method and kit for detecting a target nucleic acid sequence of a dna or a mixture of nucleic acids u

专利摘要:
METHOD AND KIT TO DETECT TARGET NUCLEIC ACID SEQUENCE FROM A DNA OR A NUCLEIC ACID MIXTURE THROUGH A PTOCE TEST. The present invention relates to the detection of a target nucleic acid sequence through a PTOCE assay (Cleavage and Extension with PTO). The present invention detects a target nucleic acid sequence in which the PTO (Probe and Mark Oligonucleotide) hybridizes to the target nucleic acid sequence is cleaved to release a fragment and the fragment is hybridized to the CTO (Capture and Mold Oligonucleotide) to form an extended duplex, followed by detecting the presence of the extended duplex. The extended duplex provides signals (generation, increase, extinction or decrease of signals) starting from the markings that indicate the presence of the extended duplex and has an adjustable Tm value, which are well adopted for detecting the presence of the target nucleic acid sequence.
公开号:BR112012026221B1
申请号:R112012026221-1
申请日:2012-01-11
公开日:2021-03-02
发明作者:Jong Yoo Chun；Young Jo Lee
申请人:Seegene, Inc；
IPC主号:

专利说明:

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION
[0001] The present invention relates to the detection of a target nucleic acid sequence by a PTOCE assay (PTO Cleavage and Extension). DESCRIPTION OF RELATED ART
[0002] DNA hybridization is a fundamental process in molecular biology and is affected by ionic strength, the composition of bases, the length of fragment to which the nucleic acid has been reduced, the degree of mismatch and the presence of denaturing agents . Technologies based on DNA hybridization would be a very useful tool in determining specific nucleic acid sequences and would clearly be valuable in clinical diagnosis, genetic research and forensic laboratory analysis.
[0003] However, conventional methods and processes that rely mainly on hybridization are very likely to produce false positive results due to non-specific hybridization between probes and non-target sequences. Therefore, problems remain that must be resolved to improve its reliability.
[0004] In addition to the probe hybridization processes, several approaches using additional enzymatic reactions, for example, the TaqManTM probe method, have been suggested.
[0005] In the TaqManTM probe method, the labeled probe hybridized to a target nucleic acid sequence is cleaved by a 5 'nuclease activity of an upstream primer-dependent DNA polymerase, generating a signal that indicates the presence of a target sequence (US Pat. Nos. 5,210,015. 5,538,848 and 6,326,145). The TaqManTM probe method suggests two approaches to signal production: polymerization-dependent cleavage and polymerization-independent cleavage. In the pending polymerization cleavage, the extension of the upstream primer must occur before a nucleic acid polymerase encounters the 5 'end of the labeled probe. As the extension reaction continues, the polymerase progressively cleaves the 5 'end of the labeled probe. In the independent polymerization cleavage, the upstream primer and the labeled probe are hybridized to a target nucleic acid sequence in close proximity so that the binding of the nucleic acid polymerase to the 3 'end of the upstream primer at puts it in contact with the 5 'end of the marked probe to release the marking. In addition, the TaqManTM probe method discloses that the probe labeled at its 5 'end which has a 5' tail region that cannot be hybridized to a target sequence is also cleaved to form a fragment comprising the region 5 'tail.
[0006] Some methods have been reported in which a probe having a 5 'tail region not complementary to a target sequence is cleaved by 5' nuclease to release a fragment comprising the 5 'tail region.
[0007] For example, Pat. No. 5,691,142 discloses a cleavage structure that will be digested by the 5 'nuclease activity of DNA polymerase. A cleavage structure is exemplified in which an oligonucleotide comprising a 5 'non-complementary portion and a 3' non-complementary portion to a template is hybridized to the template and an upstream oligonucleotide is hybridized to the template in close proximity. The cleavage structure is cleaved by DNA polymerase which has 5 'nuclease activity or modified DNA polymerase with reduced synthesis activity to release the 5' portion not complementary to the mold. The released 5 'portion is then hybridized to an oligonucleotide that has a hairpin structure to form a cleavage structure, thereby inducing progressive cleavage reactions to detect a target sequence.
[0008] Pat. US No. 7,381,532 discloses a process in which the cleavage structure that has the upstream 3 'end capped oligonucleotide is cleaved by DNA polymerase that has 5' nuclease activity or FEN nuclease to release the 5 flap region 'non-complementary and the flap region at 5' released is detected through size analysis or interactive dual marking. U.S. Pat. No. 6,893,819 discloses that detectable released flaps are produced by a flap-mediated sequential amplification method dependent on nucleic acid synthesis. In this method, a flap released starting from a first cleavage structure cleaves, in a manner dependent on nucleic acid synthesis, a second cleavage structure to release a flap from the second cleavage structure and the flaps released are detected.
[0009] By hybridizing fluorescently labeled probes to a liquid phase, a large number of target nucleic acid sequences can be simultaneously detected using even a single type of fluorescent labeling through melt curve analysis. However, conventional technologies for detecting target sequences through 5 'nuclease-mediated cleavage of labeled interactive dual probes require different types of fluorescent tags for different target sequences in multiplex target detection, which limits the number of target sequences that will be detected due to the limited number of types of fluorescent tags.
[00010] US Patent Application Pub 2008-0241838 discloses a method of target detection using cleavage of a probe that has a 5 'non-complementary portion to a target nucleic acid sequence and hybridization of a capture probe. A marking is positioned on the 5 'non-complementary portion. The labeled probe hybridized to the target sequence is cleaved to release a fragment, after which the fragment is then hybridized to the capture probe to detect the presence of the target sequence. In this method, it is necessary that an uncleaved / intact probe is not hybridized with the capture probe. For this, the capture probe that has a shorter length has to be immobilized on a solid substrate. However, such a limitation results in less hybridization efficiency on a solid substrate and also difficulties in optimizing reaction conditions.
[00011] Therefore, needs remain long felt in the art of developing new approaches for the detection of a target sequence, preferably several target sequences, in a liquid phase and in a solid phase, not only through hybridization, but also enzymatic reactions such as a 5 'nucleolithic reaction in a more convenient, reliable and reproducible manner. In addition, a new method of target detection not limited by the number of types of markings (particularly, fluorescent markings) is also required in the art.
[00012] Throughout this patent application, several patents and publications are referred to and citations are provided in parentheses. The disclosure of these patents and publications in their entirety is incorporated herein as references within this patent application for the purpose of more fully describing this invention and the state of the art to which this invention is related. SUMMARY OF THE INVENTION
[00013] The present inventors have carried out intensive research for the development of new approaches to detect target sequences with improved accuracy and convenience, inter alia, in a multiplex manner. As a result, the present inventors have established new protocols for the detection of target sequences, in which the detection of the target is performed through the hybridization of probes, the enzymatic cleavage of the probe, the extension and the detection of an extended double-strand . The present protocols are well adopted for liquid phase reactions as well as solid phase reactions and guarantee the detection of several target sequences with improved accuracy and convenience.
[00014] Therefore, it is an objective of this invention to provide a method for the detection of a target nucleic acid sequence starting from a DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension).
[00015] It is another objective of this invention to provide a kit for the detection of a target nucleic acid sequence starting from a DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension).
[00016] Other objectives and advantages of the present invention will become apparent from the detailed description below taken together with the claims and the attached drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[00017] Figure 1 shows the schematic structures of PTO (Probing and Tagging Oligonucleotide (Probing and Marking Oligonucleotide)) and CTO (Capturing and Templating Oligonucleotide (Capture and Molding Oligonucleotide)) used in the Cleavage and Extension test PTO (PTOCE assay). Preferably, the 3 'ends of the PTO and CTO are blocked to prohibit their extension.
[00018] Figure 2 schematically represents the PTOCE assay that comprises fusion analysis. The CTO has a reporter molecule and an extinction molecule in its mold portion.
[00019] Figure 3 schematically represents the PTOCE assay that comprises fusion analysis. The CTO has a reporter molecule in its mold portion. The reporter molecule is required to exhibit different signal strength depending on its presence in a single-stranded or double-stranded form.
[00020] Figure 4 schematically represents the PTOCE assay that comprises fusion analysis. The CTO has an iso-dC residue and a reporter molecule in its mold portion. The iso-dGTP extinguisher is incorporated into the extended double-tape during the extension reaction.
[00021] Figure 5 schematically represents the PTOCE assay that comprises fusion analysis. The PTO has a reporter molecule in its 5 'labeling portion and the CTO has an iso-dC residue in its mold portion. The iso-dGTP extinguisher is incorporated into the extended double-tape during the extension reaction.
[00022] Figure 6 schematically represents the PTOCE assay that comprises fusion analysis. The PTO has a reporter molecule and an extinction molecule in its 5 'labeling portion.
[00023] Figure 7 schematically represents the PTOCE assay that comprises fusion analysis. The PTO has a reporter molecule in its 5 'labeling portion. The reporter molecule is required to exhibit different signal strength depending on its presence in a single-stranded or double-stranded form.
[00024] Figure 8 schematically represents the PTOCE assay that comprises fusion analysis. The PTO has an extinction molecule in its 5 'labeling portion and the CTO has a reporter molecule in its capture portion.
[00025] Figure 9 schematically represents the PTOCE assay which comprises detection at a predetermined temperature. The CTO has a reporter molecule and an extinction molecule in its mold portion. The CTO is immobilized on a solid substrate through its 3 'end.
[00026] Figure 10 schematically represents the PTOCE assay which comprises detection at a predetermined temperature. A reporter-tagged dATP is incorporated into the extended double-tape during the extension reaction. The CTO is immobilized on a solid substrate through its 3 'end.
[00027] Figure 11 schematically represents the PTOCE assay which comprises detection at a predetermined temperature. The CTO has an iso-dC residue in its mold portion and a reporter-iso-dGTP is incorporated into the extended double-tape during the extension reaction. The CTO is immobilized on a solid substrate through its 3 'end.
[00028] Figure 12 schematically represents the PTOCE assay which comprises detection at a predetermined temperature. The PTO has a reporter molecule in its 5 'labeling portion. The CTO is immobilized on a solid substrate through its 5 'end.
[00029] Figure 13 schematically represents the PTOCE assay which comprises detection at a predetermined temperature with an intercalating dye. The CTO is immobilized on a solid substrate through its 5 'end.
[00030] Figure 14 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay which comprises the fusion analysis. The CTO has a reporter molecule and an extinction molecule in its mold portion.
[00031] Figure 15 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay which comprises the fusion analysis. The PTO has an extinction molecule at its 5 'end and CTO has a reporter molecule at its 3' end.
[00032] Figure 16 shows the results in which the Tm values of extended doubles are adjusted by CTO sequences.
[00033] Figure 17 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay with amplification by PCR. The CTO has a reporter molecule and an extinction molecule in its mold portion. Figure 17A shows the results of the PTOCE assay which comprises detection with real-time PCR and Figure 17B shows the results of the PTOCE assay which comprises post-PCR fusion analysis.
[00034] Figure 18 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay with amplification by PCR. The CTO has an iso-dC residue and a reporter molecule at its 5 'end. The iso-dGTP extinguisher is incorporated into the extended double-tape during the extension reaction. Figure 18A shows the results of the PTOCE assay which comprises detection with real-time PCR and Figure 18B shows the results of the PTOCE assay which comprises post-PCR fusion analysis.
[00035] Figure 19 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay with amplification by PCR. The PTO has an extinction molecule at its 5 'end and CTO has a reporter molecule at its 3' end. Figure 19A shows the results of the PTOCE assay which comprises detection with real-time PCR and Figure 19B shows the results of the PTOCE assay which comprises post-PCR fusion analysis.
[00036] Figure 20 shows the results of the simultaneous detection of the Neisseria gonorrhoeae (NG) gene and the Staphylococcus aureus (SA) gene through the PTOCE assay comprising post-PCR fusion analysis. The CTO has a reporter molecule and an extinction molecule in its mold portion.
[00037] Figure 21 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay which comprises the analysis of fusion on microarray. The CTO is immobilized through its 5 'end. The PTO has a reporter molecule in its 5 'labeling portion.
[00038] Figure 22 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay which comprises the detection in real time at a predetermined temperature on microarray. The CTO is immobilized through its 5 'end. The PTO has a reporter molecule in its 5 'labeling portion.
[00039] Figure 23 shows the results of the detection of the Neisseria gonorrhoeae gene through the PTOCE assay which comprises the detection in real time at a predetermined temperature on microarray. The CTO is immobilized through its 3 'end and has a reporter molecule and an extinction molecule in its mold portion.
[00040] Figure 24 shows the results of detection with single or multiple targets through the PTOCE assay that comprises detection at the end point at a predetermined temperature on microarray. The CTO is immobilized through its 5 'end. The PTO has a reporter molecule in its 5 'labeling portion. The Neisseria gonorrhoeae (NG) gene and the Staphylococcus aureus (SA) gene were used as the target nucleic acid sequences. DETAILED DESCRIPTION OF THIS INVENTION
[00041] The present invention is directed to a new method for the detection of a target nucleic acid sequence through a PTOCE assay (PTO Cleavage and Extension) and a kit for the detection of a target nucleic acid sequence through a PTOCE assay.
[00042] The present invention involves not only hybridization reactions, but also enzymatic reactions that occur depending on the presence of a target nucleic acid sequence. 1. PTOCE Target Detection Process That Comprises Fusion Analysis
[00043] In one aspect of the present invention, a method is provided for the detection of a target nucleic acid sequence starting from a DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension), which comprises: (a) the hybridization of the target nucleic acid sequence with an upstream oligonucleotide and a PTO (Probe and Mark Oligonucleotide); wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprises (i) a 3 'targeting portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence and (ii) a 5' targeting portion comprising a non-complementary nucleotide sequence the target nucleic acid sequence; wherein the 3 'targeting portion is hybridized to the target nucleic acid sequence and the 5' targeting portion is not hybridized to the target nucleic acid sequence; the upstream oligonucleotide is located upstream of the PTO; (b) contacting the result of step (a) with an enzyme that has 5 'nuclease activity under conditions for PTO cleavage; wherein the upstream oligonucleotide or its extended ribbon induces cleavage of the PTO through the enzyme that has the 5 'nuclease activity so that the cleavage releases a fragment comprising the 5' targeting portion or a part of the targeting 5 'from the PTO; (c) the hybridization of the fragment released from the PTO with a CTO (Capture and Mold Oligonucleotide); wherein the CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a part of the 5' targeting portion of the PTO and (ii) a template portion comprising a nucleotide sequence not complementary to the 5 'targeting portion and the 3' targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; (d) carrying out an extension reaction using the result of step (c) and a template-dependent nucleic acid polymerase; wherein the fragment hybridized to the capture portion of the CTO is extended and an extended double-strand is formed; wherein the extended double-strand has a value of Tm that can be adjusted by (i) a sequence and / or a fragment length, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the length of the fragment and the sequence and / or the length of the CTO; (e) the fusion of the extended double tape over a temperature range to provide a target signal indicative of the presence of the extended double tape; wherein the target signal is provided by (i) at least one tag attached to the fragment and / or the CTO, (ii) a tag embedded within the extended double-tape during the extension reaction, (iii) a tag embedded within the double-tape extended during the extension reaction and a tag attached to the fragment and / or the CTO or (iv) an interleaving tag; and (f) detecting the extended double-tape by measuring the target signal; where the presence of the extended double strand indicates the presence of the target nucleic acid sequence.
[00044] The present inventors have carried out intensive research to develop new approaches to detect target sequences with improved accuracy and convenience, inter alia, in a multiplex manner. As a result, the present inventors have established new protocols for the detection of target sequences, in which the detection of the target is performed through the hybridization of probes, the enzymatic cleavage of the probe, the extension and the detection of an extended double-strand . The present protocols are well adopted for liquid phase reactions as well as solid phase reactions and guarantee the detection of several target sequences with improved accuracy and convenience.
[00045] The present invention employs successive events followed by probe hybridization; cleavage of PTO (Probing and Marking Oligonucleotide) and extension; formation of an extended double-tape depending on the target; and detection of extended double-tape. Therefore, this is called a PTOCE (PTO Cleavage and Extension) assay.
[00046] In the present invention, the extended double strand is characterized as having one (or more) marking (s) providing a signal that indicates the presence of the extended double strand through fusion analysis or through detection at a predetermined temperature . In addition, the extended double-tape is characterized as having an adjustable Tm value, which plays a critical role in the multiple detection of the target or in the discrimination of the non-target signal.
[00047] Since the extended double strand is produced only if the target nucleic acid exists, the presence of the extended double strand indicates the presence of the target nucleic acid.
[00048] The PTOCE assay comprising the fusion analysis will be described in more detail below: Step (a): Hybridization of an upstream oligonucleotide and a PTO with a target nucleic acid sequence
[00049] According to the present invention, a target nucleic acid sequence is first hybridized with an upstream oligonucleotide and a PTO (Probe and Mark Oligonucleotide).
[00050] The term used herein "target nucleic acid", "target nucleic acid sequence" or "target sequence" refers to a nucleic acid sequence of interest for detection, which is annealed to or hybridized with a probe or primer under conditions of hybridization, annealing or amplification.
[00051] The term used herein "probe" refers to a single-stranded nucleic acid molecule comprising a portion or portions that are substantially complementary to a target nucleic acid sequence.
[00052] The term "primer" as used here refers to an oligonucleotide, which is able to act as a starting point for synthesis when placed under conditions where the synthesis of the primer extension product that is complementary to a nucleic acid strand (template) is induced, that is, in the presence of nucleotides and an agent for polymerization, such as DNA polymerase and at an appropriate temperature and pH.
[00053] Preferably, the probe and the primer are single-stranded deoxyribonucleotide molecules. The probes or primers used in this invention can be comprised of naturally occurring dNMP (i.e., dAMP, dGM, dCMP and dTMP), modified nucleotide or unnatural nucleotide. Probes or primers can also include ribonucleotides.
[00054] The initiator must be long enough to initiate the synthesis of extension products in the presence of the polymerization agent. The exact length of the initiators will depend on many factors, including temperature, application and source of the initiator. The term "ringing" or "priming" as used here refers to the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, where the juxtaposition allows the polymerase to polymerize nucleotides into a nucleic acid molecule that is complementary to the nucleic acid template or a portion thereof.
[00055] The term "hybridization" used here refers to the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization can occur between two strands of nucleic acids perfectly matched or substantially matched with some mismatches. Complementarity for hybridization may depend on the hybridization conditions, particularly the temperature.
[00056] Hybridization of a target nucleic acid sequence with the upstream oligonucleotide and the PTO can be performed under suitable hybridization conditions determined routinely through optimization procedures. Conditions such as temperature, component concentration, hybridization and washing times, buffering components and their pH and ionic strength can be varied depending on several factors, including the length and GC content of the oligonucleotide (upstream oligonucleotide and PTO) and the target nucleotide sequence. For example, when a relatively short oligonucleotide is used, it is preferable that low stringency conditions are adopted. Detailed conditions for hybridization can be found in Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).
[00057] There is no desired distinction between the terms "annealing" and "hybridization" and these terms will be used interchangeably.
[00058] The upstream oligonucleotide and PTO have hybridization nucleotide sequences complementary to the target nucleic acid sequence. The term "complementary" is used here to mean that primers or probes are sufficiently complementary to selectively hybridize to a target nucleic acid sequence under the determined ringing conditions or stringent conditions, encompassing the terms "substantially complementary. "and" perfectly complementary ", preferably" perfectly complementary ".
[00059] The 5 'targeting portion of the PTO has a nucleotide sequence not complementary to the target nucleic acid sequence. The mold portion of the CTO (Capture and Mold Oligonucleotide) has a nucleotide sequence not complementary to the 5 'targeting portion and the 3' targeting portion of the PTO. The term "non-complementary" is used here to mean that the primers or probes are sufficiently non-complementary to not selectively hybridize to a target nucleic acid sequence under the determined ringing conditions or stringent conditions. , covering the terms "substantially non-complementary" and "perfectly non-complementary", preferably perfectly non-complementary.
[00060] The term used here "PTO (Probing and Marking Oligonucleotide)" means an oligonucleotide comprising (i) a 3 'targeting portion that serves as a probe and (ii) a 5' targeting portion with a nucleotide sequence not complementary to the target nucleic acid sequence, which is nucleolithically released from the PTO after hybridization with the target nucleic acid sequence. The 5 'targeting portion and the 3' targeting portion on the PTO must be positioned in a 5 'to 3' order. The PTO is schematically illustrated in Figure 1.
[00061] Preferably, the hybridization in step (a) is performed under stringent conditions in which the 3 'targeting portion is hybridized to the target nucleic acid sequence and the 5' targeting portion is not hybridized to the sequence of target nucleic acid.
[00062] The PTO does not require any specific lengths. For example, the length of the PTO can be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 30-150 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-50 nucleotides, 35-100 nucleotides, 35-80 nucleotides, 35 -60 nucleotides or 35-50 nucleotides. The 3 'targeting portion of the PTO can be of any length as long as it is specifically hybridized to the target nucleic acid sequences. For example, the 3 'targeting portion of the PTO can be 10100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides- deos, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, 20100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides or 20-30 nucleotides in length. The 5 'targeting portion can be of any length as long as it is specifically hybridized to the mold portion of the CTO and then extended. For example, the 5 'targeting portion of the PTO may be 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides deos, 10-20 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 1530 nucleotides or 15-20 nucleotides in length.
[00063] The 3 'end of the PTO may have a 3'-OH terminal. Preferably, the 3 'end of the PTO is "locked" to prohibit its extension.
[00064] Blocking can be achieved according to conventional methods. For example, blocking can be carried out by adding to the 3'-hydroxyl group the last nucleotide of a chemical group such as biotin, labels, a phosphate group, an alkyl group, a non-nucleotide linker, phosphorothioate or alkane diol. Alternatively, blocking can be performed by removing the 3'-hydroxyl group from the last nucleotide or using a nucleotide with no 3'-hydroxyl group such as didesoxynucleotide.
[00065] Alternatively, the PTO can be designed to have a hairpin structure.
[00066] The non-hybridization between the 5 'targeting portion of the PTO and the target nucleic acid sequence refers to the non-formation of the stable double strand between them under certain hybridization conditions. According to a preferred embodiment, the 5 'targeting portion of the PTO not involved in hybridization to the target nucleic acid sequence forms a single strand.
[00067] The upstream oligonucleotide is located upstream of the PTO.
[00068] In addition, the upstream oligonucleotide or its extended strand hybridized to the target nucleic acid sequence induces cleavage of the PTO by an enzyme that has 5 'nuclease activity.
[00069] Induction of PTO cleavage by the upstream oligonucleotide can be performed in two ways: (i) induction of cleavage regardless of the extent of the upstream oligonucleotide; and (ii) induction of cleavage depending on the extent of the upstream oligonucleotide.
[00070] When the upstream oligonucleotide is positioned adjacent to the PTO sufficiently to induce cleavage of PTO by an enzyme that has 5 'nuclease activity, the enzyme bound to the upstream oligonucleotide digests the PTO without reaction of extension. In contrast, when the upstream oligonucleotide is positioned away from the PTO, an enzyme that has polymerase activity (for example, mold-dependent polymerase) catalyzes the extension of the upstream oligonucleotide (for example, upstream primer) and a enzyme that has a 5 'nuclease activity linked to the extended product digests the PTO.
[00071] Therefore, the upstream oligonucleotide can be located relative to the PTO in two ways. The upstream oligonucleotide may be located adjacent to the PTO sufficient to induce PTO cleavage in an independent manner. Alternatively, the upstream oligonucleotide may be located distant from the PTO sufficient to induce PTO cleavage in an extension-dependent manner.
[00072] The term used here "adjacent" with reference to positions or locations means that the upstream oligonucleotide is located adjacent to the 3 'targeting portion of the PTO to form a small cut. In addition, the term means that the upstream oligonucleotide is located 1-30 nucleotides, 1-20 nucleotides or 1-15 nucleotides in addition to the 3 'targeting portion of the PTO.
[00073] The term used here "distant" with reference to positions or locations includes any positions or locations sufficient to warrant extension reactions.
[00074] According to a preferred embodiment, the upstream oligonucleotide is located distant from the PTO sufficient to induce PTO cleavage in a manner dependent on the extent.
[00075] According to a preferred embodiment, the upstream oligonucleotide is an upstream primer or an upstream probe. The upstream primer is suitable for an extension-independent cleavage induction or an extension-dependent cleavage and the upstream probe is suitable for an extension-independent cleavage induction.
[00076] Alternatively, the upstream oligonucleotide may have a partial overlapping sequence with the 5 'part of the 3' targeting portion of the PTO. Preferably, the overlapping sequence is 1-10 nucleotides, more preferably 1-5 nucleotides, even more preferably 1-3 nucleotides in length. When the upstream oligonucleotide has a partial overlapping sequence with the 5 'part of the 3' targeting portion of the PTO, the 3 'targeting portion is partially digested along with the 5' targeting portion in the cleavage reaction of the step (b). In addition, the overlapping sequence allows to cleave a desired site from the 3 'targeting portion.
[00077] According to a preferred embodiment, the upstream primer induces through its extended ribbon the cleavage of the PTO through the enzyme that has the 5 'nuclease activity.
[00078] Conventional technologies for cleavage reactions by upstream oligonucleotides can be applied to the present invention, provided that the upstream oligonucleotide induces cleavage of the PTO hybridized to the target nucleic acid sequence to release a fragment comprising the portion of 5 'targeting or a portion of the 5' targeting portion of the PTO. For example, U.S. Pat. U.S. Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069 and 7,381,532 and U.S. Patent Application Pub No. 2008-0241838 can be applied to the present invention.
[00079] According to a preferred embodiment, the method is carried out in the presence of a downstream initiator. The downstream primer additionally generates a target nucleic acid sequence that will hybridize to the PTO, increasing sensitivity in target detection.
[00080] According to a preferred embodiment, when the upstream and downstream primers are used, a template-dependent nucleic acid polymerase is additionally employed for primer extension.
[00081] According to a preferred embodiment, the upstream oligonucleotide (upstream primer or upstream probe), the downstream primer and / or the 5 'targeting portion of the PTO has a dual initiation oligonucleotide structure (DPO) developed by the present inventor. Oligonucleotides that have the DPO structure exhibit significantly improved target specificity compared to conventional primers and probes (see WO 2006/095981; Chun et al., Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research, 35: 6e40 (2007)).
[00082] According to a preferred embodiment, the 3 'targeting portion of the PTO has a modified dual specificity oligonucleotide (mDSO) structure developed by the present inventor. The modified dual specificity oligonucleotide (mDSO) structure shows significantly improved target specificity compared to conventional probes (see WO 2011/028041). Step (b): Release of the PTO fragment
[00083] Subsequently, the result of step (a) is placed in contact with an enzyme that has 5 'nuclease activity under conditions for PTO cleavage. The PTO hybridized to the target nucleic acid sequence is digested through the enzyme that has 5 'nuclease activity to release a fragment comprising the 5' targeting portion or a part of the 5 'targeting portion of the PTO .
[00084] The term used here "conditions for PTO cleavage" means sufficient conditions to digest the PTO hybridized to the target nucleic acid sequence through the enzyme that has 5 'nuclease activity, such as temperature, pH, ionic strength, buffer, length and sequence of oligonucleotides and enzymes. For example, when Taq DNA polymerase is used as the enzyme that has 5 'nuclease activity, conditions for PTO cleavage include Tris-HCl, KCl, MgCl2 buffer and temperature.
[00085] When the PTO is hybridized to the target nucleic acid sequence, its 3 'targeting portion is involved in hybridization and the 5' targeting portion forms a single strand without hybridization to the sequence of target nucleic acid (see Figure 2). As such, an oligonucleotide comprising both single-stranded and double-stranded structures can be digested using an enzyme that has 5 'nuclease activity through a variety of technologies known to a person skilled in the art.
[00086] PTO cleavage sites are varied depending on the type of upstream oligonucleotides (upstream probe or upstream primer), upstream oligonucleotide hybridization sites and cleavage conditions (see US Pat. Nos. 5,210,015 , 5,487,972, 5,691,142, 5,994,069 and 7,381,532 and US Patent Application Pub. No. 2008-0241838).
[00087] A large number of conventional technologies can be employed for the PTO cleavage reaction, releasing a fragment comprising the 5 'targeting portion or a part of the 5' targeting portion.
[00088] Briefly, there may be three cleavage sites in step (b). First, the cleavage site is a junction site between a PTO hybridization portion (3 'targeting portion) and a non-hybridization portion (5' targeting portion). The second cleavage site is a site located several nucleotides in a 3 'direction beyond the 3' end of the 5 'targeting portion of the PTO. The second cleavage site is located at the 5 'end portion of the 3' targeting portion of the PTO. The third cleavage site is a site located several nucleotides in a 5 'direction beyond the 3' end of the 5 'targeting portion of the PTO.
[00089] According to a preferred embodiment, the starting site for cleavage of the PTO by the mold-dependent polymerase that has the 5 'nuclease activity after the extension of the upstream primer is a starting point of the double strand between the PTO and the target nucleic acid sequence or a 1-3 nucleotide site beyond the starting point.
[00090] In this regard, the term used here "a fragment comprising the 5 'targeting portion or a part of the 5' targeting portion of the PTO" in association with the cleavage of the PTO by the enzyme that has the activity 5 'nuclease is used to cover (i) the 5' targeting portion, (ii) the 5 'targeting portion and the 5' end portion of the 3 'targeting portion and (iii) a part of the 5 'targeting portion. In this patent application, the term "a fragment comprising the 5 'targeting portion or a part of the 5' targeting portion of the PTO" can also be described as "PTO fragment".
[00091] The term "part" used in association with the PTO or CTO such as the part of the 5 'targeting portion of the PTO, the part of the 5' end of the 3 'targeting portion of the PTO and the part of the 5 'end of the CTO capture portion refers to a nucleotide sequence composed of 1-40, 1-30, 1-20, 1-15, 1- 10 or 1-5 nucleotides, preferably 1, 2, 3 or 4 nucleotides.
[00092] According to a preferred embodiment, the enzyme which has 5 'nuclease activity is DNA polymerase which has 5' nuclease activity or FEN nuclease, more preferably a thermostable DNA polymerase which has nuclease activity at 5 'or FEN nuclease.
[00093] A suitable DNA polymerase that has 5 'nuclease activity in this invention is a thermostable DNA polymerase obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igni- terrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Species of Thermus Z05, Species , Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus coastalis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafrica- nus, Pyrocyris Most preferably, the thermostable DNA polymerase is Taq polymerase.
[00094] Alternatively, the present invention can employ DNA polymerases that have 5 'nuclease activity modified to have less polymerase activities.
[00095] The FEN (flap endonuclease) nuclease used is a 5 'flap-specific nuclease.
[00096] The FEN nuclease suitable in the present invention comprises FEN nucleases obtained from a variety of bacterial species, including Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus coastalis, Archaeaglobus veneficus, Archaeaglobus profun dus, Acidianus brierlyi, Desidylusus, mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Me- thanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and Archaeaglobus veneficus.
[00097] When the upstream initiator is used in step (a), it is preferable that the conditions for the cleavage of the PTO comprise the extension reaction of the upstream initiator.
[00098] According to a preferred embodiment, the upstream primer is used in step (a), a mold-dependent polymerase is used for the extension of the upstream primer and the mold-dependent polymerase is identical to the enzyme it has nuclease activity at 5 '.
[00099] Optionally, the upstream primer is used in step (a), a mold-dependent polymerase is used for the extension of the upstream primer and the mold-dependent polymerase is different from the enzyme that has the 5 'nuclease activity . Step (c): Hybridization of the fragment released from the PTO with CTO
[000100] The fragment released from the PTO is hybridized with a CTO (Capture and Mold Oligonucleotide).
[000101] The CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a part of the 5' targeting portion of the PTO and (ii ) a template portion comprising a nucleotide sequence not complementary to the 5 'targeting portion and the 3' targeting portion of the PTO.
[000102] The CTO acts as a template for extending the fragment released from the PTO. The fragment that serves as an initiator is hybridized to the CTO and extended to form an extended double-strand.
[000103] The mold portion can comprise any sequence as long as it is not complementary to the 5 'targeting portion and the 3' targeting portion of the PTO. In addition, the template portion can comprise any sequence as long as it can act as a template for the extent of the fragment released from the PTO.
[000104] As previously described, when the fragment having the 5 'targeting portion of the PTO is released, it is preferred that the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the 5' targeting portion. When the fragment having the 5 'targeting portion and the 5' end portion of the 3 'targeting portion is released, it is preferred that the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the portion 5 'targeting portion and the 5' end portion of the 3 'targeting portion. When the fragment having a part of the 5 'targeting portion of the PTO is released, it is preferred that the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the part of the 5' targeting portion.
[000105] In addition, it is possible to plan the capture portion of the CTO with the premeditation of the PTO cleavage sites. For example, when the capture portion of the CTO is designed to comprise a nucleotide sequence complementary to the 5 'targeting portion, the fragment that has a portion of the 5' targeting portion or the fragment that has the targeting portion to 5 'can be hybridized to the capture portion and then extended. When the fragment comprising the 5 'targeting portion and the 5' end portion of the 3 'targeting portion is released, it can be hybridized to the CTO capture portion designed to comprise a complete nucleotide sequence. to the 5 'targeting portion and then successfully extended even though mismatched nucleotides are present in the 3' end portion of the fragment. This is due to the fact that the primers can be extended depending on the reaction conditions although their 3 'end contains some mismatched nucleotides (for example 1-3 mismatched nucleotides).
[000106] When the fragment comprising the 5 'target portion and the 5' end portion of the 3 'target portion is released, the 5' end portion of the CTO capture portion can be planned to have a nucleotide sequence complementary to the cleaved part of the 5 'end of the 3' targeting portion, solving the problems associated with the mismatched nucleotides (see Figure 1).
[000107] Preferably, the nucleotide sequence of the 5 'end portion of the CTO capture portion complementary to the 5' end cleaved portion of the 3 'targeting portion can be selected depending on the predicted cleavage sites on the 3 'direction of the PTO. It is preferred that the nucleotide sequence of the 5 'end portion of the CTO capture portion complementary to the 5' end cleaved portion of the 3 'targeting portion is 1-10 nucleotides, more preferably 1-5 nucleotides, still more preferably 1-3 nucleotides.
[000108] The 3 'end of the CTO may comprise additional nucleotides not involved in hybridization to the fragment. In addition, the capture portion of the CTO may comprise a nucleotide sequence complementary to only part of the fragment (e.g., a part of the fragment containing its 3 'end portion) as long as it is stably hybridized to the fragment .
[000109] The term used "capture of the portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a part of the 5' targeting portion" is described here to encompass various designs and compositions of the CTO capture portion as discussed earlier.
[000110] The CTO can be designed to have a hairpin structure.
[000111] The length of the CTO can be widely varied. For example, the CTO has 7-1000 nucleotides, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15- 500 nucleotides, 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-1000 nucleotides, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides or 30-40 nucleotides in length. The capture portion of the CTO can be of any length as long as it is specifically hybridized to the fragment released from the PTO. For example, the capture portion of the CTO is 5100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 1040 nucleotides, 10- 30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides in length. The mold portion of the CTO can be of any length as long as it can act as a mold in the extent of the fragment released from the PTO. For example, the CTO template portion is 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5-100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10 -400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides or 15-20 nucleotides in length.
[000112] The 3 'end of the CTO may have a 3'-OH terminal. Preferably, the 3 'end of the CTO is blocked to prohibit its extension. Blocking of the CTO that cannot be extended can be achieved according to conventional methods. For example, blocking can be accomplished by adding to the 3'-hydroxyl group the last nucleotide of the CTO of a chemical group such as biotin, labels, a phosphate group, alkyl group, non-nucleotide linker, phosphorothioate or alkane diol. Alternatively, blocking can be performed by removing the 3'-hydroxyl group from the last nucleotide or using a nucleotide without a 3'-hydroxyl group such as didesoxynucleotide.
[000113] The fragment released from the PTO is hybridized with the CTO, providing a suitable shape in the extension of the fragment. Although an undigested PTO is also hybridized to the capture portion of the CTO through its 5 'targeting portion, its 3' targeting portion is not hybridized to the CTO which prohibits the formation of an extended double-strand.
[000114] The hybridization in step (c) can be described in detail with reference to the descriptions in step (a). Step (d): Fragment extension
[000115] The extension reaction is performed using the result from step (c) and a template-dependent nucleic acid polymerase. The fragment hybridized to the capture portion of the CTO is extended to form an extended double-strand. In contrast, the hybridized PTO not cleaved with the capture portion of the CTO is not extended so that no extended double strips are formed.
[000116] The term used here "extended double strand" means a double strand formed through the extension reaction in which the fragment hybridized to the capture portion of the CTO is extended using the mold portion of the CTO as a template and the nucleic acid polymerizes mold-dependent.
[000117] The extended double-tape has a different Tm value than that of the hybrid between the non-cleaved PTO and CTO.
[000118] Preferably, the extended double-strand has a Tm value greater than the hybrid between the non-cleaved PTO and CTO.
[000119] The value of Tm of the extended double ribbon is adjustable by (i) a sequence and / or a length of the fragment, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the fragment length and the sequence and / or the length of the CTO.
[000120] It is a notable feature of the present invention that the adjustable Tm value of the extended double tape is used to provide a target signal indicative of the presence of the extended double tape through the merging of the extended double tape in step (e) .
[000121] The term used here "Tm" refers to a melting temperature at which half of the double stranded nucleic acid molecule population is dissociated into single stranded molecules. The Tm value is determined by the length and the G / C content of hybridized nucleotides. The Tm value can be calculated using conventional methods such as the Wallace rule (RB Wallace et al., Nucleic Acids Research, 6: 3543-3547 (1979)) and the nearest neighbor method (SantaLucia J. Jr. and others, Biochemistry, 35: 3555-3562 (1996)); Sugimoto N. et al., Nucleic Acids Res., 24: 4501- 4505 (1996)).
[000122] According to a preferred modality, the value of Tm refers to real values of Tm under reaction conditions currently practiced.
[000123] The template-dependent nucleic acid polymerase used in step (d) can include any nucleic acid polymerases, for example, Klenow fragment of E. coli DNA polymerase I, a thermostable DNA polymerase and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikia-nii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ru-ber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Species of Thermus Z05, Species of Thermus sps 17, Thermus thermophilus, Thermotoga nitol, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga nitol, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima, Thermotoga maritima. africanus, Thermococcus coastalis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermo-siphoafricanus, Pyrococcus furiosus (Pfu), Pyrococcus woesei, Pyrococcus horikosyri pyroci More preferably, the template-dependent nucleic acid polymerase is Taq polymerase.
[000124] According to a preferred embodiment, the enzyme that has the 5 'nuclease activity used in step (b) is identical to the template-dependent nucleic acid polymerase used in step (d). More preferably, the enzyme that has the 5 'nuclease activity used in step (b), the template-dependent nucleic acid polymerase used for the upstream primer extension and the template-dependent nucleic acid polymerase used in step ( d) are identical to each other.
[000125] The extended double-tape has a tag originating from (i) at least one tag linked to the PTO and / or CTO fragment, (ii) a tag embedded within the extended double-tape during the extension reaction, (iii ) a tag incorporated within the extended double-tape during the extension reaction and a tag linked to the PTO and / or CTO fragment or (iv) an interleaving tag.
[000126] The presence of the extended double strand may indicate the presence of the target nucleic acid sequence because the extended double strand is formed when the target nucleic acid sequence is present. For the detection of the presence of the extended double-tape in a direct manner, an extended double-tape that has a marking providing a detected signal is formed in step (d). A mark used on the double strand provides a change of signal depending on whether the double strand is on a double strand or a single strand, finally providing the target signal indicative of the presence of the double strand by merging the double strand. - extended tape. Step (e): Fusion of the extended double-tape
[000127] After the extension reaction, the extended double-strand is melted over a temperature range to provide a target signal indicative of the presence of the extended double-strand.
[000128] The target signal is provided by (i) at least one tag linked to the fragment and / or the CTO, (ii) a tag embedded within the extended double-tape during the extension reaction, (iii) an embedded tag inside the extended double-tape during the extension reaction and a tag attached to the fragment and / or the CTO or (iv) an interleaving tag.
[000129] The term used here "target signal" means any signal capable of indicating the presence of the extended double-ribbon. For example, the target signal includes a mark signal (signal generation or extinction), a mark signal change (signal increase or decrease), a melting curve, a melting pattern and a melting temperature (or value of Tm).
[000130] According to a preferred modality, the target signal is a change in signal starting from a mark on the double tape extended in the fusion step. Signal change can be achieved by measuring signals at not less than two different temperatures. Alternatively, the target signal is a melting curve, a melting pattern and a melting temperature (or Tm value) obtained by measuring the signals starting from a mark on the double tape extended over a temperature range. Preferably, the temperature range is a temperature range for an analysis of the melting curve or temperatures around the Tm value of the extended double ribbon.
[000131] The extended double-tape has a higher Tm value than the hybrid between the non-cleaved PTO and CTO. Therefore, the extended double-strand and the hybrid exhibit different fusion patterns from each other. Such different fusion patterns make it possible to discriminate a target signal from non-target signals. The different melting pattern or melting temperature generates the target signal together with a suitable marking system.
[000132] Fusion can be performed using conventional technologies, including, but not limited to, heating, alkali, formate, urea and glycoxal treatment, enzymatic methods (eg helicase action) and binding proteins. For example, fusion can be achieved by heating to a temperature ranging from 80 C to 105 C. The general methods for carrying out this treatment are provided by Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).
[000133] The suitable marking systems used in this invention are various in terms of their types, locations and manner of signal production.
[000134] The marking systems useful in this invention will be described in detail below: (i) Marking linked to the fragment and / or the CTO
[000135] According to a preferred embodiment, the target signal is provided by at least one tag linked to the fragment and / or the CTO. As the extended double strand is formed between the PTO and CTO fragment, a mark on the PTO fragment or CTO is present on the extended double strand, providing the target signal in the fusion step.
[000136] The marking includes an interactive dual marking and an isolated marking. (i-1) Interactive dual marking
[000137] The interactive tagging system is a signal generation system in which energy is passed non-radioactively between a donor molecule and a receptor molecule. As a representation of the interactive labeling system, the FRET (fluorescent resonance energy transfer) labeling system includes a fluorescent reporter molecule (donor molecule) and an extinction molecule (receptor molecule). In FRET, the energy donor is fluorescent, but the energy recipient can be fluorescent or non-fluorescent. In another form of interactive labeling systems, the energy donor is not fluorescent, for example, a chromophore and the energy receptor is fluorescent. In yet another form of interactive marking systems, the energy donor is luminescent, for example, bioluminescent, chemiluminescent, electrochemiluminescent and the receiver is fluorescent. The donor molecule and the recipient molecule can be described as a reporter molecule and an extinction molecule in the present invention, respectively.
[000138] Preferably, the signal indicating the presence of the extended double-strand (ie, the presence of the target nucleic acid sequence) is generated by interactive marking systems, more preferably the FRET marking system (ie, system interactive dual dialing). First modality (intra-tape interactive dual marking)
[000139] In a first modality of a dual interactive marking system, the fragment or CTO has a dual interactive marking that comprises a reporter molecule and an extinction molecule; wherein the merging of the double-tape extended in step (e) induces the alteration of a signal from the interactive dual marking to provide the target signal in step (e). The first modality of the dual interactive marking system is illustrated in Figures 2, 6 and 9. The first modality is called an intra-tape dual interactive marking. First modality in Figure 2 (intra-tape interactive dual marking)
[000140] The exemplified modality is described with reference to Figure 2. The mold portion of the CTO has a reporter molecule and an extinction molecule. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment and the fragment is hybridized to the capture portion of the CTO and extended to form the extended double strand.
[000141] When the extended double-strand is formed in step (d), the reporter molecule and the extinction molecule in the CTO are conformationally separated to allow the extinction molecule not to eliminate the signal from the reporter molecule; where when the extended double-strand is merged in step (e), the reporter molecule and the extinction molecule are conformationally adjacent to each other to allow the extinction molecule to eliminate the signal from the reporter molecule, so that the signal- target is provided to indicate the presence of the double tape extended in step (e).
[000142] The expression used here "the reporter molecule and the extinction molecule are conformationally adjacent" means that the reporter molecule and the extinction molecule are three-dimensionally adjacent to each other through a conformational structure of the fragment or CTO such as spring structure and hairpin structure.
[000143] The expression used here "the reporter molecule and the extinction molecule are conformationally separated" means that the reporter molecule and the extinction molecule are three-dimensionally separated by altering the conformational structure of the fragment or CTO after the formation of a double strand .
[000144] Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in the fluorescent signal generated in step (d).
[000145] According to a preferred embodiment, the reporter molecule and the extinction molecule can be located anywhere on the CTO, as long as the signal from the reporter molecule is extinguished and not extinguished depending on the fusion of the extended double-strand.
[000146] According to a preferred embodiment, the reporter molecule and the extinction molecule are both linked to the mold portion or the capture portion of the CTO.
[000147] According to a preferred embodiment, the reporter molecule and the extinction molecule are positioned at the 5 'end and the 3' end of CTO.
[000148] According to a preferred embodiment, one of the reporter molecule and the extinction molecule in the CTO is located at its 5 'or 1-5 nucleotide end in addition to its 5' end and the other is located to extinguish and not extinguish the signal from the reporter molecule depending on the CTO conformation.
[000149] According to the preferred embodiment, one of the reporter molecule and the extinction molecule in the CTO is located at its 3 'or 1-5 nucleotide end in addition to its 3' end and the other is located to extinguish and not extinguish the signal from the reporter molecule depending on the CTO conformation.
[000150] According to a preferred embodiment, the reporter molecule and the extinction molecule are positioned at no more than 80 nucleotides, more preferably not more than 60 nucleotides, even more preferably not more than 30 nucleotides, even more preferably no more than 25 nucleotides in addition to each other. According to a preferred embodiment, the reporter molecule and the extinction molecule are separated by at least 4 nucleotides, more preferably at least 6 nucleotides, even more preferably at least 10 nucleotides, even more preferably at least 15 nucleotides.
[000151] In the present invention, a hybrid between the non-cleaved PTO and CTO can be formed.
[000152] When the mold portion of the CTO is marked with an interactive dual marking which is shown in Figure 2, a signal change from a marking in the hybrid between the non-cleaved PTO and CTO is not induced. Therefore, the hybrid does not provide a signal that is not a target.
[000153] When the capture portion of the CTO is marked with an interactive dual tag, the hybrid between the non-cleaved PTO and CTO provides a signal that is not targeted in the fusion step. In this case, the difference in the Tm values of the extended double-tape and the hybrid allows to discriminate the target signal of the extended double-tape from the signal that is not the target of the hybrid. First modality in Figure 6 (intra-tape interactive dual marking)
[000154] The exemplified embodiment is described with reference to Figure 6. The 5 'targeting portion of the PTO has a reporter molecule and an extinction molecule. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment comprising the 5 'targeting portion with the reporter molecule and the extinction molecule. The fragment is hybridized to the capture portion of the CTO.
[000155] When the extended double-strand is formed in step (d), the reporter molecule and the extinction molecule in the fragment are suitably separated to allow the extinction molecule not to eliminate the signal from the reporter molecule; where when the extended double-strand is merged in step (e), the reporter molecule and the extinction molecule are conformationally adjacent to each other to allow the extinction molecule to eliminate the signal from the reporter molecule, so that the signal- target is provided to indicate the presence of the double tape extended in step (e).
[000156] According to a preferred embodiment, the reporter molecule and the extinction molecule can be located anywhere on the fragment, as long as the signal from the reporter molecule is extinguished and not extinguished depending on the fusion of the extended double-strand.
[000157] According to a preferred embodiment, one of the reporter molecule and the extinction molecule in the fragment is located at its 5 'or 1-5 nucleotide end in addition to its 5' end and the other is located to extinguish and not extinguish the signal from the reporter molecule depending on the fragment's conformation.
[000158] According to a preferred embodiment, the reporter molecule and the extinction molecule are positioned at more than 50 nucleotides, more preferably not more than 40 nucleotides, even more preferably not more than 30 nucleotides, even more preferably not more than 20 nucleotides in addition to each other. According to a preferred embodiment, the reporter molecule and the extinction molecule are separated by at least 4 nucleotides, more preferably at least 6 nucleotides, even more preferably at least 10 nucleotides, even more preferably at least 15 nucleotides.
[000159] As shown in Figure 6, the hybrid between the non-cleaved PTO and CTO provides a signal that is not targeted in the fusion step. In this case, the difference in Tm values of the extended double-tape and the hybrid allows to discriminate the target signal of the extended double-tape from the signal that is not the target of the hybrid. Second Mode (Interfacing interactive dual marking)
[000160] In the second modality of the interactive marking system, the fragment has one of a dual interactive marking which comprises a reporter molecule and an extinction molecule and the CTO has the other of the interactive dual marking; wherein the merging of the double-tape extended in step (e) induces the alteration of a signal from the interactive dual marking to provide the target signal in step (e).
[000161] The exemplified modality is described with reference to Figure 8.
[000162] When the extended double-strand is formed in step (d), the signal from the reporter molecule linked to the CTO is extinguished by the extinction molecule linked to the PTO. When the extended double-strand is fused in step (e), the reporter molecule and the extinction molecule are separated to allow the extinction molecule not to eliminate the signal from the reporter molecule, so that the target signal is provided to indicate the presence of the double tape extended in step (e).
[000163] Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in the fluorescent signal from the interactive dual marking.
[000164] The reporter molecule and the extinction molecule can be located anywhere on the PTO and CTO fragment, as long as the signal from the reporter molecule is extinguished by the extinction molecule on the extended double-strand.
[000165] According to a preferred embodiment, the reporter molecule or the extinction molecule in the PTO fragment is located at the 5 'end of the 5' targeting portion.
[000166] According to a preferred embodiment, the reporter molecule or the extinction molecule in the CTO is located at its 3 'end.
[000167] As shown in Figure 8, the hybrid between the non-cleaved PTO and CTO provides a signal that is not targeted in the fusion step. In this case, the difference in the Tm values of the extended double-strand and the hybrid allows to discriminate the target signal of the extended double-strand from the signal that is not the target of the hybrid.
[000168] The reporter molecule and the extinction molecule useful in the present invention can include any molecules known in the art. Examples of these are: Cy2 ™ (506), YO-PRO ™ -1 (509), YOYO ™ -1 (509), Calcein (517), FITC (518), FluorX ™ (519), Alexa ™ (520) , Rhodamine 110 (520), Oregon Green ™ 500 (522), Oregon Green ™ 488 (524), RiboGreen ™ (525), Rhodamine Green ™ (527), Rhodamine 123 (529), Magnesium Green ™ (531), Calcium Green ™ (533), TO-PRO ™ -1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BO- DIPY TMR (568), BODIPY558 / 568 ( 568), BODIPY564 / 570 (570), Cy3 ™ (570), Alexa ™ 546 (570), TRITC (572), Magnesium Orange ™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange ™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red ™ (590), Cy3.5 ™ (596), ROX (608), Calcium Crimson ™ (615), Alexa ™ 594 (615), Texas Red (615), Nile Red (628), YO- PRO ™ -3 (631), YOYO ™ -3 (631), R-phycocyanin (642), C- Phycocyanin (648), TO -PRO ™ -3 (660), TOTO3 (660), DiD DilC (5) (665), Cy5 ™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536) , Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is a maximum emission wavelength in nanometers. Preferably, the reporter molecule and the extinction molecule include JOE, FAM, TAMRA, ROX and fluorescein-based labeling.
[000169] Suitable reporter-extinguisher pairs are featured in a variety of publications as follows: Pesce et al., Editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Fosforescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996) Pat. U.S. Nos. 3,996,345 and 4,351,760.
[000170] It is noteworthy that a non-fluorescent black extinction molecule capable of extinguishing fluorescence over a wide range of wavelengths or a specific wavelength can be used in the present invention. Examples of these are BHQ and DABCYL.
[000171] In the FRET marking adopted for the CTO, the reporter covers a FRET donor and the extinguisher covers the other FRET partner (receiver). For example, a fluorescein dye is used as the reporter and a rhodamine dye as the extinguisher. (i-2) Isolated marking
[000172] The present invention is also excellently performed using isolated tagging systems to provide signals that indicate the presence of target nucleic acid sequences.
[000173] According to a preferred embodiment, the fragment or CTO has an isolated marking and the merging of the double-tape extended in step (e) induces the alteration of a signal of the isolated marking to provide the target signal in step ( and). First Mode in Figure 3 (Isolated marking system)
[000174] The exemplified embodiment is described with reference to Figure 3. The mold portion of the CTO has an isolated fluorescent label. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment. The fragment is hybridized to the capture portion of the CTO and extended to form the extended double-strand. Through the formation of the extended double-ribbon, the fluorescent intensity from the isolated fluorescent marking becomes greater. When the extended double-strand is fused in step (e), the fluorescent intensity from the isolated fluorescent marking becomes smaller, so that the target signal is provided to indicate the presence of the extended double-strand in step (e).
[000175] According to a preferred modality, the isolated marking can be located anywhere on the CTO, as long as the signal level from the isolated marking is changed depending on the merging of the extended double-tape.
[000176] According to a preferred embodiment, the isolated marking is attached to the mold portion or the capture portion of the CTO.
[000177] When the mold portion of the CTO is marked with an isolated mark as shown in Figure 3, a signal change of a mark in the hybrid between the non-cleaved PTO and CTO is not induced. Therefore, the hybrid does not provide a signal that is not a target.
[000178] When the capture portion of the CTO is marked with an isolated tag, the hybrid between the non-cleaved PTO and CTO provides a signal that is not targeted in the fusion step. In this case, the difference in the Tm values of the extended double-tape and the hybrid allows to discriminate the target signal of the extended double-tape from the signal that is not the target of the hybrid. Second Mode in Figure 7 (Isolated marking system)
[000179] The exemplified embodiment is described with reference to Figure 7. The 5 'targeting portion of the PTO has the isolated fluorescent label. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment comprising the 5 'targeting portion with the isolated fluorescent label. Through hybridization, the signal intensity from the isolated fluorescent label in the 5 'targeting portion is increased. When the extended double strand is merged in step (e), the signal strength from the isolated fluorescent marking becomes reduced, so that the target signal is provided to indicate the presence of the extended double strand in step (e) and).
[000180] According to a preferred embodiment, the isolated tag can be located anywhere on the PTO fragment, as long as the signal level from the isolated tag is changed depending on the merging of the extended double-tape.
[000181] As shown in Figure 7, the hybrid between the non-cleaved PTO and CTO provides a signal that is not a target in the fusion step. In this case, the difference in Tm values of the extended double-tape and the hybrid allows to discriminate the target signal of the extended double-tape from the signal that is not the target of the hybrid.
[000182] The isolated mark used here must be able to provide a different signal depending on its presence on a double ribbon or an isolated ribbon. The isolated marking includes a fluorescent marking, a luminescent marking, a chemiluminescent marking, an electrochemical marking and a metal marking. Preferably, the isolated label includes a fluorescent label.
[000183] The preferable types and binding sites of isolated fluorescent labels used in this invention are disclosed in U.S. Pat. U.S. Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein as a reference in their entirety. Preferably, the isolated fluorescent label includes JOE, FAM, TAMRA, ROX and the fluorescein-based label. The labeled nucleotide residue is preferably positioned on the inner nucleotide residue within the oligonucleotide rather than at the 5 'end or the 3' end.
[000184] The isolated fluorescent label useful in the present invention can be described with reference to the descriptions for reporter and extinction molecules as indicated above.
[000185] In particular, when the present invention in a solid phase is carried out using an isolated label, it can use a general fluorescent label and does not require a specific fluorescent label capable of providing a fluorescent signal with different intensities depending on its presence on the tape double or on the isolated tape. The target signal provided on the solid substrate is measured. The modality of the isolated marking system with immobilized CTO is illustrated in Figure 12.
[000186] When the CTO immobilized on a solid substrate is used, chemical markings (eg, biotin) or enzyme markings (eg, alkaline phosphatase, peroxidase, β-galactosidase and β-gluocosidase).
[000187] In a marking system using "fragment and / or CTO-linked marking", the markings can be positioned to the extent that when a hybrid between an uncleaved PTO and CTO is formed, the hybrid does not provide a signal that is not targeted in step (e). Alternatively, the markings can be positioned to the extent that when a hybrid between an uncleaved PTO and CTO is formed, the hybrid provides a signal that is not targeted in step (e); in which the Tm value of the extended double-tape is greater than that of the hybrid between the non-cleaved PTO and CTO.
[000188] Particularly, when the markings are positioned to the extent that a hybrid between an uncleaved PTO and CTO does not provide a non-target signal, the range including the hybrid's Tm value can be used to select the value of Tm of the extended double strand for the detection of a target nucleic acid sequence. (ii) Marking incorporated within the extended double-tape
[000189] The present invention can employ a mark incorporated within the extended double-tape during the extension reaction to provide the target signal indicative of the presence of the extended double-tape.
[000190] Although the PTO or CTO fragment has no mark, a mark incorporated within the extended double-tape during the extension reaction is used successfully to allow the extended double-tape to be marked. Figures 10 and 11 illustrate an embodiment in which an isolated labeled nucleotide is incorporated into the extended double-strand during the extension reaction (see Figures 10 and 11, C and D). This modality is also applicable to other modalities using fusion analysis.
[000191] According to a preferred modality, the target signal is provided by an isolated mark incorporated within the extended double-tape during the extension reaction; wherein the isolated embedded tag is linked to an embedded nucleotide during the extension reaction; wherein the merging of the double-tape extended in step (e) induces the alteration of a signal from the isolated marking to provide the target signal in step (e).
[000192] The exemplified embodiment is described with reference to Figure 10. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment. The fragment is hybridized to the capture portion of the CTO immobilized on a solid substrate and extended in the presence of nucleotides marked with the isolated fluorescent label to form the extended double strand. The fluorescent signal from the extended double strand can be detected at the point of the solid substrate with immobilized CTO. When the extended double ribbon is fused, a ribbon that has a fluorescent label is released and the fluorescent signal is no longer detected on the dot (not shown in Figure 10). Therefore, a change in signal can be provided over the point by merging the extended double tape. In this regard, the target signal is provided to indicate the presence of the extended double tape in step (e).
[000193] The target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in fluorescent intensity at the point with immobilized CTO.
[000194] According to a preferred embodiment, a nucleotide incorporated during the extension reaction has a first unnatural base and the CTO has a nucleotide that has a second unnatural base with a specific binding affinity with the first unnatural base, as illustrated in Figure 11. The nucleotide that has the second unnatural base is preferably located anywhere on the CTO template portion.
[000195] The term used here "unnatural base" refers to derivatives of natural bases such as adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U), which are capable to form hydrogen bonded base pairs. The term used herein "unnatural base" includes bases that have different base matching patterns of natural bases as parent compounds, as described, for example, in U.S. Pat. U.S. Nos. 5,432,272, 5,965,364, 6,001,983 and 6,037,120. Base pairing between unnatural bases involves two or three hydrogen bonds like natural bases. The base pairing between unnatural bases is also formed in a specific way.
[000196] Specific examples of unnatural bases include the following bases in combinations of base pairs: iso-C / iso-G, iso-d / iso-dG, K / X, H / J and M / N ( see US Pat. No. 7,422,850).
[000197] The exemplified embodiment is described with reference to Figure 11. The fragment is hybridized to the CTO with a nucleotide that has a second unnatural base (e.g. iso-dC) with a specific binding affinity to a non-first base. natural (for example, iso-dG). The extension is performed in the presence of the nucleotide that has the first unnatural base marked with the isolated fluorescent marking, forming the extended double-strand. In the extension reaction, the nucleotide that has the first unnatural base is incorporated at a site opposite the nucleotide that has the second unnatural base.
[000198] The fluorescent signal from the extended double tape can be detected on the point of a solid substrate with immobilized CTO. When the extended double ribbon is fused, a ribbon that has a fluorescent label is released and the fluorescent signal is no longer detected over the point (not shown in Figure 11). Therefore, a change in signal can be provided over the point by merging the extended double tape. In this regard, the target signal is provided to indicate the presence of the extended double tape in step (e).
[000199] When a mark embedded within the extended double-tape during the extension reaction is employed, a mark is not incorporated within the hybrid between the non-cleaved PTO and CTO because the hybrid is not extended. Therefore, the hybrid does not provide a signal that is not a target.
[000200] The types and characteristics of the isolated markings used can be described with reference to the descriptions for a marking system using "marking linked to the fragment and / or the CTO" as previously indicated here. (iii) Marking incorporated within the extended double-tape and marking linked to the fragment or the CTO
[000201] The present invention can employ a marking system using the cooperation of the incorporated marking inside the extended double-tape during the extension reaction and a marking linked to the fragment and / or the CTO, as illustrated in Figures 4 and 5.
[000202] According to a preferred embodiment, the target signal is provided by an embedded tag within the extended double-tape during the extension reaction and a tag linked to the fragment and / or the CTO and the embedded tag is linked to a nucleotide incorporated during the extension reaction; wherein the two tags are an interactive dual tag of a reporter molecule and an extinction molecule; wherein the merging of the double-tape extended in step (e) induces the alteration of a signal from the interactive dual mark to provide the target signal in step (e).
[000203] More preferably, the nucleotide incorporated during the extension reaction has a first unnatural base and the CTO has a nucleotide that has a second unnatural base with a specific binding affinity to the first unnatural.
[000204] The exemplified modality is described with reference to Figure 4. The fragment is hybridized with the CTO which comprises a reporter or extinction molecule and a nucleotide that has a second unnatural base (for example, iso-dC) which is a specific binding affinity to an unnatural first base (eg iso-dG). The extension is performed in the presence of a nucleotide that has the first unnatural base marked with an extinction molecule or reporter, forming the extended double-strand in which the signal from the reporter molecule is extinguished by the extinction molecule. In the extension reaction, the nucleotide that has the first unnatural base is incorporated at a site opposite the nucleotide that has the second unnatural base.
[000205] When the extended double-strand is merged in step (e), the reporter molecule and the extinction molecule are separated to allow the extinction molecule not to eliminate the signal from the reporter molecule, so that the target signal is provided to indicate the presence of the double tape extended in step (e).
[000206] Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in the signal from the interactive dual marking.
[000207] The marking site on the CTO and the incorporation site of the embedded marking are determined to the extent that the two markings act as an interactive dual mark for inducing signal change in the fusion step.
[000208] Even more preferably, the CTO template portion has a reporter or extinction molecule and a nucleotide that has a second unnatural base. The extension reaction in step (d) is carried out in the presence of a nucleotide that has the extinction molecule or reporter and the first unnatural base with a specific binding affinity to the second unnatural base in the CTO. The two unnatural bases in the double-strand extended in step (d) form a base pairing to extinguish a signal from the reporter molecule by the extinction molecule and to induce the alteration of a signal, whereby the target signal is provided . Alternatively, the fragment has a reporter or extinction molecule and the template portion of the CTO has a nucleotide that has a second unnatural base. The extension reaction in step (d) is carried out in the presence of a nucleotide that has the extinction molecule or reporter and the first unnatural base with a specific binding affinity to the second unnatural base in the CTO. The two unnatural bases in the double-strand extended in step (d) form a base pairing to induce the alteration of a signal from the reporter molecule through extinction, through which the target signal is provided.
[000209] Another exemplified embodiment is described with reference to Figure 5. In this embodiment, the fragment that has a reporter or extinction molecule is hybridized with the CTO that comprises a nucleotide that has a second unnatural base (for example, iso-dC ) which is a specific binding affinity to the first unnatural base (for example, iso-dG). The extension is performed in the presence of a nucleotide that has the first unnatural base marked with the extinction molecule or reporter, forming the extended double-strand in which the signal from the reporter molecule is extinguished by the extinction molecule. In the extension reaction, the nucleotide that has the first unnatural base is incorporated at a site opposite the nucleotide that has the second unnatural base.
[000210] When the extended double-strand is formed in step (d), the reporter molecule and the extinction molecule are conformationally separated to allow the extinction molecule not to eliminate the signal from the reporter molecule; where when the extended double-strand is fused in step (e), the reporter molecule and the extinction molecule are conformationally adjacent to each other to allow the extinction molecule to eliminate the signal from the reporter molecule, so that the target signal is provided to indicate the presence of the double tape extended in step (e).
[000211] Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in the signal from the interactive dual marking.
[000212] The marking site in the PTO and the incorporation site of the embedded mark are determined to the extent that the two markings act as an interactive dual mark for inducing signal change in the fusion step.
[000213] When a mark embedded within the extended double-tape during the extension reaction is employed, a mark is not incorporated within the hybrid between the non-cleaved PTO and CTO because the hybrid is not extended. Therefore, the hybrid does not provide a signal that is not a target in the fusion stage. (iv) Interleaving marking
[000214] The present invention can employ an interlacing marking for supplying the target signal indicative of the presence of the extended double-tape. Interleaving labeling is most useful in a solid phase reaction using immobilized CTOs because the double-stranded nucleic acid molecules present in the samples can generate signals.
[000215] Exemplified intercalating dyes useful in this invention include SYBRTM Green I, PO-PRO ™ -1, BO-PRO ™ -1, SYTOTM43, SYTOTM44, SYTOTM45, SYTOXTMBlue, POPO ™ -1, POPO ™ -3, BO-BO ™ -1, BOBO ™ -3, LO-PRO ™ -1, JO-PRO ™ -1, YO-PROTM1, TO- PROTM1, SYTOTM11, SYTOTM13, SYTOTM15, SYTOTM16, SYTOTM20, SYTOTM23, TOTO ™ -3, YOYOTM3, GelStarTM and thiazole orange. Interleaving dyes are specifically interleaved within double-stranded nucleic acid molecules to generate signals.
[000216] Figure 13 illustrates a modality in which the intercalating dyes are interleaved between base pairs of the extended double ribbon (C and D in Figure 13). The modality is also applicable to another modality using fusion analysis.
[000217] The exemplified modality is described with reference to Figure 13. The fragment is hybridized with the capture portion of the CTO immobilized on a solid substrate. The extension is carried out in the presence of an intercalating dye (for example, SYBRTM Green) and produces the extended double-ribbon with intercalating dyes. The fluorescent signal from the double stripe extended over the point of the solid substrate with immobilized CTO can be detected using intercalating fluorescent dyes. When the extended double-strand is fused, intercalating fluorescent dyes are released and the fluorescent signal is no longer detected over the dot (not shown in Figure 13). In this regard, the target signal is provided to indicate the presence of the extended double tape in step (e).
[000218] The hybrid between the non-cleaved PTO and CTO provides a signal that is not targeted in the fusion stage. In this case, the difference in the Tm values of the extended double-tape and the hybrid allows to discriminate the target signal of the extended double-tape from the signal that is not the target of the hybrid (not shown in Figure 13).
[000219] Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value that is obtained by measuring the change in the fluorescent signal generated in step (d). Step (f): Detecting the target signal
[000220] Finally, the extended double strand is detected by measuring the target signal provided in step (e), in which the presence of the extended double strand indicates the presence of the target nucleic acid sequence.
[000221] Detection can be performed in several ways depending on the types of the target signal.
[000222] According to a preferred embodiment, the detection of the target signal is carried out by means of fusion analysis.
[000223] The term used here "fusion analysis" means a method in which a target signal indicative of the presence of the extended double-strand is obtained by fusing the extended double-strand, including a method for measuring the signals at two different temperatures, melting curve analysis, melting pattern analysis and melting peak analysis. Preferably, the melt analysis is an analysis of the melt curve.
[000224] According to a preferred embodiment, the fusion of step (e) is followed by hybridization to provide the target signal indicative of the presence of the extended double-strand. In such a case, the presence of the extended double ribbon is detected by analyzing the hybridization curve.
[000225] The fusion curve or hybridization curve can be obtained using conventional technologies, for example, as described in U.S. Pat Nos. 6,174,670 and 5,789,167, Drobyshev et al., Gene 188: 45 (1997); Kochinsky and Mirzabekov Human Mutation 19: 343 (2002); Livhits and others J. Biomol. Structure Dynam. 11: 783 (1994); and Howell et al. Nature Biotechnology 17:87 (1999). For example, a fusion curve or hybridization curve can consist of a graphical representation or display of the variation of the output signal with the hybridization string parameter. The output signal can be plotted directly against the hybridization parameter. Typically, a fusion curve or hybridization curve will have the output signal, for example, fluorescence, which indicates the degree of structure of the double ribbon (ie, the extent of hybridization), plotted on the Y axis and the hybridization parameter on the X axis.
[000226] The PTO and CTO can be comprised of naturally occurring dNMPs. Alternatively, PTO and CTO can be comprised of modified nucleotide or unnatural nucleotide such as PNA (peptide nucleic acid, see PCT Publication No. WO 92/20702) and LNA (locked nucleic acid, see PCT Publications No. WO 98 / 22489, WO 98/39352 and WO 99/14226). The PTO and CTO can comprise universal bases such as deoxyinosine, inosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrole and 5-nitroindole. The term "universal base" refers to one capable of forming base pairs with each of the natural DNA / RNA bases with little discrimination between them.
[000227] As previously described, the PTO can be cleaved at a site located in a 3 'direction beyond the 3' end of the 5 'targeting portion of the PTO. The cleavage site can be located at the 5 'end part of the 3' targeting portion of the PTO. When the PTO fragment comprises the 5 'end part of the 3' targeting portion of the PTO, a CTO site hybridized to the 5 'end part of the 3' targeting portion may comprise a universal base, sequence degenerate or combination thereof. For example, if the PTO is cleaved at a site located on a nucleotide in a 3 'direction beyond the 3' end of the 5 'targeting portion of the PTO, it is advantageous that the 5' end portion of the capture of the CTO comprises a universal basis for hybridization with the nucleotide. If the PTO is cleaved at a site located two nucleotides in a 3 'direction beyond the 3' end of the 5 'targeting portion of the PTO, it is advantageous that the 5' end of the CTO capture portion comprises a degenerate sequence and its nucleotide adjacent to the 3 'direction comprises a universal base. As such, when PTO cleavage occurs at various sites on the 5 'end portion of the 3' targeting portion, the use of universal bases and degenerate sequences in the CTO is useful. In addition, when PTOs that have the same 5 'targeting portion are used for the verification of various target nucleic acid sequences under primer cleavage upstream dependent on extension induction, PTO fragments that have parts from the 5 'end other than the 3' targeting portion can be generated. In such cases, universal bases and de-generated strings are usefully employed in the CTO. Strategies that use universal bases and degenerate sequences in the CTO guarantee the use of one type or minimal types of the CTO for the verification of various target nucleic acid sequences.
[000228] According to a preferred embodiment, the method further comprises the repetition of steps (a) - (b), (a) - (d) or (a) - (f) with denaturation between repetition cycles, preferably with a downstream initiator. This repetition allows to amplify the target nucleic acid sequence and / or the target signal.
[000229] According to a preferred embodiment, steps (a) - (f) are carried out in a reaction vessel or in separate reaction vessels. For example, steps (a) - (b), (c) - (d) or (e) - (f) can be performed in separate reaction vessels.
[000230] According to a preferred embodiment, steps (a) - (b) and (c) - (f) can be simultaneously or separately equalized in a reaction vessel depending on the reaction conditions (particularly, temperature).
[000231] The present invention does not require that target nucleic acid sequences that will be detected and / or amplified have any particular sequence or length, including any DNA molecules (gDNA and cDNA) and RNA.
[000232] When an mRNA is used as a starting material, a reverse transcription step is required before performing the annealing step, details of which are found in Joseph Sam- brook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, K. F. et al., Nucleic Acids Res. 16: 10366 (1988). For reverse transcription, a random hexamer or a dT oligonucleotide primer that can be hybridized to the mRNA can be used.
[000233] Target nucleic acid sequences that can be detected and / or amplified include any prokaryotic, eukaryotic nucleic acid (e.g., protozoa and parasites, fungi, yeast, higher plants, lower and higher animals, including mammals and human) or viral (for example, Herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.) or naturally occurring virus.
[000234] The present invention is also useful in detecting a variation of nucleotides. Preferably, the target nucleic acid sequence comprises a nucleotide variation. The term "nucleotide variation" used herein refers to any single or multiple nucleotide substitutions, deletions or insertions in a DNA sequence at a particular location between contiguous DNA segments that are otherwise similar in sequence. Such contiguous DNA segments include a gene or any other portion of a chromosome. This variation of nucleotides can be mutant or polymorphic allelic variations. For example, the nucleotide variation detected in the present invention includes SNP (isolated nucleotide polymorphism), mutation, deletion, insertion, substitution and translocation. The exemplified nucleotide variation includes numerous variations in the human genome (for example, variations in the MTHFR (methylenetetrahydrofolate reductase) gene), variations involved in pathogen drug resistance, and variations that cause tumorigenesis.
[000235] In the present invention for the detection of a nucleotide variation in a target nucleic acid sequence, when primers or probes used have a sequence complementary to the nucleotide variation in the target nucleic acid sequence, the target nucleic acid sequence that contains the nucleotide variation is described here as a combination template. When primers or probes used have a sequence not complementary to the nucleotide variation in the target nucleic acid sequence, the target nucleic acid sequence that contains the nucleotide variation is described here as a mismatched template.
[000236] For the detection of nucleotide variation, the 3 'end of the upstream primer can be designed to be opposite a site of a nucleotide variation in a target nucleic acid sequence. According to a preferred embodiment, the 3 'end of the upstream primer has a sequence complementary to the nucleotide variation in a target nucleic acid sequence. The 3 'end of the upstream primer which has a sequence complementary to the nucleotide variation in the target nucleic acid sequence is annealed to the combining template and extended to induce PTO cleavage. The resulting PTO fragment is hybridized to the CTO to provide the target signal. In contrast, when the 3 'end of the upstream primer is paired wrong with a variation of nucleotide in a template that looks wrong, it is not extended under conditions that girding of the 3' end of primers is essential to the extension even when the upstream initiator is hybridized with the mold that looks wrong, thus resulting in the non-generation of the target signal.
[000237] Alternatively, it is possible to use PTO cleavage depending on the hybridization of PTO that has the sequence complementary to a nucleotide variation in a target nucleic acid sequence. For example, under controlled conditions, a PTO that has the sequence complementary to the nucleotide variation in the target nucleic acid sequence is hybridized to the combining template and then cleaved. The resulting PTO fragment is hybridized to the CTO to provide the target signal. While, under controlled conditions, the PTO is not hybridized to a mold that looks wrong, which has a non-complementary sequence in the position of the nucleotide variation and is not cleaved. Preferably, in this case, the sequence complementary to the nucleotide variation in the PTO is positioned in the middle of its 3 'targeting portion of the PTO.
[000238] Alternatively, it is preferable that the 5 'end portion of the 3' targeting portion of the PTO is positioned at a nucleotide variation in a target nucleic acid sequence for the detection of the nucleotide variation and the portion of the the 5 'end of the 3' targeting portion of the PTO has the sequence complementary to the nucleotide variation in a target nucleic acid sequence.
[000239] In an embodiment for detecting the isolated nucleotide variation, the 5 'end of the 3' targeting portion of the PTO has a sequence complementary to the isolated nucleotide variation in a target nucleic acid sequence. As previously described, cleavage of the hybridized PTO with a combining template can be induced at a site immediately adjacent in a direction 3 'to the 5' end of the 3 'targeting portion of the PTO, for example, under dependent induction the extent of cleavage of the upstream primer. The 3 'end of the PTO fragment has the nucleotide complementary to the isolated variation of the nucleotide. The PTO fragment is hybridized to a CTO that has a capture portion that comprises a sequence that corresponds to the nucleotide variation and then extended to form the extended double strand, providing the target signal. If the same PTO is hybridized to a wrongly matched template that has the same sequence as the combined template except for the isolated variation of the nucleotide, cleavage of the PTO can occur at one site two nucleotides beyond in a 3 'direction departing from the 5 'end of the 3' targeting portion of the PTO. The 3 'end of the PTO fragment has the nucleotide additionally cleaved than the nucleotide complementary to the isolated variation of the nucleotide. When the CTO site hybridized with the additionally cleaved nucleotide is designed to have a complementary non-sequence to the additionally cleaved nucleotide, the 3 'end of the PTO fragment is not hybridized to the CTO, resulting in the non-extension of the PTO fragment in a controlled condition. Even if the PTO fragment is extended to form the extended double-strand, the double-strand has a different Tm value than the double-strand derived from the hybridization between the PTO and the mold that looks wrong.
[000240] According to a preferred embodiment, a PTO cleavage site that has a sequence complementary to the nucleotide variation in its part of the 5 'end of the 3' targeting portion is different depending on hybridization with a template that is combines or with a mold that looks wrong, so that the PTO fragment released from any hybridization event has a preferably different sequence, in its part of the 3 'end, more preferably, in its 3' end.
[000241] According to a preferred embodiment, the selection of the CTO nucleotide sequence taking into account a difference in the 3 'end parts of the PTO fragments allows to discriminate the template that matches the template that looks wrong.
[000242] According to a preferred embodiment, the target nucleic acid sequence used in the present invention is a pre-amplified nucleic acid sequence. The use of the pre-amplified nucleic acid sequence allows to significantly increase the sensitivity and detection specificity of the target of the present invention.
[000243] According to a preferred embodiment, the method is carried out in the presence of a downstream initiator.
[000244] The advantages of the present invention can be highlighted in the simultaneous (multiplex) detection of at least two target nucleic acid sequences.
[000245] According to a preferred embodiment, the method is performed to detect at least two types (more preferably, at least three types, even more preferably at least five types) of target nucleic acid sequences.
[000246] According to a preferred embodiment, the method is performed to detect at least two types (more preferably, at least three types, even more preferably at least five types) of target nucleic acid sequences; wherein the upstream oligonucleotide comprises at least two types (more preferably at least three types, even more preferably at least five types) of oligonucleotides, the PTO comprises at least two types (more preferably at least three types, even more preferably at least five types) of the PTOs and the CTO comprises at least one type (preferably at least two types, more preferably at least three types, even more preferably at least five types) of the CTO; wherein when at least two types of the target nucleic acid sequences are present, the method provides at least two types of the target signal that correspond to at least two types of the target nucleic acid sequences.
[000247] The 5 'targeting portions of the at least two PTOs can have an identical sequence to each other. For example, when the present invention is performed for the verification of target nucleic acid sequences, the 5 'targeting portions of PTOs may have the identical sequence.
[000248] In addition, a single type of CTO can be used for the detection of the large number of target nucleic acid sequences. For example, when PTOs that have an identical sequence in their 5 'targeting portions are used for the verification of target nucleic acid sequences, a single type of CTO can be used.
[000249] According to a preferred embodiment, the extended duplicates that correspond to at least two types of the target nucleic acid sequences have different Tm values from each other.
[000250] According to a preferred embodiment, the at least two types of the target signal that correspond to at least two types of the target nucleic acid sequences are provided starting from the different types of markings on each other.
[000251] According to a preferred embodiment, the at least two types of the target signal that correspond to at least two types of the target nucleic acid sequences are provided starting from the same type of markings.
[000252] According to a preferred embodiment, the at least two types of the target signals that correspond to at least two types of the target nucleic acid sequences are provided starting from the same type of labels; wherein the extended duplicates corresponding to at least two types of the target nucleic acid sequences have different Tm values from each other.
[000253] The term used here "different types of markings" refers to markings with different characteristics of detected signals. For example, FAM and TAMRA as fluorescent reporter markings are considered to be different types of markings because their excitation and emission wavelengths are different from each other.
[000254] When the present invention is performed to simultaneously detect at least two types of the target nucleic acid sequences by analyzing the fusion curve and the extended duplicates corresponding to at least two types of the target nucleic acid sequences. Target nucleic acids have different Tm values from each other, it is possible to detect at least two types of the target nucleic acid sequences while still using a single type of label (e.g., FAM). Target detection using immobilized CTO in a solid phase
[000255] The prominent advantage of the present invention is to be efficient in detecting target nucleic acid sequences even in a solid phase such as a microarray.
[000256] According to a preferred embodiment, the present invention is carried out on the solid phase and the CTO is immobilized through its 5 'end or 3' end on a solid substrate. In the solid phase, the target signal supplied on the solid substrate is measured.
[000257] When the immobilized CTO is used, the fusion analysis using marking systems as described above is applicable to the solid phase reaction of the present invention.
[000258] According to a preferred embodiment, the target signal is provided by an isolated tag attached to the fragment or by an isolated tag incorporated within the extended double-tape during the extension reaction. In particular, when the present invention on a solid phase is carried out using an isolated label, it can use a general fluorescent label and does not require a specific fluorescent label capable of providing a fluorescent signal with different intensities depending on its presence on the double ribbon or the ribbon isolated.
[000259] When the CTO immobilized on a solid substrate is used, chemical markings (for example, biotin) or enzymatic markings (for example, alkaline phosphatase, peroxidase, β-galactosidase and β-gluocosidase).
[000260] For the solid phase reaction, the CTO is immobilized directly or indirectly (preferably indirectly) through its 5 'end or 3' end (preferably the 3 'end) on the surface of the solid substrate. In addition, the CTO can be immobilized on the surface of the solid substrate in a covalent or non-covalent manner. When immobilized CTOs are indirectly immobilized on the surface of the solid substrate, suitable binders are used. The binders useful in this invention can include any binders used for immobilizing the probe on the surface of the solid substrate. For example, alkyl or aryl compounds with amine functionality or alkyl or aryl compounds with thiol functionality serve as binders for the immobilization of CTO. In addition, poly (T) or poly (A) tail can serve as binders.
[000261] According to a preferred embodiment, the solid substrate used in the present invention is a microarray. The microarray that provides a reaction environment in this invention can include any of those known to a person skilled in the art. All the processes of the present invention, that is, hybridization with target nucleic acid sequences, cleavage, extension, fusion and fluorescence detection, are performed on the microarray. The CTOs immobilized on the microarray serve as elements of hybridizable arrangement. The solid substrate for making the microarray includes, but is not limited to, metals (eg gold, gold and copper alloy, aluminum), metal oxide, glass, ceramics, quartz, silicon, semiconductor, Si / SiO2 wafer, ger - manium, gallium arsenide, carbon, carbon nanotube, polymers (eg polystyrene, polyethylene, polypropylene and polyacrylamide), sepharose, agarose and colloids. A large number of CTOs immobilized in this invention can be immobilized on one region that can be targeted or two or more regions that can be targeted on a solid substrate that can comprise 2-1,000,000 regions that can be targeted. Immobilized CTOs can be manufactured to produce arrangement or arrangements for an application provided through conventional manufacturing technologies such as photolithography, inkblasting, mechanical micro-stains and derivatives thereof.
[000262] The present invention carried out on the solid phase can simultaneously detect a large number of target nucleic acid sequences even when using a single type of labeling because the labels on the immobilized CTOs are physically separated. In this regard, the number of target nucleic acid sequences that will be detected by the present invention on the solid phase is not limited. II. Preferred Modality with Amplification of a Target Nucleic Acid Sequence
[000263] Preferably, the present invention is carried out simultaneously with amplification of a target nucleic acid sequence using a pair of primers composed of an upstream and a downstream primer capable of synthesizing the target nucleic acid sequence.
[000264] In another aspect of this invention, a method is provided for the detection of target nucleic acid sequences starting from a DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension), which comprises: (a) the hybridization of the target nucleic acid sequences with a pair of primers comprising an upstream and a downstream primer and a PTO (Probe and Mark Oligonucleotide); wherein each of the upstream and downstream primers each comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprises (i) a 3 'targeting portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence and (ii) a 5' targeting portion comprising a nucleotide sequence not complementary to the sequence target nucleic acid; wherein the 3 'targeting portion is hybridized to the target nucleic acid sequence and the 5' targeting portion is not hybridized to the target nucleic acid sequence; the PTO is located between the upstream and downstream initiators; wherein the PTO is blocked at its 3 'end to prohibit its extension; (b) contacting the result of step (a) with a mold-dependent nucleic acid polymerase that has 5 'nuclease activity under conditions for primer extension and PTO cleavage; where when the PTO is hybridized to the target nucleic acid sequences, the upstream primer is extended and the extended ribbon induces cleavage of the PTO by the mold-dependent nucleic acid polymerase that has 5 'nuclease activity. so that the cleavage releases a fragment comprising the 5 'targeting portion or a part of the 5' targeting portion of the PTO; (c) the hybridization of the fragment released from the PTO with a CTO (Capture and Mold Oligonucleotide); wherein the CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a part of the 5' targeting portion of the PTO and (ii) a template portion comprising a nucleotide sequence not complementary to the 5 'targeting portion and the 3' targeting portion; wherein the fragment released from the PTO is hybridized to the capture portions of the CTO; (d) performing an extension reaction using the result of step (c) and template-dependent nucleic acid polymerase; wherein the fragment hybridized to the capture portion of the CTO is extended and an extended double-strand is formed; wherein the extended double-strand has a value of Tm that can be adjusted by (i) a sequence and / or a fragment length, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the length of the fragment and the sequence and / or the length of the CTO; (e) the fusion of the extended double tape over a temperature range to provide a target signal indicative of the presence of the extended double tape; wherein the target signal is provided by (i) at least one tag attached to the fragment and / or the CTO, (ii) a tag embedded within the extended double-tape during the extension reaction, (iii) a tag embedded within the double-tape extended during the extension reaction and a marking linked to the fragment and / or the CTO or (iv) intercalating marking; and (f) detecting the extended double-tape by measuring the target signal; wherein the presence of the extended double strand indicates the presence of the target nucleic acid sequence.
[000265] Since the preferred embodiment of the present invention follows the steps of the present method described above, the common descriptions among them are omitted to avoid unnecessary redundancy which leads to the complexity of this patent application.
[000266] According to a preferred embodiment, the method further comprises the repetition of steps (a) - (b), (a) - (d) or (a) - (f) with denaturation between repetition cycles. The repetition of the reaction is accompanied by the amplification of the target nucleic acid sequence. Preferably, the amplification is performed according to the PCR (polymerase chain reaction) which is disclosed in Pat. U.S. Nos. 4,683,195, 4,683,202 and 4,800,159.
[000267] According to a preferred embodiment, the method is performed to detect at least two types of target nucleic acid sequences.
[000268] According to a preferred embodiment, the at least two types of the target signals that correspond to at least two types of the target nucleic acid sequences are provided starting from the same type of markings; wherein the extended duplicates corresponding to at least two types of the target nucleic acid sequences have different Tm values from each other. III. PTOCE Target Detection Process That Comprises Detection at a Predetermined Temperature
[000269] The present invention can be modified to use a target signal generated in association with the formation of the extended double-tape.
[000270] In yet another aspect of this invention, a method is provided for the detection of a target nucleic acid sequence starting from DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension), which comprises: (a) the hybridization of the target nucleic acid sequence with an upstream oligonucleotide and a PTO (Probe and Mark Oligonucleotide); wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprises (i) a 3 'targeting portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence and (ii) a 5' targeting portion comprising a non-complementary nucleotide sequence the target nucleic acid sequence; wherein the 3 'targeting portion is hybridized to the target nucleic acid sequence and the 5' targeting portion is not hybridized to the target nucleic acid sequence; the upstream oligonucleotide is located upstream of the PTO; (b) contacting the result of step (a) with an enzyme that has 5 'nuclease activity under conditions for PTO cleavage; wherein the upstream oligonucleotide or its extended ribbon induces cleavage of the PTO through the enzyme that has the 5 'nuclease activity so that the cleavage releases a fragment comprising the 5' targeting portion or a part of the targeting 5 'from the PTO; (c) the hybridization of the fragment released from the PTO with a CTO (Capture and Mold Oligonucleotide); wherein the CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a part of the 5' targeting portion of the PTO and (ii) a template portion comprising a nucleotide sequence not complementary to the 5 'targeting portion and the 3' targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; (d) carrying out an extension reaction using the result of step (c) and a template-dependent nucleic acid polymerase; wherein the fragment hybridized to the capture portion of the CTO is extended to form an extended double-strand; wherein the extended double-strand has a value of Tm that can be adjusted by (i) a sequence and / or a fragment length, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the length of the fragment and the sequence and / or the length of the CTO; wherein the extended double-strand provides a target signal by (i) at least one tag attached to the fragment and / or CTO, (ii) a tag embedded within the extended double-strand during the extension reaction, (iii) by minus a tag attached to the fragment and / or CTO and a tag embedded within the extended double-tape during the extension reaction or (iv) interleaving tag; and (e) the detection of the extended double tape by measuring the target signal at a predetermined temperature that the extended double tape maintains its double tape form, in which the presence of the extended double tape indicates the presence of the sequence of target nucleic acid.
[000271] Since the preferred embodiment of the present invention follows the steps of the present method described above except for the fusion step, the common descriptions between them are omitted in order to avoid unnecessary redundancy leading to the complexity of this specification.
[000272] The present invention using the fusion analysis described above here requires the detection of markings signals at not less than two different temperatures because the target signal is provided by measuring the change in signal provided in the double-ribbon fusion extended.
[000273] Probably, in this aspect of this invention, the extended double-tape per se provides a signal capable of discriminating the formation starting from the non-formation of the extended double-tape and the signal is detected at a predetermined temperature that the extended double-tape maintains its double-stranded form, in which the presence of a target nucleic acid sequence is determined.
[000274] The present invention is for measuring a target signal in association with the formation of the extended double strand, for detecting the presence of the target nucleic acid sequence.
[000275] In the present invention, the extended double-tape has a marking so that the extended double-tape provides a target signal.
[000276] Preferably, the target signal includes a signal (signal generation or signal extinction) starting from a mark on the double-strip extended at a predetermined temperature.
[000277] The marking in the present invention can be performed in the same way as for the method using the melt analysis described above. Figures 2-13 can illustrate this aspect of the present invention with a small modification for detection at a predetermined temperature.
[000278] The working principle supports a target signal from the extended double-tape is as follows: (i) the length of the fragment induces the alteration of a signal from a mark to provide the target signal; or (ii) the hybridization of the fragment and the CTO induces the alteration of a signal from a mark to provide the target signal and the extended double-tape maintains the target signal.
[000279] The exemplified embodiment of the working principle (i) can be described with reference to Fig 9. When immobilized CTOs are used, the present invention detects a large number of target nucleic acid sequences in a much more efficient manner. The mold portion of the immobilized CTO has a reporter molecule and an extinction molecule. The reporter molecule and the extinction molecule are conformationally adjacent to each other to allow the extinction molecule to eliminate a signal from the reporter molecule. When the fragment is hybridized to the capture portion of the CTO, the extinction molecule extinguishes the signal from the reporter molecule. Through the formation of the extended double-strand, the reporter reporter molecule and the extinction molecule are conformationally separated to allow the extinction molecule not to eliminate the signal from the reporter molecule. The target signal is provided in the extension step (C and D in Figure 9).
[000280] In Figure 9, the hybrid between the non-cleaved PTO and CTO does not form an extended double-strand. Therefore, the extinction molecule is still allowed to eliminate a signal from the reporter molecule. The hybrid does not provide a non-target signal.
[000281] The modality exemplified for the working principle (ii) can be described with reference to Figure 6. The figure illustrates the present aspect as well as the method that uses fusion analysis. The 5 'targeting portion of the PTO has a reporter molecule and an extinction molecule. The reporter molecule and the extinction molecule are conformationally adjacent to each other to allow the extinction molecule to eliminate a signal from the reporter molecule. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment comprising the 5 'targeting portion with the reporter molecule and the extinction molecule and the fragment is hybridized to the capture portion of the CTO. Through hybridization, the reporter molecule and the extinction molecule are concomitantly separated to allow the extinction molecule not to eliminate the signal from the reporter molecule. The target signal is provided in the fragment hybridization step and the extended double-tape maintains the target signal (C and D in Figure 6).
[000282] In Figure 6, the hybrid between the non-cleaved PTO and CTO provides a non-target signal (C and D in Figure 6) and is necessary to dissociate the hybrid to remove the non-target signal. Therefore, the temperature for the measurement of the target signal is determined to dissociate the hybrid. According to a preferred embodiment, the temperature is further determined in consideration of the Tm value of the hybrid.
[000283] According to a preferred embodiment, the extended double-tape can be detected at temperatures where the hybrid is partially dissociated.
[000284] The predetermined temperature is greater than the Tm value of the hybrid minus 10oC, preferably greater than the Tm value of the hybrid minus 5oC, more preferably, greater than the Tm value of the hybrid and even more preferably, greater than the Tm value of the hybrid plus 5oC.
[000285] According to a preferred embodiment, the target signal provided by the extended double-tape is provided during the extension of step (d); wherein a hybrid between a non-cleaved PTO and CTO does not provide a non-target signal, as shown in Figures 2-4 and 9-11.
[000286] According to a preferred embodiment, the target signal provided by the extended double-strand is provided by the hybridization of the fragment and the CTO in step (c) and the formation of the extended double-strand maintains the target signal in step ( d); wherein a hybrid between a non-cleaved PTO and CTO provides a non-target signal; where the predetermined temperature is greater than the Tm value of the hybrid, as shown in Figures 5-8 and 12-13.
[000287] When the hybrid between the non-cleaved PTO and CTO provides a non-target signal (Panel D in Fig 6), it is necessary to dissociate the hybrid to remove the non-target signal. Therefore, the temperature for the measurement of the target signal is determined to dissociate the hybrid.
[000288] The marking systems useful in this invention will be described as follows: (i) Marking linked to the fragment and / or the CTO (i-1) Interactive dual marking
[000289] In a modality of a dual interactive marking system, the CTO has a dual interactive marking that comprises a reporter molecule and an extinction molecule; wherein the length of the fragment in step (d) induces the alteration of a signal from the interactive dual tag to provide the target signal. The first modality of the interactive dual marking system is illustrated in Figure 2. The target signal is provided with the signal generation synchronized with the extension.
[000290] According to a preferred embodiment, the reporter molecule and the extinction molecule can be located in the mold portion of the CTO.
[000291] According to a preferred modality, one of the reporter molecule and the extinction molecule in the CTO are located at its 5 'or 1-5 nucleotide end in addition to its 5' end and the other is located to extinguish and not extinguishing the signal from the reporter molecule depending on CTO conformation.
[000292] In a modality of a dual interactive marking system, the CTO has a dual interactive marking that comprises a reporter molecule and an extinction molecule; wherein the hybridization of the fragment and the CTO in step (c) induces the alteration of a signal from the interactive dual tag to provide the target signal and the extended double-tape maintains the target signal.
[000293] According to the preferred embodiment, the reporter molecule and the extinction molecule can be located in the capture portion of the CTO.
[000294] According to the preferred modality, a reporter molecule and an extinction molecule in the CTO are located at its 3 'or 1-5 nucleotide end in addition to its 3' end and the other is located to extinguish and not to extinguish the signal from the reporter molecule depending on the CTO conformation.
[000295] In this modality, the hybrid between the non-cleaved PTO and CTO provides a non-target signal; wherein the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid.
[000296] In a modality of an interactive dual tagging system, the fragment has an interactive dual tagging comprising a reporter molecule and an extinction molecule; wherein the hybridization of the fragment and the CTO in step (c) induces the alteration of a signal from the interactive dual tag to provide the target signal and the extended double-tape maintains the target signal. The first modality of the interactive dual marking system is illustrated in Figure 6.
[000297] According to the preferred embodiment, one of the reporter molecule and the extinction molecule in the fragment is located at its 5 'end or 1-5 nucleotides in addition to the 5' end of the fragment and the other is located to extinguish the signal from the reporter molecule depending on the fragment's conformation.
[000298] In this modality, the hybrid between the non-cleaved PTO and CTO provides a non-target signal; wherein the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid.
[000299] In an interactive marking system modality, in which the fragment has one of a dual interactive marking which comprises a reporter molecule and an extinction molecule and the CTO has the other of the interactive dual marking; wherein the hybridization of the fragment and the CTO in step (c) induces the alteration of a signal from the interactive dual tag to provide the target signal and the extended double-tape maintains the target signal. The modality of the interactive dual marking system is illustrated in Figures 8.
[000300] The reporter molecule and the extinction molecule can be located anywhere on the PTO fragment and the CTO, as long as the signal from the reporter molecule is extinguished by the extinction molecule.
[000301] According to the modality, the reporter molecule or the extinction molecule in the PTO fragment is located, preferably, at its 5 'end.
[000302] According to the modality, the reporter molecule or the extinction molecule in the CTO is located, preferably, at its 5 'end.
[000303] In this modality, the hybrid between the non-cleaved PTO and CTO provides a non-target signal; wherein the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid. (i-2) Isolated marking
[000304] In an embodiment of an isolated marking system, the CTO has an isolated marking and the length of the fragment in step (d) induces the alteration of a signal from the isolated marking to provide the target signal. The modality of the isolated marking system is illustrated in Figure 3. The target signal is provided with signal generation synchronized with the extension.
[000305] According to the modality, the mold portion of the CTO is marked with the isolated mark.
[000306] In an isolated tagging system, the CTO has an isolated tagging and fragment hybridization and the CTO in step (c) induces the alteration of a signal from the interactive dual tagging to provide the target signal and the extended double-tape maintains the target signal.
[000307] According to the modality, the capture portion of the CTO is marked with the isolated mark.
[000308] In this modality, the hybrid between the non-cleaved PTO and CTO provides a non-target signal; wherein the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid.
[000309] In an embodiment of an isolated tagging system, the fragment has an isolated tagging and the hybridization of the fragment and the CTO in step (c) induces the alteration of a signal from the interactive dual tagging to provide the target signal and the extended double-tape maintains the target signal. The modality of the isolated marking system is illustrated in Figure 12.
[000310] In this modality, the hybrid between the non-cleaved PTO and CTO provides a non-target signal; wherein the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid.
[000311] The isolated mark used here must be able to provide a different signal depending on its presence on the double ribbon or on the isolated ribbon. The isolated marking includes a fluorescent marking, a luminescent marking, a chemiluminescent marking, an electrochemical marking and a metallic marking. Preferably, the isolated label includes a fluorescent label. Preferred types and binding sites of isolated fluorescent labels used in this invention are disclosed in U.S. Pat. U.S. Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein as a reference in their entirety. Preferably, the isolated fluorescent label includes JOE, FAM, TAMRA, ROX and fluorescein-based labeling. A labeled nucleotide residue is preferably positioned on the inner nucleotide residue within the oligonucleotide rather than at the 5 'end or the 3' end.
[000312] The isolated fluorescent label useful in the present invention can be described with reference to the descriptions for the reporter and extinction molecules as indicated above.
[000313] In particular, when the present invention on the solid phase is carried out using an isolated label, it can use a general fluorescent label and does not require the specific fluorescent label capable of providing a fluorescent signal with different intensities depending on its presence on the tape double or on isolated tape.
[000314] When the CTO immobilized on a solid substrate is used, chemical labels (for example, biotin) or enzymatic labels (for example, alkaline phosphatase, peroxidase, β-galactosidase and β-gluocosidase).
[000315] In a preferred embodiment, the markings linked to the fragment and / or the CTO are positioned to the extent that when a hybrid between a non-cleaved PTO and CTO is formed, the hybrid does not provide a signal that is not targeted in the step (d), as shown in Figures 2-3 and 9.
[000316] Alternatively, the markings can be positioned to the extent that when a hybrid between an uncleaved PTO and CTO is formed, the hybrid provides a signal that is not targeted in step (d); where the Tm value of the extended double-tape is greater than that of the hybrid between the non-cleaved PTO and CTO as shown in Figures 6-8 and 12. (ii) Marking incorporated within the extended double-tape
[000317] In particular, when the present invention is carried out in a solid phase using an immobilized CTO, this marking system becomes more useful for providing the target signal as illustrated in Figures 10 and 11.
[000318] According to a preferred modality, the target signal is provided by an isolated mark incorporated within the extended double-tape during the extension reaction; wherein the isolated embedded tag is linked to an embedded nucleotide during the extension reaction; wherein the length of the fragment in step (d) induces the alteration of a signal from the isolated mark to provide the target signal in step (d).
[000319] According to a preferred embodiment, the nucleotide incorporated during the extension reaction has a first unnatural base and the CTO has a nucleotide that has a second unnatural base with a specific binding affinity with the first unnatural base, as illustrated in Figure 11. The nucleotide having the second unnatural base is preferably located anywhere on the CTO template portion.
[000320] When a mark embedded within the extended double-tape during the extension reaction is employed, a mark is not incorporated within the hybrid between the non-cleaved PTO and CTO because the hybrid is not extended. Therefore, the hybrid does not provide a signal that is not a target. (iii) Marking incorporated within the extended double-tape and marking linked to the fragment or the CTO
[000321] The present invention can employ a marking system using the cooperation of the incorporated marking inside the extended double-tape during the extension reaction and a marking linked to the fragment and / or the CTO, as illustrated in Figures 4 and 5.
[000322] According to a preferred embodiment, the target signal is provided by a mark incorporated within the extended double-tape during the extension reaction and a mark linked to the fragment and / or the CTO; wherein an embedded tag is attached to an embedded nucleotide during the extension reaction; wherein the two tags are an interactive dual tag of a reporter molecule and an extinction molecule; wherein the length of the fragment in step (d) induces the alteration of a signal from the interactive dual tag to provide the target signal.
[000323] More preferably, the nucleotide incorporated during the extension reaction has a first unnatural base and the CTO has a nucleotide that has a second unnatural base with a specific binding affinity to the first unnatural.
[000324] Preferably, the target signal provided in step (e) is a signal from the interactive dual mark in step (d).
[000325] When a mark embedded within the extended double-tape during the extension reaction is employed, a mark is not incorporated within the hybrid between the non-cleaved PTO and CTO because the hybrid is not extended. Therefore, the hybrid does not provide a signal that is not a target. (iv) Interleaving marking
[000326] The present invention can employ an interleaving marking to provide the target signal indicative of the presence of the extended double-tape. Interleaving labeling is most useful in a solid phase reaction using immobilized CTOs because the double-stranded nucleic acid molecules present in the samples can generate signals.
[000327] The exemplified embodiment is described with reference to Figure 13. The PTO hybridized to the target nucleic acid sequence is digested to release the fragment. The fragment is hybridized to the CTO. The extension is carried out in the presence of an intercalating dye (for example, SYBRTM Green) and forms the extended double-ribbon with intercalating dyes.
[000328] In Figure 13, the hybrid between the non-cleaved PTO and CTO provides a non-target signal (C and D in Figure 13) and it is necessary to dissociate the hybrid to remove the non-target signal. Therefore, the temperature for the measurement of the target signal is determined with consideration of the Tm value of the hybrid.
[000329] Preferably, the target signal provided in step (e) is a signal from the intercalating dye.
[000330] According to a preferred modality, the PTO and / or the CTO is blocked at its 3 'end to prohibit its extension.
[000331] According to a preferred embodiment, the upstream oligonucleotide is an upstream primer or an upstream probe.
[000332] According to a preferred embodiment, the upstream oligonucleotide is located adjacent to the PTO to the extent that the upstream oligonucleotide induces cleavage of the PTO through the enzyme that has the 5 'nuclease activity.
[000333] According to a preferred modality, the upstream primer induces through its extended ribbon the cleavage of the PTO through the enzyme that has the 5 'nuclease activity.
[000334] According to a preferred embodiment, the method further comprises the repetition of steps (a) - (b), (a) - (d) or (a) - (e) with denaturation between repetition cycles.
[000335] According to a preferred embodiment, steps (a) - (b) and (c) - (e) are carried out in a reaction vessel or in separate reaction vessels.
[000336] According to a preferred embodiment, the method is performed to detect at least two types of target nucleic acid sequences; wherein the upstream oligonucleotide comprises at least two types of oligonucleotides, the PTO comprises at least two types of the PTOs and the CTO comprises at least one type of the CTOs; wherein when at least two types of the target nucleic acid sequences are present, the method provides at least two types of the target signals that correspond to at least two types of the target nucleic acid sequences.
[000337] According to a preferred embodiment, the upstream oligonucleotide is an upstream primer and step (b) uses a template-dependent nucleic acid polymerase for extending the upstream primer.
[000338] According to a preferred embodiment, the CTO is immobilized through its 5 'end or 3' end on a solid substrate and the target signal provided on the solid substrate is measured.
[000339] According to a preferred embodiment, the target signal is provided by an isolated tag attached to the fragment or by an isolated tag incorporated within the extended double-tape during the extension reaction.
[000340] According to a preferred embodiment, the method is carried out in the presence of a downstream initiator.
[000341] The detection of step (e) can be carried out in a real-time manner, in an end-point manner or in a manner with predetermined time intervals. When the present invention further comprises the repetition of steps (a) - (b), (a) - (d) or (a) - (e), it is preferred that the signal detection is performed for each cycle of the repetition at a predetermined temperature (i.e., real time manner), at the end of the repetition at a predetermined temperature (i.e., end point fashion) or at each of the predetermined time intervals during the repetition at a predetermined temperature. Preferably, detection can be performed for each repetition cycle in a real-time manner to improve detection accuracy and quantification. IV. Target Detection Kits
[000342] In a further aspect of this invention, a kit is provided for the detection of a target nucleic acid sequence starting from a DNA or a mixture of nucleic acids through a PTOCE assay (PTO Cleavage and Extension), which comprises: (a) an upstream oligonucleotide comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence; (b) a PTO (Probe and Mark Oligonucleotide) comprising (i) a 3 'targeting portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence and (ii) a 5 targeting portion 'comprising a nucleotide sequence not complementary to the target nucleic acid sequence, wherein the 3' targeting portion is hybridized to the target nucleic acid sequence and the 5 'targeting portion is not hybridized to the sequence target nucleic acid; the upstream oligonucleotide is located upstream of the PTO; wherein the upstream oligonucleotide or its extended ribbon induces cleavage of the PTO by an enzyme that has 5 'nuclease activity so that the cleavage releases a fragment comprising the 5' targeting portion or a portion of the targeting 5 'from the PTO; and (c) a CTO (Capture and Mold Oligonucleotide) comprising in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'targeting portion or a portion of the 5 'targeting of the PTO and (ii) a template portion comprising a nucleotide sequence not complementary to the 5' targeting portion and the 3 'targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; and the fragment hybridized to the capture portion of the CTO is extended by a template-dependent nucleic acid polymerase to form an extended double strand.
[000343] Since the kit of this invention is built to perform the detection of the method of the present invention described above, the common descriptions between it are omitted in order to avoid unnecessary redundancy which leads to the complexity of this specification.
[000344] According to a preferred embodiment, the kit further comprises an enzyme that has 5 'nuclease activity.
[000345] According to a preferred embodiment, the kit further comprises a template-dependent nucleic acid polymerase.
[000346] According to a preferred embodiment, the PTO and / or the CTO has at least one mark.
[000347] According to a preferred modality, the kit also comprises a marking that will be incorporated inside the extended double-tape during the extension reaction.
[000348] According to a preferred modality, the kit further comprises a mark that will be incorporated within the extended double-tape during the extension reaction and the PTO and / or CTO has at least one mark.
[000349] According to a preferred embodiment, the kit further comprises an interleaving marking.
[000350] According to a preferred modality, a marking is an isolated marking or interactive dual marking.
[000351] According to a preferred embodiment, the kit is used for the detection of at least two types of nucleic acid sequences, the upstream oligonucleotide comprises at least two types of oligonucleotides, the PTO comprises at least two types of the PTO and the CTO comprises at least two types of the CTO.
[000352] According to a preferred embodiment, the CTO is immobilized through its 5 'end or 3' end on a solid substrate.
[000353] According to a preferred embodiment, the kit further comprises a downstream initiator.
[000354] All of the present kits described previously here can optionally include the reagents necessary to carry out the target PCR amplification reactions (e.g., PCR reactions) such as buffers, DNA polymerase cofactors and deoxyribonucleotide-5 -triphosphates. Optionally, the kits can also include several polynucleotide molecules, reverse transcriptase, various buffers and reagents and antibodies that inhibit DNA polymerase activity. Kits can also include reagents needed to perform positive and negative control reactions. The optimum amounts of reagents that will be used in a given reaction can easily be determined by the person skilled in the art who have the benefit of the present disclosure. Kits are typically adopted to contain the constituents described above in separate packages or compartments.
[000355] The characteristics and advantages of this invention will be summarized as follows: (a) The present invention provides an extended double-strand dependent on the target in which the PTO (Probing and Marking Oligonucleotide) that hybridizes to a sequence of Target nucleic acid is cleaved to release a fragment and the fragment is hybridized with CTO (Capture and Mold Oligonucleotide) to form an extended double strand. The extended double-strand provides a signal (signal generation or extinction) or a signal change (signal increase or decrease) indicating the presence of a target nucleic acid sequence. (b) The presence of the extended double-tape is determined by a variety of methods or processes such as analyzing the melting curve and detecting it at a predetermined temperature (for example, the real-time way and the end point way) ). (c) The present invention allows at least two types of target nucleic acid sequences to be detected simultaneously by analyzing the fusion curve even using a single type of label (e.g., FAM). In contrast, the conventional multiplex real-time method performed in a liquid phase is severely suffering from the limitation associated with the number of detectable fluorescent markings. The present invention makes it possible to successfully overcome such drawbacks and expand the application of real-time multiplex detection. (d) The present invention can be accomplished using a large number of marking systems. For example, markings attached to any PTO and / or CTO site can be used to provide the target signal indicating the extended double-strand. In addition, the markings incorporated within the extended double-tape during the extension reaction can be used in the present invention. In addition to this, the combination of such markings can be used. The versatile marking systems applicable to the present invention will allow you to choose an appropriate marking system depending on experimental conditions or objectives. (e) The present invention provides a target-dependent extended double-strand that has a predetermined Tm value that can be adjusted by (i) a sequence and / or a length of the fragment, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the length of the fragment and the sequence and / or the length of the CTO. (f) The analysis of the conventional melting curve using an amplified product depends on the sequence of the amplified product so that it is difficult to obtain a desired Tm value of the amplified product. In contrast, the present invention depends on the sequence of an extended double strand rather than the sequence of an amplified product, allowing to select a desired Tm value from the extended double strand. Therefore, the present invention can be easily adopted for the detection of various target sequences. (g) Analysis of the conventional fusion curve using direct hybridization between labeled probes and target nucleic acid sequences most likely generates false positive signals due to non-specific probe hybridization. In contrast, the present invention employs not only PTO hybridization, but also enzymatic cleavage and extension, which completely overcomes the problems of false positive signals. (h) the Tm value of analysis of the conventional fusion curve is affected by a sequence variation on the target nucleic acid sequences. However, an extended double-strand in the present invention provides a constant Tm value independent of a sequence variation over the target nucleic acid sequences, allowing to guarantee excellent accuracy in the analysis of the fusion curve. (i) It is noteworthy that the sequence of the 5 'targeting portion of PTO and the CTO sequence can be selected without regard to the target nucleic acid sequences. This makes it possible to pre-plan a set of sequences for the 5 'targeting portion of PTO and CTO. Although the 3 'targeting portion of the PTO has to be prepared in consideration of the target nucleic acid sequences, the CTO can be prepared in a ready-to-use manner without consideration or knowledge of the target nucleic acid sequences. Such features provide prominent advantages in multiple target detection, inter alia, over a microarray assay using CTOs immobilized on a solid substrate.
[000356] The present invention will now be described in further detail by the examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention that is presented in the appended claims is not limited to or by the examples. EXAMPLES EXAMPLE 1: Evaluation of the Cleavage & Extension Test of the Probing and Marking Oligonucleotide (PTOCE)
[000357] A new assay, Oligonucleotide Sounding and Cleavage & Extension Marking (PTOCE) assay, was assessed whether an extended double-strand can provide a target signal for the detection of a target nucleic acid sequence.
[000358] For this evaluation, the PTOCE assay that detects the presence of an extended double-strand through fusion analysis was performed (PTOCE assay that comprises fusion analysis). The present inventors used Taq DNA polymerase which has 5 'nuclease activity for the upstream primer extension, PTO cleavage and PTO fragment extension.
[000359] The extended double-tape formed during the test was planned to have an interactive dual marking. Interactive dual marking on the extended double-strand was provided by (i) CTO labeled with a reporter molecule and an extinction molecule (CTO with dual labeling) or (ii) PTO that has an extinction molecule and CTO that has a reporter molecule (a PTO with an extinction mark and a CTO with a reporter mark). PTO and CTO are blocked with a carbon spacer at their 3 'ends. The synthetic oligonucleotide for the Neisseria gonorrhoeae (NG) gene was used as a target template. 1-1. PTOCE assay using a CTO with dual labeling
[000360] The PTO has no markup. The CTO has an extinction molecule (BHQ-1) and a fluorescent reporter molecule (FAM) in its mold portion. The synthetic template, upstream primer, PTO and CTO sequences used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA CCGATCCATTGAAA-3GAT-3 '(3) ID NO: 2) NG-PTO-1 5'- ACGACGGCTTGGCTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3 '(SEQ ID NO: 3) NG-CTO-1 5' - [BHQ- 1] CCTCCTCCTCCTCCTCCTCC [T (FAMC] CCAGTAAG [spacer C3] -3 '(SEQ ID NO: 4) (Underlined letters indicate the 5' targeting portion of PTO)
[000361] The reaction was carried out in the final volume of 20 μL containing 2 pmoles of synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 3), 2 pmoles of CTO (SEQ ID NO: 4) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 1.6 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, BioRad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 30 cycles of 30 s at 95 ° C, 60 s at 60 ° C. After the reaction, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000362] As shown in Figure 14, a peak at 76.5 ° C that corresponds to the expected Tm value of the extended double-tape was detected in the presence of the mold. No peak was detected in the absence of the mold. Since the non-cleaved PTO and CTO hybrid does not provide any signal in this labeling method, there was no peak that corresponded to the non-cleaved PTO and CTO hybrid. In the case of no PTO or CTO, no peak was observed. 1-2. PTOCE assay using a PTO with extinction mark and a CTO with reporter mark
[000363] The PTO is marked with an extinction molecule (BHQ-1) at its 5 'end. The CTO is labeled with a fluorescent reporter molecule (FAM) at its 3 'end.
[000364] The synthetic template, upstream primer, PTO, and CTO sequences used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA CCGATCCATTGAAGAT-3GAT-3GATGG '(SEQ ID NO: 2) NG-PTO-2 5'- [BHQ- 1] ACGACGGCTTGGCTTTACTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 5) NG-CTO-2 5'- CCTCCTCCTCCTCCTCCTCCTAGTAGTAGTAG ] -3 '(SEQ ID NO: 6) (The underlined letters indicate the 5' targeting portion of PTO)
[000365] The reaction was carried out in the final volume of 20 μL containing 2 pmoles of synthetic mold (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 5), 2 pmoles of CTO (SEQ ID NO: 6) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 1.6 units of H-Taq DNA polymerase ( Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, BioRad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 30 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 30 s at 72 ° C. After the reaction, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000366] As shown in Figure 15, a peak at 77.0 ° C that corresponds to the expected Tm value of the extended double-tape was detected in the presence of the mold. Since the non-cleaved PTO and CTO hybrid provides a signal that is not targeted in this marking method, there was a peak at 64.0 ° C ~ 64.5 ° C that corresponds to the expected Tm value of the PTO hybrid and CTO not cleaved. In the case of no PTO or CTO, no peak was observed.
[000367] These results indicate that a target-dependent extended double strand is produced and the extended double strand provides the target signal indicating the presence of the target nucleic acid sequence. EXAMPLE 2: Ability to adjust the Tm value of an extended double-tape
[000368] It was further verified whether the Tm value of an extended double-strand can be adjusted by the CTO sequence in the PTOCE assay.
[000369] For verification, the present inventors used three types of CTOs that have different sequences in their mold portion. The PTO has no markup. The three types of CTOs have an extinction molecule (BHQ-1) and a fluorescent reporter molecule (FAM) in their mold portions. PTO and CTO are blocked with a carbon spacer at their 3 'ends.
[000370] The PTOCE assay comprising the fusion analysis was performed with each of the three types of CTOs.
[000371] The synthetic template sequences, upstream primer, PTOs and CTOs used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA CCGATCCATTATGAGATGAT '(SEQ ID NO: 2) NG-PTO-3 5'- ACGACGGCTTGGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 7) NG-CTO-1 5 '- [BHQ- 1] CCTCCTCCTCCTCCTCCTCC [T (FAM) ] CCAGTAAAGCCAAGCCGT CGT [spacer C3] -3 (SEQ ID NO: 4) NG-CTO-3 5 '- [BHQ- 1] TTTTTTTTTTCCTCCTCCAG [T (FAM)] AAAGCCAAGCCGTCGT [spacer C3] -3' (SEQ ID NO: 8) NG-CTO-4 5 '- [BHQ- 1] TTTTTTTTTTTTTTTTTTAG [T (FAM)] AAAGCCAAGCCGTCGT [spacer C3] -3' (SEQ ID NO: 9) (The underlined letters indicate the 5 'targeting portion PTO)
[000372] The reaction was carried out in the final volume of 20 μL containing 2 pmoles of synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 7), 2 pmoles of CTO (SEQ ID NOs: 4, 8 or 9) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 30 cycles of 30 s at 95 ° C, 60 s at 60 ° C. After the reaction, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000373] As shown in Figure 16, a peak was detected at 76.0 ° C, 69.0 ° C or 64.5 ° C in the presence of the mold. Each peak corresponds to the expected Tm of the extended double-strand generated from the verified CTO. No peak was detected in the absence of the mold.
[000374] These results indicate that the Tm value of the extended double ribbon can be adjusted by the CTO sequence. EXAMPLE 3: Detection of a target nucleic acid sequence using the PTOCE assay which comprises real-time detection or fusion analysis
[000375] It was further verified whether the PTOCE assay can detect a target nucleic acid sequence in the manner of real-time PCR (i) or in the manner of post-PCR fusion analysis (ii): (i) The cleavage of PTO and PTO fragment extension were accompanied with the amplification of a target nucleic acid through the PCR process and the presence of the extended double strand was detected at a predetermined temperature in each cycle (PTOCE assay that comprises detection in real time at a predetermined temperature) or; (ii) PTO cleavage and PTO fragment extension were accompanied with the amplification of a target nucleic acid through the PCR process and the presence of the extended double strand was detected through post-PCR fusion analysis (assay PTOCE which comprises fusion analysis).
[000376] The upstream primer is involved in the cleavage of PTO by an enzyme that has 5 'nuclease activity and also involved in the amplification of the target acid sequence with downstream primer through the PCR process. The Taq DNA polymerase that has 5 'nuclease activity was used for the extension of the upstream and downstream primers, the cleavage of PTO and the extension of the PTO fragment.
[000377] The extended double-tape was planned to have an interactive dual marking. The interactive dual labeling on the extended double-ribbon was provided by (i) CTO labeled with a reporter molecule and an extinction molecule, (ii) an iso-dGTP extinguisher incorporated during the extension reaction and CTO that has a reporter molecule and an iso-dC residue or (iii) PTO that has an extinction molecule and CTO that has a reporter molecule. PTO and CTO are blocked with a carbon spacer at their 3 'ends.
[000378] The genomic DNA of Neisseria gonorrhoeae (NG) was used as a target nucleic acid. 3-1. PTOCE assay using a CTO with dual labeling
[000379] The PTO has no markings and the CTO is marked with an extinction molecule (BHQ-1) and a fluorescent reporter molecule (FAM) in its mold portion.
[000380] The upstream, downstream primer, PTO and CTO sequences used in this Example are: NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10) NG-R 5'-CAATGGATCGGTATCACTCGC-3' ( SEQ ID NO: 2) NG-PTO-3 5'- ACGACGGCTTGGCCCCTCATTGGCGTGTTTCG [spacer C3] -3 '(SEQ ID NO: 7) NG-CTO-1 5' - [BHQ- 1] CCTCCTCCTCCTCCTCCTCC [T (FAMC] CCAGTAAG CGT [spacer C3] -3 '(SEQ ID NO: 4) (The underlined letters indicate the 5' targeting portion of PTO) 3-1-1. PTOCE test that comprises detection in real time at a predetermined temperature
[000381] The reaction was carried out in the final volume of 20 μL containing 100 pg of NG genomic DNA, 10 pmoles of downstream primer (SEQ ID NO: 10), 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 7), 2 pmoles of CTO (SEQ ID NO: 4) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 30 s at 72 ° C. The detection of the signal was carried out at 60 ° C of each cycle. The detection temperature was determined to the extent that the extended double tape maintains the shape of a double tape.
[000382] As shown in Figure 17A, the target signal (Ct 31.36) was detected in the presence of the mold. No signal was detected in the absence of the mold. 3-1-2. PTOCE assay comprising fusion analysis
[000383] After the reaction in Example 3-1-1, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C . Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000384] As shown in Figure 17B, a peak at 76.0 ° C that corresponds to the expected Tm value of the extended double-tape was detected in the presence of the mold. No peak was detected in the absence of the mold. Since the non-cleaved PTO and CTO hybrid does not provide any signal in this labeling method, there was no peak that corresponded to the non-cleaved PTO and CTO hybrid. 3-2. PTOCE assay using an iso-dGTP extinguisher and a reporter labeled CTO that has an iso-dC residue
[000385] The PTO has no markup. The CTO has a reporter molecule (FAM) and an iso-dC residue at its 5 'end. During the PTO fragment extension reaction, an iso-dGTP labeled with an extinction molecule (dabcyl) is incorporated in the complementary position to the iso-dC residue.
[000386] The upstream, downstream primer, PTO and CTO sequences used in this Example are: NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10) NG-R 5'-CAATGGATCGGTATCACTCGC-3' ( SEQ ID NO: 2) NG-PTO-1 5'- ACGACGGCTTGGCTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3 '(SEQ ID NO: 3) NG-CTO-5 5' - [FAM] [Iso-dC] CTCCTCCAGTAAAGCCAAGCCGTCGTT [spacer] -3 '(SEQ ID NO: 11) (The underlined letters indicate the 5' targeting portion of PTO) 3-2-1. PTOCE test that comprises detection in real time at a predetermined temperature
[000387] The reaction was carried out on the final volume of 20 μL containing 100 pg of NG genomic DNA, 10 pmoles of downstream primer (SEQ ID NO: 10), 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 3), 2 pmoles of CTO (SEQ ID NO: 11) and 10 μL of 2X Plexor® Master Mix (Cat. No. A4100, Promega, USA); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles from 30 s to 95 ° C 60 s to 60 ° C, 30 s to 72 ° C and 5 cycles from 30 s to 72 ° C, 30 s to 55 ° C . The signal detection was performed at 60 ° C of each cycle. The detection temperature was determined to the extent that the extended double tape maintains the shape of a double tape.
[000388] The DNA polymerase that has a 5 'nuclease in the Plexor® Master Mix was used for the extension of the upstream and downstream primers, the PTO cleavage and the extension of the PTO fragment.
[000389] As shown in Figure 18A, the target signal (Ct 33.03) was detected in the presence of the mold. No signal was detected in the absence of the mold. 3-2-2. PTOCE assay comprising fusion analysis
[000390] After the reaction in Example 3-2-1, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating to 35 ° C to 90 ° C ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000391] As shown in Figure 18B, a peak at 70.0 ° C that corresponds to the expected Tm value of the extended double-tape was detected in the presence of the mold. No peak was detected in the absence of the mold. Since the non-cleaved PTO and CTO hybrid does not provide any signal in this labeling method, there was no peak that corresponded to the non-cleaved PTO and CTO hybrid. 3-3. PTOCE assay using a PTO with extinction mark and a CTO with reporter mark
[000392] The PTO is marked with an extinction molecule (BHQ-1) at its 5 'end. The CTO is labeled with a fluorescent reporter molecule (FAM) at its 3 'end.
[000393] The upstream, downstream primer, PTO and CTO sequences used in this Example are: NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10) NG-R 5'-CAATGGATCGGTATCACTCGC-3' ( SEQ ID NO: 2) NG-PTO-4 5 '- [BHQ- 1] ACGACGGCTTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 12) NG-CTO-2 5'- CCTCCTCCTCCTCCTCCTCCTCCAGTAAAGCCAA- '(SEQ ID NO: 6) (The underlined letters indicate the 5' targeting portion of PTO) 3-3-1. PTOCE test that comprises detection in real time at a predetermined temperature
[000394] The reaction was carried out in the final volume of 20 μL containing 100 pg of NG genomic DNA, 10 pmoles of downstream primer (SEQ ID NO: 10), 10 pmoles of upstream primer (SEQ ID NO: 2), 5 PTO samples of PTO (SEQ ID NO: 12), 2 pmoles of CTO (SEQ ID NO: 6) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM of dNTPs and 1.6 units of H -Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 30 s at 72 ° C. The signal detection was performed at 60 ° C of each cycle. The detection temperature was determined to the extent that the extended double-strand maintains the double-stranded shape and the temperature is greater than the Tm value of a hybrid between PTO and non-cleaved CTO.
[000395] As shown in Figure 19A, the target signal (Ct 29.79) was detected in the presence of the mold. No signal was detected in the absence of the mold. 3-3-2. PTOCE assay comprising fusion analysis
[000396] After the reaction in Example 3-3-1, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C . Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000397] As shown in Figure 19B, a peak at 76.5 ° C that corresponds to the expected Tm value of the extended double-tape was detected in the presence of the mold. Since the non-cleaved PTO and CTO hybrid provides a signal that is not targeted in this labeling method, the peak corresponding to the Tm value of the non-cleaved PTO and CTO hybrid was detected at 48.0 ° C in the absence of the mold.
[000398] These results indicate that a target nucleic acid sequence can be detected through the PTOCE assay which comprises real-time detection or fusion analysis. EXAMPLE 4: Detection of various target nucleic acid sequences using the PTOCE assay which comprises fusion analysis
[000399] It has also been verified whether the PTOCE assay comprising fusion analysis can detect multiple target nucleic acid sequences using the same type as a reporter molecule.
[000400] The cleavage of PTOs and the extension of PTO fragments were accompanied with the amplification of target nucleic acid sequences through the PCR process and the presence of the extended duplicates was detected through post-PCR fusion analysis (assay PTOCE which comprises fusion analysis).
[000401] The extended doubles formed during the test were designed to have an interactive dual tagging. The interactive dual marking on the extended double-tape was provided by CTO marked with a reporter molecule and an extinction molecule in its mold portion. CTOs have the same type of fluorescent reporter molecule (FAM), but they have different sequences to generate different Tm values than extended doubles. PTO and CTO are blocked with a carbon spacer at their 3 'ends.
[000402] The genomic DNAs of Neisseria gonorrhoeae (NG) and Sta-phylococcus aureus (SA) were used as target nucleic acids.
[000403] The upstream, downstream primer, PTOs and CTOs sequences used in this Example are: NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10) NG-R 5'-CAATGGATCGGTATCACTCGC-3' ( SEQ ID NO: 2) NG-PTO-3 5'- ACGACGGCTTGGCCCCTCATTGGCGTGTTTCG [spacer C3] -3 '(SEQ ID NO: 7) NG-CTO-1 5' - [BHQ- 1] CCTCCTCCTCCTCCTCCTCC [T (FAMC] CCAGTAAG CGT [spacer C3] -3 '(SEQ ID NO: 4) SA-F 5'-TGTTAGAATTTGAACAAGGATTTAATC-3' (SEQ ID NO: 13) SA-R 5'-GATAAGTTTAAAGCTTGACCGTCTG-3 '(SEQ ID NO: 14) SA -PTO-1 5'- AATCCGACCACGCATTCCGTGGTCAATCATTCGGTT- TACG [spacer C3] -3 '(SEQ ID NO: 15) SA-CTO-1 5' - [BHQ- 1] TTTTTTTTTTTTTTTTTGCA [T (FAM)] AGG -3 '(SEQ ID NO: 16) (The underlined letters indicate the 5' targeting portion of PTO)
[000404] The reaction was carried out in the final volume of 20 μL containing 100 pg of NG genomic DNA, 100 pg of SA genomic DNA, 10 pmoles of each downstream primer (SEQ ID NOs: 10 and 13), 10 pmoles of each upstream initiator (SEQ ID NOs: 2 and 14), 5 pmoles of each PTO (SEQ ID NOs: 7 and 15), 2 pmoles of each CTO (SEQ ID NOs: 4 and 16) and 10 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 1.6 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 30 s at 72 ° C. After the reaction, the melting curve was obtained by cooling the reaction mixture to 35 ° C, maintaining it at 35 ° C for 30 s and slowly heating at 35 ° C to 90 ° C. Fluorescence was measured continuously during temperature rise to monitor the dissociation of double-stranded DNAs. The melting peak was derived from the melting curve data.
[000405] As shown in Figure 20, several target signals (Tm of NG: 75.5 ° C and Tm of SA: 63.5 ° C) were detected in the presence of the molds. No signal was detected in the absence of the molds.
[000406] These results indicate that the PTOCE assay that comprises the fusion analysis allows to detect several target nucleic acids using the same type of a reporter molecule (for example, FAM) in the condition that the extended duplicates that correspond target nucleic acids have different Tm values. EXAMPLE 5: Evaluation of the PTOCE assay comprising the fusion analysis on microarray
[000407] The PTOCE assay, which comprises the analysis of fusion on microarray, was additionally verified. The cleavage of PTO was performed in a separate container and an aliquot of the result was placed inside a microarray in which the CTO was immobilized. After the extension reaction, the presence of the extended double-tape was detected through the fusion analysis.
[000408] Taq DNA polymerase that has 5 'nuclease activity was used for the upstream primer extension, PTO cleavage and PTO fragment extension. The extended double-tape formed during the test was designed to have an isolated marking. Isolated labeling on the extended double-strand was provided by PTO labeled with Quasar570 as a fluorescent reporter molecule at its 5 'end. PTO and CTO are blocked with a carbon spacer at their 3 'ends. The CTO has poly (T) 5 as a binding arm and was immobilized on the surface of a glass slide through the use of an amino group (AminnoC7) at its 5 'end. A marker probe that has a fluorescent reporter molecule (Quasar570) at its 5 'end was immobilized on the surface of the glass slide using an amino group at its 3' end.
[000409] The synthetic template, upstream primer, PTO, CTO, and marker sequences used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA -GATCATGACGCGGGCGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGJGJGJGJGJGJGYL -3 '(SEQ ID NO: 2) NG-PTO-5 5'- [Square570] ACGACGGCTTGGCTTTACTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 17) NG-CTO-S1 5'- [Ami- noC7 ] TTTTTCCTCCTCCTCCTCCTCCTCCTCCAGTAAAGCCAAGCC GTCGT [spacer C3] -3 '(SEQ ID NO: 18) Marker 5' - [Quasar570] ATATATATAT [AminoC7] -3 '(SEQ ID NO: 19) (The underlined letters indicate the' targeting portion '' PTO)
[000410] NSB9 NHS slides (NSBPOSTECH, Korea) were used to manufacture the CTO and the marker (SEQ ID NOs: 18 and 19). The CTO and marker dissolved in NSB dot-forming buffer at the final concentration of 10 μM were printed on the NSB9 NHS slides with PersonalArrayer ™ 16 Microarray Spotter (CapitalBio, China). The CTO and the marker were applied in points side by side in a 2x1 format (points in duplicate) and the resulting microarray was incubated in a chamber maintained at ~ 85% humidity overnight. The slides were then washed in a buffered solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium bisphosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37 ° C for 30 min to remove the CTO and marker not specifically bound and washed with distilled water. Then, the DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4 ° C until use.
[000411] The cleavage reaction was carried out in the final volume of 50 μL containing 2 pmoles of synthetic mold (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 1 pmol PTO (SEQ ID NO: 17) and 25 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 4 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 30 cycles of 30 s at 95 ° C, 60 s at 63 ° C.
[000412] The 30 μL of the resulting mixture was applied to a chamber mounted on the NSB glass slide surface to which the CTO (SEQ ID NO: 18) was cross-linked. The slide was placed over the block in situ in a thermocycler (GenePro B4I, China). Six equal slides were prepared for the fusion analysis. The extension reaction was allowed for 20 min at 55 ° C. Then, the resulting slides were incubated for 1 min at room temperature. Finally, each slide was washed in distilled water for 1 min at 44 ° C, 52 ° C, 60 ° C, 68 ° C, 76 ° C or 84 ° C. Image acquisition was performed using Confocal Laser Scanner, Axon GenePix4100A (Molecular Device, US) with scanning at a pixel resolution of 5 μm. The fluorescence intensity was analyzed using the quantitative microarray analysis software, GenePix pro6.0 software (Molecular Device, US). The fluorescence intensity was expressed as medians of points after local background subtractions. Each point was duplicated for the reproducibility test. The fluorescence intensity indicates the average value of the duplicated points.
[000413] As shown in Figures 21A and 21B, the melting curve was obtained by measuring the fluorescent intensity starting from the points prepared through different washing temperatures. The presence of the extended double-tape was determined from the melting curve data. EXAMPLE 6: Evaluation of the PTOCE assay comprising the real-time detection on microarray
[000414] The PTOCE assay was also verified, which comprises the detection in real time at a predetermined temperature on a microarray.
[000415] PTO cleavage and PTO fragment extension were repeated over a microarray in which the CTO was immobilized. The presence of the extended double-tape was detected at a predetermined temperature in several determined cycles.
[000416] Taq DNA polymerase that has 5 'nuclease activity was used for the upstream primer extension, PTO cleavage and PTO fragment extension.
[000417] The extended double-tape formed during the test was planned to have an isolated marking or an interactive dual marking. The isolated marking on the extended double-tape was provided by PTO labeled with a reporter molecule (PTO labeled with reporter). The interactive dual labeling on the extended double-ribbon was provided by CTO labeled with a reporter molecule and an extinction molecule (CTO with dual labeling). PTO and CTO are blocked with a carbon spacer at their ends 3 '.
[000418] The CTO has poly (T) as a binding arm. The CTO was immobilized on a glass slide using an amino group (AminnoC7) at its 5 'end or its 3' end. A marker probe that has a fluorescent reporter molecule (Quasar570) at its 5 'end was immobilized on the glass slide using an amino group at its 3' end. A fluorescent intensity on the glass slide was measured at a predetermined temperature. The detection temperature was determined to the extent that the extended double tape maintains the shape of a double tape. The synthetic oligonucleotide for Neisseria gonorrhoeae (NG) was used as a template. 6-1. PTOCE assay using a reporter-tagged PTO
[000419] The PTO has Quasar570 as a fluorescent reporter molecule at its 5 'end. The CTO was immobilized through its 5 'end. In this marking method, the detection temperature was determined to the extent that the extended double strand maintains the shape of a double strand and the temperature is greater than the Tm value of a hybrid between PTO and non-cleaved CTO.
[000420] The synthetic template, upstream primer, PTO, CTO and marker sequences used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA CCGATCCATTATGATGA -3 '(SEQ ID NO: 2) NG-PTO-5 5'- [Square570] ACGACGGCTTGGCTTTACTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 17) NG-CTO-S1 5'- [Ami- noC7 ] TTTTTCCTCCTCCTCCTCCTCCTCCTCCAGTAAAGCCAAGCC GTCGT [spacer C3] -3 '(SEQ ID NO: 18) Marker 5' - [Quasar570] ATATATATAT [AminoC7] -3 '(SEQ ID NO: 19) (The underlined letters indicate the' targeting portion '' PTO)
[000421] The slide preparation was carried out with the same protocol used in Example 5.
[000422] The PTOCE reaction was carried out in the final volume of 30 μL containing 2 pmoles of synthetic mold (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 1 pmol PTO (SEQ ID NO: 17) and 15 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 2.4 units of H-Taq DNA polymerase (Solgent, Korea); the whole mixture was applied in a chamber mounted on the NSB glass slide surface to which the CTO (SEQ ID NO: 18) was cross-linked. The slide was placed on a block in situ in a thermocycler (GenePro B4I, China). five slides of the same type were prepared for the analysis of cycles. The PTOCE reaction was performed as follows: 15 min denaturation at 95 ° C and 0, 5, 10, 20 or 30 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 60 s at 55 ° C. After reacting the corresponding number of cycles, the slides were washed in distilled water at 64 ° C for 1 min. Image acquisition was performed after each wash using Confocal Laser Scanner, Axon GenePix4100A (Molecular Device, US) with scanning at 5 μm pixel resolution. The fluorescence intensity was analyzed using the quantitative microarray analysis software, GenePix pro6.0 software (Molecular Device, US). The fluorescence intensity was expressed as medians of points after local background subtractions. Each point was duplicated for the reproducibility test. The fluorescence intensity indicates the average value of the duplicated points.
[000423] As shown in Figures 22A and 22B, the fluorescent intensity for the target nucleic acid sequence was increased depending on the number of cycles (0 cycle_UFR: 1,304 ± 0.7; 5 cycles_UFR: 18,939 ± 1,342, 1; 10 cycles_UFR: 30,619 ± 285,0; 20 cycles_UFR: 56,248 ± 2,208.3; and 30 cycles_UFR: 64,645 ± 1,110.2) in the presence of the mold. There was no change in fluorescent intensity depending on the number of cycles in the absence of the mold. 6-2. PTOCE assay using a CTO with dual labeling
[000424] The CTO was immobilized through its 3 'end and has an extinction molecule (BHQ-2) and a fluorescent reporter molecule (Quasar570) in its mold portion.
[000425] The synthetic template, upstream primer, PTO, CTO and marker sequences used in this Example are: NG-T 5'- AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTTG- TTCTTGCTCGGCAGAGCGAGTGATA CCGATGATGA -3 '(SEQ ID NO: 2) NG-PTO-6 5'- ACGACGGCTTGGCTTTACTGCCCCTCATTGGCGTG- TTTCG [spacer C3] -3' (SEQ ID NO: 20) NG-CTO-S2 5'- [BHQ- 2] CCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT Read sight online, ahead. T (Quasar570)] CCAGTAAAGCCAAG CCGTCGTTTTTTT TTTT [AminoC7] -3 '(SEQ ID NO: 21) Marker 5' - [Quasar570] ATATATATAT [AminoC7] -3 '(SEQ ID NO: 19) (The underlined letters indicate the portion of 5 'targeting of PTO)
[000426] The slide preparation was carried out with the same protocol used in Example 5.
[000427] The PTOCE reaction was carried out in the final volume of 30 μL containing 2 pmoles of synthetic mold (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 1 pmol PTO (SEQ ID NO: 20) and 15 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM dNTPs and 2.4 units of H-Taq DNA polymerase (Solgent, Korea); the whole mixture was applied in a chamber mounted on the NSB glass slide surface to which the CTO was cross-linked (SEQ ID NO: 21). The slide was placed on a block in situ in a thermocycler (GenePro B4I, China). Five slides of the same type were prepared for the analysis of cycles. The PTOCE reaction was carried out as follows: 15 min denaturation at 95 ° C and 0, 5, 10, 20 or 30 cycles of 30 s at 95 ° C, 60 s at 60 ° C, 60 s at 50 ° C. After reacting the number of corresponding cycles, image acquisition was performed using Confocal Laser Scanner, Axon GenePix4100A (Molecular Device, US) with scanning at a pixel resolution of 5 μm. The fluorescence intensity was analyzed using the quantitative microarray analysis software, GenePix pro6.0 software (Molecular Device, US). The fluorescence intensity was expressed as medians of points after local background subtractions. Each point was duplicated for the productivity test. The fluorescence intensity indicates the average value of the duplicated points.
[000428] As shown in Figures 23A and 23B, the fluorescent intensity for the target nucleic acid sequence was increased depending on the number of cycles (0 cycle_UFR: 28,078 ± 460.3; 5 cycles_UFR: 35,967 ± 555.1; 10 cycles_UFR: 44,674 ± 186,0; 20 cycles_UFR: 65,423 ± 2,1; and 30 cycles_UFR: 65,426 ± 2,8) in the presence of mold. There was no change in fluorescent intensity depending on the number of cycles in the absence of the mold. EXAMPLE 7: Detection of several target nucleic acid sequences through the PTOCE assay which comprises end-point detection at a predetermined temperature on a microarray
[000429] The detection of multiple targets was additionally verified through the PTOCE assay, which comprises end-point detection at a predetermined temperature on a microarray.
[000430] PTO cleavage was performed in a separate container with a PCR process and an aliquot of the result was placed inside a microarray in which the CTO was immobilized. After the extension reaction, the presence of the extended double-strand was detected by end-point detection at a predetermined temperature.
[000431] Taq DNA polymerase that has 5 'nuclease activity was used for the upstream and downstream primer extension, PTO cleavage and PTO fragment extension.
[000432] The extended double-tape formed during the test was planned to have an isolated marking. Isolated labeling on the extended double-strand was provided by Quasar570-labeled PTO as a fluorescent reporter molecule at the 5 'end of the PTO. PTO and CTO are blocked with a carbon spacer at their 3 'ends.
[000433] The CTO has poly (T) 5 as a binding arm and was immobilized on a glass slide through the use of an amino group (AminnoC7) at its 5 'end. A marker probe that has a fluorescent reporter molecule (Quasar570) at its 5 'end was immobilized on the glass slide using an amino group at its 3' end.
[000434] A fluorescent intensity on the glass slide was measured at a predetermined temperature. The detection temperature was determined to the extent that the extended double-strand maintains the double-stranded shape and the temperature is greater than the Tm value of a hybrid between PTO and non-cleaved CTO. The genomic DNA of Staphylococcus aureus (SA) and Neisseria gonorrhoeae (NG) were used.
[000435] The upstream, downstream primer, PTO, CTO and marker sequences used in this Example are: NG-F 5'- TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10) NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2) NG-PTO-5 5'- [Square570] ACGACGGCTTGGCTTTACTGCCCCTCATTGGCGTGTTTCG [spacer C3] -3' (SEQ ID NO: 17) NG-CTO-S1 5'- [Ami- noC7] TTTTTTCCCC GTCGT [spacer C3] -3 '(SEQ ID NO: 18) SA-F 5'-TGTTAGAATTTGAACAAGGATTTAATC-3' (SEQ ID NO: 13) SA-R2 5'-TTAGCTCCTGCTCCTAAACCA-3 '(SEQ ID NO: 22) SA -PTO-2 5 '- [Quasar570] AATCCGACCACGCTATGCTCATTCCG- TGGTCAATCATTCGGTTTACG [spacer C3] - 3' (SEQ ID NO: 23) SA_CTO-S1 5'- [Ami- noC7] TTTTTCTTCTGTTCTGTTCTTCTTCTTCTTCTGTTC NO: 24) Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19) (Underlined letters indicate the 5 'targeting portion of PTO)
[000436] The slide preparation was carried out with the same protocol used in Example 5.
[000437] The cleavage reaction was carried out in the final volume of 50 μL containing each 100 pg genomic DNA of SA and / or NG, each 10 pmoles of downstream primer (SEQ ID NOs: 10 and / or 13), each 10 pmoles of upstream initiator (SEQ ID NOs: 2 and / or 22), each 1 pmol of PTO (SEQ ID NOs: 17 and / or 23) and 25 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM of dNTPs and 4 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles of 30 s at 95 ° C, 60 s at 63 ° C. The 30 μL of the resulting mixture was applied in a chamber mounted on the NSB glass slide surface to which the CTOs (SEQ ID NOs: 18 and 24) were cross-linked. The slide was placed on a block in situ in a thermocycler (GenePro B4I, China). The extension reaction was allowed for 20 min at 55 ° C. Then the slides were washed in distilled water at 64 ° C for 1 min. Image acquisition was performed after each wash using Confocal Laser Scanner, Axon GenePix4100A (Molecular Device, US) with scanning at a pixel resolution of 10 μm. The fluorescence intensity was analyzed using the quantitative microarray analysis software, GenePix pro6.0 software (Molecular Device, US). The fluorescence intensity was expressed as medians of points after local background subtractions. Each point was duplicated for the reproducibility test. The fluorescence intensity indicates the average value of the duplicated points.
[000438] As shown in Figure 24, the target signal for SA (UFR: 65,192 ± 198.7) was detected in the presence of SA mold. The target signal for NG (UFR: 65,332 ± 1.4) was detected in the presence of NG template. Both target signals for SA (UFR: 65,302 ± 0,7) and NG (UFR 65,302 ± 0,7) were detected in the presence of both molds.
[000439] Having described a preferred embodiment of the present invention, it should be understood that variants and modifications thereof that fit within the spirit of the invention can be made apparent to those skilled in the art and the scope of this invention should be determined by the appended claims and their equivalents. GTCGT [spacer C3] -3 '(SEQ ID NO: 18) SA-F 5'-TGTTAGAATTTGAACAAGGATTTAATC-3' (SEQ ID NO: 13) SA-R2 5'-TTAGCTCCTGCTCCTAAACCA-3 '(SEQ ID NO: 22) SA -PTO-2 5 '- [Quasar570] AATCCGACCACGCTATGCTCATTCCG- TGGTCAATCATTCGGTTTACG [spacer C3] - 3' (SEQ ID NO: 23) SA_CTO-S1 5'- [Ami- noC7] TTTTTCTTCTGTTCTGTTCTTCTTCTTCTTCTGTTC NO: 24) Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19) (Underlined letters indicate the 5 'targeting portion of PTO)
[000440] The slide preparation was carried out with the same protocol used in Example 5.
[000441] The cleavage reaction was carried out in the final volume of 50 μL containing each 100 pg genomic DNA of SA and / or NG, each 10 pmoles of downstream primer (SEQ ID NOs: 10 and / or 13), each 10 pmoles of upstream initiator (SEQ ID NOs: 2 and / or 22), each 1 pmol of PTO (SEQ ID NOs: 17 and / or 23) and 25 μL of 2X Master Mix containing 2.5 mM MgCl2, 200 μM of dNTPs and 4 units of H-Taq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the thermocycler in real time (CFX96, Bio-Rad); the reaction mixture was denatured for 15 min at 95 ° C and subjected to 60 cycles of 30 s at 95 ° C, 60 s at 63 ° C. The 30 μL of the resulting mixture was applied in a chamber mounted on the NSB glass slide surface to which the CTOs (SEQ ID NOs: 18 and 24) were cross-linked. The slide was placed on a block in situ in a thermocycler (GenePro B4I, China). The extension reaction was allowed for 20 min at 55 ° C. Then the slides were washed in distilled water at 64 ° C for 1 min. Image acquisition was performed after each wash using Confocal Laser Scanner, Axon GenPix4100A (Molecular Device, US) with scanning at a pixel resolution of 10 μm. The fluorescence intensity was analyzed using the quantitative microarray analysis software, GenePix pro6.0 software (Molecular Device, US). The fluorescence intensity was expressed as medians of points after local background subtractions. Each point was duplicated for the reproducibility test. The fluorescence intensity indicates the average value of the duplicated points.
[000442] As shown in Figure 24, the target signal for SA (UFR: 65,192 ± 198.7) was detected in the presence of SA mold. The target signal for NG (UFR: 65,332 ± 1.4) was detected in the presence of NG template. Both target signals for SA (UFR: 65,302 ± 0,7) and NG (UFR 65,302 ± 0,7) were detected in the presence of both molds.
[000443] Having described a preferred embodiment of the present invention, it should be understood that variants and modifications thereof that fit within the spirit of the invention can be made apparent to those skilled in the art and the scope of this invention should be determined by the appended claims and their equivalents.

权利要求:
Claims (16)
[0001]
1. Method for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids using a PTOCE assay (Cleavage and Extension with PTO), characterized by the fact that it comprises the following steps: (a) hybridize the sequence target nucleic acid with an upstream oligonucleotide and a PTO (Probe and Mark Oligonucleotide); wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the PTO comprising (i) a 3 'targeting portion comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence and (ii) a 5' labeling portion comprising a nucleotide sequence not complementary to the targeting sequence target nucleic acid; wherein the targeting portion 3 'is hybridized to the target nucleic acid sequence and the targeting portion 5' is not hybridized to the target nucleic acid sequence; the upstream oligonucleotide is located upstream of the PTO; (b) contacting the result of step (a) with an enzyme that has a 5 'nuclease activity under conditions for PTO cleavage; wherein the upstream oligonucleotide or its extended ribbon induces cleavage of the PTO by the enzyme that possesses the 5 'nuclease activity such that the cleavage releases a fragment comprising the 5' tag portion or a part of the 5 'tag portion of the PTO; (c) hybridize the fragment released from the PTO with a CTO (Capture and Mold Oligonucleotide); wherein the CTO comprises in a 3 'to 5' direction (i) a capture portion comprising a nucleotide sequence complementary to the 5 'labeling portion or a part of the 5' labeling portion of the PTO and (ii) a portion template comprising a nucleotide sequence not complementary to the 5 'labeling portion and the 3' targeting portion of the PTO; wherein the fragment released from the PTO is hybridized to the capture portion of the CTO; (d) performing an extension reaction using the result of the e-tapa (c) and a mold-dependent nucleic acid polymerase; wherein the fragment hybridized to the capture portion of the CTO is extended and an extended doublet is formed; wherein the extended doublet has a value of Tm that can be adjusted by (i) a sequence and / or a length of the fragment, (ii) a sequence and / or a length of the CTO or (iii) the sequence and / or the fragment length and the CTO sequence and / or length; (e) fusing the extended doublet over a temperature range to provide a target signal indicative of the presence of the extended doublet; wherein the target signal is provided by (i) at least one tag attached to the fragment and / or the CTO, (ii) a tag embedded within the extended doublet during the extension reaction, (iii) a tag embedded within the extended doublet during the extension reaction and a tag attached to the fragment and / or the CTO or (iv) an interleaving tag; and (f) detecting the extended doublet by measuring the target signal; wherein the presence of the extended doublet indicates the presence of the target nucleic acid sequence.
[0002]
2. Method according to claim 1, characterized by the fact that the presence of the extended double is detected through the fusion analysis.
[0003]
Method according to claim 1, characterized by the fact that the fusion of step (e) is followed by hybridization to provide the target signal indicative of the presence of the extended doublet.
[0004]
Method according to claim 1, characterized by the fact that the target signal is provided by at least one tag linked to the fragment and / or the CTO.
[0005]
5. Method according to claim 4, characterized by the fact that the fragment or the CTO has an interactive dual label comprising an emission molecule and an extinction molecule; wherein the merger of the doublet extended in step (e) induces the alteration of a signal from the interactive dual mark to provide the target signal in step (e).
[0006]
6. Method according to claim 4, characterized by the fact that the fragment has one of an interactive dual labeling comprising an emission molecule and an extinction molecule and the CTO has the other of the interactive dual labeling; wherein the merger of the doublet extended in step (e) induces the alteration of a signal from the interactive dual markings to provide the target signal in step (e).
[0007]
7. Method according to claim 4, characterized by the fact that the fragment or CTO has a single mark and the merger of the double extended in step (e) induces the alteration of a signal from the single mark to provide the signal- target in step (e).
[0008]
8. Method according to claim 1, characterized by the fact that the target signal is provided through a single mark incorporated within the extended doublet during the extension reaction; wherein the single embedded tag is attached to an embedded nucleotide during the extension reaction; wherein the merger of the doublet extended in step (e) induces the alteration of a signal from the single mark to provide the target signal in step (e).
[0009]
9. Method according to claim 1, characterized in that the target signal is provided by an embedded tag within the extended doublet during the extension reaction and a tag linked to the fragment and / or the CTO, and the embedded tag it is linked to a nucleotide incorporated during the extension reaction; wherein the two markings are an interactive dual mark of an emission molecule and an extinction molecule; wherein the merger of the doublet extended in step (e) induces the alteration of a signal from the interactive dual mark to provide the target signal in step (e).
[0010]
Method according to claim 1, characterized in that the upstream oligonucleotide is an upstream primer or an upstream probe.
[0011]
11. Method according to claim 1, characterized by the fact that the upstream oligonucleotide has a partially overlapping sequence with the 3 'targeting portion of the PTO.
[0012]
12. Method according to claim 1, characterized by the fact that it also includes the repetition of steps (a) - (b), (a) - (d) or (a) - (f) with denaturation between the cycles of repetition.
[0013]
13. Method according to claim 1, characterized in that it is carried out to detect at least two types of target nucleic acid sequences; wherein the upstream oligonucleotide comprises at least two types of oligonucleotides, the PTO comprises at least two types of the PTOs and the CTO comprises at least one type of the CTOs.
[0014]
Method according to claim 1, characterized in that the target nucleic acid sequence comprises a variation of nucleotide.
[0015]
Method according to claim 1, characterized in that the CTO is immobilized through its 5 'end or its 3' end on a solid substrate.
[0016]
16. Method according to any one of claims 1 to 15, characterized by the fact that it is carried out in the presence of

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112012026221B1|2021-03-02|method and kit for detecting a target nucleic acid sequence of a dna or a mixture of nucleic acids using a ptoce assay

---

US10731203B2|2020-08-04|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide hybridization assay

---

US11078525B2|2021-08-03|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage

---

ES2653642T3|2018-02-08|Detection of a target nucleic acid sequence by assay without cleavage-dependent hybridization and extension of PTO

---

ES2669244T3|2018-05-24|Detection of nucleotide variation in a target nucleic acid sequence by CTO cleavage and extension assay

---

JP6096885B2|2017-03-15|Detection of Target Nucleic Acid Sequences Using PTO Cleavage and Extension-Dependent Signaling Oligonucleotide Cleavage {DetectionofTargetNucleicAcidSequencePTOCleavageandExtension- DependentSignalingOligocleationClaveage}

---

JP6295322B2|2018-03-14|Detection of target nucleic acid sequences in solid phase by PTO cleavage and extension analysis using hCTO

---

NZ706144B2|2017-02-28|Detection of target nucleic acid sequences by pto cleavage and extension assay

---

NZ604338B2|2015-09-01|Detection of target nucleic acid sequences by pto cleavage and extension assay

同族专利:

---

公开号 | 公开日

---

JP6054357B2|2016-12-27|

---

CN102959092A|2013-03-06|

---

EP2826868B1|2017-03-08|

---

US8809239B2|2014-08-19|

---

EP3967774A1|2022-03-16|

---

ES2538459T3|2015-06-22|

---

JP2015070848A|2015-04-16|

---

CA2802494C|2019-06-18|

---

BR122019022355B1|2021-05-11|

---

US10519489B2|2019-12-31|

---

NO20121065A1|2012-12-18|

---

MX2013001510A|2013-02-27|

---

AU2012205956A1|2013-01-31|

---

EP2708608B1|2017-03-15|

---

EP2572004A2|2013-03-27|

---

RU2012142160A|2015-02-20|

---

US20150086984A1|2015-03-26|

---

UA115082C2|2017-09-11|

---

KR101462192B1|2014-11-14|

---

ES2628327T3|2017-08-02|

---

SG190758A1|2013-08-30|

---

WO2012096523A2|2012-07-19|

---

BR122019022348B1|2021-05-11|

---

US20160312271A1|2016-10-27|

---

PL2708608T3|2017-09-29|

---

EP2826868A1|2015-01-21|

---

IL243623A|2017-06-29|

---

WO2012096523A3|2012-12-06|

---

ES2629759T3|2017-08-14|

---

AU2012205956B2|2015-07-16|

---

IL223608A|2016-08-31|

---

MX340258B|2016-07-01|

---

DK2572004T3|2015-06-08|

---

CA2802494A1|2012-07-19|

---

WO2012096523A9|2014-01-23|

---

EP3543352A1|2019-09-25|

---

JP2017070298A|2017-04-13|

---

WO2012096430A1|2012-07-19|

---

EP3168311A1|2017-05-17|

---

MX352460B|2017-11-24|

---

US9540681B2|2017-01-10|

---

JP6244440B2|2017-12-06|

---

MY174052A|2020-03-05|

---

CA2979858A1|2012-07-19|

---

US20200087718A1|2020-03-19|

---

EP3543352B1|2021-10-20|

---

CN103866037B|2016-09-07|

---

PT2708608T|2017-06-26|

---

NZ604338A|2015-05-29|

---

NZ706144A|2016-11-25|

---

BR112012026221A2|2017-01-10|

---

RU2566562C2|2015-10-27|

---

IN2013CN00284A|2015-10-02|

---

US20130109588A1|2013-05-02|

---

US20170073744A1|2017-03-16|

---

US10280453B2|2019-05-07|

---

KR20130006477A|2013-01-16|

---

JP2013538041A|2013-10-10|

---

CN102959092B|2016-01-13|

---

PT2572004E|2015-07-07|

---

NO343803B1|2019-06-11|

---

CA3023333C|2020-06-16|

---

CN103866037A|2014-06-18|

---

PL2572004T3|2015-08-31|

---

JP5756854B2|2015-07-29|

---

ZA201209536B|2014-03-26|

---

CA2979858C|2019-06-18|

---

EP2572004A4|2013-05-29|

---

EP2708608A1|2014-03-19|

---

EP2572004B1|2015-03-04|

---

EP3168311B1|2019-05-15|

---

CA3023333A1|2012-07-19|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3996345A|1974-08-12|1976-12-07|Syva Company|Fluorescence quenching with immunological pairs in immunoassays|

---

US4351760A|1979-09-07|1982-09-28|Syva Company|Novel alkyl substituted fluorescent compounds and polyamino acid conjugates|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

US4800159A|1986-02-07|1989-01-24|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US5210015A|1990-08-06|1993-05-11|Hoffman-La Roche Inc.|Homogeneous assay system using the nuclease activity of a nucleic acid polymerase|

---

US5965364A|1990-10-09|1999-10-12|Benner; Steven Albert|Method for selecting functional deoxyribonucleotide derivatives|

---

US5432272A|1990-10-09|1995-07-11|Benner; Steven A.|Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases|

---

DK51092D0|1991-05-24|1992-04-15|Ole Buchardt|OLIGONUCLEOTIDE ANALOGUE DESCRIBED BY PEN, MONOMERIC SYNTHONES AND PROCEDURES FOR PREPARING THEREOF, AND APPLICATIONS THEREOF|

---

US5541311A|1992-12-07|1996-07-30|Third Wave Technologies, Inc.|Nucleic acid encoding synthesis-deficient thermostable DNA polymerase|

---

CA2170264A1|1993-09-10|1995-03-16|Michael W. Konrad|Optical detection of position of oligonucleotides on large dna molecules|

---

US5538848A|1994-11-16|1996-07-23|Applied Biosystems Division, Perkin-Elmer Corp.|Method for detecting nucleic acid amplification using self-quenching fluorescence probe|

---

US6037120A|1995-10-12|2000-03-14|Benner; Steven Albert|Recognition of oligonucleotides containing non-standard base pairs|

---

US5994069A|1996-01-24|1999-11-30|Third Wave Technologies, Inc.|Detection of nucleic acids by multiple sequential invasive cleavages|

---

US6562611B1|1996-11-29|2003-05-13|Third Wave Technologies, Ins.|FEN-1 endonucleases, mixtures and cleavage methods|

---

DE69735313T2|1996-06-04|2006-11-02|University Of Utah Research Foundation, Salt Lake City|Fluorescence donor-acceptor pair|

---

ES2192672T3|1996-11-18|2003-10-16|Takeshi Imanishi|NEW ANALOGS OF NUCLEOTIDES.|

---

JP3756313B2|1997-03-07|2006-03-15|武 今西|Novel bicyclonucleosides and oligonucleotide analogues|

---

CA2303299C|1997-09-12|2016-02-23|Exiqon A/S|Oligonucleotide analogues|

---

GB9812768D0|1998-06-13|1998-08-12|Zeneca Ltd|Methods|

---

JP4724380B2|1999-04-20|2011-07-13|独立行政法人産業技術総合研究所|Nucleic acid probe used in nucleic acid measurement method and data analysis method|

---

US6322980B1|1999-04-30|2001-11-27|Aclara Biosciences, Inc.|Single nucleotide detection using degradation of a fluorescent sequence|

---

US7537886B1|1999-06-22|2009-05-26|Life Technologies Corporation|Primers and methods for the detection and discrimination of nucleic acids|

---

US7118860B2|1999-10-29|2006-10-10|Stratagene California|Methods for detection of a target nucleic acid by capture|

---

US7585632B2|1999-10-29|2009-09-08|Hologic, Inc.|Compositions and methods for the detection of a nucleic acid using a cleavage reaction|

---

US7381532B2|1999-10-29|2008-06-03|Stratagene California|Compositions and methods for the detection of a nucleic acid using a cleavage reaction|

---

US6656692B2|1999-12-21|2003-12-02|Ingeneus Corporation|Parallel or antiparallel, homologous or complementary binding of nucleic acids or analogues thereof to form duplex, triplex or quadruplex complexes|

---

US6265170B1|2000-01-24|2001-07-24|Ingeneus Corporation|Homogenous assay of duplex of triplex hybridization by means of multiple measurements under varied conditions|

---

DK1715063T3|2000-03-29|2011-05-16|Lgc Ltd|Hydration beacon and method for rapid sequence detection and distinction|

---

AT497018T|2000-05-19|2011-02-15|Eragen Biosciences Inc|MATERIALS AND METHODS FOR DETECTING NUCLEIC ACIDS|

---

US7678541B2|2000-11-21|2010-03-16|Hologic, Inc.|Methods and compositions for the detection of a nucleic acid using a non-invasive cleavage reaction|

---

US6893819B1|2000-11-21|2005-05-17|Stratagene California|Methods for detection of a nucleic acid by sequential amplification|

---

US7309573B2|2000-11-21|2007-12-18|Stratagene California|Methods for detection of a nucleic acid by sequential amplification|

---

US20030165865A1|2001-01-29|2003-09-04|Hinkel Christopher A.|Methods of analysis of nucleic acids|

---

WO2003033741A1|2001-10-16|2003-04-24|Aclara Biosciences, Inc.|Universal e-tag primer and probe compositions and methods|

---

WO2003070984A1|2002-02-15|2003-08-28|Somalogic, Inc.|Methods and reagents for detecting target binding by nucleic acid ligands|

---

GB0205455D0|2002-03-07|2002-04-24|Molecular Sensing Plc|Nucleic acid probes, their synthesis and use|

---

US9261460B2|2002-03-12|2016-02-16|Enzo Life Sciences, Inc.|Real-time nucleic acid detection processes and compositions|

---

US20080187910A1|2002-06-26|2008-08-07|Nilsen Thor W|Nucleic acid assay and method of detecting the presence of a nucleic acid sequence|

---

EP1959376B1|2002-09-26|2016-04-06|Kenji Yoshida|Information processing device, method, and program for reading a dot pattern|

---

US8206904B2|2002-12-18|2012-06-26|Third Wave Technologies, Inc.|Detection of nucleic acids|

---

JP3706385B2|2003-03-17|2005-10-12|健治 吉田|Information input / output method using dot pattern|

---

WO2005010199A2|2003-07-16|2005-02-03|Geneohm Sciences, Inc.|Invasive cleavage reaction with electrochemical readout|

---

US20050142595A1|2003-11-07|2005-06-30|U.S. Genomics, Inc.|Intercalator FRET donors or acceptors|

---

WO2005059548A1|2003-12-19|2005-06-30|Kankyo Engineering Co., Ltd.|Novel mixtures for assaying nucleic acid, novel method of assaying nucleic acid with the use of the same and nucleic acid probe to be used therefor|

---

CA2497324A1|2004-02-17|2005-08-17|Affymetrix, Inc.|Methods for fragmenting and labelling dna|

---

US20060029954A1|2004-06-30|2006-02-09|Applera Corporation|Compositions and methods for identifying nucleotides in polynucleotide sequences|

---

WO2006004949A1|2004-06-30|2006-01-12|Applera Corporation|Compositions and methods for detecting and quantitating polynucleotide sequences|

---

KR100977186B1|2005-03-05|2010-08-23|주식회사 씨젠|Processes Using Dual Specificity Oligonucleotide and Dual Specificity Oligonucleotide|

---

EP1885890A4|2005-05-26|2010-01-20|Univ Boston|Quantification of nucleic acids and proteins using oligonucleotide mass tags|

---

EP1907586A2|2005-07-15|2008-04-09|Applera Corporation|Detection of nucleic acid amplification|

---

JP2010514450A|2006-12-29|2010-05-06|アプライドバイオシステムズインコーポレイテッド|Nucleic acid detection method and system|

---

EP2118310B1|2006-12-29|2013-03-06|Applied Biosystems, LLC|Systems and methods for detecting nucleic acids|

---

FI20075124A0|2007-02-21|2007-02-21|Valtion Teknillinen|Method and test kit for detection of nucleotide variations|

---

KR20090067334A|2007-12-21|2009-06-25|주식회사 씨젠|Methods for detecting target nucleic acid using nuclease activity of nucleic acid polymerase|

---

JP5651022B2|2008-03-15|2015-01-07|ホロジック，インコーポレーテッド|Compositions and methods for analyzing nucleic acid molecules in amplification reactions|

---

WO2009155271A1|2008-06-17|2009-12-23|Sigma-Aldrich Co.|Real time polymerase chain reaction process using a universal detection system|

---

AU2009282246B2|2008-08-15|2015-06-25|Cascade Biosystems, Inc.|Detecting nucleic acid|

---

WO2010030716A1|2008-09-10|2010-03-18|Igor Kutyavin|Detection of nucleic acids by oligonucleotide probes cleaved in presence of endonuclease v|

---

CN102216472A|2008-11-13|2011-10-12|里博克斯艾克斯有限公司|Rna detection method|

---

EP2256215A1|2009-04-30|2010-12-01|Steffen Mergemeier|Assay system using a nuclease activity of a nucleic acid polymerase|

---

EP2248915B1|2009-05-05|2013-09-18|Qiagen GmbH|Detection of multiple nucleic acid sequences in a reaction cartridge|

---

WO2011027966A2|2009-09-03|2011-03-10|Seegene, Inc.|Td probe and its uses|

---

JP5822843B2|2009-12-21|2015-11-24|シージーン アイエヌシー|TSG primer target detection|

---

EP2569449A4|2010-05-14|2013-12-04|Life Technologies Corp|Identification of nucleic acids|

---

US9921165B2|2010-11-05|2018-03-20|Genalyte, Inc.|Optical analyte detection systems and methods of use|

---

MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|US5600026A|1992-05-27|1997-02-04|Sumitomo Chemical Company, Limited|Process for production of cresols|

---

ES2582602T3|2007-03-28|2016-09-14|Signal Diagnostics|High resolution nucleic acid analysis system and method to detect sequence variations|

---

US10669574B2|2008-11-18|2020-06-02|XCR Diagnostics, Inc.|DNA amplification technology|

---

MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

KR20140044309A|2011-02-18|2014-04-14|엔브이에스 테크놀로지스 인코포레이티드|Quantitative, highly multiplexed detection of nucleic acids|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

US9850524B2|2011-05-04|2017-12-26|Seegene, Inc.|Detection of target nucleic acid sequences by PO cleavage and hybridization|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|

---

JP5976849B2|2012-03-05|2016-08-24|シージーン アイエヌシー|Detection of nucleotide mutations in target nucleic acid sequences by PTO cleavage and extension assays {Detection of Nucleotide Variation on Target Nucleic Acid Sequence PTO Cleavage and Extension Assay}|

---

EP2770065B1|2013-02-25|2017-12-13|Seegene, Inc.|Detection of nucleotide variation on target nucleic acid sequence|

---

US9683259B2|2012-04-19|2017-06-20|Seegene, Inc.|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide cleavage|

---

MX2015001961A|2012-08-16|2015-09-10|Nvs Technologies Inc|Assay methods and systems.|

---

CA2896213C|2012-12-27|2018-12-11|Seegene, Inc.|Detection of target nucleic acid sequence by pto cleavage and extension-dependent non-hybridization assay|

---

WO2014142575A1|2013-03-13|2014-09-18|Seegene, Inc.|Quantification of target nucleic acid using melting peak analysis|

---

AU2013202788B2|2013-03-14|2015-10-01|Gen-Probe Incorporated|Indexing signal detection module|

---

AU2013202805B2|2013-03-14|2015-07-16|Gen-Probe Incorporated|System and method for extending the capabilities of a diagnostic analyzer|

---

CN104520711B|2013-05-30|2017-09-19|秀根科技株式公司|The real-time quantitative and method for qualitative analysis of biological substance|

---

EP3022319A4|2013-07-15|2017-03-22|Seegene, Inc.|Detection of target nucleic acid sequence by pto cleavage and extension-dependent immobilized oligonucleotide hybridization|

---

KR101778771B1|2013-07-31|2017-09-18|주식회사 씨젠|Method for determining snp genotype|

---

CN105793435A|2013-10-09|2016-07-20|弗洛雷森特里克公司|Multiplex probes|

---

CN105705657B|2013-10-18|2020-07-28|Seegene株式会社|Detection of target nucleic acid sequences in solid phase based on pto cleavage and extension analysis using hybrid-capture and templated oligonucleotides|

---

CN105452451B|2013-12-06|2020-06-05|生物辐射实验室股份有限公司|Fusion polymerases|

---

WO2015147370A1|2014-03-28|2015-10-01|Seegene, Inc.|Detection of target nucleic acid sequences using different detection temperatures|

---

KR102295290B1|2014-07-10|2021-08-30|플루어레센트릭 인코포레이티드|Dna amplification technology|

---

DE102014110535A1|2014-07-25|2016-01-28|Certoplast Vorwerk & Sohn Gmbh|Process for producing an adhesive tape|

---

KR102246600B1|2014-08-11|2021-05-03|루미넥스 코포레이션|Probes for improved melt discrimination and multiplexing in nucleic acid assays|

---

KR101750464B1|2014-11-28|2017-06-28|케이맥바이오센터주식회사|The probe system for real time quantitative and qualitative analyzing of biomaterial, the reaction chamber with said probe system, and the analyzing method thereof|

---

FR3029290B1|2014-12-01|2020-03-06|Biomerieux|METHOD FOR ESTIMATING THE TARGET PROBE PROBE OF A DNA CHIP AND METHOD OF MANUFACTURING A DNA CHIP|

---

EP3230475A4|2014-12-09|2018-07-18|Seegene, Inc.|Differentiation of signals for target nucleic acid sequences|

---

JP2018504096A|2014-12-09|2018-02-15|シージーン アイエヌシー|Detection of target nucleic acid sequences using different detection temperatures and reference values|

---

DE102015115836A1|2015-09-18|2017-03-23|Biotype Diagnostic Gmbh|Confirmatory test for primary nucleic acid amplificates in a continuous reaction mixture and immediate evaluation by means of immunochromatographic methods|

---

WO2017046192A1|2015-09-18|2017-03-23|Biotype Diagnostic Gmbh|Confirmation test for primary nucleic acid amplification products in a continuous reaction preparation and direct evaluation by means of electrophoretic methods|

---

AU2016356474A1|2015-11-20|2018-06-21|Seegene, Inc.|Method for calibrating a data set of a target analyte|

---

WO2017105104A1|2015-12-15|2017-06-22|Seegene, Inc.|Signal extraction for a target nucleic acid sequence|

---

KR102218776B1|2016-06-10|2021-02-22|주식회사 씨젠|Method of providing tagging oligonucleotide|

---

WO2018050824A1|2016-09-15|2018-03-22|Roche Diagnostics Gmbh|Methods for performing multiplexed pcr|

---

WO2018066950A1|2016-10-06|2018-04-12|Seegene, Inc. .|Methods for preparing oligonucleotides for detecting target nucleic acid molecules in samples|

---

EP3559275A1|2016-12-23|2019-10-30|Albert-Ludwigs-Universität Freiburg|Two-part mediator probe|

---

RU2665631C2|2017-01-25|2018-09-03|Общество с ограниченной ответственностью "Секвойя Дженетикс"|Method of specific identification of dna sequences|

---

CN108823287B|2017-04-28|2019-04-12|厦门大学|A method of detection target nucleic acid sequence|

---

DE102017210140A1|2017-06-16|2018-12-20|Fidlock Gmbh|Closure device for detachably connecting two parts|

---

CN107236815A|2017-07-18|2017-10-10|江西贤聚景欣医药生物科技有限公司|The multiple quenching fluorescence probe and method detected for target nucleic acid sequence|

---

US20200270679A1|2017-09-29|2020-08-27|Seegene, Inc.|Detection of target nucleic acid sequences by pto cleavage and extension-dependent extension assay|

---

CA3088250A1|2018-01-22|2019-07-25|Luminex Corporation|Methods and compositions for discrete melt analysis|

---

WO2020127620A1|2018-12-20|2020-06-25|F. Hoffmann-La Roche Ag|Detection of target nucleic acid by solid-phase molography|

法律状态:
2018-04-03| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-07-30| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2020-06-30| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2020-12-08| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-03-02| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 11/01/2012, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

KR1020110002840A|KR20120081482A|2011-01-11|2011-01-11|Detection of target nucleic acid sequence by tagged probe cleavage and extension|

---

KR10-2011-0002840|2011-01-11|

---

KR1020110023465A|KR20120105811A|2011-03-16|2011-03-16|Detection of target nucleic acid sequence by pto cleavage and extension-dependent signal generation|

---

KR10-2011-0023465|2011-03-16|

---

KRPCT/KR2011/004452|2011-06-17|

---

PCT/KR2011/004452|WO2012096430A1|2011-01-11|2011-06-17|Detection of target nucleic acid sequences by pto cleavage and extension assay|

---

PCT/KR2012/000287|WO2012096523A2|2011-01-11|2012-01-11|Detection of target nucleic acid sequences by pto cleavage and extension assay|BR122019022355-6A| BR122019022355B1|2011-01-11|2012-01-11|method and kit for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids through a ptocean assay|

---

BR122019022348-3A| BR122019022348B1|2011-01-11|2012-01-11|method and kit for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids through a ptocean assay|