cationic, polycationic, hydrophobic, amphipathic and / or antimicrobial peptide.
[024] The term “modified autolysin variant” is used here synonymously with the term “autolysin variant”. Both terms refer to a fusion protein comprising an autolysin and a peptide, in particular a cationic, polycationic, hydrophobic, amphipathic and / or antimicrobial peptide.
[025] The term "peptide filament" as used here refers to any type of peptide attached to a protein such as an endolysin, a bacteriocin or an autolysin. In particular, the term "peptide filament" as used herein refers to a cationic peptide, a polycationic peptide, an amphipathic peptide, a hydrophobic peptide and / or an antimicrobial peptide. However, a peptide filament in the meaning of the present invention does not refer to His-tags, preferably His5-tags, His6-tags, His7-tags, His8-tags, His9-tags, His10-tags, His11-tags, His12-tags, His16-tags and His20-tags, Strep-tags, Avi-tags, Myc-tags, Gst-tags, JS-tags, cysteine-tags, FLAG-tags or other tags known in the art, thioredoxin or proteins that bind to maltose (MBP). The term “tag” in contrast to the term “peptide filament” as used here refers to a peptide that can be useful to facilitate expression and / or affinity purification of a polypeptide, to immobilize a polypeptide to a surface or to serve as a a label or a labeling group for the detection of a polypeptide, for example, by binding with antibodies in different ELISA assay formats as long as the function that makes the tag useful for one of the facilitations listed above is not caused by the post load of said peptide. However, the His6-tag can, depending on the respective pH, also be positively charged, but it is used as an affinity purification tool since it binds to immobilized divalent cations and is not used as a peptide filament according to the present invention. .
[026] The term "peptide" as used herein refers to short peptides consisting of from approximately 2 to approximately 100 amino acid residues, more preferably from approximately 4 to approximately 50 amino acid residues, more preferably up to approximately 5 to 30 amino acid residues, where the amino group of an amino acid residue is linked to the carboxyl group of another amino acid residue by a peptide bond. A peptide can have a specific function. A peptide can be a naturally occurring peptide or a peptide designed and synthesized in a synthetic way. The peptide can, for example, be derived from or removed from a native protein through enzymatic or chemical cleavage, or it can be prepared using conventional peptide synthesis techniques (for example, solid phase synthesis) or molecular biology techniques (see Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989)). Preferably synthetically produced peptides are, for example, cationic, polycationic, amphipathic or hydrophobic peptides. Naturally occurring peptides are, for example, antimicrobial peptides.
[027] As used here, the term “cationic peptide” refers to a peptide that has positively charged amino acid residues. Preferably a cationic peptide has a pKa value of 9.0 or greater. Typically, at least four of the amino acid residues of the cationic peptide can be positively charged, for example, lysine or arginine. “Positively charged” refers to the side chains of amino acid residues that have a net positive charge under approximately biological conditions. The term "cationic peptide" as used here also refers to polycationic peptides.
[028] The term "polycationic peptide" as used here refers to a planned and synthetically produced peptide composed mainly of post-loaded amino acid residues, in particular lysine, arginine and / or histidine residues, more preferably lysine and / or residues arginine. A peptide is composed primarily of post-charged amino acid residues if at least approximately 20, 30, 40, 50, 60, 70, 75, 80, 85, 90, 95 or approximately 100% of the amino acid residues are amino acid residues positively charged, in particular lysine and / or arginine residues. Amino acid residues that are not positively charged amino acid residues can be neutrally charged amino acid residues and / or negatively charged amino acid residues and / or hydrophobic amino acid residues. Preferably, amino acid residues that are not positively charged amino acid residues are neutrally charged amino acid residues, in particular serine and / or glycine.
[029] The term, "antimicrobial peptide" (AMP) as used here refers to any naturally occurring peptide that has microbicidal and / or microbistatic activity, for example, on bacteria, viruses, fungi, yeasts, mycoplasma and protozoa. Thus, the term "antimicrobial peptide" as used here refers in particular to any peptide that has antibacterial, antifungal, antimycotic, antiparasitic, antiprotozoal, antiviral, anti-infectious, anti-infectious and / or germicidal, algicidal, amoebicidal, microbicidal properties. , bactericides, fungi-cides, parasicides, protozoacids, protozoicides, in particular sushi and defensin peptides. The antimicrobial peptide may be a member of the RNAse A superfamily, a defensin, a cathelicidin, granulisine, histatin, psoriasin, dermicidin or hepcidin. The antimicrobial peptide can be naturally occurring in insects, fish, plants, arachnids, vertebrates or mammals.
[030] Preferably the antimicrobial peptide can be naturally occurring in insects, fish, plants, arachnids, vertebrates or mammals. Preferably, the antimicrobial peptide may be naturally occurring in rabana-te, silkworm, lychee, frog, preferably in Xenopus laevis, Rana toads, more preferably in Rana catesbeiana, toad, preferably the Asian toad Bufo gargarizans , fly, preferably in Drosophila, more preferably in Drosophila melanogaster, in Aedes aegypti, in bee, bumblebee, preferably in Bombus pascuorum, blowfly, preferably in Sar cophaga peregrine, scorpion, louse, catfish, preferably in Parasilurus asotus, cow, pig, sheep, swine, bovine, monkey and human being.
[031] The term “sushi peptide” as used here refers to complement control proteins (CCP) that have short consensus repetitions. The sushi module of sushi peptides functions as a protein-protein interaction domain in many different proteins. It has been shown that peptides that contain a Sushi domain have antimicrobial activities. Preferably, sushi peptides are naturally occurring antimicrobial peptides.
[032] The term "amphipathic peptide" as used here refers to synthetic peptides that have both hydrophilic and hydrophobic functional groups. Preferably, the term "amphipathic peptide" as used here refers to a peptide that has a defined array of hydrophilic and hydrophobic groups, for example, amphipathic peptides can be, for example, alpha helix, which have predominantly chains nonpolar sides along one side of the helix and polar residues along the rest of its surface.
[033] The term “hydrophobic group” as used here refers to chemical groups such as amino acid side chains that are substantially insoluble in water, but soluble in an oil phase, with the solubility in the oil phase being greater than that in water or in an aqueous phase. In water, amino acid residues that have a hydrophobic side chain interact with each other to generate a non-aqueous environment. Examples of amino acid residues with hydrophobic side chains are residues of valine, isoleucine, leucine, methenine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine.
[034] The term "endolysin" as used here refers to an enzyme that is suitable for hydrolyzing bacterial cell walls. “Endolysins” comprise at least one “enzymatically active domain” (EAD) that has at least one of the following activities: endopeptidase, N-acetyl-muramoyl-L-alanine-amidase (ami-dase), N-acetyl-muramidase, N-acetyl-glucosaminidase (lysozyme) or transglycosylses. In addition, endolysins may also contain regions that are enzymatically inactive and bind to the cell wall of host bacteria, the so-called CBDs (cell wall binding domains). Endolysin can contain one, two or more CBDs. However, the term "endolysin" as used here still refers to enzymes that have at least one EAD, but without CBDs. Generally, the domain that binds to the cell wall is able to bind to different components on the surface of bacteria. Preferably, the domain that binds to the cell wall is a peptideoglycan binding domain and binds to a bacterial peptideoglycan.
[035] The term “cell wall” as used here refers to all the components that form the cell wall lining of Gram-positive and Gram-negative bacteria and thus guarantee their integrity. In particular, the term “cell wall” as used here refers to peptideoglycan, the outer membrane of Gram-negative bacteria with the lipopolysaccharide, to the bacterial cell membrane, but also to the additional layers deposited on the peptideoglycan, for example, capsules, outer protein layers or viscous substances.
[036] The term “autolysins” as used here refers to enzymes related to endolysins, but encoded by bacteria and involved, for example, in cell division and cell wall metabolism. An overview of autolysins can be found in “Bacterial peptidoglycan (murein) hydrolases. Vollmer W, Joris B, Charlier P, Foster S. FEMS Microbiol Rev. 2008 Mar; 32 (2): 259-86 ”.
[037] The term “bacteriocin” as used here refers to substances similar to proteins, similar to polypeptides or similar to peptides that are capable of inhibiting the growth of other bacteria. Some bacteriocins are able to degrade bacterial cell walls like Lysostafine (which degrades Staphylococcus cell walls), Mutanolysin (which degrades Streptococcus cell walls) and Enterolysin (which degrades Enterococcus cell walls). Preferably said inhibition occurs specifically by absorbing said other bacteria to specific receptors for bacteriocin. In general, bacteriocins are produced by microorganisms. However, the term “bacteriocin” as used here refers to an isolated form produced by a microorganism or to a synthetically produced form and also refers to variants that substantially maintain the activities of their original bacteriocins, but whose sequences have been altered through insertion or deletion of one or more amino acid residues.
[038] The term “EAD” as used here refers to the enzymatically active domain of an endolysin. EAD is responsible for the hydrolysis of bacterial peptideoglycans. It exhibits at least one enzyme activity of an endolysin. EAD can also be composed of more than one enzymatically active module. The term "EAD" is used here synonymously with the term "catalytic domain".
[039] The term “deletion” as used here refers to the removal of 1, 2, 3, 4, 5 or more amino acid residues from the respective starting sequence.
[040] The term "insertion" or "addition" as used here refers to the insertion or addition of 1, 2, 3, 4, 5 or more amino acid residues to the respective starting sequence.
[041] The term "substitution" as used here refers to the exchange of an amino acid residue located in a certain position for a different one.
[042] The term “biofilm” as used here refers to an aggregate of bacterial microorganisms in which the bacterial cells adhere to each other and / or to a surface. These adherent cells are often covered with an extracellular polymeric substance (EPS) matrix, which is produced by the cells. The EPS biofilm is composed of DNA, proteins and extracellular polysaccharides. These biofilms can form on any living or non-living surfaces, in particular both on solid surfaces in the form of colonies and on liquid surfaces in the form of films. Microbial cells that grow in a bio-film are physiologically distinct from planktonic cells in the same organism.
[043] The present invention relates to methods of eliminating, reducing or preventing a bacterial biofilm which comprise the steps of: a) providing a fusion protein comprising an enzyme that has the activity of degrading the bacterial cell wall Gram-negative and / or Gram-positive to which a peptide with membrane-disrupting or LPS activity is fused; and b) contacting a material, liquid, surface or biological material with said fusion protein. Preferably, the present invention relates to methods of eliminating, reducing or preventing a bacterial biofilm comprising the steps of: c) providing a fusion protein comprising an endolysin, an autolysin or a bacteriocin to which a peptide with activity rupture of membrane or LPS is fused; and d) contacting a material, liquid, surface or biological material with said fusion protein.
[044] The term "supply" of a fusion protein according to the present invention refers to simply taking and using the fusion protein according to the present invention or to generating and purifying such fusion protein before use in accordance with the present invention.
[045] Preferably, the material is a stone, rock, soil, sediment, food, feed or cosmetics. Preferably, the liquid is water, such as drinking water, groundwater or sewage, thermal waters, seas, lakes, rivers, any type of aqueous system, cleaning solutions and storage for contact lenses, dentures, implants, prostheses or dental appliances.
[046] Preferably, biological material is any substance derived or obtained from a living organism, in particular plants and mammals, preferably humans, for example, cells, tissues, organs, blood, blood components and body fluids. Preferably, the cells are, for example, nucleated cells or anucleated cells. The cells can be derived from any organ, in particular, hepatocytes, smooth mucular cells, endothelial cells, keratinocytes, islet cells, stem cells (from adults and neonates, various tissues or species origin), progenitor cells from stem cells, umbilical cord blood cells, gametes (male and female), gamete progenitor cells, erythroblasts, leukoblasts and chondroblasts. Tissues are, for example, mucous membranes, nerves, muscles, epithelia, connective and supporting tissues, oral soft tissues and teeth. The organs are, for example, heart, heart valves, eye, ear, urinary tract, lungs, liver, kidney, biliary tract, prostate, nose, digestive tract, respiratory tract, gastrointestinal tract, brain and bone marrow. Preferred body fluids are urine, cerebrospinal fluid and lymphatic fluids.
[047] Preferably, the surfaces are solid biological or non-biotic surfaces. The preferred examples of surfaces are the surfaces of medical devices, in particular implants, prostheses, catheters, such as dental implants, prostheses of the urinary tract, peritoneal membrane and peritoneal dialysis catheters, internal catheters for hemodialysis and for the chronic administration of chemotherapy agents. (Hickman catheters), cardiac implants such as pacemakers, prosthetic heart valves, ventricular assist devices, synthetic vascular grafts and stents, internal fixation devices, percutaneous sutures and tracheal and ventilator tubing, as well as system tubing surfaces industrial or drinking water and natural aquatic systems.
[048] Biofilms are formed by bacterial microorganisms in which the bacterial cells adhere to each other and / or to a surface. Extracellular polymeric substances (EPS) excreted by bacterial microorganisms from a biofilm form hydrogels with water, so that a sludge-like matrix is formed. This matrix can also comprise gas bubbles and inorganic particles. The biofilm EPS is composed of extracellular DNA, proteins and polysaccharides. In addition to bacterial microorganisms, other single-celled organisms can be integrated into the biofilm. Biofilms can occur through the deposition of bacterial microorganisms at the interfaces. Mainly, the biofilm is formed on water surfaces or on an interface for a solid phase. These biofilms can form on any living or non-living surfaces. In general, all interfaces can be deposited by biofilms. Biofilms are present almost anywhere, in soil and sediments, in groundwater, on rock, in deserts, in thermal waters, on and within plants and animals, particularly on mucous membranes. In addition, biofilms can occur on medical devices, such as implants, catheters, endoscopes, prostheses, instruments and devices, but also in cosmetics, food and feed. Biofilms can also be associated with infections, because in most cases bacterial microorganisms form biofilms to be protected against the immune system. The formation of a biofilm guarantees the long-term survival of bacterial microorganisms. An example of an acute respiratory tract infection is legionnaire's disease which is caused by ingesting or inhaling clusters of legionella biofilms that come out of the air or water pipes of heating or cooling systems. Still many food bacteria, such as E. coli 0157: H7, Listeria monocytogenes, Yersinia enterocolitica, Salmonella spp. and Camphylobacter jejuni can form on food and biofilms from devices that are then highly resistant to biocides, drought, heat, antibiotics and cleaning reagents. The microorganisms responsible for infections of implants, catheters and other medical devices can be coagulase-negative staphylococci, Staphylococcus aureus, Enterococcus faecalis, Streptococcus spp., Escherichia coli, Klebsiella pneumoniae, Acinetobacter spp., Proteus mirabilis, Pseudomom and Candida spp. which are also associated with a broad spectrum of nosocomial infections. Typical bacterial infections associated with biofilms in humans are: wound infections, in particular wounds associated with diabetes mellitus, tonsillitis, osteomyelitis, bacterial endocarditis, sinusitis, corneal infections, urinary tract infection, biliary tract infection, kidney stones feces, urethritis, prostatitis, infections caused by catheters, infections of the middle ear, plaque formation, gingivitis, periodontitis, cystic fibrosis and infections caused by permanent internal devices such as joint prostheses and heart valves.
[049] The presence of biofilms can be determined through various tests, such as through the Tissue Culture Plate Method (TCP) described in Christensen et al., J Clin Microbiol 22: 996-1006 (1985) or through the Method in a tube (TM) as previously described by Christensen et al., Infect Immun 37: 318-26 (1982) or through the Congo Red Agar Method (CRA) described by Freeman et al., J Clin Pathol 42: 872-4 (1989). Biofilm can be quantified using the violet crystal assay (Peeters et al., J Microbiol Methods 72: 157-165 (2008)).
[050] The fusion protein according to the present invention can influence the interaction of the bacteria that form a biofilm so that the cells are transferred into isolated planktonic cells where they are then lysed by said fusion protein, consequently the biofilm is then partly or totally degraded. The influence of the fusion protein according to the present invention on bacteria can also directly lyse the associated bacteria in a biofilm and thus, the biofilm is degraded in part or totally. In addition, the fusion protein according to the present invention can prevent the formation of bacterial biofilms by lysing bacteria that are capable of forming a biofilm with other bacteria.
[051] The fusion proteins according to the present invention refer preferably to endolysin variants, bacteriocin variants and autolysin variants.
[052] Preferred fusion proteins according to the present invention comprise an endolysin, an autolysin or a bacteriocin fused to a peptide with lipopolysaccharide (LPS) disrupting activity or in general from mem-brane. LPS is a major component of the outer membrane of Gram-negative bacteria. This increases the negative charge of the cell membrane and protects the membrane from certain types of chemical attack. To some degree, said LPS protects the membrane from Gram-negative bacteria also from the endolysins added outside the bacteria. However, LPS can be disrupted by peptides that have LPS disrupting activity, for example, as positively charged peptides. In addition, said peptides may be involved in the transport mechanism of outer membrane protein, in the destabilization of structural proteins of the outer membrane and / or in the lipid-dependent destabilization. The inventors of the present invention have surprisingly discovered that a peptide that has LPS or generally membrane-disrupting activity promotes the passage of an endolysin, an autolysin or a bacteriocin fused to said peptide through the outer membrane of Gram- negative. After the promoted passage of endolysin, autolysin or bacteriocin through the outer bacterial membrane, the bacterium's cell wall can be more easily broken or disintegrated by endolysin due to the degradation of the peptide-glycolan layer followed by osmotic lysis when the cell pressure internal bacterium cannot be resisted any longer. Gram-positive bacteria have a thicker layer of peptideoglycan than Gram-negative bacteria. Here the membrane that interrupts the activity of the fusion protein supports the lysis of the bacteria, by acting on the cytoplasmic membrane.
[053] Thus, the present invention relates to methods of eliminating, reducing or preventing bacterial biofilms through fusion proteins composed of an enzyme, preferably an endolysin, an autolysin or a bacteriocin, which has the activity of degrading the cell wall of Gram-negative and / or Gram-positive bacteria and a peptide with membrane-disrupting activity, wherein said peptide is fused to the enzyme at the N and / or C-terminus. Said fusion proteins according to the present invention are also called modified endolysin variants or simply endolysin or modified endolysin variants, modified autolysin variants or au-tolysin variants, modified bacteriocins or bacteriocin variants.
[054] The endolysin portion of the fusion protein is preferably encoded by specific bacteriophages for Gram-negative bacteria such as groups of Gram-negative bacteria from groups, families, genera or bacterial species comprising strains pathogenic to humans or animals such as Enterobacteriaceae (Escherichia, especially E. coli, Salmonella, Shigella, Citrobacter, Edwardsiella, Enterobacter, Hafnia, Klebsiella, especially K. pneumoniae, Morganella, Proteus, Providencia, Serratia, Yersinia), Pseudomonadaceae (especially P. aeruginosa, Burkholderia, Stenotrophomonas, Shewanella, Sphingomonas, Comamonas), Neisseria, Moraxella, Vibrio, Aeromonas, Brucella, Francisella, Bordetella, Legionella, Bartonella, Coxiella, Haemophilus, Pasteurella, Mannheimia, Actinobacillus, Treaceae and Gardaceae ), Leptospiraceae, Campylobacter, Helicobacter, Spirillum, Streptobacillus, Bacteroidae (Bacteroides, Fusobacteria, Prevot ella, Porphyromonas), Acinetobacter, especially A. baumannii.
[055] In another preferred embodiment, the fusion protein endolysin is co-determined by specific bacteriophages by Gram-positive bacteria such as Gram-positive bacteria from groups, families, genera or bacterial species that comprise pathogenic strains for humans or animals, in particular of the phylum Acti-nobacteria, in particular of the class Actinobacteridae, in particular of the order Actinomycetales, in particular of the families Actinomycineae: Actinomycetaceae (Acti-nomyces, Mobiluncus), Corynebacterineae: Mycobacteriaceae (Mycobacteria), No- cardiaceae, Corynebacteriaceae, Frankineae: Frankiaceae, Micrococcineae: Brevi- bacteriaceae and Propionibacteriaceae (Propionibacterium) and of the order Bifidobacteria- les, in particular from the families Bifidobacteriaceae (Bifidobactere, Falcivibrio, Ac- ; and the phylum Firmicutes, in particular of the Bacilli class, in particular of the Bacillales order, in particular of the families: Bacillaceae (Bacillus), Listeriaceae (Listeria), Staphylococcaceae (Staphylococcus, Gemella, Jeotgalicoccus) and of the Lactobacillales order, in particular of the families: Enterococcaceae (Enterococcus), Lactobacillaceae (Lactobacillus, Pediococcus), Leuconostocaceae (Leuconostoc), Streptococcaceae (Lactococcus, Streptococcus) and of the class Clostridia, in particular of the order: Clostridiales (Clostridiales e, Clostridium, e Tenericutes / Mollicutes, in particular of the order: Mycoplasmatales (Mycoplasma, Ureaplasma), Entomoplasmatales (Spi-roplasma), Anaeroplasmatales (Erysipelothrix), Acholeplasmatales (Acholeplasma), Haloplasmatales (Haloplasma).
[056] In another preferred embodiment, the autolysin or bacteriocin of the fusion protein is encoded by Gram-negative or Gram-positive bacteria such as Gram-negative or Gram-positive bacteria from groups, families, genera or bacterial species that comprise strains pathogenic to humans or animals that are listed above.
[057] Preferably, the endolysin part is derived from a phage or a wild-type endolysin which is represented in Table 1 below:



[058] The part of endolysin which is derived from endolysins of the phages ΦKZ and EL of Pseudomonas aeruginosa, of the phage OBP of Pseudomonas putida, of the phage LUZ24 or of the T4 lysozyme, gp61 muramidase, PSP3 endolysin, of the Salmonella phage, is also preferred Acinetobacter baumannii phage, E. coli P2 Phage, E. coli N4 and K1F phage and Salmonella typhimurium phage.
[059] Additional preferred endolysins from the fusion protein are phage endolysins from Listeria PlyA118, PlyA500, PlyPSA, PlyA511, PlyP35, PlyP40, Staphylococcal phage Phi 11 endolysin, Phi MR11 endolysin, LysK, Ply 2638, Clostridium perfring , Clostridium difficile: CD27L endolysin, Streptococcus: B30 endolysin, phage Dp-1 Pal amidase, C1 endolysin, Cpl-1 endolysin, PlyGBS, Enterococccus: PlyV12, Bacillus anthracis: Endolysin phage PlyG, phage of Propionpacterium g20.
[060] The preferred autolysins of the fusion protein are described in: Bacterial peptideoglycan (murein) hydrolases. Vollmer W, Joris B, Charlier P, Foster S. FEMS Microbiol Rev. 2008 Mar; 32 (2): 259-86. Epub 2008 Feb 11. Review. An example of a preferred autolysin is AtlA Autolysin.
[061] The preferred bacteriocins are Lysostaphine (which degrades Staphylococcus cell walls), Mutanolysin (which degrades Streptococcus cell walls) and Enterolysin (which degrades Enterococcus cell walls). More preferably, the bacteriocin of the fusion protein according to the present invention comprises an amino acid sequence according to SEQ ID NO: 87.
[062] Additional examples for the endolysin part of the fusion protein are selected from the group consisting of Cpl-1 according to SEQ ID NO: 84, Ply511 according to SEQ ID NO: 85, LysK according to to SEQ ID NO: 86, PA6-gp20 according to SEQ ID NO: 88, phiKZgp144 according to SEQ ID NO: 1, ELgp188 according to SEQ ID NO: 2, Salmonella endolysin according to SEQ ID NO: 3, Enterobacteria T4 phage endolysin according to SEQ ID NO: 4, Acinetobacter baumannii endolysin according to SEQ ID NO: 5, E.coli Phage K1F endolysin according to SEQ ID NO : 6, OBPgpLYS according to SEQ ID NO: 7, PSP3 Salmonella endolysin (PSP3gp10) according to SEQ ID NO: 8, E. coli Phage P2 endolysin (P2gPO9) according to SEQ ID NO: 9 , Salmonella typhimurium muramidase phage STM0016 according to SEQ ID NO: 89, E. coli muramidase phage N4 N4-gp61 according to SEQ ID NO: 90, N4-gp61 trunc. according to SEQ ID NO: 91 and Ply 2638 according to SEQ ID NO: 92.
[063] In another preferred embodiment of the present invention the methods of eliminating, reducing or preventing bacterial biofilms through the fusion protein according to the present invention comprise modifications and / or alterations of the amino acid sequences. Such alterations and / or modifications may comprise mutations such as deletions, insertions and additions, substitutions or combinations thereof and / or chemical alterations of the amino acid residues, for example, biotinylation, acetylation, PEGylation, chemical alterations of the amino groups, SH- or carboxyl. Said modified and / or altered endolysins exhibit the lytic activity of the respective wild type endolysin. However, said activity can be greater or less than the activity of the respective wild-type endolysin. Said activity can be approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or approximately 200% of the activity of respective wild-type or even greater endolysin. Activity can be measured by tests well known in the art by one skilled in the art, for example, such as the plate lysis test or the liquid lysis test which are, for example, described in Briers et al., J. Biochem. Biophys Methods 70: 531-533, (2007).
[064] The peptide of the fusion protein according to the present invention can be linked to the enzyme, preferably to endolysin, autolysin or bacteriocin through additional amino acid residues, for example, through cloning means. Preferably, said additional amino acid residues may not be recognized and / or cleaved by proteases. Preferably said peptide can be linked to the enzyme through at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional amino acid residues. Preferably, the peptide fused at the N-terminus of the enzyme, preferably to endolysin, autolysin or bacteriocin, of the fusion protein according to the invention further comprises additional amino acids at its N-terminus. Preferably the peptide comprises the amino acid methionine (Met) or methionine, glycine and serine (Met-Gly-Ser) or alanine, methionine and glycine (Ala-Met-Gly). In another preferred embodiment, the peptide is attached to the N-terminal of the enzyme, preferably to endolysin, autolysin or bacteriocin, through additional amino acid residues, in particular glycine and serine (Gly-Ser). In another preferred embodiment the peptide is attached to the C-terminus of the enzyme via additional amino acid residues, in particular glycine and serine (Gly-Ser).
[065] In one aspect of the present invention the peptide with membrane-disrupting and / or LPS activity comprises the positively charged peptide, which comprises one or more of the positively charged amino acids which are lysine, arginine and / or histidine. Preferably, more than 80%, preferably more than 90%, preferably 100% of the amino acids in said peptide are positively charged amino acids. Advantageously, the cationic peptide is positioned at the N-terminal and / or C-terminal end of the fusion protein, thus increasing the cationicity of the latter proteins. In another embodiment of the invention, the cationic peptide fused to the enzyme, preferably endolysin, autolysin or bacteriocin, is at least 5, more preferably at least 9 amino acids in length.
[066] In a preferred embodiment said peptide comprises approximately 3 to approximately 50, more preferably approximately 5 to approximately 20, for example, approximately 5 to approximately 15 amino acid residues and at least 20, 30, 40, 50, 60 or 70%, more preferably at least 80%, for example, at least 90% of said amino acid residues are arginine or lysine residues. In another preferred embodiment said peptide comprises approximately 3 to approximately 50, more preferably approximately 5 to approximately 20, for example, approximately 5 to approximately 15 amino acid residues and said amino acid residues are arginine or lysine residues.
[067] Preferably, the fusion protein peptide is fused to the N-terminal and / or the C-terminal of the enzyme, preferably endolysin, autolysin or bacteriocin. In a particularly preferred embodiment, said peptide is fused only to the N-terminus of the enzyme, preferably endolysin, autolysin or bacteriocin. However, fusion proteins that have a peptide at both the N-terminus and the C-terminus are still preferred. Said N-terminal and C-terminal peptides can be the same or different peptides.
[068] The fusion protein peptide is preferably covalently linked to the enzyme. Preferably, said peptide consists of at least 5, more preferably at least 6, 7.8, 9, 10, 11, 12, 13, 14,15,16, 17,18,19,20, 21, 22,23, 24,25,26,27,28, 29, 30,31,32,33, 34,35,36,37,38, 39,40,41,42, 43, 44,45, 46,47,48, 49.50, 51, 52.53.54.55, 56.57.58.59.60, 61.62.63.64, 65, 66.67, 68.69.70.71.72, 73, 74,75,76,77, 78,79,80,81,82, 83,84,85,86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or at least 100 amino acid residues. Especially preferred is a peptide comprising approximately 5 to approximately 100 amino acid residues, approximately 5 to approximately 50 or approximately 5 to approximately 30 amino acid residues. Most preferred is a peptide comprising approximately 6 to approximately 42 amino acid residues, approximately 6 to approximately 39 amino acid residues, approximately 6 to approximately 38 amino acid residues, approximately 6 to approximately 31 amino acid residues, approximately 6 to approximately 25 amino acid residues, approximately 6 to approximately 24 amino acid residues, approximately 6 to approximately 22 amino acid residues, approximately 6 to approximately 21 amino acid residues, approximately 6 to approximately 20 amino acid residues, approximately 6 to approximately 19 amino acid residues, approximately 6 to approximately 16 amino acid residues, approximately 6 to approximately 14 amino acid residues, approximately 6 to approximately 12 amino acid residues, approximately 6 to approximately 10 amino acid residues or approximately 6 to approximately 9 amino acid residues.
[069] In one aspect of the present invention the peptide is selected from the group of cationic peptides, polycationic peptides, hydrophobic peptides, antimicrobial peptides and amphipathic peptides.
[070] In one aspect of the present invention the peptide is a cationic and / or polycationic peptide, which comprises one or more of the amino acid residues positively charged with lysine, arginine and / or histidine, in particular lysine and / or arginine . Preferably, more than approximately 20, 30, 40, 50, 60, 70, 75, 80, 85, 90, 95 or 99% of the amino acid residues in said peptide are positively charged amino acid residues, in particular lysine and / or arginine. Especially preferred are peptides consisting of approximately 100% post-loaded amino acid residues, in particular arginine and / or lysine residues, wherein preferably approximately 60% to approximately 70% of said post-loaded amino acid residues are residues of lysine and approximately 30% to approximately 40% of said post-loaded amino acid residues are residues of argin. Most preferred is a peptide consisting of approximately 100% post-loaded amino acid residues, in particular arginine and / or lysine residues, wherein preferably approximately 64% to approximately 68% of said post-loaded amino acid residues are lysine and approximately 32 % to approximately 36% of said positively charged amino acid residues are arginine. Peptides consisting of only argin or only lysine are also preferred.
[071] Cationic and / or polycationic peptides of the fusion protein that comprise at least one motif according to SEQ ID NO: 10 (KRKKRK) are especially preferred. In particular cationic peptides comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 motifs according to SEQ ID NO: 10 ( KRKKRK) are preferred. More preferred are cationic peptides that comprise at least one KRK motif (lys-arg-lys), preferably at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 KRK motifs.
[072] In another preferred embodiment of the present invention the peptide is a cationic peptide which comprises, in addition to the post-loaded amino acid residues, in particular lysine and / or arginine residues, neutrally charged amino acid residues, in particular residues of glycine and / or serine. Cationic peptides consisting of approximately 70% to approximately 100% or approximately 80% to approximately 95% or approximately 85% to approximately 90% of post-loaded amino acid residues, in particular lysine, arginine and / or histidine residues, are preferred. more preferably lysine and / or arginine residues and from approximately 0% to approximately 30% or approximately 5% to approximately 20% or approximately 10% to approximately 20% neutrally charged amino acid residues, in particular glycine residues and / or serine. Preferred are peptides consisting of approximately 4% to approximately 8% of serine residues, approximately 33% to approximately 36% of ariginine residues and approximately 56% to approximately 63% of lysine residues. Especially preferred are peptides that comprise at least one motif according to SEQ ID NO: 32 (KRXKR), where X is any other amino acid other than lysine, arginine and histidine. Especially preferred are peptides that comprise at least one motif according to SEQ ID NO: 33 (KRSKR). More preferred are cationic peptides comprising at least approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or approximately 20 motifs according to SEQ ID NO: 32 (KRXKR) or SEQ ID NO: 33 (KRSKR).
[073] Fusion protein peptides consisting of approximately 9 to approximately 16% glycine residues, from approximately 4 to approximately 11% serine residues, from approximately 26 to approximately 32% residues are preferred. ariginine and from approximately 47 to approximately 55% of lysine residues. Especially preferred are peptides that comprise at least one motif according to SEQ ID NO: 34 (KRGSG). More preferred are cationic peptides comprising at least approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or approximately 20 motifs according to SEQ ID NO: 34 (KRGSG).
[074] In another preferred embodiment of the present invention, the cationic peptide comprises, in addition to the positively charged amino acid residues, in particular lysine and / or arginine residues, hydrophobic amino acid residues, in particular valine, isoleucine, leucine, methionine residues , phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine, more preferably alanine, valine, leucine, isoleucine, phenylalanine and / or tryptophan residues. Cationic peptides of the fusion protein are preferred which consist of approximately 70% to approximately 100% or approximately 80% to approximately 95% or approximately 85% to approximately 90% of positively charged amino acid residues, in particular lysine residues and / or arginine and from approximately 0% to approximately 30% or approximately 5% to approximately 20% or approximately 10% to approximately 20% hydrophobic amino acid residues, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine residues , tyrosine, histidine, threonine, serine, proline and glycine, more preferably alanine, valine, leucine, isoleucine, phenylalanine and / or tryptophan residues.
[075] Especially preferred are the peptides of the fusion protein selected from the group consisting of the sequences shown below in Table 2.Table 2:


[076] Preferably, the fusion protein peptide is not a tag such as a His-tag, Strep-tag, Avi-tag, Myc-tag, Gst-tag, JS-tag, cysteine-tag, FLAGtag or other tags known in the art and is not thioredoxin or proteins that bind to maltose (MBP). However, the fusion protein according to the present invention may further comprise such a tag or tags.
[077] Preferably, the fusion protein peptide has the function of carrying the fusion protein according to the present invention through the outer membrane of bacteria, but does not have or has only low activity when administered without being fused to endolysin, to autolysin or bacteriocin. The function of driving the fusion protein through the outer membrane of Gram-negative and / or Gram-positive bacteria is caused by the potential of the outer membrane or the interruption or permeabilization or destabilization of LPS of said peptide. Such an outer membrane or LPS interrupting or permeabilizing or destabilizing activity of the peptide can be determined in a method as follows: The bacterial cells to be treated are cultured in a liquid medium or on agar plates. Then the concentration of bacterial cells in the liquid medium is determined photometrically at DO600nm or the colonies on the agar plates are counted, respectively. Now, bacterial cells in liquid medium or on plates are treated with a fusion protein according to the invention. After incubation, the concentration of bacterial cells in the liquid medium is determined photometrically at DO600nm or the colonies on the agar plates are counted again. If the fusion protein exhibits such an outer membrane or LPS interrupting or permeabilizing or destabilizing activity, the bacterial cells are lysed due to treatment with the fusion protein and thus the concentration of bacterial cells in the liquid medium or the number of colonies of bacteria on the agar plate is reduced. Thus, the reduction in the concentration of bacterial cells or in the number of bacterial colonies after treatment with the fusion protein is indicative of an outer membrane or interruption or permeabilization or destabilization of LPS from the fusion protein.
[078] In a further embodiment of the present invention the peptide is an antimicrobial peptide that comprises a positive net charge and approximately 50% hydrophobic amino acids. Antimicrobial peptides are amphipathic, with a length of approximately 12 to approximately 50 amino acid residues. Antimicrobial peptides are naturally occurring in insects, fish, plants, arachnids, vertebrates or mammals. Preferably, the antimicrobial peptide can be naturally occurring in radish, silkworm, lychee, frog, preferably in Xenopus laevis, Rana frogs, more preferably in Rana catesbeiana, frog, preferably Asian frog Bufo bufo gargarizans, fly, preferably in Drosophila, more preferably in Drosophila melanogaster, in Aedes aegypti, in bee, bumblebee, preferably in Bombus pascuorum, blowfly, preferably in Sarcophaga peregrine, scorpion, lump, catfish, preferably in Parasilurus asotus, cow, pig, sheep, swine , bovine, monkey and human being.
[079] In another preferred embodiment the antimicrobial peptide of the fusion protein consists of approximately 0% to approximately 5% or approximately 0% to approximately 35% or approximately 10% to approximately 35% or approximately 15% to approximately 45% or approximately 20 % to approximately 45% of post-loaded amino acid residues, in particular lysine and / or arginine residues and from approximately 50% to approximately 80% or approximately 60% to approximately 80% or approximately 55% to approximately 75% or approximately 70% up to approximately 90% hydrophobic amino acid residues, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine residues, more preferably alanine, valine, leucine residues , isoleucine, phenylalanine and / or tryptophan.
[080] In another preferred embodiment of the present invention the antimicrobial peptide of the fusion protein consists of approximately 4% to approximately 58% of post-loaded amino acid residues, in particular lysine and / or arginine residues and approximately 33% to approximately 89% hydrophobic amino acid residues, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine residues, more preferably alanine, valine, leucine, iso- residues leucine, phenylalanine and / or tryptophan.
[081] Examples of antimicrobial peptides from the fusion protein according to the present invention are listed in the following table. Table 3:


[082] In a further embodiment of the present invention the peptide is a sushi peptide which is described by Ding JL, Li P, Ho B Cell Mol Life Sci. 2008 Abr; 65 (7-8): 1202-19. Sushi peptides: structural characterization and mode of action against Gram-negative bacteria. Sushi 1 peptide according to SEQ ID NO: 133 is especially preferred.
[083] The preferred sushi peptides of the fusion protein are sushi peptides S1 and S3 and multiples thereof; FASEB J. 2000 Set; 14 (12): 1801-13.
[084] In a further embodiment of the present invention the peptide is a hydrophobic peptide, comprising at least 90% of the hydrophobic amino acid residues of valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine , threonine, serine, proline and / or glycine. In another preferred embodiment the hydrophobic peptide of the fusion protein consists of approximately 90% to approximately 95% or from approximately 90 to approximately 100% or from approximately 95% to approximately 100% of the hydrophobic amino acid residues of valine, isoleucine, leucine , methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and / or glycine.
[085] The preferred hydrophobic peptides of the fusion protein are Wal-magh1 which has the amino acid sequence according to SEQ ID NO: 134 and the hydrophobic peptide of the fusion protein which has the amino acid sequence Phe-Phe-Val- Ala-Pro (SEQ ID NO: 135).
[086] In a further embodiment of the present invention the peptide is an amphipathic peptide, comprising one or more of the amino acid residues post-loaded with lysine, arginine and / or histidine, combined with one or more of the hydrophobic amino acid residues of valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and / or glycine. The side chains of the amino acid residues are oriented so that the cationic and hydrophobic surfaces are agglomerated on the opposite sides of the peptide. Preferably, more than approximately 30, 40, 50, 60 or 70% of the amino acids in said peptide are positively charged amino acids. Preferably, more than approximately 30, 40, 50, 60 or 70%, of the amino acid residues in said peptide are hydrophobic amino acid residues. Advantageously, the amphipathic peptide is fused at the N-terminal and / or C-terminal end of the enzyme with cell wall degradation activity, thus increasing the amphipacity of the latter proteins.
[087] In another embodiment of the present invention the peptide is an amphipathic peptide consisting of at least 5, more preferably at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42 , 43, 44, 45, 46, 47, 48, 49 or 50 amino acid residues. In a preferred embodiment at least approximately 30, 40, 50, 60 or 70% of said amphipathic peptide amino acid residues are arginine or lysine residues and / or at least approximately 30, 40, 50, 60 or 70% of said residues Amphipathic peptide amino acids are the hydrophobic amino acids valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and / or glycine.
[088] In another preferred embodiment of the present invention the peptide is an amphipathic peptide which comprises, in addition to the post-loaded amino acid residues, in particular lysine and / or arginine residues, hydrophobic amino acid residues, in particular valine, isoleucine residues , leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine, more preferably alanine, valine, leucine, isoleucine, phenylalanine and / or tryptophan residues. Amphipathic peptides are preferred which consist of approximately 10% to approximately 50% or approximately 20% to approximately 50% or approximately 30% to approximately 45% or approximately 5% to approximately 30% of post-loaded amino acid residues, in particular lysine and / or arginine residues and from approximately 50% to approximately 85% or approximately 50% to approximately 90% or approximately 55% to approximately 90% or approximately 60% to approximately 90% or approximately 65% up to approximately 90% hydrophobic amino acid residues, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine residues, more preferably alanine residues , valine, leucine, isoleucine, phenylalanine and / or tryptophan. In another preferred embodiment, amphipathic peptides consisting of 12% to approximately 50% of post-loaded amino acid residues, in particular lysine and / or arginine residues and from approximately 50% to approximately 85% hydrophobic amino acid residues, valine residues, isoleucine , leucine, methionine, phenylanine, tryptophan, cysteine, alanine, tyrosine, histidine, threonine, serine, proline and glycine, more preferably alanine, valine, leucine, isoleucine, phenylalanine and / or tryptophan residues.
[089] The preferred amphipathic peptides of the fusion protein are α4-helix of T4 lysozyme according to SEQ ID NO: 136 and Variant WLBU2 which has the amino acid sequence according to SEQ ID NO: 137 and Walmagh 2 of according to SEQ ID NO: 138.
[090] In a preferred embodiment of the present invention the fusion protein consists of a peptide according to SEQ ID NOs: 10 to 30, 32 to 34 and 93 to 138 and an endolysin according to SEQ ID NOs: 1 to 9, 84 to 86 and 88 to 92 or a bacteriocin according to SEQ ID NO: 87. In a preferred embodiment the fusion protein comprises a peptide selected from the group of peptides according to SEQ ID NOs: 10 to 30, 32 to 34 and 93 to 138 and an endolysin selected from the group of endolysins according to SEQ ID NOs: 1 to 9, 84 to 86 and 88 to 92 or a bacteriocin according to SEQ ID NO: 87.
[091] Fusion proteins selected from the group consisting of the following fusion proteins shown in Table 4 are especially preferred. Table 4:



[092] Fusion proteins according to the present invention and thus in particular especially preferred fusion proteins according to SEQ ID NOs: 35 to 49, 53, 57, 61 to 64, 66 to 78 and 139 to 142 they may additionally comprise a methionine on the N-terminus.
[093] Fusion proteins according to the present invention and thus in particular especially preferred fusion proteins according to SEQ ID NOs: 35 to 49, 53, 57, 61 to 64, 66 to 78 and 139 to 142 they may additionally comprise a tag, for example, for purification. A His6-tag, preferably at the C-terminus of the fusion protein, is preferred. Said tag can be linked to the fusion protein through additional amino acid residues, for example, via cloning means. Preferably said tag can be linked to the fusion protein via at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 additional amino acid residues. In a preferred embodiment the fusion protein comprises a His6-tag its C-terminal linked to the fusion protein via the additional amino acid residues lysine and glycine (Lys-Gly) or leucine and glutamic acid (Leu-Glu). Preferably, said additional amino acid residues may not be recognized or cleaved by proteases. In another preferred embodiment the fusion protein comprises a His6-tag at its N-terminus linked to the fusion protein via the additional amino acid residues lysine and glycine (Lys-Gly) or leucine and glutamic acid (Leu-Glu). In another preferred embodiment, the fusion protein comprises a His6-tag at its N-terminus and C bound to the enzyme, preferably to endolysin, autolysin or bacteriocin via the additional amino acid residues lysine and glycine (Lys-Gly) or leucine and glutamic acid (Leu-Glu).
[094] In particular, the fusion proteins that are used in the examples that are described below are preferred. The fusion proteins according to SEQ ID NOs: 35 to 42, 53, 57 and 61 which are used in the examples comprise a His6-tag at the C-terminus linked to the fusion protein via the additional amino acid residues lysine and glycine (Lys-Gly). The fusion protein according to SEQ ID NOs: 43 to 49, 75, 139, 141 and 142 which are used in the examples comprise a His6-tag at the C-terminus linked to the respective fusion protein via the additional amino acid residues leucine and glutamic acid (Leu-Glu).
[095] Fusion proteins are constructed by linking at least two nucleic acid sequences using standardized cloning techniques that are described, for example, by Sambrook et al. 2001, Molecular Cloning: A Laboratory Manual. Such a protein can be produced, for example, in recombinant DNA expression systems. Such fusion proteins according to the present invention can be obtained by fusing the nucleic acids to endolysin, autolysin or bacteriocin and the respective peptide.
[096] Since some fusion proteins can be toxic after expression in bacteria or not homogeneous to protein degradation, the strategy could be to express these fusion proteins fused or linked to other additional proteins. The example for these other additional proteins is Thioredoxin, which has been shown to mediate the expression of toxic antimicrobial peptides in E.coli (TrxA mediating the expression of CM4 antimicrobial peptide fusion starting from several genes linked in Escherichia coli. Zhou L, Zhao Z, Li B, Cai Y, Zhang S. Protein Expr Purif. 2009 Abr; 64 (2): 225-230).
[097] For the antimicrobial function of fusion proteins, it may be necessary to remove the additional fusion protein via proteolytic cleavage. Commercially available kits such as the pET32 expression system (Novagen), may need to modify, for example, the N-terminus of the fusion depending on the protease used, such as from MGS to AMGS (SEQ ID NO: 31), in which the residue of remaining alanine results from an introduced Enterokinase cleavage site.
[098] In another preferred embodiment of the present invention, the peptides of the fusion proteins according to the present invention comprise modifications and / or alterations of the amino acid sequences. Such alterations and / or modifications may comprise mutations such as deletions, insertions and additions, substitutions or combinations thereof and / or chemical alterations of the amino acid residues, for example, biotinylation, acetylation, PEGylation, chemical alterations of the amino groups, SH - or carboxyl.
[099] The present invention also relates to methods of eliminating, reducing or preventing bacterial biofilms through an isolated nucleic acid molecule encoding the fusion protein according to the present invention. The present invention also relates to a vector that comprises the nucleic acid molecule according to the present invention. Said vector can provide the constitutive or inducible expression of said fusion protein according to the present invention.
[0100] Fusion proteins can be obtained from a microorganism, such as a suitable genetically modified host cell that expresses said fusion proteins. Said host cell can be a microorganism such as bacteria or yeast or fungi or an animal cell, for example, as a mammalian cell, in particular, a human cell. In one embodiment of the present invention the yeast cell is a Pichia pastoris cell. The host can be selected using simple biotechnological means, for example, yield, solubility, costs, etc., but it can also be selected from a medical point of view, for example, non-pathological bacteria or yeasts, human cells .
[0101] In a further aspect the present invention relates to methods of eliminating, reducing or preventing bacterial biofilms through a composition, preferably a pharmaceutical composition, which comprises a fusion protein according to the present invention and / or a host transformed with a nucleic acid molecule or a vector comprising a nucleotide sequence encoding a fusion protein according to the present invention.
[0102] In a preferred embodiment of the present invention the methods of eliminating, reducing or preventing bacterial biofilms through the composition comprise additional permeabilizing agents of the outer membrane of Gram-negative bacteria such as metal chelators, for example, such as EDTA, TRIS, lactic acid, lactoferrin, polymyxin, citric acid and / or other substances that are described, for example, by Vaara (Agents that increase the permeability of the outer membrane. Vaara M. Microbiol Rev. 1992 Sep; 56 (3): 395 -441). Also preferred are compositions comprising combinations of the permeation agents mentioned above. Especially preferred is a composition comprising approximately 10 μM to approximately 100 mM EDTA, more preferably approximately 50 μM to approximately 10 mM EDTA, more preferably approximately 0.5 mM to approximately 10 mM EDTA, more preferably approximately 0.5 mM up to approximately 2 mM EDTA, more preferably approximately 0.5 mM to 1 mM EDTA. However, still compositions that comprise approximately 10 μM to approximately 0.5 mM EDTA are preferred. Also preferred is a composition comprising approximately 0.5 mM to approximately 2 mM EDTA, more preferably approximately 1 mM EDTA and additionally approximately 10 to approximately 100 mM TRIS.
[0103] The present invention also relates to methods of eliminating, reducing or preventing bacterial biofilms through a fusion protein according to the present invention and / or a host transformed with a nucleic acid that comprises a nucleotide sequence that encodes a fusion protein according to the present invention for use as a medicament.
[0104] In a further aspect the present invention relates to the use of a fusion protein according to the present invention and / or a host transformed with a vector that comprises a nucleic acid molecule that comprises a nucleotide sequence that encodes a fusion protein according to the present invention for the elimination, reduction and prevention of bacterial biofilms. It is preferred to use the bacteria that produce the biofilm to cause a disturbance, disease or health condition that is harmful to plants, animals and / or humans. The use in which the bacteria that produce the biofilm can be Gram-negative bacteria of groups, families, genera or bacterial species that comprise strains pathogenic to humans or animals such as Entero- bacteriaceae (Escherichia, especially E. coli, Salmonella, is preferred) , Shigella, Citrobacter, Edwardsiella, Enterobacter, Hafnia, Klebsiella, especially K. pneumoniae, Morganella, Proteus, Providencia, Serratia, Yersinia), Pseudomonadaceae (Pseudomonas, especially P. aeruginosa, Burkholderia, Stenotrophomonas, Shewanella, Cohen , Neisseria, Moraxella, Vibrio, Aeromonas, Brucella, Francisella, Bordetella, Legionella, Bartonella, Coxiella, Haemophilus, Pasteurella, Mannheimia, Actinobacillus, Gardnerella, Spirochaetaceae (Treponema and Borrelia), Leptospiraceae, Campylobacter, Helicobacter, Stracthacterium, Helicobacter, ceae (Bacteroides, Fusobacteria, Prevotella, Porphyromonas), Acinetobacter, especially A. baumannii. Preferably, said disorder, disease or health condition can be caused by Pseudomonas, in particular Pseudomonas aeruginosa and / or Pseudomonas putida, Burkholderia, in particular Burkholderia pseudomallei and / or Burkholderia solanacearum, Salmonella, in particular Salmonella typhimurium and / or Salmonella Enteritidid , Acinetobacter, in particular Acinetobacter baumannii, Escherichia coli and / or Klebsiella, in particular Klebsiella pneumoniae. In particular, the treatment and / or prevention of the disorder, disease or health status can be caused by Gram-positive bacteria from groups, families, genera or bacterial species that comprise strains pathogenic to humans or animals such as Listeria monocytogenes, Staphylococcus aureus , Enterococcus faecalis, Enterococcus faecium, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus mutans, Streptococcus equi, Clostridium difficile, Clostridium botulinum, Clostridium tetani, Clostridium perfringens, Bacillushacteri , Myco-plasma pneumoniae, Actinomyces.
[0105] In a preferred embodiment, the fusion protein, preferably the endolysin variant, the autolysin variant or the bacteriocin variant.
[0106] In a further aspect the present invention relates to a method of treating a disorder, disease or health condition associated with bacterial biofilm in an individual in need of treatment and / or prevention, the method of which comprises administration said individual of an efficient amount of a fusion protein according to the present invention and / or an efficient amount of a host transformed with a nucleic acid comprising a nucleotide sequence encoding a fusion protein according to the present invention or a composition according to the present invention. The individual can be a human being or an animal.
[0107] Preferably said method of treatment can be for the treatment and / or prevention of infections caused by Gram-negative and / or Gram-positive bacteria associated with bacterial biofilm, in particular by Gram-negative and Gram-positive bacteria that are listed earlier. In particular, said method of treatment may be for the treatment and / or prevention of infections of the skin, soft tissues, respiratory system, lungs, digestive tract, eyes, teeth, nasopharynx, mouth, bone, vagina, bacteremia and / or endocarditis wounds caused by Gram-negative and / or Gram-positive bacteria associated with bacterial biofilm, in particular by Gram-negative and Gram-positive bacteria that are listed above.
[0108] The dosage and route of administration used in a method of treatment or prophylaxis according to the present invention depend on the specific disease / infection site that will be treated. The route of administration can be, for example, oral, topical, nasopharyngeal, parenteral, inhalation, intravenous, intramuscular, intrathecal, intraspinal, endobronchial, intrapulmonary, intraosseous, intracardiac, intraarticular, rectal, vaginal or any other route of administration . In a preferred embodiment, the fusion protein is applied topically to biological material, preferably the skin, in particular from mammals, preferably from humans. In a preferred embodiment, the fusion protein is applied systemically to biological material, preferably blood, in particular from mammals, preferably from humans.
[0109] For the application of a fusion protein according to the present invention and / or an efficient amount of a host transformed with a nucleic acid comprising a nucleotide sequence encoding a fusion protein according to the present invention or a composition according to the present invention to a place of infection (or place at risk of being infected), a formulation that protects the active compounds from environmental influences such as proteases, oxidation, immune response, etc., can be used until reaching the place of infection. infection. Therefore, the formulation can be capsule, pill, pill, powder, suppository, emulsion, suspension, gel, lotion, cream, ointment, solution for injection, syrup, spray, inhalant or any other reasonable medicinal galenic formulation; Preferably, the galenic formulation may comprise carriers, stabilizers, flavorings, suitable buffers or other suitable reagents. For example, for topical application the formulation can be a lotion, a cream, a gel, an ointment or a plaster, for nasopharyngeal application the formulation can be a saline solution that will be applied through a spray in the nostrils. For oral administration in the case of treatment and / or prevention of a specific infection site, for example, in the intestines, it may be necessary to protect a fusion protein according to the present invention from the harsh digestive environment of the gastrointestinal tract to the site of infection to be hit. Thus, bacteria can be used as carriers, which survive the initial stages of digestion in the stomach and which subsequently secrete a fusion protein according to the present invention within the intestinal environment.
[0110] In a specific embodiment the present invention relates to the use of a fusion protein according to the present invention and / or a host transformed with a vector that comprises a nucleic acid molecule that comprises a nucleotide sequence that encodes a fusion protein according to the present invention in the manufacture of a medicament for the treatment and / or prevention of a disorder, disease or health condition caused by infections caused by associated Gram-positive and / or Gram-negative bacteria to bacterial biofilm. A preferred embodiment relates to the use of a fusion protein according to the present invention in the production of a medicament for the treatment and / or prevention of a disorder, disease or health condition caused by infections caused by bacteria Gram-positive and / or Gram-negative cells associated with bacterial biofilm in combination or in addition to antibiotics.
[0111] In a specific embodiment the present invention relates to the use of a fusion protein according to the present invention and / or a host transformed with a vector that comprises a nucleic acid molecule that comprises a nucleotide sequence that encodes a fusion protein according to the present invention in the production of a medicament for the treatment and / or prevention of a disorder, disease or health condition caused by Pseudomonas associated with bacterial biofilm, particularly by Pseudomonas aeruginosa in particular intestinal diseases , in particular in children, infections in the meninges, for example, hemorrhagic meningitis, infections of the middle ear, of the skin (Ecthyma gangraenosum), in particular burns, of the urinary tract, rhinitis, bacteremic pneumonia, in particular in which the patient is suffering from cystic fibrosis or hematological malignancies such as leukemia or with neutropenia from immunosuppressive therapy, septicemia, in particularly because of long-term intravenous or urinary catheterization, invasive surgical procedures and severe burns, endocarditis, in particular where the patient is an intravenous drug user or a patient with complications from open heart surgery, highly destructive eye infections. in particular after the use of contaminated ophthalmic solutions or severe facial burns, osteochondritis, in particular as a result of severe trauma or piercing injuries through contaminated clothing.
[0112] In another specific embodiment of the present invention the disorder, disease or state of health is caused by Burkholderia pseudomallei associated with bacterial biofilm, in particular Whitmore's disease, chronic pneumonia, septicemia, in particular in which the patient has an injury traumatized skin. In another specific embodiment of the present invention, the disorder, disease or state of health is caused by Salmonella thyphimurium and Salmonella enteritidis associated with bacterial biofilm, in particular acute gastroenteritis and local purulent processes, particularly osteomyelitis, endocarditis, cholecystitis and especially caused by Salmonella thyphimurium meningitis, in particular in which the patient is less than two years old. In another specific embodiment of the present invention the disorder, disease or state of health is caused by Salmonella typhi, in particular typhus. In another specific embodiment of the present invention the disorder, disease or state of health is caused by Salmonell paratyphi, in particular paratyphoid. In another specific embodiment of the present invention the disorder, disease or state of health is caused by Acinetobacter baumannii associated with bacterial biofilm, in particular bronchitis, pneumonia, wound infections and septicemia, in particular as a result of intravenous catheterization. In another specific embodiment of the present invention the disorder, disease or health condition is caused by Escherichia coli associated with bacterial biofilm, in particular extra intestinal infections, particularly appendicitis, purulent cholecystitis, peritonitis, purulent meningitis and urinary tract infection, infections E. coli intraintestinal infections, particularly epidemic enteritis and infectious disease similar to dysinteria, septicemia, enterotoxemia, mastitis and dysinteria. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Klebsiella pneumoniae associated with bacterial biofilm, in particular pneumonia, bacteremia, meningitis and urinary tract infections. In a specific embodiment the present invention relates to the use of a fusion protein according to the present invention and / or a host transformed with a vector that comprises a nucleic acid molecule that comprises a nucleotide sequence that encodes a fusion protein according to the present invention in the production of a medicament for the treatment and / or prevention of a disorder, disease or health condition caused by Listeria monocytogenes, in particular Granulomatosis infantiseptica (listeriosis of newborns), mononucleosis, conjunctivitis, meningitis, septic granulomatosis and listeriosis in pregnant women. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Staphylococcus aureus, in particular skin infections such as pyoderma, particularly folliculitis, furuncle, carbuncle, sweat gland abscesses and pemphigus and syndrome scales-like skin. The scaly skin syndrome can appear in three clinical conditions: exfoliative dermatitis, impetigo bullosa and scarlet erythroderma. In addition, the disorder, illness or health condition caused by Staphylococcus aureus is pneumonia caused by Staphylococcus, hospitalism, in particular infections from surgical injuries, puerperal mastitis and enterocolyte and food infections. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Streptococcus pyogenes, in particular tonsillitis, pharyngitis, scarlet fever, erysipelas, rheumatic fever and acute glomerulonephritis. In another specific embodiment of the present invention the disorder, disease or state of health is caused by Streptococcus pneumoniae, in particular pneumonia, ulcus serpens corneae, otitis media, meningitis, peritonitis, mastoiditis and osteomyelitis.
[0113] In another specific embodiment of the present invention the disorder, disease or health condition is caused by Clostridium perfringens, in particular gas gangrene, ulcerative necrotizing enteritis and food infections. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Clostridium botulinum, in particular botulism. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Clostridium difficile, in particular pseudomembranous enterocolinte. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Bacillus anthracis, in particular cutaneous anthrax, inhalation anthrax and gastrointestinal anthrax. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Enterococcus faecalis or E. faecium, such as nosocomial infections and endocarditis. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Bacillus cereus, in particular foodborne infections, bronchial pneumonia, septicemia and meningitis. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Mycobacteria avium, Mycobacteria paratuberculosis and Mycobacteria tuberculosis, in particular tuberculosis. In another specific embodiment of the present invention, the disorder, disease or health condition is caused by Mycoplasma pneumoniae, in particular pneumonia, diseases of the upper respiratory tract and inflammation of the eardrum. In another specific embodiment of the present invention the disorder, disease or state of health is caused by Actinomyces, in particular actinomycosis in humans, cattle, cats and dogs. In another specific embodiment of the present invention, the disorder, disease or state of health is caused by Corynebacterium diphteriae, in particular localized diphtheria of the tonsils, nose, nasopharynx or middle ear, progressive laryngeal, tracheal and bronchial diphtheria , toxic or malignant diphtheria, skin or injury diphtheria.
[0114] The methods of eliminating, reducing or preventing bacterial biofilms through fusion proteins according to the present invention provide a possibility of invasion within the bacterial biofilm and eliminate, reduce and prevent bacterial biofilm.
[0115] The methods of eliminating, reducing or preventing bacterial biofilms using fusion proteins according to the present invention can be for the treatment and / or prevention of the following infections: wound infections, in particular injuries associated with diabetes mellitus, tonsillitis, osteomyelitis, bacterial endocarditis, sinusitis, corneal infections, urinary tract infection, biliary tract infection, infectious kidney stones, urethritis, prostatitis, catheter infections, middle ear infections, formation of dental plaque, gingivitis, periodontitis, cystic fibrosis and infections of permanent internal devices such as joint prostheses and heart valves.
[0116] In another preferred mode of elimination, reduction and prevention of bacterial biofilms through fusion proteins according to the present invention can be for the treatment and / or prevention of infections associated with foreign material, such as contamination and colonization of catheters, implants and medical devices, in particular instruments, devices, endoscopes, dental devices, dialysis equipment, such as peritoneal dialysis catheters, pacemakers, endotracheal tubes, vocal prostheses, cerebrospinal fluid bridges, venous catheter, artificial heart valves and joint prostheses.
[0117] In another preferred mode of elimination, reduction and prevention of bacterial biofilms through fusion proteins according to the present invention, the bacterial biofilm is formed by Staphylococcus epidermidis, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli and Candida albicans.
[0118] In another preferred mode of elimination, reduction and prevention of bacterial biofilms through fusion proteins according to the present invention can be for the prevention or removal of contamination in health care, agricultural and industrial units, in particular in hospital water pipes, in water, in pipes, in ventilation, in building heating, in air conditioning, oil wells, cosmetics and medicines.
[0119] In another preferred mode of elimination, reduction and prevention of bacterial biofilms through fusion proteins according to the present invention can be for the prevention of biocorrosion, in particular in cooling circuits, water treatment plants, domestic hot water, power plants, production systems and machinery for automobiles, computers, pigmentation, oil and gas.
[0120] In another preferred modality of elimination, reduction and prevention of bacterial biofilms through fusion proteins according to the present invention can be for the prevention of biological contamination, in particular on submarine objects, ships, platforms, sensor systems for purposes scientific or surveillance activities in the maritime field.
[0121] In a preferred embodiment of the present invention a fusion protein according to the present invention is used for medical treatment, if the infection to be treated or prevented is caused by multidrug-resistant bacterial strains associated with the bacterial biofilm, in particular by strains resistant to one or more of the following antibiotics: streptomycin, tetracycline, cephalothin, genotamycin, cefotaxime, cephalosporin, ceftazidime or imipenem.
[0122] In addition, in the methods or use of the present invention the fusion protein, preferably the endolysin variant, the autolysin variant or the bacteriocin variant can be used, added or administered in combination or in addition with conventional antibacterial agents , such as antibiotics, lantibiotics, bacteriocins or endolysins. In another preferred embodiment, antibiotics are added, used or administered in the methods and use according to the present invention simultaneously with the fusion protein, after or before administration or addition of the fusion protein.
[0123] In a preferred embodiment of the present invention the fusion protein can be used or administered in combination with at least the following antibiotics: β-lactams, aminoglycosides, fluoroquinolones, macrolides, novobiocin, rifampicin, oxazolidinones, fusidic acid, mupirocin, pleuromutilins, daptomycin, vancomycin, tetracyclines, sulfonamides, chloramphenicol, trimethoprim, phosphomycin, cycloserine and polymyxin.
[0124] In another preferred embodiment of the present invention the fusion protein can be used in the methods of eliminating, reducing or preventing bacterial biofilms from Staphylococcus aureus by administering it in combination with at least one of the following antibiotics: β -lactams, aminoglycosides, fluoroquinolones, macrolides, novobiocin, rifampicin, oxazolidinones, fusidic acid, mupirocin, pleuromutilins, daptomycin, vancomycin, tetracyclines, sulphamides, chloramphenicol, trimethoprine, phosphomycin and cycles.
[0125] In another preferred embodiment of the present invention a fusion protein can be used in the methods of eliminating, reducing or preventing bacterial bio-films of Escherichia coli by administering it in combination with at least one of the following antibiotics : β-lactams, aminoglycosides, fluoroquinolones, tetracyclines, sulfonamides, chloramphenicol, trimethoprim, fosfomycin, cycloserine and polymyxin.
[0126] In another preferred embodiment of the present invention a fusion protein can be used in the methods of eliminating, reducing or preventing bacterial bio-films of Pseudomonas aeruginosa by administering it in combination with at least one of the following antibiotics: β -lactams, aminoglycosides, fluoroquinolones and polymyxin.
[0127] The present invention further relates to a pharmaceutical package for use in the elimination, reduction and prevention of bacterial biofilm comprising one or more compartments, wherein at least one compartment comprises one or more fusion protein according to the present invention and / or one or more hosts transformed with a nucleic acid comprising a nucleotide sequence encoding a fusion protein according to the present invention or a composition according to the present invention.
[0128] In another aspect the present invention relates to a process for preparing a pharmaceutical composition for use in the elimination, reduction and prevention of bacterial biofilm, said process comprising mixing one or more fusion protein according to the present invention and / or one or more hosts transformed with a nucleic acid comprising a nucleotide sequence encoding a fusion protein according to the present invention with a pharmaceutically acceptable diluent, excipient or carrier.
[0129] Still in an additional aspect the composition according to the present invention is a cosmetic composition for use in the elimination, reduction and prevention of bacterial biofilm. Various species of bacteria can cause irritation on surfaces exposed to the environment of the patient's body such as the skin. For the purpose of preventing such irritations or for the purpose of eliminating minor manifestations of said bacterial pathogens, special cosmetic preparations can be used, which comprise sufficient amounts of the fusion protein according to the present invention in order to degrade Gram-bacteria negative and / or gram-positive pathogens already existing or newly sedimented.
[0130] In a further aspect the present invention relates to the fusion protein according to the present invention for use as a means of diagnosis in medical, food or food or environmental diagnostics, in particular as a means of diagnosis for the diagnosis of bacterial infection caused in particular by Gram-negative and / or Gram-positive bacteria associated with bacterial biofilm. In this regard, the fusion protein according to the present invention can be used as a tool to specifically degrade pathogenic bacteria associated with bacterial biofilm, in particular pathogenic Gram-negative and / or Gram-positive bacteria. The degradation of bacterial cells by the fusion protein according to the present invention can be supported by the addition of detergents such as Triton X-100 or other additives that weaken the bacterial cell envelope like polymyxin B. Specific cell degradation is necessary as a step for the subsequent specific detection of bacteria using methods based on nucleic acids such as PCR, nucleic acid hybridization or NASBA (Nucleic Acid Sequence Amplification), immunological methods such as IMS, immunofluorescence or ELISA techniques or other methods based on cellular content of bacterial cells as enzymatic assays using specific proteins for distinct bacterial groups or species (eg, β-galactosidase for enterobacteria, coagulase for positive strains for coagulase).
[0131] In a further aspect the present invention relates to the use of the fusion protein according to the present invention for the removal, reduction and / or prevention of contamination by Gram-negative and / or Gram- positive associated with the bacterial biofilm of food material, of food processing equipment, of food processing plants, of surfaces that come into contact with food material such as shelves and food storage areas and in all other situations, where pathogenic bacteria, facultative pathogens or other undesirable bacteria can potentially infest food material, medical devices and all types of surfaces in hospitals and surgery.
[0132] In particular, a fusion protein of the present invention can be used in the methods of eliminating, reducing or preventing bacterial biofilms prophylactically as a disinfectant. Said disinfecting agent can be used before or after surgery or, for example, during hemodialysis. In addition, premature babies and immunocompromised persons or those in need of prosthetic devices can be treated with a fusion protein according to the present invention. Said treatment can be carried out prophylactically or during acute infection. In the same context, nosocomial infections, especially by antibiotic-resistant strains such as Pseudomonas aeruginosa (FQRP), Acinetobacter and Enterobacteriaceae species such as E.coli, Salmonella, Shigella, Citrobacter, Edwardsiella, Enterobacter, Hafnia, Klebsiella, Morganella species , Proteus, Supply, Serratia and Yersinia; Methicillin-resistant Staphylococcus aureus, Vancomycin-resistant Enterococcus faecalis, Vancomycin-resistant Ente rococcus faecium, Streptococcus pneumoniae, Propioni- bacterium acnes, Mycobacteria tuberculosis resistant to various drugs, can be treated prophylactically or during the acute phase with a fusion protein of the present invention. Therefore, a fusion protein according to the present invention can be used as a disinfectant to eliminate, reduce or prevent bacterial biofilms also in combination with other ingredients useful in a disinfection solution such as detergents, detergent agents, solvents, antibiotics, lantibiotics or bacteriocins.
[0133] For the use of the fusion protein according to the present invention for the elimination, reduction or prevention of bacterial biofilms as a disinfectant, for example, in hospital, dental surgery, veterinarian, kitchen or bathroom, the fusion protein can be prepared in a composition in the form of, for example, a fluid, a powder, a gel or an ingredient of a wet wipe product or a disinfection wipe. Said composition may additionally comprise carrier, additives, diluting agents and / or excipients suitable for their respective use and form, respectively, - but also agents that support the antimicrobial activity such as EDTA or agents that increase the antimicrobial activity of the proteins of Fusion. The fusion protein can also be used with common disinfectants, such as, alcohols, aldehydes, oxidizing agents, phenolics, quaternary ammonium compounds or UV light. For disinfecting, for example, surfaces, objects and / or devices the fusion protein can be applied to said surfaces, objects and / or devices. The application can occur, for example, by moistening the disinfection composition with any means such as a cloth or rag, by spraying, pouring. Fusion proteins can be used in varying concentrations depending on the respective application and the intended “reaction time” to obtain the total antimicrobial activity.
[0134] In a further aspect the present invention relates to the use of the fusion protein according to the present invention as a food additive.
[0135] The additional scope of the applicability of the present invention will become evident from the detailed description provided later here, however, it should be understood that the detailed description and the specific examples, while indicating such detailed description and specific examples, although indicating the preferred embodiments of the invention are provided for the purpose of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. It should be understood that both the foregoing general description and the following detailed description are examples and explanatory only and are not restrictive of the invention, as claimed.
[0136] The following examples explain the present invention, but are not considered to be limiting. Unless otherwise indicated, standardized methods of molecular biology were used, as, for example, described by Sambrock et al., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor , New York.
[0137] EXAMPLE 1: Cloning, expression and purification of modified en-dolisin variants phiKZgp144 and ELgpgp188.
[0138] phiKZgp144 as represented in SEQ ID NO: 1 and ELgp188 as represented in SEQ ID NO: 2 are modular endolysins that originate from seKZ and EL from Pseudomonas aeruginosa with a N-terminal peptideoglycan and a catalytic domain C-terminal (Briers et al., 2007).
[0139] For the amplification of the open reading frame (ORF) of the phiKZgp144 and ELgp188 PCR a standardized 5 'primer (for phiKZgp144: 5' ATGAAAGTATTACGCAAA 3 '(SEQ ID NO: 83); for ELgp188 5' ATGAACTTCCGGGAC ' (SEQ ID NO: 65)) and the 3 'primers standardized according to SEQ ID NO: 81 and 82 were amplified (for phiKZgp144: TTTTCTATGTGCTGCAAC (SEQ ID NO: 81); for ELgp188: ATACGAAAT AACGTGACGA (SEQ ID NO : 82)) were used. To extend the 5 'end of the open reading frame encoding phiKZgp144 or ELgp188 with a gene fragment encoding nine positively charged residues (Lys-Arg-Lys-Lys-Arg- Lys-Lys-Arg-Lys - SEQ ID NO: 11) a tail PCR with an extended 5 'primer (for phiKZgp144: 5' ATGGGATCCAAACGCAAGAAACGTAAGAAA CGCAAAAAAGTATTACGCAAAG 3 '(SEQ ID NO 79); 3 'standardized according to SEQ ID NO: 81 and 82 were amplified. The PCR product was cloned into the expression vector pEXP5CT / TOPO® (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The arginine triplets were incorporated in addition to the lysine triplets to avoid elimination of tRNA and reduce the risk of alterations in the frame (the only two triplets available for lysine are AAA and AAG, leading to long A filaments). Inserting additional polycationic cassettes into the planned BamHI restriction site increases the length of the tail with extra cationic residues. This insertion creates an arginine and serine triplet at each junction site (Figure 1). Up to four polycationic peptides were fused to either phiKZgp144 or ELgp188, called (POLY) n-gp144 or (POLY) n-gp188 (n = 1,2,3,4), which comprise 9, 19, 29 and 39 residues, respectively of amino acids loaded positively at the N-terminal. Consequently, the following constructs were expressed in E. coli BL21 (DE3) pLysS cells (cells that grow exponentially at 37 ° C, induction using 1 mM IPTG, expression for 4 h at 37 ° C):


[0140] The modified endolysin variants POLY-gp144 (SEQ ID NO: 35), (POLY) 2-gp144 (SEQ ID NO: 36), POLY-gp188 (SEQ ID NO: 39) and (POLY) 2-gp188 (SEQ ID NO: 40) were used for further investigations. Said proteins were purified by Ni2 + affinity chromatography using the 6xHis-tag C-terminal (Akta Fast Protein Liquid Chromatography). spectrophotometric measurement of protein concentration and the total volume of the purified stock solution.The purification of gp188 derivatives was carried out under more stringent conditions (65 mM imidazole) compared to gpl44 derivatives (50 mM imidazole) to ensure high purity. The total yields per liter of the E. coli expression culture are shown in table 5.
[0141] Table 5 - Yields of recombinant derivatives from purification of endolysin per liter of E. coli expression culture.

[0142] The purified stock solutions were ~ 90% pure. Mass spectral analysis of purified POLY-derivative solutions revealed traces of the L2 protein from the E. coli 50S ribosomal subunit and the 16S uridine-516 pseudouridylate rRNA synthase. All derivatives of phiKZgp144 exhibited formation of multimers that could be converted into monomers through the addition of β-mercaptoethanol, indicating that interdisulfide bonds cause multimerization.
[0143] EXAMPLE 2: Antibacterial activity of modified variants of phiKZgp144 and ELgp188
[0144] Exponential cells (~ 106 / mL) of P. aeruginosa PAO1p (Pirnay JP et al. (2003), J Clin Microbiol., 41 (3): 1192-1202) were diluted 100 x (the final density was ~ 106 / mL) and incubated at room temperature with every 10 μg of non-dialysed protein (unmodified endolysins phiKZgp144 (SEQ ID NO: 1) and ELpg188 (SEQ ID NO: 2) and modified endolysin variants POLY-gp144 (SEQ ID NO: : 35), (POLY) 2-gp144 (SEQ ID NO: 36), POLY-gp188 (SEQ ID NO: 39) and (POLY) 2-gp188 (SEQ ID NO: 40) at a final concentration of 100 μg / mL in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole). After 1 hour the cell suspensions were diluted in PBS buffer (10e-5, 10e-4 and 10e-3) and plated (standardized LB medium, incubated overnight at 37 ° C). Additionally, a negative control containing cells in PBS buffer was plated. Residual colonies were counted after an overnight incubation. of cells counted for antibacterial activity in the form of information relative activation (%) (= 100- (Ni / No) * 100 with N0 = number of untreated cells and Ni = number of treated cells) and in logarithmic units (= log10N0 / Ni) was calculated (Table 6). All samples were repeated six times. Means / standard deviations are represented. Statistical analysis was performed using Student's t test.
[0145] The unmodified endolysins phiKZgp144 and ELgp188 do not significantly reduce cell numbers compared to the negative control. This observation illustrates the efficacy of the outer membrane as a barrier for endolysin to degrade the cell wall of Gram-negative bacteria. In contrast, as shown in Table 6, incubation with the modified endolysins POLY-gp144, (POLY) 2-gp144, POLY-gp188 and (POLY) 2-gp188 causes a significant reduction (α = 0.05) in the number of cells bacterial (99.85 ± 0.09% for POLY-gp144 and 98.0 ± 0.2% for POLY-gp188). An increase in the length of the polythionic peptide additionally tends to reinforce antibacterial activity, especially in the case of phiKZgp144 (a reduction of up to 99.98 ± 0.02% or 3.7 ± 0.3 log units is achieved within 1 hour for (POLY) 2-gp144). In addition, the experiments demonstrated that the modified endolysins of phiKZgp144 have a greater antibacterial activity than the modified endolysins of ELgp188.
[0146] Table 6 - Antibacterial effect of unmodified and modified endolysins of phiKZgpl 44 and ELgpl 88 variants.

[0147] Thus, the example demonstrated that the addition of a short peptide of nine cationic residues at the N-terminal in phiKZgp144 (SEQ ID NO: 1) is already sufficient to kill almost 99.9% of the cells within 1 hour. Poly-L-Lysine also has intrinsic antibacterial activity, although this property has so far been attributed only to polymers of at least 20 residues (Vaara and Vaara, 1983a, 1983b). However, the combined action of polycationic peptide and endolysin kills cells.
[0148] In an additional experiment the modified POLY-gp144 endolysin was subjected to dialysis at 50 mM KH2PO4 / K2HPO4 pH 7 and used instead of the non-dialysed protein solution as previously described. In this way, the level of inactivation was further increased from 2.9 ± 0.3 log units to 3.9 ± 0.2 log units.
[0149] EXAMPLE 3: Expression of modified variants of phiKZgp144 and ELgp188 in Pichia pastoris as a host for non-toxic recombinant production
[0150] The open reading frame encoding POLY-gp144 (SEQ ID NO: 35) was cloned into the bifunctional vector pPICZαA (Invitrogen), which was subsequently integrated into the P. pastoris genome through homologous recombination (as indicated by the manufacturer; P. pastoris X33 cells, Invitrogen). Gene expression was induced with methanol (1%) in BMMY medium and the supernatant was analyzed for the presence of enzyme activity after 1, 3 and 4 days. Therefore, an amount of 30 μL of supernatant from the P. pastoris expression culture was added to 270 μL of P. aeruginosa PAO1p cells permeabilized with chloroform (Pirnay JP et al. (2003), J Clin Microbiol., 41 (3 ): 1192-1202) after 1, 3 and 4 days (buffer condition: KH2PO4 / K2HPO4 I = 120 mM pH 6.2). Subsequently, the optical density was recorded spectrophotometrically (Figure 2). A drop in optical density indicates the secretion of a mural enzyme by P. pastoris. As a negative control, P. pastoris X33 with no expression plasmid was included. Thus, the lysis of the substrate after the addition of the supernatant sample is a measure for successful recombinant production and for the secretion of POLY-gp144 (SEQ ID NO: 35) by P. pastoris. After 1 day, limited enzyme activity could be detected. Maximum activity was observed after 3 days since no significant decrease in activity in the supernatants was observed on the fourth day. No toxic effects on P. pastoris cell density were observed.
[0151] During expression by P. pastoris the secretion of the vector's α signal causes secretion of the recombinant protein in the surrounding medium, which allows for simplified purification since only a limited number of other proteins are secreted. A BamHI restriction site at the 5 'end of the open reading frames makes it possible to add more cassettes that encode additional polycationic peptides.
[0152] EXAMPLE 4: PhiKZgp144 endolysin variants further modified with different polycationic peptides
[0153] To test and to compare the potential of polycationic peptides, variants of phiKZgp144 and other genes encoding endolysin that have different polycationic peptides at the N-terminal end of the protein were synthesized. Peptide variation refers to the length, composition and insertion of linker sequences. On the one hand, additional polycationic peptides that have several N-terminals of the KRK motif were produced. On the other hand, polycationic peptides that consist only of arginine (R) or lysine (K) have been produced. In addition, to increase the translation of long polycationic peptides, polycationic peptides that comprise a ligand sequence have been produced.
[0154] The different products were cloned into the expression vector pET32b (Novagen, Darmstadt, Germany). pET32b was used to reduce the potential toxicity of the polycationic peptide against the host E. coli. A fusion protein encoded by the vector (thioredoxin), masks the polycationic peptide and can be eliminated during the purification process.
[0155] Consequently, the following modified endolysin variants were expressed in E. coli BL21 (DE3) cells at 37 ° C until an optical density of DO600nm = 0.6 is reached. Then the expression of the protein was induced with 1 mM of IPTG (final concentration) and the expression was carried out for four hours. Then E. coli cells were collected by centrifugation for 20 min at 6000g and cell disruption and protein purification were performed according to the S-tag purification kit (Novagen, Darmstadt, Germany):


[0156] All proteins were purified using the S-Tag ™ rEK Purification Kit (Novagen, Darmstadt, Germany). Using the pET32b vector, the expressed proteins were not toxic to the host resulting in high yields of the protein produced. Purified stock solutions exhibited high purity.
[0157] Exponential cells (~ 106 / mL) of P. aeruginosa PAO1p (Isolated from burn injury, Queen Astrid Hospital, Brussels; Pirnay JP et al. (2003), J Clin Microbiol., 41 (3): 1192- 1202) were diluted 100 x (the final density was ~ 106 / mL) incubated at room temperature with each 10 μg of non-dialysed protein that are listed previously at a final concentration of 100 μg / mL in buffer (20 mM NaH2PO4- NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole). After 1 hour the cell suspensions were diluted 1: 100 and plated on LB. In addition, a negative control was plated using buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole). Residual colonies were counted after an overnight incubation at 37 ° C. Based on the number of cells counted, antibacterial activity in the form of relative inactivation (%) (= 100- (Ni / No) * 100 with N0 = number of untreated cells and Ni = number of treated cells) was calculated (Table 7 ). All samples were repeated at least four times. Table 7 - Antibacterial effect of unmodified and modified endolysins phiKZgp144 and ELgp188


[0158] unmodified phiKZgp144 does not significantly reduce cell numbers compared to the negative control. In addition, modified phiKZgp144 variants that carry a polycationic peptide with several N-terminals of the KRK motif greatly increase the antimicrobial effect. However, still variants that have a homomer peptide of lysine or arginine show significant cell reduction compared to unmodified phiKZgp144 as measured. In addition, also the variant that has a polycationic peptide of 38 amino acid residues and that comprises a linker sequence increases the antimicrobial effect enormously.
[0159] EXAMPLE 5: Modified endolysin variants of Salmonella typhimurium phage PSP3
[0160] PSP3gp10 according to SEQ ID NO: 8 is a globular endolysin with 165 amino acid residues that originates from Salmonella typhimurium phage PSP3 with a muramidase domain similar to catalytic lambda. As predicted through the BLASTp and Pfam analyzes, the PSP3gp10 endolysin comprises its catalytic domain in the range of approximately amino acid residue 34 to approximately amino acid residue 152.
[0161] PSP3 purified genomic DNA from phage PSP3 was used as a template for the amplification of the PSP3gp10 open reading frame (ORF) in a Hot Start Taq PCR polymerase reaction (Qiagen, Germany) using the following PCR parameters:

[0162] For said PCR a standardized 5 'primer (5' ATGGGATCCCCGGTCATTAATACTCACCAG 3 '(SEQ ID NO: 50)) and a standardized 3' primer (5 'TGCCATCACCCCGCCAGCCGTG 3' (SEQ ID NO: 51)) . To extend the 5 'end of the ORF which encodes PSP3gp10 with a gene fragment encoding the 9-mer polycationic peptide Lys-Arg-Lys-Lys-Arg-Lys-Lys-Arg-Lys (SEQ ID NO: 11) Tail PCR (Hot Start Taq polymerase PCR with the same parameters) with a 5 'extended primer (5' ATGGGATCCAAACGCAAGAAACGTAAGAAACGCAAACCGGTCATTAATACTCACCAG 3 '(SEQ ID NO: 52)) and the 3' standardized primer according to SEQ ID NO: 51 was applied. Both the original unmodified PSP3gp10 PCR fragment and the PK-extended fragment were ligated into the expression vector pEXP5CT / TOPO® (Invitrogen, Carlsbad, CA, USA) following the manufacturer's TA cloning protocol.
[0163] Recombinant expression of PSP3gp10 according to SEQ ID NO: 8 and PKPSP3gp10 according to SEQ ID NO: 53 is performed on exponentially growing E. coli BL21 (ÀDE3) pLysS cells (Invitrogen) after induction with 1 mM IPTG (isopropylthiogalactoside) at 37 ° C over a period of 4 hours. Both proteins were purified by Ni2 + affinity chromatography (Akta FPLC, GE Healthcare) using the 6xHis-tag C-terminal, encoded by the expression vector pEXP5CT / TOPO®. Ni2 + affinity chromatography is performed in 4 subsequent steps, all at room temperature: 1. Equilibrium of the 1 mL Histrap HP column (GE Healthcare) with 10 column volumes of Wash Buffer (60 mM imidazole, 0.5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min. 2. Loading of the total lysate (with the desired endolysin) in the 1 mL Hispath HP column at a flow rate of 0.5 mL / min. 3. Wash the column with 15 column volumes of Wash Buffer at a flow rate of 1 mL / min. 4.Elution of bound endolysin from the column with 10 column volumes of Elution Buffer (500 mM imidazole, 5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min.
[0164] The total yields of both purified recombinant proteins per liter of E.coli expression culture are shown in table 8. The values were determined by spectrophotometric measurement of the protein concentration and the total volume of the purified stock solution in one 280 nm wavelength. The purified stock solutions consisting of PSP3gp10 and PKPSP3gp10, respectively, in elution buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) were at least 90% pure as visually determined in gels of SDS-PAGE.Table 8 - Yields of purified recombinant PSP3gp10 endolysin and its modified variant PKPSP3gp10 per liter of E. coli expression culture.

[0165] To determine the anti-Gram-negative spectrum of PKPSP3gp10 endolysin according to SEQ ID NO: 53, a combination of 1.315 μM of PKPSP3gp10 endolysin and 0.5 mM EDTA was tested on the clinical strains of P. aeruginosa PAO1p and Br667, Escherichia coli WK6 and Salmonella typhimurium (see Table 9). Exponentially growing bacterial cells (OD 600nm 0.6) were diluted 100 times to a final density of approximately 106 µg / ml of each strain and incubated for 30 minutes at room temperature without shaking with unmodified endolysin PSP2gp10 (SEQ ID NO: 8 ) and modified endolysin PKPSP3gp10 (SEQ ID NO: 53) each in combination with and without 0.5 mM EDTA. For the incubation, the endolysins were each used in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole) and the incubation occurred at a final endolysin concentration of 1.315 μM . As a control, each strain was also incubated for 30 minutes with 0.5 mM EDTA (in the same buffer as described above), but without endolysin. Table 9 - List of Gram-negative strains used

[0166] After incubation, cell suspensions were diluted three times (105-104-103 cells / mL respectively) and 100 μL of each dilution was plated in LB medium. Residual colonies were counted after an overnight incubation at 37 ° C. Based on the numbers of cells counted, antibacterial activity in the form of relative inactivation in logarithmic units (= log10N0 / Ni with N0 = number of untreated cells and Ni = number of treated cells) was calculated (Table 10). - Antibacterial activity of unmodified endolysin (PSP3gp10) and its modified endolysin variant (PKPSP3gp10) with and without EDTA-Na2 in Gram-negative species with different exponential growth.

[0167] All samples were repeated three times. The means +/- standard deviations are represented. The maximum reduction observed is dependent on the level of detection of 10 cells / mL and the initial cell density. For PAO1p, EDTA works synergistically with both unmodified PSP3gp10 endolysin and its modified PKPSP3gp10 variant.
[0168] EXAMPLE 6: Variants of modified P-2 endolysins from Es-cherichia coli phage
[0169] P2gPO9 according to SEQ ID NO: 9 is a globular endolysin of 165 amino acid residues that originates from Escherichia coli P2 phage with a muramidase domain similar to catalytic lambda. As predicted by the BLASTp and Pfam analyzes, the P2gPO9 endolysin comprises its catalytic domain in the range of approximately amino acid residue 34 to approximately amino acid residue 152.
[0170] P2 phage purified genomic DNA was used as a template for the amplification of the P2gPO9 open reading frame (ORF) in the standardized PCR reaction with Pfu polymerase (Fermentas) using the following PCR parameters:


[0171] For said PCR a standardized 5 'primer (5' ATGGGATCCCCGGTAATTAACACGCATC 3 '(SEQ ID NO: 54)) and a standardized 3' primer (5 'AGCCGGTACGCCGCCAGCGGTACGC 3' (SEQ ID NO: 55)) . To extend the 5 'end of the ORF encoding P2gPO9 with a gene fragment encoding the 9-mer polycationic peptide Lys-Arg-Lys-Lys- Arg-Lys-Lys-Arg-Lys (SEQ ID NO: 11) Tail PCR (with the same parameters as the previous standardized PCR) with an extended 5 'primer (5' ATGGGATCCAAACGCAAGAAACGTAAGAAACGC AAACCGGTAATTAACACGCATC 3 '(SEQ ID NO: 56) and the standardized 3' primer according to SEQ ID NO 55 Both the original unmodified P2gPO9 PCR fragment and the extended fragment were ligated into the expression vector pEXP5CT / TOPO® (Invitrogen, Carlsbad, CA, USA) following the manufacturer's TA cloning protocol.
[0172] P2gPO9 recombinant expression according to SEQ ID NO: 9 and PKP2gPO9 according to SEQ ID NO: 57 is performed on E. coli BL21 (ÀDE3) pLysS cells with exponential growth (Invitrogen) after induction with 1 mM IPTG (isopropylthiogalactoside) at 37 ° C for a period of 4 hours. Both proteins were purified by Ni2 + affinity chromatography (Akta FPLC, GE Healthcare) using the 6xHis-tag C-terminal, encoded by the expression vector pEXP5CT / TOPO®. Ni2 + affinity chromatography is performed in 4 subsequent steps, all at room temperature: 1. Equilibrium of the 1 mL Histrap HP column (GE Healthcare) with 10 column volumes of Wash Buffer (60 mM imidazole, 0.5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min. 2. Loading of the total lysate (with the desired endolysin) in the 1 mL Hisp trap HP at a flow rate of 0.5 mL / min. 3. Wash the column with 15 column volumes of Wash Buffer at a flow rate of 1 mL / min. 4.Elution of bound endolysin from the column with 10 column volumes of Elution Tamper bread (500 mM imidazole, 5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min
[0173] The total yields of both purified recombinant proteins per liter of E.coli expression culture are shown in table 11. Values were determined by spectrophotometric measurement of protein concentration and the total volume of the purified stock solution at a length 280 nm waveform. The purified stock solutions consisting of P2gPO9 and PKP2gPO9, respectively, in elution buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) were at least 95% pure as visually determined in gels of SDS-PAGE.Table 11 - Yields of purified recombinant P2gPO9 endolysin and its PKP2gPO9 derivative modified with PK per liter of E. coli expression culture.

[0174] To determine the anti-Gram-negative spectrum of PK2gPO9 endolysin according to SEQ ID NO: 57, a combination of 1.315 μM PK2gPO9 endolysin and 0.5 mM EDTA was tested on the clinical strains of P. aeruginosa PAO1p and Br667, Burkholderia pseudomallei, Pseudomonas putida G1 and in Escherichia coli WK6 (see Table 13). Exponentially growing bacterial cells (OD 600nm 0.6) were diluted 100 times to a final density of approximately 106 µg / ml of each strain and incubated for 30 minutes at room temperature without shaking with unmodified endolysin P2gPO9 (SEQ ID NO: 9 ) and modified endolysin PKP2gPO9 (SEQ ID NO: 57) each in combination with and without 0.5 mM EDTA. For the incubation, the endolysins were each used in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole) and the incubation occurred at a final concentration of endolysin of 1.315 μM. As a control, each strain was also incubated for 30 minutes with 0.5 mM EDTA (in the same buffer as described above), but without endolysin. After incubation, cell suspensions were diluted three times (105-104-103 cells / mL respectively) and 100 μL of each dilution was plated in LB medium. Residual colonies were counted after an overnight incubation at 37 ° C. Based on the number of cells counted, antibacterial activity in the form of relative inactivation in logarithmic units (= log10N0 / Ni with N0 = number of untreated cells and Ni = number of treated cells, both counted after incubation) was calculated (Table 12 Table 12 - Antibacterial activity of unmodified endolysin (P2gPO9) and its modified endolysin variant (P2gPO9) with and without EDTA-Na2 on Gram-negative species in different exponential growth.

[0175] All samples were repeated three times. The means +/- standard deviations are represented. The maximum reduction observed is dependent on the level of detection of 10 cells / mL and the initial cell density.Table 13 - List of Gram-negative strains used
* Pirnay JP et al., (2003). Molecular epidemiology of Pseudomonas aeruginosacolonization in a burn unit: persistence of a multidrug-resistant clone and a silver sulfadiazine-resistant clone. J Clin Microbiol., 41 (3): 1192-1202.
[0176] EXAMPLE 7: Modified endolysin variants of Pseudomonas putida OBP phage
[0177] OBPgpLYS according to SEQ ID NO: 7 is a modular endolysin of 328 amino acid residues that originates from the Pseudomonas OBP phage put with supposed domains that bind to the N-terminal peptideoglycan and a catalytic chitinase domain C-terminal. As predicted through the BLASTp and Pfam analyzes, the OBPgpLYS endolysin comprises its catalytic domain in the range of approximately amino acid residue 126 to approximately the amino acid residue 292 and the N-terminal peptideoglycan binding domain in the range of approximately - approximately amino acid residues 7 to 96.
[0178] Purified genomic DNA from OBP phage was used as a template for the amplification of the OBPgpLYS open reading frame (ORF) in the standardized PCR reaction with Pfu polymerase (Fermentas, Ontario, Canada) using the PCR parameters below :


[0179] Therefore, a standardized 5 'primer (5' ATGAAAAATAGCGAGAAGAAT 3 '(SEQ ID NO: 58)) and a standardized 3' primer (5 'AACTATTCCGAGTGCTTTCTTTGT 3' (SEQ ID NO: 59)). To extend the 5 'end of the ORF encoding OBPgpLYS with a gene fragment encoding the 9-mer polycationic peptide Lys-Arg-Lys-Lys-Arg-Lys-Lys- Arg-Lys- (SEQ ID NO: 11) a tail PCR (with the same parameters as the previous standardized PCR) with a 5 'extended primer (5' ATGGGATCCAAACGCAAGAAACGTAAGAAACGCAAAAAAAATAGCGAG AAGAAT 3 '(SEQ ID NO: 60)) and the 3' standardized primer according to SEQ ID NO 59 was applied. Both the original unmodified OBPgpLYS fragment and the extended fragment were ligated into the pEXP5CT / TOPO® expression vector (Invitogen, Carlsbad, CA, USA) following the manufacturer's TA cloning protocol.
[0180] OBPgpLYS recombinant expression according to SEQ ID NO: 7 and PKOBPgpLYS according to SEQ ID NO: 61 is performed on E. coli BL21 (ÀDE3) pLysS (Invitrogen) cells with exponential growth after induction with 1 mM IPTG (isopropylthiogalactoside) at 37 ° C for a period of 4 hours. Both proteins were purified by Ni2 + affinity chromatography (Akta FPLC, GE Healthcare) using the 6xHis-tag C-terminal, encoded by the expression vector pEXP5CT / TOPO®. Ni2 + affinity chromatography is performed in 4 subsequent steps, all at room temperature: 1. Equilibrium of the 1 mL Histrap HP column (GE Healthcare) with 10 column volumes of Wash Buffer (60 mM imidazole, 0.5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min. 2. Loading of the total lysate (with the desired endolysin) in the 1 mL Hisp trap HP at a flow rate of 0.5 mL / min. 3. Wash the column with 15 column volumes of Wash Buffer at a flow rate of 1 mL / min. 4.Elution of bound endolysin from the column with 10 column volumes of Elution Tamper bread (500 mM imidazole, 5 mM NaCl and 20 mM NaH2PO4-NaOH at pH 7.4) at a flow rate of 0.5 mL / min
[0181] The total yields of both purified recombinant proteins per liter of E. coli expression culture are shown in table 14. The values were determined by spectrophotometric measurement of the protein concentration and the total volume of the purified stock solution in one 280 nm wavelength. Purified stock solutions consisting of OBPgpLYS and PKOBPgpLYS, respectively, in elution buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 500 mM imidazole) were at least 90% pure as de-terminated. visually in the SDS-PAGE gels. Table 14 - Yields of purified recombinant endolysin OBPgpLYS and its PK-modified PKOBPgpLYS derivative per liter of E. coli expression culture.

[0182] To determine the anti-Gram-negative spectrum of PKOBPgpLYS en-dolisin according to SEQ ID NO: 61, a combination of 1.313 μM PK OB-PgpLYS endolysin and 0.5 mM EDTA was tested on the strain of P. aeruginosa Br667 multiresistant clinic, Pseudomonas putida G1 (phage host OBP) and a range of other Gram-negative pathogens (Escherichia coli WK6, Salmonella typhimurium LT2 and Burkholderia pseudomallei) (see Table 16). Exponentially growing bacterial cells (OD 600nm 0.6) were diluted 100 times to a final density of approximately 106 µg / ml of each strain and incubated for 30 minutes at room temperature without shaking with unmodified endolysin OBPgpLYS (SEQ ID NO: 7) and modified endolysin PKOBPgpLYS (SEQ ID NO: 61) each in combination with and without 0.5 mM EDTA. For the incubation, the endolysins were each used in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole) and the incubation occurred at a final endolysin concentration of 1.313 μM . As a control, each strain was also incubated for 30 minutes with 0.5 mM EDTA (in the same buffer as described above), but without endolysin. After incubation, cell suspensions were diluted three times (105-104-103 cells / mL respectively) and 100 μL of each dilution was plated in LB medium. Residual colonies were counted after an overnight incubation at 37 ° C. Based on the number of cells counted, antibacterial activity in the form of relative inactivation in logarithmic units (= log10N0 / Ni with N0 = number of untreated cells and Ni = number of treated cells, both counted after incubation) was calculated (Table 15 ). All samples were repeated three times. Standard +/- standard deviations are represented. The maximum reduction observed is dependent on the level of detection of 10 cells / mL and the initial cell density.
[0183] Table 15 - Antibacterial activity of unmodified endolysin (OBPgpLYS) and its modified endolysin variant (PKOBPgpLYS) with and without EDTA-Na2 on Gram-negative species in different exponential growth.

Table 16 - List of Gram-negative strains used
* Pirnay JP, De Vos D, Cochez C, Bilocq F, Pirson J, StruelensM, Duinslaeger L, Cornelis P, Zizi M, Vanderkelen A. (2003). Molecular epidemiology of Pseudomonas aeruginosa colonization in a burn unit: persistence of a multidrug-resistant clone and a silver sulfadiazine-resistant clone. J Clin Microbiol., 41 (3): 1192-1202.
[0184] Although the overall efficacy of the treatment with OBPgpLYS is dependent on the species, the results in Table 16 show an addictive effect of PKOBPgpLYS compared with the unmodified OBPgpLYS for all species of bacteria tested, both in the absence and in the presence of 0.5 mM EDTA. For the species of Pseudomonas and Burkholderia, an evident synergistic effect with EDTA is observed for PKOBPgpLYS activity.
[0185] EXAMPLE 8: Effect of different EDTA concentration on the antibacterial activity of OBPgpLYS and PKOBPgpLYS
[0186] To determine the influence of EDTA on the antibacterial activity of unmodified and modified endolysins, the antibacterial activity of unmodified OBPgpLYS endolysin (SEQ ID NO: 7) and PKOBPgpLYS endolysin (SEQ ID NO: 61) was tested on cells of Pseudomonas aeruginosa PAO1p (Pirnay JP and others J Clin Microbiol., 41 (3): 1192-1202 (2003)) using different concentrations of EDTA and endolysins. Exponentially growing bacterial cells (OD 600nm 0.6) were diluted 100 times to a final density of approximately 106 µg / ml and incubated for 30 minutes at room temperature without shaking with unmodified endolysin OBPgpLYS (SEQ ID NO: 7) and modified PKOBPgpLYS endolysin (SEQ ID NO: 61). For incubation, endolysins were used each in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole) at final concentrations of 0.013 μM, 0.131 μM endolysin and 1,315 μM. Thus, the following different EDTA concentrations were used: 0 mM, 0.05 mM, 0.5 mM of 10 mM E. As a control a sample was also incubated for 30 minutes without endolysin, instead it had buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole) added. After incubation, cell suspensions were diluted three times (105-104-103 cells / mL respectively) and 100 μL of each dilution was plated on LB medium. Residual colonies were counted after an overnight incubation at 37 ° C. Based on the number of cells counted, antibacterial activity in the form of relative inactivation in log units (= log10N0 / Ni with N0 = number of untreated cells and Ni = number of treated cells, both counted after incubation) was calculated ( Table 17). All samples were repeated three times. The means +/- standard deviations are represented. The maximum observed reduction (5.69 log units) is dependent on the level of detection of 10 cells / mL and the initial cell density. "Δ" provides the difference in activity between the respective samples of OBPgpLYS and PKOBPgpLYS. Table 17 - Unmodified endolysin antibacterial activity (OBPg-pLYS) and its modified endolysin variant (PKOBPgpLYS) in combination with different concentrations of EDTA on cells of Pseudomonas aeruginosaPAO1p in exponential growth

[0187] As shown in Table 17, the unmodified OBPgpLYS endolysin significantly reduces cell numbers with more than 2.5 log units to 1.315 μM and with +/- 1 log unit to 0.013 μM, compared to the control negative. The modified endolysin PKOBPgpLYS results in a reduction of 0.5 log unit added for PAO1p cells with exponential growth. The observed antibacterial effect can be increased to more than a reduction of 5.69 log units (below the detection level) by combining PKO-BPgpLYS with the external membrane permeabilizer EDTA-Na2 at a concentration of 0, 5 and 10 mM EDTA. The difference in activity between the unmodified OBPgpLYS and the PK modified OBPgpLYS increases by increasing the amount of added endolysin (from 0.013 - 1.315 μM of endolysin). EXAMPLE 9: Antibacterial activity of modified phiKZgp144 variants on different Gram-negative bacteria
[0188] To test and to compare the potential of variant polycationic peptides of phiKZgp144 and other endolysins, encoding genes that have polycationic peptides at the N-terminal end of the protein were synthesized.
[0189] The different products were cloned into the expression vector pET32b (Novagen, Darmstadt, Germany). pET32b was used to reduce the potential toxicity of the polycationic peptide against the E. coli host. A fusion protein encoded by the vector (thioredoxin), masks the polycationic peptide and can be eliminated during the purification process.
[0190] The genes encoding smi01 (YP_001712536) and KRK9_smi01 (SEQ ID NO: 75) have been fully synthesized (Entelechon, Regensburg, Germany) and cloned into pET32b.
[0191] Consequently, the following modified endolysin variants were expressed in E. coli BL21 (DE3) cells at 37 ° C until an optical density of DO600nm = 0.6 is reached: smi01 (YP_001712536), KRK9_smi01 (SEQ ID NO: 75), phiKZgp144 (SEQ ID NO: 1), pKKZ144pET32b (SEQ ID NO: 43) and POLIKZ144 (SEQ ID NO: 35). Protein expression was induced with 1 mM IPTG (final concentration) and the expression was carried out for four hours. Then E.coli cells were collected by centrifugation for 20 min at 6000g and cell disruption and protein purification were performed using the S-Tag ™ rEK Purification Kit (Novagen, Darmstadt, Germany). Using the vector pET32b, the expressed proteins were non-toxic to the host resulting in high yields of produced protein. Purified stock solutions exhibited high purity.
[0192] For the test and as a reference for comparison phiKZgp144 and PO-LIgp144 were synthesized and purified as described in EXAMPLE 1.
[0193] Exponentially growing cells (~ 106 / mL) of P. aeruginosa PAO1p (Isolated from burn injury, Queen Astrid Hospital, Bru-xelas; Pirnay JP et al. (2003), J Clin Microbiol., 41 (3 ): 1192-1202), Acinetobacter baumannii (DSMZ 30007) or Burkholderia solanaceum (Isolated provided by Prof. C. Michiels) were diluted 100 x (the final density was ~ 106 / mL) incubated at room temperature with every 10 μg of non-dialysed proteins that are listed previously at a final concentration of 100 μg / mL in buffer (20 mM NaH2PO4-NaOH pH7.4; 0.5 M NaCl; 0.5 M imidazole). After 1 hour, the cell suspensions were diluted 1: 100 and plated on LB. In addition, a negative control was plated using buffer (20 mM NaH2PO4-NaOH pH 7.4; 0.5 M NaCl; 0.5 M imidazole). Residual colonies were counted after an overnight incubation at 37 ° C. Based on the number of cells counted, antibacterial activity in the form of relative inactivation (%) (= 100- (Ni / No) * 100 with N0 = number of untreated cells and Ni = number of treated cells) was calculated (Table 18 ). All samples were repeated at least four times. Table 18 - Antibacterial effect of different modified endolysin variants (NCBI numbers in parentheses) on different bacterial species

[0194] The unmodified endolysins phiKZgp144 and smi01 (YP_001712536) do not significantly reduce cell numbers compared to the negative control. This observation again illustrates the efficacy of the outer membrane as a barrier for endolysin to degrade the cell wall of Gram-negative bacteria. In contrast, as shown in Table 18, incubation with the modified endolysins KRK9_smi01, pKKZ144pET32b and POLY-gp144 causes a significant reduction in the number of bacterial cells on Acinetobacter baumannii (50% for KRK_smi01; 99.9% for pKKZ144pET32b), Pseudomonas aeruginosa , 9% for pKKZ144pET32b) and Burkholderia solanaceum (90 - 99.9% for POLIKZ144).
[0195] These experiments demonstrate the applicability of the cationic / polycationic fusion approach to other endolysins. In addition, experiments have shown that modified endolysins are active on a variety of bacteria. EXAMPLE 10: Reduction of Pseudomonas aeruginosa biofilm
[0196] In the present experiment the antimicrobial activity of the modified endolysin variants SMAP29-KZ144 and PK-OBP, the endolysins OBP and KZ144 and the peptide PK was tested against the biofilm of strains 2572 and 2573 of Pseudomonas aeruginosa.
[0197] The biofilm reduction was quantified using a crystal viola-assay (Peeters et al., J Microbiol Methods 72: 157-165 (2008)). Biofilm formation:
[0198] Liquid cultures performed overnight of a mucoid strain of Pseudomonas aeruginosa 2572 (isolated from the patient), Pseudomonas aeruginosa 2573 and a non-mucoid E. coli BL21 (DE3) were diluted to DO600 = 0.1. A 96-well polystyrene plate was inoculated with 100 μL of culture / well. After incubation for 4 h at 37 ° C, the supernatant was discarded and the adherent bacteria were washed using 100 μL of physiological saline solution (PS). The inoculated wells were filled with 100 μL of liquid LB medium and incubated for an additional 24 h. After discarding the supernatant, the developed biofilm was washed again with 100 μL of PS. Biofilm treatment:
[0199] The biofilm was treated using 50 μg / well of PKKZ144 or 20 μg / well of alginate lyase or 50 μg / well of SMAP29-KZ144 and KZ144 or 25 μg / well of PK-OBP and OBP or 1.25 μg of PK peptide (all in buffer with 500mM NaCl) diluted one part to a part of 2x LB medium (without NaCl) and incubated for 12 h. The untreated series was performed as negative controls (one part of protein buffer to one part of 2x LB without NaCl). After discarding the supernatant, the developed biofilm was washed again with 100 μL of PS. Biofilm quantification:
[0200] The washed biofilm was fixed with 300 μL of methanol (99%; 15 min) and air dried. Staining was performed using 100 μL of 0.3% violet crystal. After 20 min, the wells were washed with tap water and 300 μL of 33% acetic acid was used by dissolving the bound violet crystal from the extracellular matrix of the bio-film. After 20 min a 1:10 dilution was made and the absorption (590 nm) was measured.
[0201] The statistical analysis showed a massive reduction in the biofilm detected using PKKZ144 compared with inoculants treated or untreated with alginate lyase. Using PKKZ144 it was possible to reduce the biofilm to the level of a non-mucoid E. coli laboratory strain.
[0202] The modified endolysin variants SMAP29-KZ144 and PK-OBP also exhibited a massive reduction in the biofilm of Pseudomonas aeruginosa compared with the endolysins OBP and KZ144. In contrast, the PK peptide appeared to increase the formation of the biofilm of Pseudomonas aeruginosa. EXAMPLE 11: Acinetobacter baumannii 'biofilm reduction
[0203] In the present experiment the antimicrobial activity of the modified endolysin variant PK-OBP, the endolysin OBP and the peptide PK was tested against the biofilm of the DSMZ30007 strain of Acinetobacter baumannii.
[0204] The reduction in biofilm was quantified using a viola-ta crystal assay (Peeters et al., J Microbiol Methods 72: 157-165 (2008)).
[0205] Biofilm formation, treatment and quantification were performed as described in Example 10.
[0206] The modified endolysin variant PK-OBP exhibited a massive reduction in the biofilm of Acinetobacter baumannii compared to endolysin OBP. In contrast, the PK peptide appeared to increase the formation of the biofilm of Acinetobacter baumannii. EXAMPLE 12: Reduction of Staphylococcus aureus biofilm
[0207] In the present experiment, the antimicrobial activity of the Ply2638-PK and PK-Lysostafine fusion proteins, the Lysostafin and Ply2638 enzymes and the PK peptide was tested against the Staphylococcus aureus strain KS13 biofilm.
[0208] The reduction of biofilm was quantified using a viola-ta crystal assay (Peeters et al., J Microbiol Methods 72: 157-165 (2008)).
[0209] Biofilm formation, treatment and quantification were performed as described in Example 10. Except for the fact that biofilm treatment, 25 μg / well of Ply2638A-PK and Ply2638A or 18 μg / well of PK-Lysostafine and Lysosta-fine or 1.25 μg PK peptide was used.
[0210] The fusion proteins PK-Lysostaffin and PK-Ply2638 exhibited a massive reduction in the biofilm of Staphylococcus aureus compared with the enzymes Lysosthafine and Ply2638. In contrast, the PK peptide appeared to increase the formation of the Staphylococcus aureus biofilm. EXAMPLE 13: Reduction of Listeria monocytogenes biofilm
[0211] In the present experiment, the antimicrobial activity of the modified endolysin variant Pentapeptide-Ply511 was tested against the biofilm of the ScottA strain of Listeria monocytogenes.
[0212] The biofilm reduction was quantified using a crystal viola-assay (Peeters et al., J Microbiol Methods 72: 157-165 (2008)).
[0213] Biofilm formation, treatment and quantification were performed as described in Example 10. Except for the treatment of the bio-film, 25 μg / well of Pentapeptide-Ply511 was used.
[0214] The modified endolysin variant PK-Ply511 exhibited a massive reduction in the biofilm of Listeria monocytogenes.

权利要求:
Claims (16)
[0001]
1. Method for eliminating or reducing a bacterial biofilm CHARACTERIZED by the fact that it comprises: a) providing a fusion protein comprising an endolysin or bacteriocin to which a peptide with membrane-breaking or LPS activity is fused; and b) bringing a material, liquid, surface or biological material into contact with said fusion protein, in which the method is not a method for treating the human or animal body by surgery or therapy, in which said endolysin or bacteriocin has the activity of degrading the cell wall of Gram-negative bacteria, and in which Gram-negative bacteria are selected from the group consisting of Enterobacteriaceae, Pseudomonadaceae and Acinetobacter, and / or in which said endolysin or bacteriocin has the activity of degrading the wall cell of Gram-positive bacteria and in which Gram-positive bacteria are selected from the group consisting of Listeriaceae and Staphylococcaceae, in which said endolysin is selected from the group consisting of phiKZgp144 according to SEQ ID NO: 1, ELgp188 of according to SEQ ID NO: 2, Salmonella endolysin according to SEQ ID NO: 3, enterobacterial phage T4 endolysin according to SEQ ID NO: 4, steel Acinetobacter baumannii endolysin According to SEQ ID NO: 5, E.coli Phage K1F endolysin according to SEQ ID NO: 6, OBPgpLys according to SEQ ID NO: 7, PSP3 salmonella endolysin according to SEQ ID NO: 8, E.coli Phage P2 endolysin according to SEQ ID NO: 9, Ply511 according to SEQ ID NO: 85, Ply2638 according to SEQ ID NO: 92 or in which said bacteriocin is in agreement with SEQ ID NO: 87; and in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 10 to 30 and 32 to 34, or in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NO: 93 to 133, or where the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 134 and 135; or wherein the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 136 to 138.
[0002]
2. Method, according to claim 1, CHARACTERIZED by the fact that said peptide is fused to the N and / or C-terminal of endolysin.
[0003]
3. Method according to claim 1 or 2, CHARACTERIZED by the fact that the cell wall of Gram-negative bacteria is selected from the group consisting of Escherichia, Salmonella, Shigella, Citrobacter, Edwardsiella, Enterobacter, Hafnia, Klebsiella, Morganella , Proteus, Providencia, Serratia, Yersinia, Pseudomonas, Burkholderia, Stenotrophomonas, Shewanella, Sphingomonas, Comamonas, A. baumannii and in which Gram-positive bacteria are selected from the group consisting of Listeria monocytogenes and Staphylococcus aureus.
[0004]
4. Method, according to claim 3, CHARACTERIZED by the fact that the cell wall of Gram-negative bacteria is selected from the group consisting of E. coli, K. pneumoniae, P. aeruginosa and A. baumannii.
[0005]
5. Method according to any one of claims 1 to 4, CHARACTERIZED by the fact that said variant of endolysin or bacteriocin variant comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 35 to 49, 53, 57, 62 to 64, 66 to 78 and 139 to 142.
[0006]
6. Method according to any one of claims 1 to 5, CHARACTERIZED by the fact that the material in contact with the fusion protein is a stone, rock, soil, sediment, food, feed or cosmetics.
[0007]
Method according to any one of claims 1 to 6, CHARACTERIZED by the fact that the liquid in contact with the fusion protein is water.
[0008]
8. Method according to claim 6, CHARACTERIZED by the fact that the water is potable water, groundwater or sewage, thermal spring, sea, lake, river, any type of aqueous system, cleaning and storage solutions contact lenses, dentures, implants, prostheses or dental appliances.
[0009]
9. Method according to any one of claims 1 to 8, CHARACTERIZED by the fact that the liquid in contact with the fusion protein is any substance derived or obtained from a living organism.
[0010]
10. Method according to any one of claims 1 to 9, CHARACTERIZED by the fact that the liquid in contact with the fusion protein is selected from the group consisting of a surface: medical devices, industrial water system piping or drinking water and natural aquatic systems.
[0011]
11. Method according to any one of claims 1 to 10, CHARACTERIZED by the fact that antibiotics can be added in combination or in addition to the fusion protein.
[0012]
12. Endolysin variant or bacteriocin variant CHARACTERIZED by the fact that it comprises an endolysin or a bacteriocin to which a peptide with membrane-breaking or LPS activity is fused for use as a medicine for the treatment of Gram-positive bacteria infections and / or Gram-negatives associated with bacterial biofilm, in which the bacterial biofilm is formed by bacterial microorganisms, in which said endolysin is selected from the group consisting of phiKZgp144 according to SEQ ID NO: 1, ELgp188 according to with SEQ ID NO: 2, Salmonella endolysin according to SEQ ID NO: 3, enterobacterial phage T4 endolysin according to SEQ ID NO: 4, Acinetobacter baumannii endolysin according to SEQ ID NO: 5 , E.coli Phage K1F endolysin according to SEQ ID NO: 6, OBPgpLys according to SEQ ID NO: 7, salmonella PSP3 endolysin according to SEQ ID NO: 8, E Phage P2 endolysin .coli according to SEQ ID NO: 9, Ply511 according with SEQ ID NO: 85, Ply2638 according to SEQ ID NO: 92 or wherein said bacteriocin is in accordance with SEQ ID NO: 87; and in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 10 to 30 and 32 to 34, or in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NO: 93 to 133, or where the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 134 and 135; or wherein the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 136 to 138.
[0013]
13. Endolysin variant or bacteriocin variant according to claim 12, CHARACTERIZED by the fact that the endolysin variant or the bacteriocin variant is used in combination or in addition to antibiotics.
[0014]
14.Use of an endolysin variant or a bacteriocin variant comprising an endolysin or a bacteriocin to which a peptide with membrane-breaking or LPS activity is fused, CHARACTERIZED by the fact that it is for the removal and / or reduction of contamination by Gram-negative and / or Gram-positive bacteria associated with the bacterial biofilm of food material, of food processing equipment, of food processing plants, of surfaces that come into contact with food material, of medical devices, of surfaces in hospitals or surgery, where the bacterial biofilm is formed by bacterial microorganisms, in which said endolysin is selected from the group consisting of phiKZgp144 according to SEQ ID NO: 1, ELgp188 according to SEQ ID NO: 2, Salmonella endolysin according to SEQ ID NO: 3, enterobacterial phage T4 endolysin according to SEQ ID NO: 4, Acinetobacter baumannii endolysin according to SEQ I D NO: 5, E.coli Phage K1F endolysin according to SEQ ID NO: 6, OBPgpLys according to SEQ ID NO: 7, PSP3 salmonella endolysin according to SEQ ID NO: 8, endolysin of E.coli P2 phage according to SEQ ID NO: 9, Ply511 according to SEQ ID NO: 85, Ply2638 according to SEQ ID NO: 92 or in which said bacteriocin complies with SEQ ID NO: 87; and in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 10 to 30 and 32 to 34, or in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NO: 93 to 133, or where the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 134 and 135; or wherein the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 136 to 138.
[0015]
15. Use of an endolysin variant or a bacteriocin variant comprising an endolysin or a bacteriocin to which a peptide with membrane-disrupting or LPS activity is fused, CHARACTERIZED by the fact that it is as a means of diagnosis in diagnoses of food or feed or environmental bacterial infection associated with bacterial biofilm, as a means of diagnosis in in vitro medical diagnoses of bacterial infection associated with bacterial biofilm, or as a disinfectant or cosmetic substance, in which said endolysin is selected from the group consisting of phiKZgp144 according to SEQ ID NO: 1, ELgp188 according to SEQ ID NO: 2, Salmonella endolysin according to SEQ ID NO: 3, enterobacterial phage T4 endolysin according to SEQ ID NO: 4 , Acinetobacter baumannii endolysin according to SEQ ID NO: 5, E.coli Phage K1F endolysin according to SEQ ID NO: 6, OBPgpLys according to SEQ ID NO: 7, PSP3 salmonella endolysin according to SEQ ID NO: 8, E.coli Phage P2 endolysin according to SEQ ID NO: 9, Ply511 according to SEQ ID NO: 85, Ply2638 according to SEQ ID NO: 92 or wherein said bacteriocin is in accordance with SEQ ID NO: 87; and in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 10 to 30 and 32 to 34, or in which the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NO: 93 to 133, or where the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 134 and 135; or wherein the peptide exhibits an amino acid sequence selected from the group consisting of SEQ ID NOs: 136 to 138.
[0016]
16. Use according to claim 14 or 15, CHARACTERIZED by the fact that the variant of endolysin or the variant of bacteriocin is used in combination or in addition to antibiotics.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10485854B2|2019-11-26|Method of reducing biofilms

---

AU2016202296B2|2017-12-21|Antimicrobial Agents

---

ES2395357T3|2013-02-12|Antimicrobial agents

---

AU2011347152B2|2016-08-04|Antimicrobial agents

同族专利:

---

公开号 | 公开日

---

US20130052182A1|2013-02-28|

---

HK1183687A1|2014-01-03|

---

EP2563916B1|2015-07-08|

---

US20170173121A1|2017-06-22|

---

EP2563916A1|2013-03-06|

---

JP2013532955A|2013-08-22|

---

CN103119158A|2013-05-22|

---

KR20130100062A|2013-09-09|

---

JP2016208985A|2016-12-15|

---

CA2794603C|2019-05-21|

---

TWI527521B|2016-04-01|

---

IL222713A|2017-08-31|

---

US9534223B2|2017-01-03|

---

EA201270774A1|2013-04-30|

---

AU2011247584A1|2012-10-11|

---

US10485854B2|2019-11-26|

---

CA2794603A1|2011-11-03|

---

BR112012026880A2|2015-09-22|

---

AU2011247584B2|2016-01-14|

---

TW201204262A|2012-02-01|

---

MX2012012345A|2013-05-20|

---

CN103119158B|2015-04-08|

---

IL222713D0|2012-12-31|

---

DK2563916T3|2015-10-05|

---

SG184836A1|2012-11-29|

---

WO2011134998A1|2011-11-03|

---

EA037276B1|2021-03-03|

---

WO2011134998A8|2011-12-15|

---

MX340520B|2016-07-12|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

GB8816693D0|1988-07-13|1988-08-17|Agricultural & Food Res|Viral enzyme & gene|

---

US20020037260A1|1997-10-16|2002-03-28|Budny John A.|Compositions for treating biofilm|

---

CN101511382B|2006-09-06|2013-11-13|加利福尼亚大学董事会|Selectively targeted antimicrobial peptides and the use thereof|

---

MX2010003328A|2007-09-25|2010-08-16|Pastoral Greenhouse Gas Res Lt|Cell-permeabilising peptides and polypeptides for microbial cells.|

---

GB0815484D0|2008-08-26|2008-10-01|Univ Leuven Kath|Antibacterial agents|

---

GB0905451D0|2009-03-31|2009-05-13|Novabiotics Ltd|Biofilms|

---

EP2445515B1|2009-06-26|2016-04-06|Katholieke Universiteit Leuven, K.U. Leuven R&D|Antimicrobial agents|

---

DK2563916T3|2010-04-27|2015-10-05|Lysando Ag|METHOD FOR REDUCING biofilms|GB0815484D0|2008-08-26|2008-10-01|Univ Leuven Kath|Antibacterial agents|

---

EP2445515B1|2009-06-26|2016-04-06|Katholieke Universiteit Leuven, K.U. Leuven R&D|Antimicrobial agents|

---

BRPI1015203B1|2009-06-26|2021-06-01|Lysando Ag|FUSION PROTEIN COMPOSED OF AN ENDOLYSIN AND AN EXTENSION OF AMPHIPHATIC PEPTIDE, USES OF THE SAME AND PHARMACEUTICAL COMPOSITION INCLUDING SUCH PROTEIN|

---

CN102575240B|2009-08-24|2016-01-13|勒芬天主教大学，K.U.勒芬R&D|new endolysin OBPgpLYS|

---

DK2563916T3|2010-04-27|2015-10-05|Lysando Ag|METHOD FOR REDUCING biofilms|

---

EP2468856A1|2010-12-23|2012-06-27|Lysando Aktiengesellschaft|Antimicrobial Agents|

---

DK2705144T4|2011-05-04|2019-10-21|Micreos Human Health Bv|POLYPEPTIDE|

---

MX344635B|2012-03-23|2017-01-04|Amicrobe Inc|Compositions and uses of antimicrobial materials with tissue-compatible properties.|

---

EP3513807A1|2012-05-09|2019-07-24|Contrafect Corporation|Biofilm prevention, disruption and treatment with bacteriophase lysin|

---

WO2014001571A1|2012-06-29|2014-01-03|Lysando Ag|Composition for use in mycobacteria diagnosis|

---

EP2679677A1|2012-06-29|2014-01-01|Lysando Aktiengesellschaft|Composition for use in Mycobacteria therapy|

---

CN102949750B|2012-11-15|2014-11-05|中国人民解放军第三军医大学|Double-layer electrospinning bionic periosteum and method for preparing same|

---

DE102013106455A1|2013-06-20|2014-12-24|Airbus Defence and Space GmbH|Method for decontamination of bacteriological contaminants|

---

US10203329B2|2013-09-12|2019-02-12|The Johns Hopkins University|Biofilm formation to define risk for colon cancer|

---

WO2015070911A1|2013-11-14|2015-05-21|Lysando Ag|Modified kz144 endolysin sequence|

---

WO2015070912A1|2013-11-14|2015-05-21|Lysando Ag|Modified el188 endolysin sequence|

---

US10329550B2|2014-02-14|2019-06-25|Lysando Ag|Antimicrobial agents|

---

WO2015155244A1|2014-04-08|2015-10-15|Lysando Ag|Pharmaceutical composition against chronic bacterial infections|

---

ES2767294T3|2014-06-26|2020-06-17|Univ Rockefeller|Acinetobacter lysines|

---

WO2016130024A1|2015-02-13|2016-08-18|Supreme Biotechnologies Limited|Endolysin expression platform|

---

TW201710282A|2015-09-04|2017-03-16|佛教慈濟醫療財團法人|Novel antimicrobial peptides derived from phage of Acinetobacter baumannii and use thereof|

---

US11246819B2|2016-05-12|2022-02-15|The Trustees Of The University Of Pennsylvania|Compositions and methods for inhibiting biofilm deposition and production|

---

CN106854247A|2016-12-12|2017-06-16|华南农业大学|A kind of preparation method of the bacterial virus catenase that can crack Escherichia coli and salmonella|

---

EP3555121B1|2016-12-16|2021-09-22|Universidade do Minho|Novel endolysin|

---

EP3378485A1|2017-03-24|2018-09-26|Nomad Bioscience GmbH|Bacteriocins for control of salmonella enterica|

---

US20200263221A1|2017-08-31|2020-08-20|Syngulon Sa|Methods and compositions for making bacteriocins and antimicrobial peptides|

---

CN107723280B|2017-11-10|2019-09-17|扬州大学|Baltic Sea Shewanella bacteriophage SppYZU01 and application thereof|

---

EP3723789A4|2017-12-12|2021-12-01|Contrafect Corporation|Identification of lysins and derivatives thereof with bacterial activity against pseudomonas aeruginosa|

---

CN108251330B|2017-12-28|2021-03-23|江苏世邦生物工程科技有限公司|Compound microbial agent for treating soil pollution and preparation method and application thereof|

---

US20210198645A1|2018-05-30|2021-07-01|Lysando Ag|Novel antimicrobial fusion proteins|

---

EP3802814A1|2018-05-30|2021-04-14|Lysando AG|Novel antimicrobial proteins|

---

AU2020276206A1|2019-05-10|2021-12-02|Locus Ip Company, Llc|Compositions and methods for treating biofilm-related lung conditions|

---

WO2021185948A1|2020-03-19|2021-09-23|Micreos Human Health B.V.|A stabilized protein of interest|

法律状态:
2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according art. 34 industrial property law|

---

2019-06-04| B07D| Technical examination (opinion) related to article 229 of industrial property law|

---

2019-12-17| B07E| Notice of approval relating to section 229 industrial property law|

---

2020-02-04| B06U| Preliminary requirement: requests with searches performed by other patent offices: suspension of the patent application procedure|

---

2020-09-01| B06A| Notification to applicant to reply to the report for non-patentability or inadequacy of the application according art. 36 industrial patent law|

---

2021-02-02| B09A| Decision: intention to grant|

---

2021-03-16| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 27/04/2011, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

EP10161170.5|2010-04-27|

---

EP10161170|2010-04-27|

---

PCT/EP2011/056657|WO2011134998A1|2010-04-27|2011-04-27|Method of reducing biofilms|

---