HUMANIZED ANTIBODY OR ANTIGEN-BINDING FRAGMENT OF THE SAME THAT SPECIFICALLY BINDS TO A HUMAN FOLATE

专利摘要:
humanized antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, its method of preparation and use, as well as immunoconjugates, pharmaceutical composition, diagnostic reagent and kit comprising the present invention relates to agents anticancer, which are provided including, but not limited to, antibodies and immunoconjugates that bind to human folate receptor 1. methods of using the agents, antibodies or immunoconjugates, such as methods of inhibiting tumor growth, are further provided.
公开号:BR112012021296B1
申请号:R112012021296-6
申请日:2011-02-24
公开日:2021-06-15
发明作者:Olga AB；Daniel Tavares；Lingyun Rui；Gillian Payne；Viktor S. Goldmakher
申请人:Immunogen, Inc；
IPC主号:

专利说明:

CROSS REFERENCE TO RELATED ORDERS
[0001] This application claims the priority benefit of US Provisional Application 61/307,797, filed February 24, 2010, US Provisional Application 61/346,595, filed May 20, 2010, and US Provisional Application 61/413,172, filed on November 12, 2010, each of which is incorporated herein by reference in their entirety. FIELD OF THE INVENTION
[0002] The field of this invention relates generally to antibodies and immunoconjugates that bind to the human folate receptor 1, as well as methods of using the antibodies and immunoconjugates for the treatment of diseases such as cancer. BACKGROUND OF THE INVENTION
[0003] Cancer is a leading cause of death in the developed world, with more than 1 million people diagnosed with cancer and 500,000 deaths annually in the United States alone. Globally it is estimated that more than 1 in 3 people will develop some form of cancer during their lifetime. There are more than 200 different types of cancer, four of which—breast, lung, colorectal, and prostate—account for more than half of all new cases (Jemal et al., 2003, Cancer J. Clin. 53:5-26 ).
[0004] Folate receptor 1 (FOLR1), also known as Folate Receptor-Alpha, or Folate Binding Protein, is an N-glycosylated protein expressed in the plasma membrane of cells. FOLR1 has a high affinity for folic acid and several reduced folic acid derivatives. FOLR1 mediates the distribution of the physiological folate, 5-methyltetrahydrofolate into cells.
[0005] FOLR1 is overexpressed in the vast majority of ovarian cancers, as well as in many uterine, endometrial, pancreatic, renal, lung and breast cancers, while the expression of FOLR1 in normal tissues is restricted to the apical membrane of cells epithelial cells in the proximal renal tubules, lung alveolar pneumocytes, bladder, testes, choroid and thyroid plexus (Weitman SD, et al, Cancer Res 52: 3396-3401 (1992); Antony AC, Annu Rev Nutr 16: 501-521 (1996) ); Kalli KR, et al. Gynecol Oncol 108: 619-626 (2008)). This pattern of FOLR1 expression makes it a desirable target for FOLR1-targeted cancer therapy.
[0006] Because ovarian cancer is usually asymptomatic until the advanced stage, it is often diagnosed late and has a poor prognosis when treated with currently available procedures, usually chemotherapy after surgical volume reduction (von Gruenigen V et al, Cancer 112: 2221-2227 (2008); Ayhan A et al, Am Obstet Gynecol 196: 81 and 81-86 (2007); Harry VN et al, Obstet Gynecol Surv 64: 548-560 (2009)). Thus, there is a clear unmet medical need for more effective therapeutics for ovarian cancers.
[0007] Three anti-FOLR1 antibodies were examined as potential anticancer drugs. Murine monoclonal antibodies Mov18 and Mov19 were isolated in the 1980s (Miotti S et al, Int Cancer 39: 297-303 (1987)), confirmed for the target FOLR1 ( Coney LR et al, Cancer Res 51 : 6125-6132 ( 1991)) and tested in preclinical studies for their ability to eradicate cancer cells expressing the antigen as conjugated to a cytotoxic ribosome inactivating protein (Conde FP et al, Eur Biochem 178: 795-802 (1989)) .
[0008] Mov19 has been tested as a bispecific antibody targeting cytotoxic T cells and natural killer cells (Mezzanzanica D et al, Int J Cancer 41 : 609-615 (1988); Ferrini S et al, Int J Cancer Suppl 4:53- 55 (1989); Ferrini S et al, Int J Cancer 48: 227-233 (1991)), and as a Mov19 single-stranded Fv (scFv) fusion protein with interleukin-2 in vivo (Melani C et al. , Cancer Res 58: 4146-4154 (1998)). Chimeric anti-FOLR1 antibodies (variable murine/constant human) Mov18 and Mov19 were examined preclinically for their ability to mediate cytotoxic immune cell-dependent killing of tumor cells expressing FOLR1 in vitro (Coney LR et al, Cancer Res 54: 2448 -2455 (1994)), and a Mov18-IgE chimeric was tested in preclinical IgE-dependent immunotherapeutic models ( Karagiannis SN et al, J Immunol 179: 2832-2843 (2007); Gould H] et al, Eur J Immunol 29: 3527-3537 (1999)).
[0009] Mov18 was studied in the form of conjugates with various radionuclides in preclinical studies and then, in the early 1990s, in clinical trials (Zacchetti A et al., Nucl Med Biol 36: 759-770 (2009)), which ended up without any drug being approved for clinical use.
[00010] MORAb003, a humanized form of the murine monoclonal anti-FOLR1 antibody LK26 was evaluated preclinically as an unmodified antibody (Ebel W et al, Cancer Immun 7:6 (2007)) and as a conjugate with the radionuclide 111In ( Smith-Jones PM et al, Nucl Med Biol 35: 343-351 (2008)), and is currently undergoing clinical trials as an unmodified antibody (DK Armstrong et al J. Clin. Oncol 26: 2008, May 20 suppl; abstract 5500). SUMMARY OF THE INVENTION
[00011] The present invention provides novel antibodies that bind to human folate receptor 1, immunoconjugates comprising such antibodies, and methods for their use are described herein. The present invention further provides novel polypeptides, such as antibodies that bind to human folate receptor 1, fragments of such antibodies, and other polypeptides related to such antibodies are also provided. Polynucleotides comprising nucleic acid sequences encoding the polypeptides are also provided, as are vectors comprising the polynucleotides. Cells comprising the polypeptides and/or polynucleotides of the invention are further provided. Compositions (for example pharmaceutical compositions) comprising the novel human folate receptor 1 antibodies or immunoconjugates are also provided. In addition, methods for making and using the novel human folate receptor 1 antibodies or immunoconjugates are also provided, such as methods of using the novel human folate receptor 1 antibodies or immunoconjugates to inhibit tumor growth and/or treat the cancer.
[00012] Thus, in one aspect, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO:1); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaa1FXaa2Xaa3 (SEQ ID NO:56); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9); where Xaa1 is selected from K, Q, H, and R; Xaa2 is selected from Q, H, N, and R; and Xaa3 is selected from G, E, T, S, A, and V. In a certain embodiment, the humanized antibody or antigen-binding fragment thereof binds a human folate receptor 1 with substantially the same affinity as the Mov19 chimeric antibody. In a certain embodiment, the humanized antibody or antigen binding fragment thereof comprises the heavy chain CDR2 sequence RIHPYDGDTFYNQKFQG (SEQ ID NO:2).
[00013] In a given modality, binding affinity is measured by flow cytometry, Biacore, or radioimmunoassay.
[00014] In another embodiment, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO:1), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a heavy chain CDR2 comprising RIHPYDGDTFYNQKFQG (SEQ ID NO:2), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a light chain CDR2 comprising RASNLEA (SEQ ID NO:8), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[00015] In a particular embodiment, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds human folate receptor 1 comprising the heavy chain of SEQ ID NO:6. In another embodiment, the humanized antibody or antigen-binding fragment thereof is encoded by plasmid DNA deposited with the ATCC on April 7, 2010 and having ATCC deposit nos., PTA-10772 and PTA-10773 or 10774.
[00016] In a particular embodiment, the invention provides a humanized antibody or antigen binding fragment thereof that competes for binding to FOLR1 with an antibody comprising (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO: 1) ; a heavy chain CDR2 comprising RIHPYDGDTFYNQXaa1FXaa2Xaa3 (SEQ ID NO:56); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9); where Xaa1 is selected from K, Q, H, and R; Xaa2 is selected from Q, H, N, and R; and Xaa3 is selected from G, E, T, S, A, and V. In a certain embodiment, the humanized antibody comprises the heavy chain CDR2 sequence RIHPYDGDTFYNQKFQG (SEQ ID NO:2).
[00017] In a particular embodiment, the invention provides a polypeptide, humanized antibody or antigen-binding fragment thereof comprising a heavy chain variable domain at least about 90% identical to SEQ ID NO:4, and a variable domain of light chain at least about 90% identical to SEQ ID NO: 10 or SEQ ID NO: 11. In another embodiment, the humanized antibody or antigen binding fragment comprises a heavy chain variable domain at least about 95% identical to SEQ ID NO:4, and a light chain variable domain at least about 95% identical to SEQ ID NO:10 or SEQ ID NO:11. In a further embodiment, the humanized antibody comprises at least a heavy chain variable domain about 99% identical to SEQ ID NO:4, and a light chain variable domain at least about 99% identical to SEQ ID NO:10 or SEQ ID NO:1 1. In a given embodiment, the humanized antibody comprises the heavy chain variable domain of SEQ ID NO:4, and that of the light chain variable minimum of SEQ ID NO: 10 or SEQ ID NO: 11. In certain embodiments, the invention provides a polypeptide, antibody, or antigen binding fragment at least about 90% identical to SEQ ID NOs: 88- 119. In certain embodiments, the invention provides a polypeptide, antibody, or antigen-binding fragment at least about 95% identical to SEQ ID NOs: 88-119. In certain embodiments, the invention provides a polypeptide, antibody, or antigen-binding fragment at least about 99% identical to SEQ ID NOs: 88-119.
[00018] In a particular embodiment, the invention provides a humanized antibody or antigen-binding fragment thereof that is expressed at least ten times greater than chMov19 in eukaryotic cells. In one embodiment, eukaryotic cells are HEK-293T cells.
[00019] In certain embodiments, the invention provides an antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising SSYGMS (SEQ ID NO :30); a heavy chain CDR2 comprising TISSGGSYTY (SEQ ID NO:31); and/or a heavy chain CDR3 comprising DGEGGLYAMDY (SEQ ID NO:32); and/or (b) a light chain CDR1 comprising KASDHINNWLA (SEQ ID NO:27); a light chain CDR2 comprising GATSLET (SEQ ID NO:28); and a light chain CDR3 comprising QQYWSTPFT (SEQ ID NO:29). In another embodiment, the invention provides an antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMQ (SEQ ID NO:60) ; a heavy chain CDR2 comprising AIYPGNGDSR (SEQ ID NO:61); and/or a heavy chain CDR3 comprising RDGNYAAY (SEQ ID NO:62); and/or (b) a light chain CDR1 comprising RASENIYSNLA (SEQ ID NO:57); a light chain CDR2 comprising AATNLAD (SEQ ID NO:58); and a light chain CDR3 comprising QHFWASPYT (SEQ ID NO:59). In another embodiment, the invention provides an antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMY (SEQ ID NO:66) ; a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO:67); and/or a heavy chain CDR3 comprising RHDYGAMDY (SEQ ID NO:68); and/or (b) a light chain CDR1 comprising RASENIYTNLA (SEQ ID NO:63); a light chain CDR2 comprising TASNLAD (SEQ ID NO:64); and a light chain CDR3 comprising QHFWVSPYT (SEQ ID NO:65). In another embodiment, the invention provides an antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising SSFGMH (SEQ ID NO:72) ; a heavy chain CDR2 comprising YISSGSSTIS (SEQ ID NO:73); and/or a heavy chain CDR3 comprising EAYGSSMEY (SEQ ID NO:74); and/or (b) a light chain CDR1 comprising RASQNINNNLH (SEQ ID NO:69); a light chain CDR2 comprising YVSQSVS (SEQ ID NO:70); and a light chain CDR3 comprising QQSNSWPHYT (SEQ ID NO:71). In another embodiment, the invention provides an antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TSYTMH (SEQ ID NO:78) ; a heavy chain CDR2 comprising YINPISGYTN (SEQ ID NO:79); and/or a heavy chain CDR3 comprising GGAYGRKPMDY (SEQ ID NO:80); and/or (b) a light chain CDR1 comprising KASQNVGPNVA (SEQ ID NO:75); a light chain CDR2 comprising SASYRYS (SEQ ID NO:76); and a light chain CDR3 comprising QQYNSYPYT (SEQ ID NO:77).
[00020] In certain embodiments, the polypeptides of the invention are full-length antibodies or antigen-binding fragments. In certain embodiments, the antibodies or antigen binding fragments are a Fab, a Fab', an F(ab')2, an Fd, a single-chain Fv or scFv, a disulfide linked Fv, a V NAR domain, one IgNar, one intrabody, one IgG-CH2, one minibody, one F(ab')3, one tetrabody, one triabody, one diabody, one single domain antibody, DVD-Ig, Fcab, mAb2, one (scFv)2 , or an scFv-Fc.
[00021] In certain embodiments, an antibody or polypeptide of the invention binds to a human folate receptor 1 with a Kd of about 1.0 to about 10 nM. In one embodiment, the antibody or polypeptide binds to a human folate receptor 1 with a Kd of about 1.0 nM or better. In a given modality, binding affinity is measured by flow cytometry, Biacore, or radioimmunoassay.
[00022] The invention also provides a method of making an antibody of the invention comprising culturing a cell expressing said antibody; and (b) isolating the antibody from said cultured cell. In one embodiment, the cell is a eukaryotic cell.
[00023] The invention also provides an immunoconjugate having the formula (A) - (L) - (C), wherein: (A) is an antibody or antigen binding fragment or polypeptide of the invention; (L) is a linker; and (C) is a cytotoxic agent, wherein said linker (L) links (A) to (C).
[00024] In one embodiment, the linker is selected from the group of a cleavable linker, a non-cleavable linker, a hydrophilic linker, and a dicarboxylic acid based linker. In a further embodiment, the linker is selected from the group consisting of: N-succinimidyl4-(2-pyridyldithio)pentanoate (SPP) or N-succinimidyl4-(2-pyridyldithio)-2-sulfopentanoate (sulfo-SPP); N-succinimidyl-4-(2-pyridyldithio)butanoate (SPDB) or N-succinimidyl4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); N-succinimidyl4-(maleimidomethyl)-cyclohexanecarboxylate (SMCC); N-sulfosuccinimidyl 4-(maleimidomethyl)-cyclohexanecarboxylate (sulfoSMCC); N-succinimidyl-4-(iodoacetyl)-aminobenzoate (SIAB); and N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide). In one embodiment, the linker is N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide).
[00025] In one embodiment, immunoconjugates comprise a cytotoxic agent selected from the group of a maytansinoid, maytansinoid analogue, benzodiazepine, taxoid, CC-1065, CC-1065 analogue, duocarmycin, duocarmycin analogue, calicheamicin, dolastatin, dolastatin analogue, auristatin, tomaymycin derivative, and leptomycin derivative or a prodrug of the agent. In an additional modality, the cytotoxic agent is a maytansinoid. In another embodiment, the cytotoxic agent is N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine or N(2')-deacetyl-N2-(4-mercapto-4 -methyl-1-oxopentyl)-maytansine.
[00026] In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO: 4, and the light chain variable domain of SEQ ID NO: 10 or SEQ ID NO :11; (L) N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine; where (L) connects (A) to (C).
[00027] In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO. :11; (L) N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine; where (L) connects (A) to (C).
[00028] In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO. :11; (L) N-succinimidyl 4-(2-pyridyldithio)2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine; where (L) connects (A) to (C).
[00029] In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO. :11; (L) -succinimidyl 4-(2-pyridyldithio)-2-sulfopentanoate (sulfo-SPP); and (C) N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine; where (L) connects (A) to (C).
[00030] In one embodiment the invention provides an immunoconjugate comprising: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO. :11; (L) N-succinimidyl 4-(2-pyridyldithio)pentanoate (SPP); and (C) N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine; where (L) connects (A) to (C).
[00031] The invention also provides a pharmaceutical composition comprising an antibody, antigen binding fragment, polypeptide, or immunoconjugate of the invention and a pharmaceutically acceptable carrier. In one embodiment, the pharmaceutical composition further comprises a second anti-cancer agent.
[00032] The invention also provides a diagnostic reagent comprising an antibody, antigen binding fragment, polypeptide, or immunoconjugate of the invention that is labeled. In one embodiment, the label is selected from the group of a radiolabel, a fluorophore, a chromophore, an imaging agent, and a metal ion.
[00033] The invention also provides a kit comprising the antibody, antigen-binding fragment, polypeptide, or immunoconjugate of the invention.
[00034] The invention also provides a method of inhibiting tumor growth in a subject, comprising administering a therapeutically effective amount of the antibody, antigen-binding fragment, polypeptide, immunoconjugate, or pharmaceutical composition of the invention to the subject. In a certain embodiment, the invention provides a method of inhibiting tumor growth in a subject comprising administering a therapeutically effective amount of an immunoconjugate having the formula (A) - (L) - (C), wherein: (A) is an antibody or antigen-binding fragment thereof that specifically binds a human folate receptor 1; (L) is a linker; and (C) is a cytotoxin selected from the group consisting of a maytansinoid and a maytansinoid analogue; where (L) binds (A) to (C) and where the immunoconjugate reduces the mean tumor volume at least twice in a KB xenograft model. In a certain embodiment, the method comprises administering an antibody or antigen binding fragment thereof which comprises (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO:1); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaalFXaa2Xaa3 (SEQ ID NO:56); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9); where Xaa1 is selected from K, Q, H, and R; Xaa2 is selected from Q, H, N, and R; and Xaa3 is selected from G, E, T, S, A, and V. In a further embodiment, the antibody comprises a heavy chain CDR2 comprising RIHPYDGDTFYNQKFQ G (SEQ ID NO:2).
[00035] In a particular embodiment, the invention provides a method for inhibiting tumor growth comprising administering an antibody or antigen-binding fragment thereof encoded by plasmid DNA deposited with the ATCC on April 7, 2010 and having deposited ATCC nos. PTA-10772 and PTA-10773 or 10774.
[00036] In another embodiment, the method provides for administering an immunoconjugate comprising a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO. :11; (L) N-succimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine.
[00037] In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11; (L) N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine; where (L) connects (A) to (C).
[00038] In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11; (L) N-succinimidyl 4-(2-pyridyldithio)2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N2-(4-mercapto-4-methyl-1-oxopentyl)-maytansine; where (L) connects (A) to (C).
[00039] In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11; (L) N-succinimidyl 4-(2-pyridyldithio)-2-sulfopentanoate (sulfo-SPP); and (C) N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine; where (L) connects (A) to (C).
[00040] In another embodiment, the method comprises administering an immunoconjugate comprising (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11; (L) N-succinimidyl 4-(2-pyridyldithio)pentanoate (SPP); and (C) N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine; where (L) connects (A) to (C).
[00041] In another embodiment, the method comprises administering an immunoconjugate comprising the huFR-1-21 antibody deposited with ATCC on April 7, 2010 and having ATCC deposit nos. PTA-10775 and PTA-10776. In a certain embodiment, the huFR1-21 antibody comprises (a) a heavy chain CDR1 comprising SSYGMS (SEQ ID NO:30); a heavy chain CDR2 comprising TISSGGSYTY (SEQ ID NO:31); and a heavy chain CDR3 comprising DGEGGLYAMDY (SEQ ID NO:32); and (b) a light chain CDR1 comprising KASDHINNWLA (SEQ ID NO:27); a light chain CDR2 comprising GATSLET (SEQ ID NO:28); and a light chain CDR3 comprising QQYWSTPFT (SEQ ID NO:29). In certain embodiments the method comprises administering an immunoconjugate which comprises the antibody is the huFR1-48 antibody which comprises: (a) a heavy chain CDR1 comprising TNYWMQ (SEQ ID NO:60); a heavy chain CDR2 comprising AIYPGNGDSR (SEQ ID NO:61); and a heavy chain CDR3 comprising RDGNYAAY (SEQ ID NO:62); and (b) a light chain CDR1 comprising RASENIYSNLA (SEQ ID NO:57); a light chain CDR2 comprising AATNLAD (SEQ ID NO:58); and a light chain CDR3 comprising QHFWASPYT (SEQ ID NO:59). In certain embodiments the method comprises administering an immunoconjugate which comprises the antibody is the huFR1-49 antibody which comprises: (a) a heavy chain CDR1 comprising TNYWMY (SEQ ID NO:66); a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO:67); and a heavy chain CDR3 comprising RHDYGAMDY (SEQ ID NO:68); and (b) a light chain CDR1 comprising RASENIYTNLA (SEQ ID NO:63); a light chain CDR2 comprising TASNLAD (SEQ ID NO:64); and a light chain CDR3 comprising QHFWVSPYT (SEQ ID NO:65). In certain embodiments the method comprises administering an immunoconjugate which comprises the antibody huFR1-57 which comprises: (a) a heavy chain CDR1 comprising SSFGMH (S EQ ID NO: 72); a heavy chain CDR2 comprising YISSGSSTIS (SEQ ID NO:73); and a heavy chain CDR3 comprising EAYGSSMEY (SEQ ID NO:74); and (b) a light chain CDR1 comprising RASQNINNNLH (SEQ ID NO:69); a light chain CDR2 comprising YVSQSVS (SEQ ID NO:70); and a light chain CDR3 comprising QQSNSWPHYT (SEQ ID NO:71). In certain embodiments the method comprises administering an immunoconjugate which comprises the antibody is the huFR1-65 antibody which comprises: (a) a heavy chain CDR1 comprising TSYTMH (SEQ ID NO:78); a heavy chain CDR2 comprising YINPISGYTN (SEQ ID NO:79); and a heavy chain CDR3 comprising GGAYGRKPMDY (SEQ ID NO:80); and (b) a light chain CDR1 comprising KASQNVGPNVA (SEQ ID NO:75); a light chain CDR2 comprising SASYRYS (SEQ ID NO:76); and a light chain CDR3 comprising QQYNSYPYT (SEQ ID NO:77).
[00042] In one embodiment, the method inhibits the growth of ovarian tumor, brain tumor, breast tumor, uterine tumor, endometrial tumor, pancreatic tumor, kidney tumor, or lung tumor. In a certain modality, the method inhibits ovarian tumor growth. In another embodiment, the invention inhibits lung tumor growth. In a certain modality, tumor growth inhibition is used to treat cancer. In a further embodiment, the method comprises administering a second anti-cancer agent to the subject. In a given modality, the second anticancer agent is a chemotherapeutic agent.
[00043] The invention also provides an isolated cell that produces the antibody, antigen-binding fragment, or polypeptide of the invention.
[00044] The invention also provides an isolated polynucleotide comprising a sequence at least 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48, and 120 to 127. In a given embodiment, the isolated polynucleotide is at least 95% identical to a sequence selected from the group consisting of SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48 , and 120 to 127. In another embodiment, the isolated polynucleotide is at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48 , and 120 to 127. The invention also provides a vector comprising any of the polynucleotides of SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48, and 120 to 127. In another embodiment, a The invention provides a host cell comprising a vector that contains a polynucleotide of SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48, and 120-127. BRIEF DESCRIPTION OF THE DRAWINGS
[00045] Figure 1. Surface residues for murine Mov19 (muMov19) and humanized (huMov19). (A) Murine and humanized Mov19 light chain surface residues. The murine and humanized Mov19 light chain variable region frame surface residues and position number (Kabat system) are given. Human residues that are different from the original murine sequences are underlined. *Position 74 is not a surface position, but to remove a consensus N-linked glycosylation site in version 1.00, this position was changed to a Threonine (the most common human residue at this position), resulting in version 1.60. (B) Murine and Human Mov19 heavy chain surface residues. Murine and humanized Mov19 heavy chain variable region frame surface residues and position number (Kabat system) are given. Human residues that are different from the original murine sequences are underlined. Similar surface residues are provided for FR1-21 (C) and (D).
[00046] Figure 2. Alignments of heavy and light chain variable domains from Mov19 and chimeric huMov19 and light and heavy chain variable domains from muFR1-21 and huFR1-21. Alignment of the coated sequences for the variable regions of Mov19 and FR1-21 with their murine counterparts. A) and C) light chain variable domains; B) and D) heavy chain variable domain. Quotation marks "-" denote identity with the murine sequence. CDRs (Kabat definition) are underlined.
[00047] Figure 3. Expression of Mov 19 and chimeric huMov 19 in HEK cells. Chimeric and human Mov19 expression plasmids were transiently transfected into HEK293-T cells in suspension, collected 7 days later, and the expressed antibody was determined by quantitative ELISA. Light chain and heavy chain plasmids were transfected at both respective molar ratios.
[00048] Figure 4. Binding specificity of anti-FOLR1 antibodies as detected by their binding to 300-19 cells expressing FOLR1. Binding of huMov19 to 300-19-FOLR1 cells by flow cytometry. 300-19 parental cells expressing FOLR-1. Gray solid shading represents cellular autofluorescence; black dotted lines represent cells incubated with FITC-conjugated anti-human secondary antibody, solid black lines represent cells incubated with huMov-19 antibody and FITC-conjugated anti-human secondary antibody.
[00049] Figure 5. Binding affinities and in vitro cytotoxic activity of anti-FOLR1 antibodies and immunoconjugates. Binding affinity of huMov19 and various murine and humanized FR-1 antibodies was measured in SKOV3 cells. The in vitro cytotoxic activity of the PEG4-Mal-DM4 conjugates of the listed antibodies was also tested.
[00050] Figure 6. Antibody-dependent cellular cytotoxicity of immunoconjugates. ADCC activity of huMov19, huFR1-21, and Mor003 was tested against Igrov1 cells. Igrov 1 were incubated at 15,000 cells/well Target:NK cell ratio 1:4.
[00051] Figure 7. Cytotoxic activity of continuous exposure of huFR1-21-PEG4-mal-DM4 and huMov19-PEG4-mal-DM4 in KB cells. An excess of unconjugated antibodies suppressed the activity of the immunoconjugates when they were co-incubated in the presence of KB cells, indicating that the cytotoxic activity is antigen-dependent.
[00052] Figure 8. In vivo efficacy of huMov19-targeted conjugates in a KB xenograft model. Cleavable conjugate targeted to FOLR1 huMov19-SPDB-DM4 (B) compared to huC242-SPDB-DM4 targeted to non-FOLR1 (D), and non-cleavable conjugate huMov19-PEG4-Mal-DM4 (C) compared to huC242-PEG4Mal Non-targeting DM4 (E) were tested using an established xenograft model of KB cells implanted subcutaneously in the SCID mouse. Targeting FOLR1 by huMovl 9 resulted in significant reduction in mean tumor volume.
[00053] Figure 9. In vivo efficacy of huMov 19-PEG4-Mal-DM4 compared to FR-1 murine anti-FOLR1 antibodies in a KB xenograft model. FR-1 series antibodies, either unconjugated, or conjugated to PEG4-Mal-DM4 were tested for their ability to reduce mean tumor volume compared to huMov 19-PEG4-Mal-DM4 in a KB xenograft tumor model . (A) FR-1-9, (B) FR-1-13, (C) FR-1-22, and (D) FR-1-23.
[00054] Figure 10. In vivo efficacy of huMov19-PEG4-Mal-DM4 and huFR1-21-PEG4-Mal-DM4 in a KB xenograft model. Single 10 mg/kg injections of huMov19-PEG4-Mal-DM4 and huFR 1-21-PEG4-Mal-DM4 on day 6 after inoculation were performed. Both huMov19-PEG4-Mal-DM4 and huFR1-21-PEG4-Mal-DM4 showed a significant reduction in mean tumor volume. "Average TV" refers to the average tumor volume.
[00055] Figure 11. HuMov 19-PEG4-mal-DM4 shows dose-dependent activity in the KB xenograft model. The dose-dependent activity of the immunoconjugate was tested across the range of doses tested. Weekly dosing resulted in improved anti-tumor activity. High drug loadings only marginally improved activity in the 10 mg/kg dose groups, with reduced activity in the lower dose groups. 3.7 DAR refers to 3.7 drug molecules per antibody.
[00056] Figure 12. In vivo efficacy of huMov19 conjugated to DM1 and DM4 with various ligands. huMov19 was conjugated to SMCC-DM1 at 3.9 drug molecules per antibody; sulfo-mal-DM4 at 3.7 drug molecules per antibody (B), and sulfo-mal-DM4 at 8.23 drug molecules per antibody (C) and tested for their ability to reduce mean tumor volume by several comparisons compared to huMov19-PEG4-mal-DM4.
[00057] Figure 13. In vivo efficacy of huMov19 conjugated to DM1 and DM4 with various linkers. huMov19 was conjugated to SPP-DM1 at 4.3 drug molecules per antibody; sulfo-SPDB-DM4 at 3.8 drug molecules per antibody, SPDB-DM4 at 3.8 drug molecules per antibody, and sulfo-SPDB-DM4 at 6.8 drug molecules per antibody and tested for their ability to reduce mean tumor volume. Mice were treated with 5 mg/kg (A) and 2.5 mg/kg (B) of one of the conjugates listed above or with PBS alone.
[00058] Figure 14. In vivo efficacy of huMov19-sulfo-SPDB-DM4 in the OVCAR-3 xenograft tumor model. Mice were treated with 25, 50, or 100 μg/kg of huMov 19-sulfo-SPDB-DM4 or with PBS only.
[00059] Figure 15. In vivo efficacy of huMov19-sulfo-SPDB-DM4 in the IGROV-1 xenograft tumor model. Mice were treated with 25, 50, or 100 μg/kg of huMov19-sulfo-SPDB-DM4 or with PBS only.
[00060] Figure 16. In vivo efficacy of huMov19-sulfo-SPDB-DM4 in the OV-90 xenograft tumor model. Mice were treated with 25, 50, or 100 μg/kg of huMov 19-sulfo-SPDB-DM4 or with PBS only.
[00061] Figure 17. Effect of cleavable linkers and non-cleavable linkers on the efficacy of immunoconjugates in KB xenograft models.
[00062] Figure 18. Effect of cleavable ligands on the efficacy of immunoconjugates in (A) KB xenograft model (B) OVCAR-3 xenograft model.
[00063] Figure 19. In vitro and in vivo efficacy of huFR1-48, huFR1-49, huFR1-57, and huFR1-65-SMCC-DM1 in KB and xenograft tumor models. Mice were treated with single doses of 200 μg/kg. DETAILED DESCRIPTION OF THE INVENTION
[00064] The present invention provides new agents, including but not limited to polypeptides such as antibodies, and immunoconjugates that bind to the human folate receptor 1 (FOLR1). Related polypeptides and polynucleotides, compositions comprising the FOLR1 Binding Agents, and methods of making the FOLR1 Binding agents are also provided. Methods of using the new FOLR1 binding agents, such as tumor growth inhibition methods and/or cancer treatment, are further provided. I. Definitions
[00065] To facilitate an understanding of the present invention, a series of terms and phrases are defined below.
[00066] The terms "human folate receptor 1" or "FOLR1" as used herein, refer to any native human FOLR1, unless otherwise indicated. The term "FOLR1" encompasses "full-length", unprocessed FOLR1, as well as any form of FOLR1 that results from processing within the cell. The term also encompasses naturally-occurring variants of FOLR1, for example, splicing variants, allelic variants, and isoforms. The FOLR1 polypeptides described herein can be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods. Examples of FOLR1 sequences include, but are not limited to, NCBI reference numbers P15328, NP_001092242.1, AAX29268.1, AAX37119.1, NP_057937.1, and NP_057936.1.
[00067] The term "antibody" means an immunoglobulin molecule that specifically recognizes and binds to a target, such as a protein, polypeptide, carbohydrates, peptides, lipids, polynucleotide, or combinations of the foregoing through at least one recognition site of antigen within the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments (such as Fab, Fab', F(ab')2, and Fv fragments), single-chain Fv (scFv) mutants ), multispecific antibodies such as bispecific antibodies generated from at least two intact antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antigen-determining portion of an antibody, and any other modified immunoglobulin molecule comprising a antigen recognition site, as long as the antibodies exhibit the desired biological activity. An antibody can be from any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, or subclasses (isotypes) thereof (for example, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2), based in the identity of their heavy chain constant domains referred to as alpha, delta, epsilon, gamma and mu, respectively. Different classes of immunoglobulins have different and well-known subunit structures and three-dimensional configurations. Antibodies can be naked or conjugated to other molecules such as toxins, radioisotopes, etc.
[00068] A "blocking" antibody or an "antagonistic" antibody is one that inhibits or reduces the biological activity of the binding antigen, such as FOLR1. In a given embodiment, blocking antibodies or antagonist antibodies substantially or completely inhibit the biological activity of the antigen. Desirably, the biological activity is reduced by 10%, 20%, 30%, 50%, 70%, 80%, 90%, 95%, or even 100%.
[00069] The term "anti-FOLR1 antibody" or "antibody that binds a FOLR1" refers to an antibody that is capable of binding FOLR1 with sufficient affinity such that the antibody is useful as a diagnostic and agent. /or therapeutic targeting FOLR1. The extent of binding of an anti-FOLR1 antibody to an unrelated, non-FOLR1 protein is less than about 10% of antibody binding to FOLR1 as measured, for example, by a radioimmunoassay (RIA). In certain embodiments, an antibody that binds to FOLR1 has a dissociation constant (Kd) of < 1 µM, < 100 nM, < 10 nM, < 1 nm, or < 0.1 nM.
[00070] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigenic determination of variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, single chain antibodies, and multispecific antibodies formed from antibody fragments.
[00071] The term "monoclonal antibody" refers to a homogeneous population of antibodies involved in the highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies which typically include different antibodies directed against different antigenic determinants. The term "monoclonal antibody" encompasses both intact and full-length monoclonal antibodies, as well as antibody fragments (such as Fab, Fab', F(ab')2,Fv), single chain mutants (scFv), protein fusion comprising an antibody moiety, and any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore, the "monoclonal antibody" refers to such antibodies made in any number of ways, including but not limited to, by hybridoma, phage selection, recombinant expression, and transgenic animals.
[00072] The term "humanized antibody" refers to forms of non-human (e.g., murine) antibodies that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences ). Typically, humanized antibodies are human immunoglobulins in which the complementarity determining region (CDR) residues are replaced by CDR residues from a non-human species (e.g., mouse, rat, rabbit, hamster), which have the specificity, affinity , and desired capacity (Jones et al., 1986, Nature, 321:522-525; Riechmann et al., 1988, Nature, 332:323-327; Verhoeyen et al., 1988, Science, 239:1534-1536) . In some cases, the Fv framework region (FR) residues of a human immunoglobulin are replaced with the corresponding residues in an antibody from a non-human species that has the desired specificity, affinity, and capacity. The humanized antibody can be further modified by replacing additional residues that in the Fv framework region and/or within the substituted non-human residues to refine and optimize the antibody's specificity, affinity, and/or capacity. In general, the humanized antibody will comprise substantially all of at least one, and typically two or three, variable domains containing all or substantially all of the CDR regions that correspond to the non-human immunoglobulin whereas all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody may also comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in US Patent 5,225,539 or 5,639,641.
[00073] An "variable region" of an antibody refers to the variable region of an antibody light chain or the variable region of an antibody heavy chain, either individually or in combination. The heavy and light chain variable regions each consist of four framework regions (FR) connected by three complementarity determining regions (CDRs) also known as hypervariable regions. The CDRs on each chain are held together in close proximity by the FRs and, with the CDRs on the other chain, contribute to the formation of the antigen-binding site of antibodies. There are at least two techniques for determining CDRs: (1) an approach based on cross-species sequence variability (ie, Kabat et al. Sequences of Proteins of Immunological Interest, (5th ed., 1991, National Institutes of Health, Bethesda Md.)), and (2) an approach based on crystallographic studies of antigen-antibody complexes (Al-lazikani et al (1997) J. Molec. Biol. 273:927-948)). Furthermore, combinations of these two approaches are sometimes used in the art to determine CDRs.
[00074] Kabat's numbering system is generally used when referring to a residue in the variable domain (approximately residues 1-107 of the light chain and residues 1-113 of the heavy chain) (eg, Kabat et al., Sequences of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991)).
[00075] Amino acid position numbering as in Kabat, refers to the numbering system used for heavy chain variable domains or light chain variable domains of antibody compilation in Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991). Using this numbering system, the actual linear amino acid sequence may contain few amino acids or additional amino acids corresponding to a shortening of, or insertion into, a variable domain FR or CDR. For example, a heavy chain variable domain may include an insertion of a single amino acid (residue 52a according to Kabat) after residue 52 of H2 and inserted residues (e.g. residues 82a and 82b, and 82c, etc. according to Kabat) after residue 82 FR of heavy chain. Kabat numbering of residues can be determined for a given antibody by an alignment in regions of antibody sequence homology with a "standard" Kabat numbered sequence. Chothia refers instead to the location of structural loops (Chothia and Lesk J. Mol. Biol. 196:901-917 (1987)). The end of Chothia's CDR-H1 loop when numbered using the Kabat numbering convention varies between H32 and H34, depending on the length of the loop (this is because Kabat's numbering scheme places inserts in H35A and H35B; if not 35A nor 35B are present, the loop ends in 32; if only 35A is present, the loop ends in 33; if both 35A and 35B are present, the loop ends in 34). The AbM hypervariable regions represent a compromise between the Kabat CDRs and Chothia structural loops, and are used by Oxford Molecular's AbM antibody modeling software.

[00076] The term "human antibody" means an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human made using any technique known in the art. This definition of a human antibody includes intact or full-length antibodies, fragments thereof, and/or antibodies that comprise at least one human heavy and/or light chain polypeptide, such as, for example, an antibody comprising heavy chain polypeptides of human and murine light chain.
[00077] The term "chimeric antibodies" refers to an antibody in which the amino acid sequence of the immunoglobulin molecule is derived from two or more species. Typically, the variable region of both the light and heavy chains corresponds to the variable region of antibodies derived from a mammalian species (e.g., mouse, rat, rabbit, etc.), with the desired specificity, affinity and capacity as the regions constants are homologous to sequences in antibodies derived from one another (usually human) to avoid eliciting an immune response in the species.
[00078] The term "epitope" or "antigenic determinant" is used interchangeably herein and refers to the portion of an antigen capable of being recognized and specifically bound by a particular antibody. When the antigen is a polypeptide, epitopes can be formed from either contiguous amino acids or non-contiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained upon protein denaturation, whereas epitopes formed by tertiary folding are typically lost upon protein denaturation. An epitope typically includes at least 3, and more usually, at least 5 or 8-10 amino acids in a unique spatial conformation.
[00079] "Binding affinity" generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (eg an antibody) and its binding partner (eg an antigen ). Unless otherwise indicated, as used herein, "binding affinity" refers to intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (eg, antibody and antigen ). The affinity of an X molecule for its Y partner can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally bind antigen faster and tend to stay bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for the purposes of the present invention. Specific illustrative modalities are described below.
[00080] "Or better" when used herein to refer to binding affinity refers to a stronger binding between a molecule and its binding partner. "Or better" when used here refers to a stronger binding, represented by a smaller numerical Kd value. For example, an antibody that has an affinity for an antigen of "0.6 nM or better", the antibody's affinity for the antigen is less than 0.6 nM, that is, 0.59 nM, 0.58 nM, 0.57 nM etc., or any value less than 0.6 nM.
[00081] The phrase "substantially similar," or "substantially the same", as used herein, denotes a sufficiently high degree of similarity between two numerical values (generally one associated with an antibody of the invention and one associated with a reference antibody / comparison) such that one skilled in the art would regard the difference between the two values as having little or no biological and/or statistical significance within the context of the biological characteristic measured by said values (eg Kd values) . The difference between said two values may be less than about 50%, less than 40%, less than 30%, less than 20%, or less than 10%, as a function of the value for the antibody of reference/comparison.
[00082] A polypeptide, antibody, polynucleotide, vector, cell or composition that is "isolated" is a polypeptide, antibody, polynucleotide, vector, cell or composition that is of a form not found in nature. Polypeptides, isolated antibodies, polynucleotides, vectors, cells or compositions include those that have been purified to a degree where they are no longer in the form in which they are found in nature. In some embodiments, an antibody, polynucleotide, vector, cell, or composition that is isolated is substantially pure.
[00083] As used herein, "substantially pure" refers to material that is at least 50% pure (ie, free of contaminants), at least 90% pure, at least 95% pure, at least 98% pure , or at least 99% pure.
[00084] The term "immunoconjugate" or "conjugate" as used herein refers to a compound or derivative thereof that is linked to a cell binding agent (i.e., an anti-FOLR1 antibody or a fragment thereof ) and is defined by a generic formula: CLA, where C = cytotoxin, L = linker, and A = cell binding agent or anti-FOLR1 antibody or antibody fragment. Immunoconjugates can also be defined by the generic formula in reverse order: A-L-C.
[00085] A "linker" is any chemical moiety that is capable of binding a compound, generally a drug, such as a maytansinoid, to a cell binding agent such as an anti-FOLR1 antibody or a fragment thereof in a manner stable covalent. Linkers may be susceptible to, or substantially resistant to, acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage, under conditions under which the compound or antibody remains active. Suitable linkers are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups. Linkers also include charged linkers, and hydrophilic forms thereof as described herein and known in the art.
[00086] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals, in which a population of cells is characterized by unregulated cell growth. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include squamous cell cancer, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, squamous cell lung carcinoma, peritoneum cancer, hepatocellular cancer, gastrointestinal cancer, pancreatic cancer , glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, cancer prostate cancer, vulvar cancer, thyroid cancer, liver carcinoma, and various types of head and neck cancers.
[00087] "Tumor" and "neoplasm" refer to any tissue mass that results from excessive cell growth or proliferation, either benign (non-cancerous) or malignant (cancerous) including precancerous lesions.
[00088] The terms "cancer cell", "tumor cell", and grammatical equivalents refer to the total population of cells derived from a tumor or a precancerous lesion, including both non-tumorigenic cells, which comprise the most of the tumor cell population, and tumorigenic stem cells (cancer stem cells). As used herein, the term "tumor cell" will be modified by the term "non-tumorigenic" when referring only to those tumor cells that lack the ability to renew and differentiate to distinguish tumor cells from cells -stem cancer.
[00089] The term "subject" refers to any animal (eg, a mammal), including, but not limited to, humans, non-human primates, rodents, and the like, which must be the recipient of a particular treatment. . Normally, the terms "subject" and "patient" are used interchangeably here in reference to a human subject.
[00090] Administration "in combination with" one or more other therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
[00091] The term "pharmaceutical formulation" refers to a preparation that is in such a form that it allows the biological activity of the active ingredient to be effective, and that does not contain any additional component that is unacceptably toxic to a subject for which the formulation must be administered. Such a formulation can be sterile.
[00092] An "effective amount" of an antibody as disclosed herein is an amount sufficient to accomplish a specifically indicated purpose. An "effective amount" can be determined empirically and in a routine manner, in relation to the stated purpose.
[00093] The term "therapeutically effective amount" refers to an amount of an antibody or other drug effective to "treat" a disease or disorder in a subject or a mammal. In the case of cancer, the therapeutically effective amount of the drug can reduce the number of cancer cells to reduce tumor size; inhibit (ie slow to some extent, and in a certain modality to stop) the infiltration of cancer cells into peripheral organs; inhibit (ie, decrease to a certain extent and in a certain modality to stop) tumor metastasis; inhibit to some extent the growth of the tumor and/or alleviate to some extent one or more of the symptoms associated with cancer. See the definition of "treatment" here. To the extent that the drug can prevent the growth and/or kill existing cancer cells, they can be cytostatic and/or cytotoxic. A "prophylactically effective amount" refers to an amount effective, in dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to, or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.
[00094] The word "label" when used herein refers to a detectable compound or composition that is directly or indirectly conjugated to the antibody so as to generate a "labeled" antibody. The label may be detectable on its own (for example, radioisotope labels or fluorescent labels) or, in the case of an enzyme label, it may catalyze the chemical change of a compound or substrate composition that is detectable.
[00095] A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer, regardless of the mechanism of action. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, tree poisonous plant alkaloids, cytotoxic/antitumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizer, and kinase inhibitors. Chemotherapeutic agents include compounds used in "targeted therapy" and conventional chemotherapy.
[00096] Terms such as "treating" or "treatment" or "treating" or "alleviating" or "to alleviate" refer either to 1) therapeutic measures capable of curing, delaying, decreasing symptoms of, and/or progression arresting a diagnosed pathological condition or disorder and 2) to prophylactic or preventative measures that prevent and/or delay the development of a targeted pathological condition or disorder. Thus, those in need of treatment include those who already have the disorder; those likely to have the disorder, and those in whom the disorder should be prevented. In certain embodiments, a subject is successfully "treated" for cancer in accordance with the methods of the present invention if the patient shows one or more of the following: a reduction in the number or complete absence of cancer cells; a reduction in tumor size; relief or; inhibition or absence of an infiltration of cancer cells into peripheral organs, including, for example, the spread of cancer into soft tissue and bone; inhibition or absence of tumor metastasis; inhibition or absence of tumor growth, relief of one or more symptoms associated with the specific cancer; reducing morbidity and mortality, improving quality of life; reduction in the tumorigenicity, tumorigenic frequency, or tumorigenic capacity, of a tumor, reduction in the number or frequency of cancer stem cells in a tumor, differentiation of tumorigenic cells to a non-tumorigenic state, or some combination of effects.
[00097] "Polynucleotide", or "nucleic acid", as used interchangeably herein, refers to polymers of nucleotides of any length, and includes DNA and RNA. The nucleotides can be deoxyribonucleotides and ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a DNA polymer or RNA polymerase. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and their analogs. If present, modification of the nucleotide structure can be conferred before or after assembly of the polymer. The nucleotide sequence can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications include, for example, "caps", the replacement of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications such as, for example, those with uncharged bonds (e.g., methyl, phosphonates and phosphotriesters , phosphoamidates and kabamates, etc.) and with charged bonds (eg phosphorothioates and phosphorodithioates, etc.), those containing pendant fractions such as, for example, proteins (eg nucleases, toxins, antibodies, signal peptides, ply -L-lysine, etc.), those with intercalators (eg acridine, psoralen, etc.), those containing chelators (eg metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylants, those with modified linkages (eg, nucleic acids with alpha anomeric carbon, etc.), as well as unmodified forms of polynucleotide(s). Furthermore, any of the hydroxyl groups present on common sugars can be substituted, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or by activation to prepare additional bonds to additional nucleotides, or can be conjugated to supports solids. A 5' and 3' OH terminus can be phosphorylated or substituted with organic leveling group moieties or amines of 1 to 20 carbon atoms. Other hydroxyl groups can also be derivatized to standard protecting groups. Polynucleotides may also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-O-methyl-, 2'-O-allyl, 2'-fluoro-or 2'-azido - ribose, carbocyclic sugar analogues,. alpha-anomeric sugars, epimeric sugars such as arabinose, xylose sugars or lixoses, pyranose, furanose sugars, sedoheptuloses, acyclic analogues and non-basic nucleoside analogues such as methyl riboside. One or more phosphodiester linkages can be replaced with alternative linking groups. These alternative linking groups include, but are not limited to, embodiments in which the phosphate is replaced by P(O)S ("thioate"), P(S)S ("dithioate"), "(O)NR2 (" amidate"), P(O)R, P(O)OR', CO or CH2 ("formacetal"), wherein each R or R' is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (--O--), aryl, alkenyl, cycloalkyl, cycloalkenyl, or araldil bond Not all bonds in a polynucleotide need be identical The above description is applicable to all polynucleotides referred to herein, including RNA and DNA.
[00098] The term "vector" means a construct, which is capable of delivering, and optionally expressing, one or more gene(s) or sequence(s) of interest in a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA expression vectors or RNA or encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
[00099] The terms "polypeptide", "peptide", and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can be linear or branched, it can comprise the modified amino acids, and it can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art. It is understood that because the polypeptides of this invention are based on antibodies, in certain embodiments, the polypeptides may occur as single chains or associated chains.
[000100] The terms "identical" or "percent identity" in the context of two or more nucleic acids or polypeptides refer to two or more sequences or subsequences that are the same or have a certain percentage of nucleotide or amino acid residues that are the same, when compared and aligned (introducing gaps if necessary) for maximum match, not considering any conservative amino acid substitutions as part of the sequence identity. Percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and programs are known in the art which can be used to obtain amino acid or nucleotide sequence alignments. A non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al, 1990, Proc. Natl. Academic Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Academic Sci., 90:5873-5877, and incorporated into the NBLAST and XBlast programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain embodiments, gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, California) or Megalign (DNASTAR) are programs of additional publicly available software that can be used to align the sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the LACUNA program in GCG software (for example, using a matrix of NWSgapdna.CMP and a gap weight of 40, 50, 60, 70, or 90 and one weight length of 1, 2, 3, 4, 5 or 6). In certain alternative embodiments, the LACUNA program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (eg using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4 , 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with a residue table, a gap length penalty of 12 and a gap penalty of 4. Appropriate parameters for maximum alignment by particular alignment software can be determined by one of skill in the art. In certain embodiments, the default parameters of the alignment software are used. In certain embodiments, the "X" percent identity of a first amino acid sequence to a second amino acid sequence is calculated as 100 x (Y/Z), where Y is the number of amino acid residues marked as identical matches in the first alignment. and second sequences (as aligned by visual inspection or a special sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is greater than that of the second sequence, the percent identity of the first sequence for the second sequence will be greater than the percent identity of the second sequence for the first sequence.
[000101] As a non-limiting example, if any particular polynucleotide has a certain percent sequence identity (for example, it is at least 80% identical, at least 85% identical, at least 90% identical, and in some embodiments, at least , 95%, 96%, 97%, 98%, or 99% identical) for a reference sequence can, in certain embodiments, be determined using the BestFit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). BestFit uses Smith and Waterman's local homology algorithm, Advances in Applied Mathematics 2: 482 489 (1981), to find the best segment of homology between two sequences. When using BestFit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence according to the present invention, the parameters are adjusted such that the percent identity is calculated on the full length of the reference nucleotide sequence and gaps in homology of up to 5% of the total number of nucleotides in the reference sequence are allowed.
[000102] In some embodiments, two nucleic acids or polypeptides of the invention are substantially identical, meaning that they are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity when compared and aligned for maximum match, as measured using a sequence comparison algorithm or by visual inspection. In certain embodiments, the identity exists over a region of the sequences that is at least about 10, about 20, about 40-60 residues in length therebetween, or any full value, or over a region longer than 60 -80 residues, for example, at least about 90-100 residues, or the sequences are substantially identical over the entire length of the sequences being compared, such as the coding region of a nucleotide sequence, for example.
[000103] A "conservative amino acid substitution" is one in which an amino acid residue is replaced by another amino acid residue with a similar side chain. Families of amino acid residues having similar side chains have been defined in the art, including basic side chains (eg lysine, arginine, histidine), acidic side chains (eg aspartic acid, glutamic acid) and uncharged polar side chains ( for example, asparagine, glutamine, serine, threonine, cysteine, tyrosine), non-polar side chains (for example, glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (per example threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). For example, replacing a phenylalanine with a tyrosine is a conservative substitution. In certain embodiments, conservative substitutions in the polypeptide and antibody sequences of the invention do not abrogate the binding of the polypeptide or antibody containing the amino acid sequence to the antigen(s), i.e., the FOLR1 to which the polypeptide or antibody binds. Methods of identifying conservative nucleotide and amino acid substitutions that do not eliminate binding to antigens are well known in the art (see, for example, Brummell et al., Biochem. 32: 1180-1187 (1993); Kobayashi et al. Protein Eng. 12(10):879-884 (1999); and Burks et al. Proc. Natl. Acad. Sci. USA 94:412-417 (1997)).
[000104] As used in the present disclosure and claims, the singular forms "a", "an" and "o, a" include the plural forms, unless the context clearly indicates otherwise.
[000105] It is understood that anywhere modalities are described herein with the language "comprising", modalities of analogous forms described in terms of "consenting to" and/or "consisting essentially of" are also provided.
[000106] The term "and/or" as used in a phrase such as "A and/or B" herein is intended to include both "A and B", "A or B", "A" and "B". Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following modalities: A, B and C; A, B, or C; A or C; A or B, B or C; A and C; A and B; B and C; A (individually); B (individually) and C (individually). II. FOLR1 Binding Agents
[000107] The present invention provides agents that specifically bind to human FOLR1. These agents are referred to herein as "FOLR1 binding agents". The full-length (aa) and nucleotide (nt) amino acid sequences for FOLR1 are known in the art and also provided herein as represented by SEQ ID NOs:25 and 26, respectively.
[000108] In certain embodiments, FOLR1 binding agents are antibodies, immunoconjugates or polypeptides. In some embodiments, the FOLR1 binding agents are humanized antibodies. In certain embodiments, the FOLR-1 binding agents are humanized versions of the murine Mov19 antibody (variable heavy and light chain shown as SEQ ID NOs: 17 and 18 respectively).
[000109] In certain embodiments, FOLR1 binding agents having one or more of the following effects: inhibiting the proliferation of tumor cells, reducing the tumorigenicity of a tumor by reducing the frequency of cancer stem cells in the tumor, inhibiting growth of tumor, increase survival, trigger cell death of tumor cells, differentiation of tumor cells to a non-tumorigenic state, or prevent metastasis of tumor cells.
[000110] In certain embodiments, immunoconjugates or other agents that specifically bind human FOLR1 trigger cell death through a cytotoxic agent. For example, in certain embodiments, an antibody to a human FOLR1 antibody is conjugated to a maytansinoid that is activated in tumor cells expressing FOLR1 by internalizing the protein. In certain alternative embodiments, the agent or antibody is unconjugated.
[000111] In certain embodiments, FOLR1 binding agents are able to inhibit tumor growth. In certain embodiments, FOLR1 binding agents are capable of inhibiting tumor growth in vivo (eg, in a xenograft mouse model and/or in a human having cancer). In certain embodiments, FOLR1 binding agents are capable of inhibiting tumor growth in a human.
[000112] Thus, the invention provides a humanized antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO: 1); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaa1FXaa2Xaa3 (SEQ ID NO:56); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9); where Xaa1 is selected from K, Q, H, and R; Xaa2 is selected from Q, H, N, and R; and Xaa3 is selected from G, E, T, S, A, and V. In certain embodiments, the antibody is the huMov19 antibody, which is the antibody described above comprising the heavy chain CDR2 RIHPYDGDTFYNQKFQG (SEQ ID NO:2 ).
[000113] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the huMov19 CDRs with up to four (ie 0, 1, 2, 3, or 4) conservative amino acid substitutions for CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO: 1), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a heavy chain CDR2 comprising RIHPYDGDTFYNQKFQG (SEQ ID NO:2), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; a light chain CDR2 comprising RASNLEA (SEQ ID NO:8), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9), or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
The invention also provides a humanized antibody (huFR1-21) or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising SSYGMS ( SEQ ID NO:30); a heavy chain CDR2 comprising TISSGGSYTY (SEQ ID NO:31); and a heavy chain CDR3 comprising DGEGGLYAMDY (SEQ ID NO:32); and/or (b) a light chain CDR1 comprising KASDHINNWLA (SEQ ID NO:27); a light chain CDR2 comprising GATSLET (SEQ ID NO:28); and a light chain CDR3 comprising QQYWSTPFT (SEQ ID NO:29).
[000115] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the huFR1-21 CDRs with up to four (ie 0, 1, 2, 3, or 4) amino acid substitutions preservatives by CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising SSYGMS (SEQ ID NO:30) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a heavy chain CDR2 comprising TISSGGSYTY (SEQ ID NO:31) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or and a heavy chain CDR3 comprising DGEGGLYAMDY (SEQ ID NO: 32) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising KASDHINNWLA (SEQ ID NO:27) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR2 comprising GATSLET (SEQ ID NO:28) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR3 comprising QQYWSTPFT (SEQ ID NO:29) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[000116] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the CDRs of huFR1-48 with up to four (ie 0, 1, 2, 3, or 4) amino acid substitutions preservatives by CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMQ (SEQ ID NO:60) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a heavy chain CDR2 comprising IYPGNGDSR (SEQ ID NO:61) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or and a heavy chain CDR3 comprising RDGNYAAY (SEQ ID NO:62) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising RASENIYSNLA (SEQ ID NO: 57) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR2 comprising AATNLAD (SEQ ID NO:58) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR3 comprising QHFWASPYT (SEQ ID NO:59) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[000117] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the huFR1-49 CDRs with up to four (ie 0, 1, 2, 3, or 4) amino acid substitutions preservatives by CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TNYWMY (SEQ ID NO:66) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO:67) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or and a heavy chain CDR3 comprising RHDYGAMDY (SEQ ID NO: 68) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising RASENIYTNLA (SEQ ID NO:63) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR2 comprising TASNLAD (SEQ ID NO:64) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR3 comprising QHFWVSPYT (SEQ ID NO:65) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[000118] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the CDRs of huFR1-57 with up to four (ie 0, 1, 2, 3, or 4) amino acid substitutions preservatives by CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising SSFGMH (SEQ ID NO:72) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a heavy chain CDR2 comprising YISSGSSTIS (SEQ ID NO:73) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or and a heavy chain CDR3 comprising EAYGSSMEY (SEQ ID NO:74) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising RASQNINNNLH (SEQ ID NO:69) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR2 comprising YVSQSVS (SEQ ID NO:70) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR3 comprising QQSNSWPHYT (SEQ ID NO:71) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[000119] In certain embodiments, the invention provides humanized antibodies or antigen binding fragments that specifically bind to FOLR1 comprising the huFR1-65 CDRs with up to four (ie 0, 1, 2, 3, or 4) amino acid substitutions preservatives by CDR. Thus, in certain embodiments the invention provides humanized antibodies or antigen binding fragments that specifically bind a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising TSYTMH (SEQ ID NO:78) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a heavy chain CDR2 comprising YINPISGYTN (SEQ ID NO:79) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or and a heavy chain CDR3 comprising GG A YGRKPMD Y (SEQ ID NO: 80) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or (b) a light chain CDR1 comprising ASQNVGPNVA (SEQ ID NO:75) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR2 comprising SASYRYS (SEQ ID NO:76) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions; and/or a light chain CDR3 comprising QQYNSYPYT (SEQ ID NO:77) or a variant thereof comprising 1, 2, 3, or 4 conservative amino acid substitutions.
[000120] Polypeptides comprising one of the individual light chains or heavy chains described herein, as well as polypeptides (eg antibodies) comprising both a light chain and a heavy chain are also provided. The polypeptides of SEQ ID NOs: 4 and 6 comprise the variable domain of the heavy chain of huMov19, and the heavy chain of huMov19, respectively. The polypeptides of SEQ ID NOs: 10-13 comprise the version 1.00 variable domain light chain, the version 1.60 variable domain light chain, the version 1.00 light chain, and the version 1.60 light chain of huMovl 9, respectively. The polypeptides of SEQ ID NOs: 42 and 46 comprise the variable domain of the heavy chain of huFR1-21, and the heavy chain of huFR1-21, respectively. The polypeptides of SEQ ID NOs:41 and 45 comprise a variable domain light chain and huFR1-21 light chain, respectively. The polypeptides of SEQ ID NOs: 97 and 113 comprise the variable domain of the heavy chain of huFR1-48, and the heavy chain of huFR1-48, respectively. The polypeptides of SEQ ID NOs:96 and 112 comprise a variable domain light chain and light chain of huFR1-48, respectively. The polypeptides of SEQ ID NOs: 99 and 115 comprise the variable domain of the heavy chain of huFR1-49, and the heavy chain of huFR1-49, respectively. The polypeptides of SEQ ID NOs:98 and 114 comprise a variable domain light chain and huFR1-49 light chain, respectively. The polypeptides of SEQ ID NOs: 101 and 117 comprise the variable domain of the heavy chain of huFR1-57, and the heavy chain of huFR1-57, respectively. The polypeptides of SEQ ID NOs: 100 and 116 comprise a variable domain light chain and huFR1-57 light chain, respectively. The polypeptides of SEQ ID NOs: 103 and 119 comprise the variable domain of the heavy chain of huFR1-65, and the heavy chain of huFR1-65, respectively. The polypeptides of SEQ ID NOs: 102 and 118 comprise a variable domain light chain and huFR1-65 light chain, respectively.
[000121] Also provided are polypeptides comprising: (a) a polypeptide having at least about 90% sequence identity to SEQ ID NO:4 or 6; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs: 10-13. Polypeptides are also provided which comprise: (a) a polypeptide having about 90% sequence identity to SEQ ID NO: 42 or 46; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs: 41 and 45. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 90% identity sequence for SEQ ID NO:97 or 113; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs:96 or 112. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 90% identity sequence for SEQ ID NO:99 or 115; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs: 98 or 114. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 90% identity sequence for SEQ ID NO: 101 or 117; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs: 100 or 116. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 90% identity sequence for SEQ ID NO: 103 or 119; and/or (b) a polypeptide having at least about 90% sequence identity to SEQ ID NOs: 102 or 118. In certain embodiments, the polypeptide comprises a polypeptide having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity for SEQ ID NOs:4, 6, 10-13, 41, 42, 45 or 46. Thus, in certain embodiments, the polypeptide comprises (a) a polypeptide having at least about 95% sequence identity to SEQ ID NO:4 or 6, and/or (b) a polypeptide having at least about 95% of sequence identity for SEQ ID NOs: 10-13. In certain embodiments, the polypeptide comprises (a) a polypeptide having at least about 95% sequence identity to SEQ ID NO:42 or 46, and/or (b) a polypeptide having at least about 95% identity of sequence for SEQ ID NOs:41 or 45. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% sequence identity for SEQ ID NO:97 or 113; and/or (b) a polypeptide having at least about 95% sequence identity to SEQ ID NOs:96 or 112. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% identity sequence for SEQ ID NO:99 or 115; and/or (b) a polypeptide having at least about 95% sequence identity to SEQ ID NOs:98 or 114. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% identity sequence for SEQ ID NO: 101 or 117; and/or (b) a polypeptide having at least about 95% sequence identity to SEQ ID NOs: 100 or 116. Polypeptides are also provided which comprise: (a) a polypeptide having at least about 95% identity sequence for SEQ ID NO: 103 or 119; and/or (b) a polypeptide having at least about 95% sequence identity to SEQ ID NOs: 102 or 118. In certain embodiments, the polypeptide comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO. : 4; and/or (b) a polypeptide having the amino acid sequence of SEQ ID NO: 10 or SEQ ID NO: 11. In certain embodiments, the polypeptide comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO:45; and/or (b) a polypeptide having the amino acid sequence of SEQ ID NO:46. In certain embodiments, the polypeptide comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 6; and/or (b) a polypeptide having the amino acid sequence of SEQ ID NO: 12 or SEQ ID NO: 13. In certain embodiments, the polypeptide is an antibody and/or the polypeptide specifically binds human folate receptor 1. In certain embodiments, the polypeptide is an antibody and/or the polypeptide. In certain embodiments, the polypeptide is a humanized antibody that specifically binds human folate receptor 1. For example, the invention provides a humanized antibody or antibody that specifically binds a human FOLR1 that comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 4; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 10 or SEQ ID NO: 11. In certain embodiments the polypeptide comprising SEQ ID NO:4 is a heavy chain variable region. In certain embodiments, the polypeptide comprising SEQ ID NO: 10 or 11 is a light chain variable region. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 6; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 12 or SEQ ID NO: 13. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the sequence of amino acid of SEQ ID NO:45; and (b) a polypeptide having the amino acid sequence of SEQ ID NO:46. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 112; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 113. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 114; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 115. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 16; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 117. The invention also provides a humanized antibody or antibody that specifically binds a human FOLR1 which comprises (a) a polypeptide having the amino acid sequence of SEQ ID NO: 118; and (b) a polypeptide having the amino acid sequence of SEQ ID NO: 119. In certain embodiments, the polypeptide having a certain percentage sequence identity for SEQ ID NOs: 4, 6, 10-13, 41, 42, 45, 46, 96-103 and 112-119 differ from SEQ ID NO: 4, 6, 1013, 41, 42, 45, 46, 96-103 and 112-119 by conservative amino acid substitutions only.
[000122] In certain embodiments, the FOLR-1 binding agent comprises, consists essentially of, or consists of an anti-FOLR1 antibody selected from the group consisting of huMov19, FR-1-21, FR1-48, FR1 antibodies -49, FR1-57, and FR1-65.
[000123] In certain embodiments, the huMov19 antibody is encoded by plasmids deposited with the American Type Culture Collection (ATCC) on April 7, 2010 and having ATCC deposit nos. PTA-10772 and PTA-10773 or 10774.
[000124] In certain embodiments, the FR-1-21 antibody is encoded by plasmids deposited with the ATCC on April 7, 2010, and assigned deposit designation numbers PTA-10775 and 10776.
[000125] In certain embodiments, humanized antibodies bind to FOLR1 with substantially the same affinity as the chimeric antibody Mov19. The affinity or avidity of an antibody for the antigen can be determined experimentally using any suitable method well known in the art, for example, flow cytometry, enzyme-linked immunosorbent assay (ELISA), or radioimmunoassay (RIA), or kinetics (e.g. , BIACORE™ analysis). Direct binding assays as well as competitive binding assay formats can be readily employed. (See, for example, Berzofsky, et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, WE, Ed., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company : New York, NY (1992) and methods described herein The measured affinity of a particular antibody-antigen interaction may vary if measured under different conditions (eg, salt concentration, pH, temperature). and other antigen binding parameters (eg, KD or Kd, Kon, Koff) are made with standard solutions of antibody and antigen, and a standard buffer, as known in the art and as the buffer described herein.
[000126] In one aspect, binding assays can be performed using flow cytometry on cells expressing the FOLR1 antigen on the surface. For example, SKOV3 positive FOLR1 cells were incubated with varying concentrations of anti-FOLR1 antibodies using 1 x 105 cells per sample in 100 µL of FACS buffer (RPMI-1640 medium supplemented with 2% normal goat serum). Then, cells were pelleted, washed, and incubated for 1 h with 100 µL of FITC-conjugated goat-anti-mouse IgG or goat-anti-human IgG antibody (as is obtainable from eg Jackson Laboratory, 6 μg/ ml in FACS buffer). Cells were pelleted again, washed with FACS buffer and resuspended in 200 µL of PBS containing 1% formaldehyde. Samples were acquired, for example, using a FACSCalibur flow cytometer with the HTS multi-well sampler and analyzed using CellQuest Pro (all from BD Biosciences, San Diego, US). For each sample the mean fluorescence intensity for FL1 (MFI) was exported and plotted against antibody concentration in a semi-log plot to generate a binding curve. A sigmoidal dose-response curve is fitted to the binding curves and EC50 values are calculated using programs such as GraphPad Prism v4 with standard parameters (GraphPad software, San Diego, CA). EC50 values can be used as a measure for the apparent dissociation constant "Kd" or "KD" for each antibody.
Monoclonal antibodies can be prepared using hybridoma methods such as those described by Kohler and Milstein (1975) Nature 256:495. Using the hybridoma method, a mouse, hamster, or other appropriate host animal, is immunized as described above to elicit the production of antibodies by lymphocytes that will specifically bind to an immunizing antigen. Lymphocytes can also be immunized in vitro. After immunization, lymphocytes are isolated and fused with a suitable myeloma cell line, using, for example, polyethylene glycol to form hybridoma cells which can then be selected from unfused lymphocytes and myeloma cells. Hybridomas that produce monoclonal antibodies specifically directed against a chosen antigen, as determined by immunoprecipitation, immunoblotting, or by an in vitro binding assay (eg, radioimmunoassay (RIA); enzyme-linked immunosorbent assay (ELISA)) can then be propagated or cultured in vitro using standard methods (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, 1986) or in vivo as ascites tumors in an animal. The monoclonal antibodies can then be purified from the culture medium or ascites fluid as described for the polyclonal antibodies noted above.
[000128] Alternatively, monoclonal antibodies can also be made by recombinant DNA methods such as described in US Patent 4,816,567. Polynucleotides encoding a monoclonal antibody are isolated from mature B cells or hybridoma cells, such as by RT-PCR using oligonucleotide primers that specifically amplify the genes encoding the antibody heavy and light chains, and its sequence is determined using conventional procedures. Isolated polynucleotides encoding heavy and light chains are then cloned into suitable expression vectors, which, when transfected into host cells, such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells or myeloma cells that do not otherwise produce the immunoglobulin protein, monoclonal antibodies are produced by the host cells. In addition, recombinant monoclonal antibodies, or fragments thereof from the desired species can be isolated from phage display libraries that express CDRs from the desired species, as described (McCafferty et al., 1990, Nature, 348:552-554 ; Clackson et al., 1991, Nature, 352:624-628; and Marks et al., 1991, J. Mol. Biol., 222:581-597).
[000129] The polynucleotide(s) encoding a monoclonal antibody can be further modified in a number of different ways, using recombinant DNA technology to generate alternative antibodies. In some embodiments, the light and heavy chain constant domains of, for example, a mouse monoclonal antibody may be replaced 1) with regions from, for example, a human antibody to generate a chimeric antibody, or 2) with a mouse monoclonal antibody. non-immunoglobulin to generate a fusion antibody. In some embodiments, constant regions are truncated or removed to generate the antibody fragment of a desired monoclonal antibody. Site-directed or high-density variable region mutagenesis can be used to optimize the specificity, affinity, etc., of a monoclonal antibody.
[000130] In some embodiments, the monoclonal antibody against human FOLR1 is a humanized antibody. In certain embodiments, such antibodies are used therapeutically to reduce antigenicity and HAMA (human anti-mouse antibody) responses when administered to a human subject.
[000131] Methods for engineering, humanizing or reappearing non-human or human antibodies can also be used and are well known in the art. A humanized, reappeared, or similarly designed antibody can have one or more amino acid residues from a source that is non-human, for example, but not limited to, mouse, rat, rabbit, non-human primate, or other mammals. These non-human amino acid residues are replaced by residues that are often referred to as the import residues, which are usually taken from an import variable, constant, or other domain of a known human sequence.
[000132] Such imported sequences can be used to reduce immunogenicity or reduce, increase or modify binding, affinity, nominal constant, extranominal constant, avidity, specificity, half-life, or any other suitable characteristic, as known in the art. In general, CDR residues are directly and most substantially involved in influencing FOLR1 binding. Likewise, part or all of the human or non-human CDR sequences are maintained while the non-human constant and variable region sequences may be substituted for human or other amino acids.
[000133] Antibodies may also optionally be humanized, coated, genetically modified or genetically modified human antibodies with high affinity retention for the FOLR1 antigen and other favorable biological properties. To achieve this goal, humanized (or human) or genetically modified anti-FOLR1 antibodies and coated antibodies can optionally be prepared by a process of analysis of the parental sequences and various humanized and genetically modified conceptual products using three-dimensional models of the genetically modified and parental sequences. humanized. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available, which illustrate and expose likely three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these exposures allows analysis of the likely role of residues in the functioning of the candidate immunoglobulin sequence, that is, analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen, such as FOLR1. In this way, framework residues (FR) can be selected and combined from the consensus and import sequences so that characteristic desired antibody, such as increased affinity for target antigens, is achieved.
The humanization, surface recomposition or genetic modification of the antibodies of the present invention can be carried out using any known method, such as, but not limited to, those described in, Winter (Jones et al, Nature 321 :522 (1986); Riechmann et al. al., Nature 332:323 (1988); Verhoeyen et al., Science 239:1534 (1988)), Sims et al., J. Immunol. 151: 2296 (1993); Chothia and Lesk, J. Mol. Biol. 196:901 (1987), Carter et al., Proc. Natl. Academic Sci. U.S.A. 89:4285 (1992); Presta et al., J. Immunol. 151:2623 (1993), US Patents 5,639,641, 5,723,323; 5,976,862; 5,824,514; 5,817,483; 5,814,476; 5,763,192; 5,723,323; 5,766,886; 5,714,352; 6,204,023; 6,180,370; 5,693,762; 5,530,101; 5,585,089; 5,225,539; 4,816,567; PCT/US98/16280; US96/18978; US91/09630; US91/05939; US94/01234; GB89/01334; GB91/01134; GB92/01755; WO90/14443; WO90/14424; WO90/14430; EP 229246; 7,557,189; 7,538,195; and 7,342,110, each of which is incorporated herein by reference, including the references cited therein.
[000135] In certain alternative embodiments, the antibody to FOLR1 is a human antibody. Human antibodies can be prepared directly using various techniques known in the art. Immortalized human B lymphocytes immunized in vitro or isolated from an immunized subject that produce an antibody directed against a target antigen can be generated (See, for example, Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boemer et al., 1991, J. Immunol., 147 (1):86-95; and US Patent 5,750,373). In addition, the human antibody can be selected from a phage library, wherein the phage library expresses human antibodies, as described, for example, in Vaughan et al., 1996, Nat. Biotech., 14:309- 314, Sheets et al., 1998, Proc. Nat'l. Academic Sci., 95:6157-6162, Hoogenboom and Winter, 1991, J. Mol. Biol., 227:381, and Marks et al., 1991, J. Mol. Biol., 222:581). Techniques for generating and using antibody phage libraries are also described in US Patents 5,969,108, 6,172,197, 5,885,793, 6,521,404; 6,544,731; 6,555,313; 6,582,915; 6,593,081; 6,300,064; 6,653,068; 6,706,484, and 7,264,963, and Rothe et al., 2007, J. Mol. Bio., doi:10.1016/j.jmb.2007.12,018 (each of which is incorporated by reference in its entirety). Affinity maturation strategies and chain shuffling strategies (Marks et al., 1992, Bio/Technology 10:779-783, incorporated herein by reference in its entirety) are known in the art and can be employed to generate high-grade human antibodies. affinity.
[000136] Humanized antibodies can also be made in transgenic mice containing human immunoglobulin loci that are capable of producing, upon immunization, the full repertoire of human antibodies in the absence of endogenous immunoglobulin production. This approach is described in US Patents 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425, and 5,661,016.
This invention also encompasses bispecific antibodies that specifically recognize a human folate receptor 1. Bispecific antibodies are antibodies that are capable of recognizing and specifically binding to at least two different epitopes. Different epitopes can be within the same molecule (eg the same human folate receptor 1) or on different molecules such that both, eg antibodies can specifically recognize and bind to the human folate receptor 1 as well. as, for example, 1) an effector molecule on a leukocyte, such as a T cell receptor (eg, CD3) or Fc receptors (eg, CD64, CD32, or CD16), or 2) a cytotoxic agent, such as described in detail below.
[000138] Exemplary bispecific antibodies can bind to two different epitopes, at least one of which originates from a polypeptide of the invention. Alternatively, an anti-antigen arm of an immunoglobulin molecule can be combined with an arm that binds to a trigger molecule on a leukocyte such as a T cell receptor molecule (eg, CD2, CD3, CD28 or B7), or Fc receptors for IgG in order to focus the cellular defense mechanisms for the cell expressing the specific antigen. Bispecific antibodies can also be used to target cytotoxic agents to cells that express a particular antigen. These antibodies have an antigen-binding arm and an arm that binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOTA, or TETA. Techniques for preparing bispecific antibodies are common in the art (Millstein et al., 1983, Nature 305:537-539; Brennan et al., 1985, Science 229:81; Suresh et al, 1986, Methods in Enzymol. 121 :120; Traunecker et al., 1991, EMBO J. 10:3655-3659; Shalaby et al., 1992, J. Exp. Med. 175:217225; Kostelny et al., 1992, J. Immunol. 148:1547 -1553; Gruber et al., 1994, J. Immunol. 152:5368; and US Patent 5,731,168). Antibodies with more than two valences are also contemplated. For example, trispecific antibodies can be prepared (Tutt et al., J. Immunol. 147:60 (1991)). Thus, in certain embodiments the anti-FOLR1 antibodies are multispecific.
[000139] In certain embodiments an antibody fragment is provided to, for example, increase tumor penetration. Various techniques are known for producing antibody fragments. Traditionally, these fragments have been derived by proteolytic digestion of intact antibodies (e.g., Morimoto et al., 1993, Journal of Biochemical and Biophysical Methods 24:107-117; Brennan et al., 1985, Science, 229:81). In certain embodiments, antibody fragments are produced recombinantly. Fab, Fv and scFv antibody fragments can all be expressed in and secreted from E. coli or other host cells, thus allowing the production of large amounts of these fragments. Such antibody fragments can also be isolated from the antibody phage libraries discussed above. The antibody fragment may also be from linear antibodies, as described in US Patent 5,641,870, for example, and may be monospecific or bispecific. Other techniques for producing antibody fragments will be apparent to one of skill in the art.
[000140] According to the present invention, the techniques can be adapted for the production of single chain antibodies specific for the human folate receptor 1 (see US Patent 4,946,778). In addition, the methods can be adapted to construct Fab expression libraries (Huse, et al., Science 246:1275-1281 (1989)) to allow rapid and efficient identification of monoclonal Fab fragments with the desired specificity for human folate receptor 1, or derivatives, fragments, analogs or homologs thereof. Antibody fragments can be produced by prior art techniques, including, but not limited to: (a) an F(ab')2 fragment produced by pepsin digestion of an antibody molecule, (b) a Fab fragment generated by reducing the disulfide bridges of an F(ab')2 fragment, (c) a Fab fragment generated by treating the antibody molecule with papain and a reducing agent, and (d) fragments of Fv.
[000141] It may further be desirable, particularly in the case of antibody fragments, to modify an antibody in order to increase its serum half-life. This can be achieved, for example, by incorporating a salvage receptor binding epitope into the antibody fragment by mutating the appropriate region in the antibody fragment or by incorporating the epitope into a peptide tag, which is then fused to the fragment. antibody at either end or in the middle (for example, by peptide or DNA synthesis).
[000142] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (US Patent 4,676,980). It is contemplated that the antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate.
[000143] For the purposes of the present invention, it should be noted that the modified antibodies may comprise any type of variable region that provides for the association of the antibody with the polypeptides of a human FOLR1. In this regard, the variable region can include, or be derived from, any type of mammal that can be induced to mount a humoral immune response and generate immunoglobulins against the desired tumor associated antigen. As such, the variable region of the modified antibodies can be, for example, of human, murine, non-human primate (e.g., cynomolgus monkeys, monkeys, etc.) or lupine origin. In some embodiments both the variable and constant regions of the modified immunoglobulins are human. In other embodiments compatible antibody variable regions (generally derived from a non-human source) can be designed or specifically adapted to improve the binding properties or reduce the immunogenicity of the molecule. In this regard, the variable regions useful in the present invention can be humanized or otherwise altered by the inclusion of imported amino acid sequences.
[000144] In certain embodiments, the variable domains in both the heavy and light chains are altered by at least a partial replacement of one or more CDRs and, if necessary, by partial replacement of the framework region and sequence change. Although the CDRs can be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is anticipated that the CDRs will be derived from an antibody of a different class and in certain modalities from an antibody from a different species. It may not be necessary to replace all of the CDRs with the complete CDRs from the donor variable region to transfer antigen-binding capacity from one variable domain to another. Instead, it may only be necessary to transfer the residues that are needed to maintain the activity of the antigen-binding site. Given the explanations set forth in US Patents 5,585,089, 5,693,761 and 5,693,762, it will be well within the purview of those skilled in the art, either by performing routine experiments, or by trial and error testing to obtain a functional antibody, with reduced immunogenicity.
[000145] Despite the variable region changes, those skilled in the art will appreciate that the modified antibodies of the present invention will include antibodies (e.g., full length antibodies or immunoreactive fragments thereof) in which at least a fraction of one or more of the constant region domains have been deleted or altered in order to provide desired biochemical characteristics, such as increased tumor localization or reduced serum half-life, when compared to an antibody of approximately the same immunogenicity comprising a native or unaltered constant region. In some embodiments, the constant region of the modified antibodies will comprise a human constant region. Modifications to the constant region compatible with the present invention comprise additions, deletions or substitutions of one or more amino acids in one or more domains. That is, the modified antibodies described herein may comprise alterations or modifications to one or more of the three constant domains of the heavy chain (CH1, CH2 or CH3), and/or to the constant domain of the light chain (CL). In some embodiments, modified constant regions in which one or more domains are partially or completely deleted are contemplated. In some embodiments, the modified antibodies will comprise deleted domain constructs or variants in which the entire CH2 domain has been removed (ΔCH2 constructs). In some embodiments, the omitted constant region domain will be replaced by a short amino acid spacer (eg, 10 residues) that provides some of the molecular flexibilities typically conveyed by the missing constant region.
[000146] In addition to its configuration, it is known in the art that the constant region mediates several effector functions. For example, the binding of the C1 component of complement to an antibody activates the complement system. Complement activation is important in opsonization and cell lysis of pathogenic organisms. Complement activation also stimulates the inflammatory response and may also be involved in autoimmune hypersensitivity. In addition, antibodies bind to cells through the Fc region, with an Fc receptor site over the antibody Fc region binding to an Fc receptor (FcR) on a cell. There are a number of Fc receptors, which are specific for different classes of antibodies, including IgG (gamma receptors), IgE (eta receptors), IgA (alpha receptors) and IgM (mu receptors). Antibody binding to Fc receptors on cell surfaces triggers a number of important and diverse biological responses, including immersion and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called mediated cytotoxicity by antibody-dependent cells, or ADCC), release of inflammatory mediators, placental transfer and control of immunoglobulin production.
[000147] In certain embodiments, FOLR1 binding antibodies provide altered effector functions which, in turn, affect the biological profile of the administered antibody. For example, deletion or inactivation (through point mutations or other means) of a constant region domain, can reduce binding to the modified circulating antibody Fc receptor, thus increasing tumor localization. In other cases, it may be that constant region modifications in accordance with this invention moderate complement binding and thus reduce the serum half-life and non-specific association of a conjugated cytotoxin. However, other constant region modifications can be used to eliminate disulfide bonds or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. Likewise, constant region modifications in accordance with the present invention can readily be made using well known techniques of biochemical or molecular engineering well within the purview of one of ordinary skill in the art.
[000148] In certain embodiments, a FOLR1 binding agent is an antibody that lacks one or more effector functions. For example, in some embodiments, the antibody has no antibody-dependent cellular cytotoxicity (ADCC) activity and/or no complement-dependent cytotoxicity (CDC) activity. In certain embodiments, the antibody does not bind an Fc receptor and/or complement factors. In certain embodiments, the antibody has an effector function.
[000149] It should be noted that, in certain embodiments, the modified antibodies can be engineered to fuse the CH3 domain directly with the hinge region of the respective modified antibodies. In other constructs it may be desirable to provide a peptide spacer between the hinge region and the modified CH2 and/or CH3 domains. For example, compatible constructs can be expressed in which the CH2 domain has been deleted and the remaining CH3 domain (modified or unmodified) is linked to the hinge region with a 5-20 amino acid spacer. This spacer can be added, for example, to ensure that the constant domain regulation elements remain free and accessible or that the hinge region remains flexible. However, it should be noted that amino acid spacers may, in certain cases, prove to be immunogenic and induce an undesirable immune response against the construct. Thus, in certain embodiments, any spacer added to the construct will be relatively non-immunogenic, or even omitted altogether, in order to maintain the desired biochemical qualities of the modified antibodies.
[000150] In addition to the deletion of the entire constant region domains, it will be appreciated that the antibodies of the present invention can be provided by the deletion or partial substitution of some or even a single amino acid. For example, mutation of a single amino acid in selected areas of the CH2 domain may be sufficient to substantially reduce Fc binding and thus increase tumor localization. Likewise, it may be desirable to simply delete the part of one or more domains of the constant region that control effector function (eg, complement ClQ binding) to be modulated. Such partial deletions of constant regions may improve selected antibody features (serum half-life), while leaving other desirable functions associated with the subject's constant region domain intact. Furthermore, as mentioned above, the constant regions of the described antibodies can be modified by mutation or substitution of one or more amino acids that enhance the profile of the resulting construct. In this regard, it may be possible to affect the activity provided by a conserved binding site (eg, Fc binding), while substantially maintaining the configuration and immunogenic profile of the modified antibody. Certain modalities may comprise the addition of one or more amino acids in the constant region to potentiate desirable characteristics, such as decreasing or increasing effector function or providing more cytotoxin or carbohydrate fixation. In such embodiments, it may be convenient to insert or replicate selected specific sequences derived from constant region domains.
The present invention also encompasses variants and equivalents that are substantially homologous to the chimeric, humanized and human antibodies, or antibody fragments thereof, set forth herein. These can contain, for example, conservative substitution mutations, i.e. the replacement of one or more amino acids with similar amino acids. For example, conservative substitution refers to replacing one amino acid with another within the same general class, such as, for example, an acidic amino acid with another acidic amino acid, a basic amino acid with another basic amino acid, or a neutral amino acid with another basic amino acid. another neutral amino acid. What is intended by a conservative amino acid substitution is well known in the art.
[000152] The polypeptides of the present invention can be recombinant polypeptides, natural polypeptides or synthetic polypeptides, comprising an antibody, or fragment thereof, against human FOLR1. It will be recognized in the art that some amino acid sequences of the invention can be varied without significant effect on protein structure or function. Thus, the invention further includes polypeptide variations that show substantial activity or that include regions of an antibody, or fragment thereof, against FOLR1 protein. Such mutants include deletions, insertions, inversions, repeats, and type substitutions.
[000153] Polypeptides and analogs can be further modified to contain additional chemical fractions that are not normally part of the protein. Those derived fractions can improve the solubility, biological half-life or absorption of the protein. Fractions can also reduce or eliminate the desirable side effects of proteins and the like. An overview for fractions can be found in REMINGTON'S PHARMACEUTICAL SCIENCES, 20th ed., Mack Publishing Co., Easton, PA (2000).
[000154] The isolated polypeptides described herein can be produced by any suitable method known in the art. Such methods range from direct synthetic protein methods to constructing a DNA sequence encoding isolated polypeptide sequences and expressing those sequences in a suitable transformed host. In some embodiments, a DNA sequence is constructed using recombinant technology by isolating or synthesizing a DNA sequence that encodes a wild-type protein of interest. Optionally, the sequence can be mutagenized through site-specific mutagenesis to provide functional analogues of the sequence. See, for example, Zoeller et al., Proc. Nat'l. Academic Sci. USA 81:5662-5066 (1984) and US Patent 4,588,585.
[000155] In some embodiments, a DNA sequence encoding a polypeptide of interest would be constructed by chemical synthesis using an oligonucleotide synthesizer. Such oligonucleotides can be designed based on the amino acid sequence of the desired polypeptide and selection of the codons that are favored in the host cell in which the recombinant polypeptide of interest will be produced. Standard methods can be applied to synthesize an isolated polynucleotide sequence that encodes an isolated polypeptide of interest. For example, a complete amino acid sequence can be used to construct a back-translated gene. In addition, a DNA oligomer containing a nucleotide sequence that encodes the particular isolated polypeptide can be synthesized. For example, several small oligonucleotides that encode portions of the desired polypeptide can be synthesized and then ligated. Individual oligonucleotides usually contain 5' or 3' bulges for complementary assembly.
[000156] Once assembled (by synthesis, site-directed mutagenesis or other method), the polynucleotide sequences encoding a particular isolated polypeptide of interest will be inserted into an expression vector and operatively linked to an appropriate expression control sequence for the expression of the protein in a desired host. Proper assembly can be confirmed by nucleotide sequencing, restriction mapping and expression of a biologically active polypeptide in a suitable host. As is well known in the art, in order to obtain high levels of expression of a transfected gene in a host, the gene must be operably linked to transcriptional and translational expression control sequences that are functional in the chosen expression host.
[000157] In certain embodiments, recombinant expression vectors are used to amplify and express antibodies encoding DNA, or fragments thereof, against human FOLR1. Recombinant expression vectors are replicable DNA constructs that have synthetic DNA fragments or cDNA derivatives that encode a polypeptide chain of an anti-FOLR1 antibody, or a fragment thereof, operably linked to transcriptional or translational regulatory elements suitable derivatives of genes from mammals, microbes, viruses or insects. A transcriptional unit generally comprises a set of (1) a genetic element or elements having a regulatory role in gene expression, for example, transcriptional promoters or enhancers, (2) a coding or structural sequence that is transcribed into mRNA and translated into protein , and (3) appropriate transcription and translation initiation and termination sequences, as described in detail below. Such regulatory elements can include an operator sequence to control transcription. The ability to replicate in a host, normally conferred by an origin of replication, and a selection gene to facilitate recognition of transformants can be further incorporated. DNA regions are operably linked when they are functionally related to one another. For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor that participates in the secretion of the polypeptide; a promoter is operably linked to a coding sequence if it controls transcription of the sequence, or a ribosome binding site is operably linked to a coding sequence if it is positioned to permit translation. Structural elements intended for use in yeast expression systems include a leader sequence that allows extracellular secretion of translated protein by a host cell. Alternatively, when the recombinant protein is expressed without a leader or transport sequence, it may include an N-terminal methionine residue. This residue can optionally be subsequently cleaved from the expressed recombinant protein to provide a final product.
[000158] The choice of expression control sequence and expression vector will depend on the choice of the host. A wide variety of expression host/vector combinations can be employed. Useful expression vectors for eukaryotic hosts include, for example, vectors comprising expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Useful expression vectors for bacterial hosts include known bacterial plasmids such as E. coli plasmids, including pCR 1, pBR322, pMB9 and their derivatives, larger host range plasmids such as M13 and single-stranded DNA phages.
[000159] Suitable host cells for expression of a FOLR1 binding polypeptide or antibody (or a FOLR1 protein for use as an antigen) include prokaryotic, yeast, insect or higher eukaryotic cells under the control of appropriate promoters . Prokaryotes include gram negative or gram positive organisms, for example, E. coli or bacilli. Higher eukaryotic cells include established cell lines of mammalian origin as described below. Cell-free translation systems can also be employed. Appropriate cloning and expression vectors for use with bacterial, yeast, fungal, and mammalian cellular hosts are described by Pouwels et al. (Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., 1985), the relevant disclosure of which is incorporated herein by reference. Additional information on protein production methods, including antibody production, can be found, for example, in US Patent Publication 2008/0187954, US Patents 6,413,746 and 6,660,501, and International Patent Publication WO 04009823, each of which is incorporated herein by reference in their entirety.
[000160] Various mammalian or insect cell culture systems are also advantageously used to express the recombinant protein. Expression of recombinant proteins in mammalian cells can be accomplished because such proteins are generally correctly folded, appropriately modified and fully functional. Examples of mammalian host cell lines include monkey kidney cell lines HE-293 and HEK-293T and COS-7, described by Gluzman (Cell 23:175, 1981), and other cell lines capable of expressing a appropriate vector including, for example, L, C127, 3T3 cells, Chinese hamster ovary (CHO), HeLa and BHK cell lines. Mammalian expression vectors can comprise non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the gene to be expressed, and other non-transcribed sequences that flank 5' or 3' and the 5' or non-translated sequences. 3', such as required ribosome binding sites, a polyadenylation site, splice donor and receptor sites, and transcription termination sequences. Baculovirus systems for producing heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio/Technology 6:47 (1988).
[000161] Proteins produced by a transformed host can be purified according to any suitable method. Such conventional methods include chromatography (eg, ion exchange, affinity and column sizing chromatography), centrifugation, differential solubility, or any other standard technique for protein purification. Affinity tags such as hexa-histidine, maltose binding domain, influenza coat sequence and glutathione-S-transferase can be attached to the protein to allow easy purification by passage through an appropriate affinity column. Isolated proteins can also be physically characterized using techniques such as proteolysis, nuclear magnetic resonance and x-ray crystallography.
[000162] For example, supernatants from systems that secrete recombinant protein into the culture media can first be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. After the concentration step, the concentrate can be applied to a suitable purification matrix. Alternatively, an anion exchange resin can be used, for example, a matrix or substrate having diethylaminoethyl (DEAE) pendant groups. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly used in protein purification. Alternatively, a cation exchange step can be employed. Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Finally, one or more reverse phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl groups or other aliphatic groups, can be employed to further purify a FOLR1 binding agent. Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a homogeneous recombinant protein.
[000163] The recombinant protein produced in bacterial culture can be isolated, for example, by initial extraction of cell pellets, followed by one or more steps of concentration, saltingout, aqueous ion exchange chromatography or size exclusion. High performance liquid chromatography (HPLC) can be used for the final purification steps. Microbial cells used in the expression of a recombinant protein can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption or use of cell lysing agents.
[000164] Methods known in the art for purifying antibodies and other proteins also include, for example, those described in US Patent Publications 2008/0312425, 2008/0177048, and 2009/0187005, each of which is incorporated herein by reference in this document in its entirety.
[000165] In certain embodiments, the FOLR1 binding agent is a polypeptide that is not an antibody. A variety of methods for identifying and producing non-antibody polypeptides that bind with high affinity to a protein target are known in the art. See, for example, Skerra, Curr. Opinion Biotechnol., 18:295-304 (2007), Hosse et al., Protein Science, 15:14-27 (2006), Gill et al., Curr. Opinion Biotechnol., 17:653-658 (2006), Nygren, FEBS J., 275:2668-76 (2008), and Skerra, FEBS J., 275:2677-83 (2008), each of which is incorporated herein. by reference in its entirety. In certain embodiments, phage display technology has been used to identify/produce the FOLR1 binding polypeptide. In certain embodiments, the polypeptide comprises a protein support of a type selected from the group consisting of protein A, a lipocalin, a fibronectin domain, an ankyrin consensus repeat domain, and thioredoxin.
[000166] In some embodiments, the agent is a non-protein molecule. In certain embodiments, the agent is a small molecule. Combinatorial chemistry libraries and techniques useful for identifying non-protein FOLR1 binding agents are known to those of skill in the art. See, for example, Kennedy et al., J. Comb. Chem, 10:345-354 (2008), Dolle et al, J. Comb. Chem., 9:855-902 (2007), and Bhattacharyya, Curr. Med. Chem., 8:1383-404 (2001), each of which is incorporated herein by reference in its entirety. In certain embodiments, the agent is a carbohydrate, a glycosaminoglycan, a glycoprotein or a proteoglycan.
[000167] In certain embodiments, the agent is a nucleic acid aptamer. Aptamers are polynucleotide molecules that have been selected (eg, from random pools or mutated) based on their ability to bind to another molecule. In some embodiments, the aptamer comprises a DNA polynucleotide. In certain alternative embodiments, the aptamer comprises an RNA polynucleotide. In certain embodiments, the aptamer comprises one or more modified nucleic acid residues. Methods of generating and screening nucleic acid aptamers for binding to proteins are well known in the art. See, for example, US Patent 5,270,163, US Patent 5,683,867, US Patent 5,763,595, US Patent 6,344,321, US Patent 7,368,236, US Patent 5,582,981, US Patent 5,756,291, US Patent 5,840 .867, US Patent 7,312,325, US Patent 7,329,742, International Patent Application WO 02/077262, International Patent Publication. WO 03/070984 , US Patent Application Publication 2005/0239134 , US Patent Application Publication 2005/0124565 and US Patent Application Publication 2008/0227735 , each of which is incorporated herein by reference in its entirety. III. Immunoconjugates
[000168] The present invention is also directed to conjugates (also referred to herein as immunoconjugates), comprising anti-FOLR1 antibodies, antibody fragments, functional equivalents, improved antibodies and aspects thereof are disclosed herein, linked or conjugated to a cytotoxin (drug ) or prodrug. Thus, in a particular embodiment, the invention provides an immunoconjugate comprising a humanized antibody or antigen binding fragment thereof that specifically binds a human folate receptor 1, wherein the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO: 1); a heavy chain CDR2 comprising RIHPYDGDTFYNQXaa1FXaa2Xaa3 (SEQ ID NO:56); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9); where Xaa1 is selected from K, Q, H, and R; Xaa2 is selected from Q, H, N, and R; and Xaa3 is selected from G, E, T, S, A, and V. In certain embodiments, the antibody is the huMov19 antibody, which is the antibody described above comprising the heavy chain CDR2 RIHPYDGDTFYNQKFQG (SEQ ID NO:2 ). In other embodiments, the antibody is FR1-21 and comprises (a) a heavy chain CDR1 comprising SSYGMS (SEQ ID NO:30); a heavy chain CDR2 comprising TISSGGSYTY (SEQ ID NO:31); and/or a heavy chain CDR3 comprising DGEGGLYAMDY (SEQ ID NO:32); and (b) a light chain CDR1 comprising KASDHINNWLA (SEQ ID NO:27); a light chain CDR2 comprising GATSLET (SEQ ID NO:28); and a light chain CDR3 comprising QQYWSTPFT (SEQ ID NO:29). In other embodiments, the antibody is FR1-48 and comprises: (a) a heavy chain CDR1 comprising TNYWMQ (SEQ ID NO:60); a heavy chain CDR2 comprising AIYPGNGDSR (SEQ ID NO:61); and/or a heavy chain CDR3 comprising RDGNYAAY (SEQ ID NO:62); and/or (b) a light chain CDR1 comprising RASENIYSNLA (SEQ ID NO: 57); a light chain CDR2 comprising AATNLAD (SEQ ID NO:58); and a light chain CDR3 comprising QHFWASPYT (SEQ ID NO:59). In other embodiments, the antibody is FR1-49 and comprises: (a) a heavy chain CDR1 comprising TNYWMY (SEQ ID NO:66); a heavy chain CDR2 comprising AIYPGNSDTT (SEQ ID NO:67); and/or a heavy chain CDR3 comprising RHDYGAMDY (SEQ ID NO:68); and/or (b) a light chain CDR1 comprising RASENIYTNLA (SEQ ID NO:63); a light chain CDR2 comprising TASNLAD (SEQ ID NO:64); and a light chain CDR3 comprising QHFWVSPYT (SEQ ID NO:65). In other embodiments, the antibody is FR1-57 and comprises: (a) a heavy chain CDR1 comprising SSFGMH (SEQ ID NO:72); a heavy chain CDR2 comprising YISSGSSTIS (SEQ ID NO:73); and/or a heavy chain CDR3 comprising EAYGSSMEY (SEQ ID NO: 74); and/or (b) a light chain CDR1 comprising RASQNINNNLH (SEQ ID NO:69); a light chain CDR2 comprising YVSQSVS (SEQ ID NO:70); and a light chain CDR3 comprising QQSNSWPHYT (SEQ ID NO:71). In yet another embodiment, the antibody is FR1-65 and comprises: (a) a heavy chain CDR1 comprising TSYTMH (SEQ ID NO:78); a heavy chain CDR2 comprising YINPISGYTN (SEQ ID NO:79); and/or a heavy chain CDR3 comprising GGAYGRKPMDY (SEQ ID NO:80); and/or (b) a light chain CDR1 comprising KASQNVGPNVA (SEQ ID NO:75); a light chain CDR2 comprising SASYRYS (SEQ ID NO:76); and a light chain CDR3 comprising QQYNSYPYT (SEQ ID NO:77).
[000169] Suitable drugs or prodrugs are known in the art. In certain embodiments, drugs or prodrugs are cytotoxic agents. The cytotoxic agent used in the cytotoxic conjugate of the present invention can be any compound that results in the death of a cell, or induces cell death, or otherwise decreases cell viability, and includes, for example, maytansinoids and maytansinol analogues. Other cytotoxic agents are, for example, benzodiazepines, taxoids, CC-1065 and CC-1065 analogues, duocarmycins and duocarmycin analogues, enedins such as calicheamicins, dolastatin and dolastatin analogues including auristatins, tomaymycin derivatives, leptomycin derivatives, methotrexate , cisplatin, carboplatin, daunorubicin, doxorubicin, vincristine, vinblastine, melphalan, mitomycin C, chlorambucil and morpholino doxorubicin. In certain embodiments, cytotoxic agents are maytansinoids and maytansinoids analogues.
[000170] Such conjugates can be prepared by the use of a linking group in order to link a drug or prodrug to the antibody or functional equivalent. Suitable linking groups are well known in the art and include, for example, disulfide groups, thioether groups, acid labile groups, photolabile groups, peptidase labile groups and esterase labile groups.
[000171] The drug or prodrug can, for example, be linked to the anti-FOLR1 antibody or a fragment thereof via a disulfide bond. The linker molecule or cross-linking agent comprises a reactive chemical group that can react with the anti-FOLR1 antibody or a fragment thereof. In certain embodiments, the chemical groups reactive for reaction with the cell binding agent are N-succinimidyl esters and N-sulfosuccinimidyl esters. In addition, the linker molecule comprises a reactive chemical group, in certain embodiments a dithiopyridyl group that can react with the drug to form a disulfide bond. In certain embodiments, linker molecules include, for example, N-succinimidyl 3-(2-pyridyldithio) propionate (SPDP) (see, for example, Carlsson et al., Biochem. J., 173: 723-737 (1978) ), N-succinimidyl-4-(2-pyridyldithio)-butanoate (SPDB) (see, for example, US Patent 4,563,304), N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB ) (see US Publication 20090274713), N-succinimidyl 4-(2-pyridyldithio) pentanoate (SPP) (see, for example, CAS Registry Number 341498-08-6), 2-iminothiolane or acetylsuccinic anhydride. For example, the antibody or cell binding agent can be modified with cross-linking reagents and the antibody or cell binding agent containing free or protected thiol groups thus derived is then reacted with a maytansinoid containing thiol or disulfide to produce conjugates. Conjugates can be purified by means of chromatography, including but not limited to HPLC, size exclusion, adsorption, ion exchange and affinity capture, dialysis or tangential flow filtration. In certain embodiments, the anti-FOLR1 antibody is linked to the cytotoxin via an SPDB or sulfo-SPDB linker. In one embodiment, the huMov19 antibody is linked to a cytotoxin through an SPDB or sulfo-SPDB linker.
[000172] In another aspect of the present invention, the anti-FOLR1 antibody is associated with cytotoxic drugs through disulfide bonds and a polyethylene glycol spacer in enhancing the potency, solubility, or efficacy of the immunoconjugate. Such hydrophilic cleavable linkers are described in WO2009/0134976. The additional advantage of this linker design is the high desired monomer ratio and minimal aggregation of the antibody-drug conjugate. Specifically contemplated in this aspect are conjugates of cell binding agents and disulfide group-linked drugs (-SS-) having polyethylene glycol spacers ((CH2CH2O)n=1-14), with a narrow drug loading range of 2-8 are described which show relatively high potent biological activity for cancer cells and possess the desired biochemical properties of high conjugation yield and high monomer ratio with minimal protein aggregation.
[000173] In this aspect, an anti-FOLR1 antibody drug conjugate of formula (I) or a conjugate of formula (I') is specifically contemplated:
wherein: A represents an anti-FOLR1 antibody or fragment; C represents a cytotoxin or drug; X represents an aliphatic, aromatic, or heterocyclic moiety attached to the cell binding agent via a thioether linkage, an amide linkage, a carbamate linkage, or an ether linkage; Y represents an aliphatic, aromatic or heterocyclic moiety attached to the drug via a disulfide bond; 1 is 0 or 1; m is an integer from 2 to 8; en is an integer from 1 to 24.
[000174] In some modes, m is an integer from 2 to 6.
[000175] In some modes, m is an integer from 3 to 5.
[000176] Also, in some embodiments, n is an integer from 2 to 8. Alternatively, as disclosed, for example, in US Patents 6,441,163 and 7,368,565, the drug may first be modified to introduce a suitable reactive ester to react with a cell binding agent. Reaction of these drugs with a binding moiety activated with a cell binding agent provides another method of producing a cell binding agent drug conjugate. Maytansinoids can also be linked to the anti-FOLR1 antibody or fragment using PEG linkage groups, as indicated, for example, in US Patent 6,716,821. These non-cleavable PEG linking groups are soluble in both water and non-aqueous solvents, and can be used to attach one or more cytotoxic agents to a cell binding agent. Exemplary PEG linkers include heterobifunctional PEG linkers that react with cytotoxic agents and cell linkers at opposite ends of the linkers via a sulfhydryl or disulfide functional group at one end, and an active ester at the other end. As a general example of synthesis of a cytotoxic conjugate using a PEG linker, reference is again made to US Patent 6,716,821, which is incorporated fully herein by reference. Synthesis begins with the reaction of one or more cytotoxic agents carrying a reactive PEG moiety with a cell binding agent, resulting in the displacement of the active ester from the terminus of each reactive PEG moiety by an amino acid residue of the binding agent. to cells, to produce a cytotoxic conjugate comprising one or more cytotoxic agents covalently linked to a cell binding agent through a PEG linking group. Alternatively, cell attachment can be modified with the bifunctional PEG crosslinker to introduce a reactive disulfide moiety (such as a pyridyldisulfide), which can then be treated with a thiol-containing maytansinoid to provide a conjugate. In another method, the cell attachment can be modified with the bifunctional PEG crosslinker to introduce a thiol moiety, which can then be treated with a reactive disulfide-containing maytansinoid (such as a pyridyldisulfide) to provide a conjugate.
[000177] Antibody-maytansinoid conjugates with non-cleavable bonds can also be prepared. Such crosslinking agents are described in the art (see, ThermoScientific Pierce Crosslinking Technical Handbook and US Patent Application Publication No. 2005/0169933) and include, but are not limited to, N-succinimidyl 4-(maleimidomethyl) cyclohexanecarboxylate ( SMCC), N-succinimidyl-4-(N-maleimidomethyl)-cyclohexane-1-carboxy-(6-amidocaproate), which is a "long chain" analogue of SMCC (LC-SMCC), N-succinimidyl ester of K-maleimidoundecanoic acid (KMUA), β-maleimidopropanoic acid N-succinimidyl ester (BMPS), Y-maleimidobutyric acid N-succinimidyl ester (GMBS), ε-maleimidocaproic acid N-hydroxysuccinimide ester (EMCS), m- maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), N-(α-maleimidoacetoxy)-succinimide ester (AMAS), succinimidyl-6-(p-maleimidopropionamido)hexanoate (SMPH), N-succinimidyl 4-(p-malcimidophenyl-butyrate ( SMPB), and N-(p-maleimidophenyl)isocyanate (PMPI), N-succinimidyl-4-(iodoacetyl)-aminobenzoate (SIAB), N-succinimidyl iodoacetate (SIA), Ns uccinimidyl bromoacetate (SBA), and N-succinimidyl 3-(bromoacetamido)propionate (SBAP). In certain embodiments, the antibody is modified with crosslinking reagents such as succinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (SMCC), sulfo-SMCC, maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), sulfo-MBS or succinimidyl-iodoacetate, as described in the literature, to introduce 1 to 10 reactive groups ( Yoshitake et al, Eur. J. Biochem., 101:395-399 (1979); Hashida et al, J. Applied Biochem., 56- 63 (1984); and Liu et al, Biochem., 18:690-697 (1979)). The modified antibody is then reacted with the thiol-containing maytansinoid derivative to produce a conjugate. The conjugate can be purified by gel filtration through a Sephadex G-25 column, or by dialysis or tangential flow filtration. The modified antibodies are treated with the thiol-containing maytansinoid (1 to 2 molar equivalent/maleimide group) and antibody-maytansinoid conjugates are purified by gel filtration through a Sephadex G-25 column, chromatography on a ceramic hydroxyapatite column, dialysis or tangential flow filtration or a combination of their methods. Typically, an average of 110 maytansinoids per antibody is bound. One method is to modify antibodies with succinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (SMCC) to introduce maleimide groups, followed by reacting the modified antibody with a thiol-containing maytansinoid to give a thioether-linked conjugate . Again, conjugates with 1 to 10 drug molecules per antibody molecule result. Maytansinoid antibody conjugates, antibody fragments, protein hormones, protein growth factors and other proteins are made in the same way.
[000178] In another aspect of the invention, the antibody FOLR1 (e.g., huMovl 9, FR1 -21, FR1-48, FR1-49, FR1-57 or FR1-65) is associated with the drug via a non-cleavable bond through a PEG spacer. Suitable cross-linking reagents that comprise hydrophilic PEG chains that form linkers between the drug and the anti-FOLR1 fragment or antibody are also well known in the art, or are commercially available (e.g., from Quanta Biodesign, Powell, Ohio) . Suitable PEG-containing crosslinkers can also be synthesized from commercially available PEGs using standard techniques of synthetic chemistry known to those skilled in the art. Drugs can be reacted with crosslinkers containing bifunctional PEG to produce compounds of the following formula, Z - Xl-(-CH2-CH2-O-)n-Yp-D, by methods described in detail in US Patent Publication 20090274713 and Publication WO2009/0134976, which can then react with the cell binding agent to provide a conjugate. Alternatively, cell attachment can be modified with the bifunctional PEG crosslinker to introduce a thiol reactive group (such as a maleimide or haloacetamide), which can then be treated with a thiol-containing maytansinoid to provide a conjugate. In another method, the cell attachment can be modified with the bifunctional PEG crosslinker to introduce a thiol moiety, which can then be treated with a thiol-reactive maytansinoid (such as a maytansinoid carrying a maleimide or haloacetamide) to provide a conjugate.
[000179] Accordingly, another aspect of the present invention is an anti-FOLR1 antibody drug conjugate of formula (II) or formula (IF):
wherein, A represents an anti-FOLR1 antibody or fragment; C represents a cytotoxin or drug; X represents an aliphatic, aromatic or heterocyclic moiety linked to the cell binding agent via a thioether linkage, an amide linkage, a carbamate linkage, or an ether linkage; Y represents an aliphatic, aromatic or heterocyclic moiety linked to a drug via a covalent bond selected from the group consisting of a thioether bond, an amide bond, a carbamate bond, an ether bond, an amine bond, a carbon-carbon bond and a hydrazone bond; 1 is 0 or 1; p is 0 or 1; m is an integer from 2 to 15; en is an integer from 1 to 2000.
[000180] In a given modality, m is an integer from 2 to 8; and n is an integer from 1 to 24
[000181] In a given modality, m is an integer from 2 to 6.
[000182] In a given modality, n is an integer from 2 to 8.
[000183] In a given embodiment, m is an integer from 3 to 5. In a given embodiment, the antibody is huMovl 9. In another embodiment, the antibody is FR-1-21. In another embodiment, the antibody is FR-1 -48. In another embodiment, the antibody is FR-1-49. In another embodiment, the antibody is FR-1-57. In another embodiment, the antibody is FR-1-65. Examples of PEG-containing linkers include linkers with an N-succinimidyl ester or N-sulfosuccinimidyl ester moiety for reaction with the anti-FOLR1 antibody or a fragment thereof, as well as a maleimido- or haloacetyl-based moiety for reaction with the compound. A PEG spacer can be incorporated into any crosslinker known in the art with the methods described herein.
[000184] Many of the binders disclosed herein are described in detail in US Patent Publications 20050169933 and 20090274713, and in WO2009/0134976, the contents of which are fully incorporated herein by reference.
[000185] The present invention includes aspects in which about 2 to about 8 drug molecules ("drug loading"), e.g., maytansinoid, are linked to an anti-FOLR1 antibody or a fragment thereof, the antitumor effect of the conjugate is much more effective compared to a lower number of drug loading or linked to the same cell binding agent. "Drug load", as used herein, refers to the number of drug molecules (e.g., a maytansinoid) that can be linked to a cell binding agent (e.g., an anti-FOLR1 antibody or a fragment of it). In one aspect, the number of drug molecules that can be linked to a cell binding agent can range from about 2 to about 8 (e.g., 1.9, 2.0, 2.1, 2.2 , 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3 .5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7 , 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6 .0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2 , 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1). In certain embodiments, the drug is N2-deacetyl-N2'-(3-mercapto-1-oxopropyl)-maytansine (DM1) or N2'-deacetyl-N2'-(4-mercapto-4-methyl-i-oxopentii) maytansine (DM4). Thus, in a given modality, the huMov19 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-21 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-48 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-49 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-57 antibody is conjugated to DM1 or DM4. In another embodiment, the FR-1-65 antibody is conjugated to DM1 or DM4.
[000186] Thus, in one aspect, an immunocongugado comprises one maytansinoid per antibody. In another aspect, an immunoconjugate comprises 2 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 3 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 4 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 5 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 6 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 7 maytansinoids per antibody. In another aspect, an immunoconjugate comprises 8 maytansinoids per antibody.
[000187] In one aspect, an immunoconjugate comprises about 1 to about 8 maytansinoids per antibody. In another aspect, an immunoconjugate comprises about 2 to about 7 maytansinoids per antibody. In another aspect, an immunoconjugate comprises about 2 to about 6 maytansinoids per antibody. In another aspect, an immunoconjugate comprises about 2 to about 5 maytansinoids per antibody. In another aspect, an immunoconjugate comprises about 3 to about 5 maytansinoids per antibody. In another aspect, an immunoconjugate comprises about 3 to about 4 maytansinoids per antibody.
[000188] In one aspect, a composition comprising immunoconjugates has an average of about 2 to about 8 (for example, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3, 7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6, 2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1) drug molecules (e.g., maytansinoids) bound by antibodies. In one aspect, a composition comprising immunoconjugates has an average of about 1 to about 8 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 2 to about 7 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 2 to about 6 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 2 to about 5 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 3 to about 5 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 3 to about 4 drug molecules (e.g., maytansinoids) per antibody. In one aspect, a composition comprising immunoconjugates averages from about 3.5 to about 4 drug molecules (e.g., maytansinoids) per antibody.
[000189] In one aspect, a composition comprising immunoconjugates has a mean of about 2 ± 0.5, about 2.5 ± 0.5, about 3 ± 0.5, about 3.5 ± 0.5 , about 4 ± 0.5, about 4.5 ± 0.5, about 5 ± 0.5, about 5.5 ± 0.5, about 6 ± 0.5, about 6.5 ± 0.5, about 7 ± 0.5, about 7.5 ± 0.5, or about 8 ± 0.5 drug molecules (e.g., maytansinoids) bound per antibody. In one aspect, a composition comprising immunoconjugates has an average of about 3.5 ± 0.5 drug molecules (e.g., maytansinoids) per antibody.
[000190] The anti-FOLR1 antibody or a fragment thereof can be modified by reacting a bifunctional crosslinking reagent with the anti-FOLR1 antibody or a fragment thereof, thus resulting in the covalent attachment of a binding molecule to the antibody anti-FOLR1 or a fragment thereof. As used herein, a "bifunctional crosslinking reagent" is any chemical moiety that covalently links a cell binding agent to a drug, such as the drugs described herein. In another method, a portion of the binding moiety is provided by the drug. In this regard, the drug comprises a binding moiety that is part of a larger ligand molecule that is used to join the cell binding agent with the drug. For example, to form DM1 maytansinoid, the side chain at the C-3 hydroxyl group of maytansine is modified to have a free sulfhydryl (SH) group. This thiolated form of maytansine can be reacted with a cell binding modifying agent to form a conjugate. Thus, the final linker is assembled from two components, one of which is provided by the crosslinking reagent, while the other is provided by the DM1 side chain.
[000191] Drug molecules can also be linked to antibody molecules through an intermediate carrier molecule such as serum albumin.
[000192] As used herein, the expression "linked to a cell binding agent" or "linked to an anti-FOLR1 fragment or antibody" refers to the conjugate molecule comprising at least one drug derivative linked to a fragment or anti-FOLR1 cell binding agent antibody via a suitable linking group, or a precursor thereof. In certain embodiments, the linking group is SMCC.
[000193] In certain embodiments, cytotoxic agents useful in the present invention are maytansinoids and maytansinoid analogues. Examples of suitable maytansinoids include esters of maytansinol and maytansinol analogues. All drugs that inhibit microtubule formation and that are highly toxic to mammalian cells are included, such as the analogues of maytansinol and maytansinol.
[000194] Examples of suitable maytansinol esters include those having a modified aromatic ring and those having modifications at other positions. Suitable such maytansinoids are described in US Patents 4,424,219; 4,256,746; 4,294,757; 4,307,016; 4,313,946; 4,315,929; 4,331,598; 4,361,650; 4,362,663; 4,364,866; 4,450,254; 4,322,348; 4,371,533; 5,208,020; 5,416,064; 5,475,092; 5,585,499; 5,846,545; 6,333,410; 7,276,497 and 7,473,796.
[000195] In a certain modality, the immunoconjugates of the invention use the thiol-containing maytansinoid (DM1), previously called N2-deacetyl-N2'-(3-mercapto-1-oxopropyl)-maytansine, as the cytotoxic agent. DM1 is represented by the following structural formula (III):

[000196] In another embodiment, the conjugates of the present invention use the thiol-containing maytansinoid N2'-deacetyl-N2'(4-methyl-4-mercapto-1-oxopentyl)-maytansine (eg, DM4) as the cytotoxic agent. DM4 is represented by the following structural formula (IV):

[000197] Another maytansinoid comprising a side chain that contains a sterically hindered thiol bond is N2'-deacetyl-N2'-(4-mercapto-1-oxopentyl)-maytansine (called DM3), represented by the following structural formula (V ):

[000198] Each of the maytansinoids taught in US Patents 5,208,020 and US 7,276,497 can also be used in the conjugate of the present invention. In this regard, the full disclosure of 5,208,020 and 7,276,697 is incorporated herein by reference.
[000199] Many positions on the maytansinoids can serve as the position to chemically link the linking moiety. For example, the C-3 position having a hydroxyl group, the C-14 position modified with hydroxymethyl, the C-15 position modified with hydroxy, and the C-20 position having a hydroxy group are all expected to be useful. In certain modalities, the C-3 position is used. In certain embodiments, the C-3 position of maytansinol is used.
[000200] Structural representations of certain conjugates are shown below:



[000201] In one embodiment, the antibody is huMovl 9. In another embodiment, the antibody is FR1-21.
[000202] Several descriptions for the production of such antibody-maytansinoid conjugates are given in US Patents 6,333,410, 6,441,163, 6,716,821, and 7,368,565, each of which is incorporated herein in its entirety.
[000203] In general, an antibody solution in aqueous buffer can be incubated with a molar excess of maytansinoids having a disulfide moiety bearing a reactive group. The reaction mixture can be stopped by adding excess amine (eg ethanolamine, taurine, etc.) The maytansinoid-antibody conjugate can then be purified by gel filtration. The number of maytansinoid molecules bound per antibody molecule can be determined by spectrophotometrically measuring the ratio of absorbance at 252 nm to 280 nm. An average of 1 to 10 maytansinoid molecules/antibody molecule is used and an average of 2 to 5 is also used in certain modalities. The average number of maytansinoid/antibody molecules can be, for example, about 1 to 10, 2 to 5, 3 to 4, 3.5 to 4 or 3.5. In one aspect, the average number of maytansinoid/antibody molecules is about 3.5 ± 0.5. In one aspect, the average number of maytansinoid/antibody molecules is about 3.5 to 4.
[000204] Antibody conjugates with maytansinoid drugs can be evaluated for their ability to suppress the proliferation of various undesirable cell lines in vitro. For example, cell lines such as the human KB cell line can easily be used to assess the cytotoxicity of these compounds. Cells to be evaluated can be exposed to compounds for 4 to 5 days and the remaining cell fractions measured in direct assays by known methods. IC50 values can then be calculated from the test results.
[000205] Benzodiazepine compounds described, for example, in the U.S. Patent Application Publication. 2010/0203007 (e.g. indolinobenzodiazepines or oxazolidinebenzodiazepines), derivatives thereof, intermediates thereof, can also be used to prepare anti-FOLR1 antibody fragment or conjugates.
[000206] Useful benzodiazepines include compounds of formula (XIV), (XV) and (XVI), in which the dimer compounds optionally carry a linking group that allows attachment to cell binding agents.

[000207] where the double line -- between N and C represents a single bond or a double bond, whereas when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or a amine protecting fraction that converts the compound to a prodrug;
[000208] Y is selected from -OR, an ester represented by -OCOR', a carbonate represented by -OCOOR', a carbamate represented by -OCONR'R", an amine or a hydroxyl amine represented by NR'R" , amide represented by -NRCOR', a peptide represented by NRCOP, where P is an amino acid or a polypeptide containing between 2 to 20 amino acid units, a thioether represented by SR', a sulfoxide represented by SOR', a sulfone represented by -SO2R', a sulfite -SO3, a bisulfite - OSO3, a halogen, cyano, an azido, or a thiol, where R, R' and R" are the same or different and are selected from H, alkyl, linear, branched or cyclic substituted or unsubstituted alkenyl or alkynyl having from 1 to 10 carbon atoms, a polyethylene glycol unit (-OCH2CH2)n, where n is an integer from 1 to 2000, aryl having from 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms wherein the substituent is selected apart ir of halogen, OR7, NR8R9, NO2, NRCOR', SR10, a sulfoxide represented by SOR', a sulfone represented by -SO2R', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO2NRR', cyano, a azido, -CORn, OCORn or OCONRnR12, wherein the definitions of R7, Rg, R9, R10, R11 and R12 are given above, optionally R" is OH; W is CO, C=S, CH2, BH, SO or SO2;
[000209] R1, R2, R3, R4, R1', R2', R3' and R4' are each independently selected from linear, branched or cyclic H, alkyl, alkenyl or substituted or unsubstituted alkynyl having to 1 to 10 carbon atoms, the polyethylene glycol moiety (-OCH2CH2)n, where n is an integer from 1 to 2000, or a substituent selected from a halogen, guanidinium [-NH(C=NH) )NH2], OR-, NR8R9, NO2, NRCOR', SR10, a sulfoxide represented by SOR', a sulfone represented by -SO2R', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO2NRR', cyano, an azido, -COR11, OCOR11 or OCONR11R12 where R7, R8, R9, R10, R11 and R12 are each independently selected from H, alkyl, alkenyl or linear, branched or cyclic alkynyl having 1 to 10 atoms of carbon, polyethylene glycol unit (-OCH2CH2)n, where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms, optionally R10 is SR13 or COR13, wherein R13 is selected from linear, branched or cyclic alkyl, alkenyl or alkynyl having from 1 to 10 carbon atoms, the polyethylene glycol (-OCH2CH2) moiety n, where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 carbon atoms, optionally R11 is OR14, where R14 has the same definition as R, optionally, any one of R 1 , R 2 , R 3 , R 4 , R 1' , R 2' , R 3' , or R/j' is a linking group that allows attachment to a cell binding agent via a covalent bond or is selected from a polypyrrole, poly-indolyl, poly-imidazolyl, polypyrol-imidazolyl, poly-pyrol-indolyl or polyimidazol-indolyl moiety optionally carrying a linking group that allows attachment to a cell-binding agent;
[000210] Z is selected from (CH2)n, where n is 1, 2 or 3, CR15R16, NR17, O or S, where R15, R16 and R17 are each independently selected from H , linear, branched or cyclic alkyl having 1 to 10 carbon atoms, the polyethylene glycol moiety (-OCH2CH2)n, wherein n is an integer from 1 to 2000;
[000211] R6 is OR, SR or NRR', where R and R' have the same definition as given above;
[000212] X' is selected from CH2, NR, CO, BH, SO or SO2 where R has the same definition as given above;
[000213] Y' is O, CH2, NR or S, where R has the same definition as given above;
[000214] Z' is CH2 or (CH2)n, where n is 2, 3 or 4, since X', Y" and /,' are not all CH2 at the same time;
[000215] A and A' are the same or different and are selected from O, -CRR'O, S, -CRR'S, -NR15 or CRR'NHR15, where R and R' have the same definition as given above and where R15 has the same definition as given above for R;
[000216] D and D' are the same or different and independently selected from linear, branched or cyclic alkyl, alkenyl or alkynyl having 1 to 10 carbon atoms, optionally substituted with any one of halogen, OR7, NR8R9, NO2, NRCOR' , SR10, a sulfoxide represented by SOR', a sulfone represented by -SO2R', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO2NRR', cyano, an azide, -COR11, OCOR11 or OCONR11R12, where as definitions of R7, R8, R9, R10, R11 and R12 are given above, the polyethylene glycol unit (-OCH2CH2)n, wherein n is an integer from 1 to 2000; L is an optional phenyl group or a heterocycle ring having 3 to 10 carbon atoms which is optionally substituted, wherein the substituent is a linking group which allows attachment to a cell binding agent via a covalent bond, or is selected from linear, branched or cyclic alkyl, alkenyl or alkynyl having 1 to 10 carbon atoms, optionally substituted with any one of halogen, OR7, NR8R9, NO2, NRCOR". SR10, a sulfoxide represented by SOR". A sulfone represented by -SO2R', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO2NRR', cyano, an azido, -CORn, OCOR11 or OCONR11R12, where the definitions of R7, R8, R9, R10, R11 and R12 are given above, the polyethylene glycol unit (-OCH2CH2)n, wherein n is an integer from 1 to 2000; optionally, L itself is a linking group that allows attachment to a cell binding agent via a covalent bond; or their pharmaceutically acceptable solvates, salts, hydrates or hydrated salts, their optical isomers, racemates, diastereomers, enantiomers or the polymorphic crystalline structures of these compounds; since the compound has no more than one linking group which allows binding to a cell binding agent via covalent bonding.
[000217] In one aspect, the double line " between N and C represents a single bond or a double bond, whereas when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or an amine protecting group that converts the compound to a prodrug;
[000218] Y is selected from -OR, NR'R", a sulfite -SO3, or a bisulfite -OSO3, wherein R is selected from H, linear, branched or cyclic alkyl, alkenyl or alkynyl having to 1 to 10 carbon atoms, polyethylene glycol moiety (-OCH2CH2)n, where n is an integer from 1 to 2000, aryl having 6 to 10 carbon atoms, heterocyclic ring having 3 to 10 atoms of carbon;
[000219] W is C=O, CH2 or SO2;
[000220] R1, R2, R3, R4, R1', R2', R3' and R4' are each independently selected from H, NO2 or a linking group that allows binding to a binding agent. cell via covalent bonding;
[000221] R6 is OR18, where R18 has the same definition as R;
[000222] Z is selected from (CH2)n, where n is 1, 2 or 3, CR15R16, NR17, O or S, where R15, R16 and R17 are each independently selected from H , linear, branched or cyclic alkyl having 1 to 10 carbon atoms, the polyethylene glycol moiety (-OCH2CH2)n, wherein n is an integer from 1 to 2000;
[000223] X' is selected from CH2, or C=O;
[000224] Y' is O, NR, or S, where R is defined as above;
[000225] Z' is CH2 or (CH2)2;
[000226] A and A' are each O;
[000227] D and D' are the same or different and independently selected from linear, branched or cyclic alkyl, alkenyl or alkynyl having from 1 to 10 carbon atoms;
[000228] L is an optional phenyl group or a heterocycle ring having from 3 to 10 carbon atoms which is optionally substituted, wherein the substituent is a linking group that allows attachment to a cell binding agent through covalent bonding , or is selected from linear, branched or cyclic alkyl, alkenyl or alkynyl having 1 to 10 carbon atoms, optionally substituted with any one of halogen, OR7, NR8R9, NO2, NRCOR', SR10, a sulfoxide represented by SOR ', a sulfone represented by -SO2R', a sulfite -SO3, a bisulfite -OSO3, a sulfonamide represented by SO2NRR', cyano, an azide, -COR11, OCOR11 or OCONR11R12, the polyethylene glycol unit (-OCH2CH2)n, where n is an integer from 1 to 2000; optionally, L itself is a linking group that allows attachment to a cell binding agent through covalent bonding; or their pharmaceutically acceptable solvates, salts, hydrates or hydrated salts, their optical isomers, racemates, diastereomers, enantiomers or the polymorphic crystalline structures of these compounds.
[000229] In another aspect the compound is represented by the formula (XVII):

[000230] wherein the double line between N and C represents a single bond or a double bond, whereas when it is a double bond X is absent and Y is H, and when it is a single bond, X is H or a group of amine protection that converts the compound into a prodrug, and Y is selected from OH, an ether represented by -OR, a sulfite -SO3, or a bisulfite -OSO3, where R is selected from alkyl, alkenyl or linear, branched or cyclic alkynyl carrying 1 to 10 carbon atoms one of R2, R3 is a linking group that allows attachment to a cell binding agent through covalent bonding and the other is H, one of L', L" or L'" is a linking group that allows binding to a cell binding agent, while the others are H; L' can be the linking group and G is CH or N. Other examples are described in the US Patent Application. No. 61/150,201, the entire content of which is incorporated herein by reference. Thus, in a given embodiment, the huMov19 antibody is conjugated to a benzodiazepene having a structure shown in XIX-XXII above. In another embodiment, the FR-1-21 antibody is conjugated to a benzodiazepene having a structure shown in XIX-XXII above. IV. Polynucleotides
[000231] In certain embodiments, the invention encompasses polynucleotides comprising polynucleotides that encode a polypeptide that specifically binds to the human FOLR1 receptor or a fragment of such a polypeptide. For example, the invention provides a polynucleotide comprising a nucleic acid sequence that encodes an antibody to a human FOLR1 or encodes a fragment of such an antibody. Polynucleotides of the invention can be in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA; and it can be double-stranded or single-stranded and, if single-stranded, it can be the encoding tape or non-coding (antisense) tape.
[000232] In certain embodiments, polynucleotides are isolated. In certain embodiments, polynucleotides are substantially pure.
[000233] The present invention provides a polynucleotide comprising a polynucleotide encoding a polypeptide comprising a sequence selected from the group consisting of SEQ ID NOs:4, 10, 11, 41, 42 and 88 to 103. A polynucleotide encoding is also provided. a polypeptide having at least about 95%, at least about 96%, at least about 97%, at least about 98%>, or at least about 99% sequence identity to SEQ ID NOs:4, 10, 11, 41, 42, and 88 to 103.
[000234] The polynucleotides SEQ ID NOs: 5, 14, and 15 comprise the coding sequence for huMov19 variable domain heavy chain, variable domain light chain version 1.00, and variable domain light chain version 1.60, respectively.
[000235] The invention further provides a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NOs:5, 14, 15, 37, 38, 43, 44, 47, 48, and 120-127. Also provided is a polynucleotide having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to SEQ ID NOs: 5, 14, 15, 37, 38, 43, 44, 47, 48, and 120-127. Thus, in certain embodiments, the polynucleotide comprises (a) a polynucleotide having at least about 95% sequence identity to SEQ ID NO:5, and/or (b) a polynucleotide having at least about 95% sequence identity. sequence a SEQ ID NO: 14 or 15. In certain embodiments, the polynucleotide comprises (a) a polynucleotide having the amino acid sequence of SEQ ID NO: 5; and/or (b) a polynucleotide having the amino acid sequence of SEQ ID NO: 14 or SEQ ID NO: 15.
[000236] In certain embodiments the polynucleotide comprises the coding sequence for the mature polypeptide fused in the same reading frame to a polynucleotide that assists, for example, in the expression and secretion of a polypeptide from a host cell (for example to a leader sequence that functions as a secretory sequence to control the transport of a polypeptide from the cell). The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. Polynucleotides can also encode a proprotein which is the mature protein and additional 5' amino acid residues. A mature protein with a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
[000237] In certain embodiments, polynucleotides comprise a coding sequence for the mature polypeptide fused in the same reading frame to a marker sequence, which allows, for example, the purification of the encoded polypeptide. For example, the tag sequence can be a hexa-histidine tag provided by a pQE-9 vector to allow purification of the mature polypeptide fused to the tag in the case of a bacterial host, or the tag sequence can be a hemagglutinin tag ( HA ) derived from the influenza hemagglutinin protein when a mammalian host (eg COS-7 cells) is used.
[000238] The present invention further relates to variants of the polynucleotides described hereinbefore that encode, for example, fragments, analogs, and derivatives.
[000239] Polynucleotide variants may contain alterations in the coding regions, non-coding regions, or both. In some embodiments the polynucleotide variants contain alterations that produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. In some embodiments, nucleotide variants are produced by silent substitutions due to the degeneracy of the genetic code. Polynucleotide variants can be produced for a variety of reasons, for example, to optimize codon expression for a particular host (shifting codons in human mRNA to those preferred by a bacterial host such as E. coli).
[000240] Vectors and cells comprising the polynucleotides described herein are also provided. V. Methods of Use and Pharmaceutical Compositions
[000241] The FOLR1 binding agents (including antibodies, immunoconjugates and polypeptides) of the present invention are useful in a variety of applications, including, but not limited to, therapeutic treatment methods, such as the treatment of cancer, such as malignancies. of B-cells. In certain embodiments, the agents are useful for inhibiting tumor growth, inducing differentiation, reducing tumor volume, and/or reducing the tumorigenicity of a tumor. Modes of use can be methods, in vitro, ex vivo, or in vivo. In certain embodiments, the FOLR1 binding agent or antibody or immunoconjugate or polypeptide is an antagonist of human FOLR1 to which it binds.
[000242] In one aspect, anti-FOLR1 antibodies and immunoconjugates of the invention are useful to detect the presence of FOLR1 in a biological sample. The term "detection" as used herein encompasses either quantitative or qualitative detection. In certain embodiments, a biological sample comprises a cell or tissue. In certain embodiments, such tissues include cancerous and/or normal tissues that express FOLR1 at higher levels relative to other tissues. In certain modalities, overexpression of FOLR1 detects the presence of ovarian cancer, lung cancer, brain cancer, breast cancer, uterine cancer, kidney cancer, or pancreatic cancer.
[000243] In one aspect, the invention provides a method to detect the presence of FOLR1 in a biological sample. In certain embodiments, the method comprises contacting the biological sample with an anti-FOLR1 antibody under conditions permissive for the binding of the anti-FOLR1 antibody to FOLR1, and detecting whether a complex is formed between the anti-FOLR1 antibody and FOLR1.
[000244] In one aspect, the invention provides a method for diagnosing a disorder associated with increased expression of FOLR1. In certain embodiments, the method comprises contacting a test cell with an anti-FOLR1 antibody, determining the level of expression (quantitatively or qualitatively) of FOLR1 by the test cells by detecting the binding of the anti-FOLR1 antibody to FOLR1. and comparing the expression level of FOLR1 per test cell to the expression level of FOLR1 by a control cell (eg, a normal cell of the same tissue origin as the test cell, or a cell that expresses FOLR1 at levels comparable to such a normal cell), wherein a higher level of expression of FOLR1 by the test cell as compared to the control cell indicates the presence of a disorder associated with increased expression of FOLR1. In certain embodiments, the test cell is obtained from a subject suspected of having a disorder associated with increased expression of FOLR1. In certain embodiments, the disorder is a cell proliferation disorder, such as a cancer or tumor.
[000245] In certain embodiments, a method of diagnosis or detection, such as those described above, comprises the detection of binding of an anti-FOLR1 antibody to FOLR1 expressed on the surface of a cell or in a membrane preparation obtained from a cell that expresses FOLR1 on its surface. In certain embodiments, the method comprises contacting a cell with an anti-FOLR1 antibody under conditions permissive for the binding of the anti-FOLR1 antibody to FOLR1, and detecting whether a complex is formed between the anti-FOLR1 antibody and FOLR1 on the cell surface. An exemplary assay for detecting the binding of an anti-FOLR1 antibody to FOLR1 expressed on the surface of a cell is a "FACS" assay.
[000246] Some other methods can be used to detect the binding of anti-FOLR1 antibodies to FOLR1. Such methods include, but are not limited to, antigen binding assays, which are well known in the art, such as western blots, radioimmunoassays, ELISA (enzyme binding immunosorbent assay), sandwich type immunoassays, immunoprecipitation assays , fluorescent immunoassays, protein A immunoassays, and immunohistochemistry (IHC).
[000247] In certain embodiments, anti-FOLR1 antibodies are labeled. Labels include, but are not limited to, labels or fractions that are directly detected (eg, fluorescent, chromophores, electron-dense, chemiluminescent, and radioactive labels), as well as fractions, such as enzymes or ligands, that are indirectly detected , for example, through an enzymatic reaction or molecular interaction.
[000248] In certain embodiments, anti-FOLR1 antibodies are immobilized on an insoluble matrix. Immobilization involves separating the anti-FOLR1 antibody from any FOLR1 that remains free in solution. This is done conventionally either by insolubilization of the anti-FOLR1 antibody prior to the assay procedure, such as by adsorption to a water-insoluble matrix or surface (Bennich et al., US Patent 3,720,760), or by covalent coupling (for example , using glutaraldehyde crosslinking), or by insolubilization of the anti-FOLR1 antibody after formation of a complex between the anti-FOLR1 antibody and FOLR1, for example, by immunoprecipitation.
[000249] Any of the above diagnostic or detection modalities may be performed using an immunoconjugate of the invention in place of or in addition to an anti-FOLR1 antibody.
[000250] In certain embodiments, the disease treated with the FOLR1 binding agent or antagonist (eg, a huMov19 antibody or immunoconjugate) is cancer. In certain embodiments, cancer is characterized by tumors that express the folate 1 receptor to which the FOLR1 binding agent (eg, antibody) binds.
[000251] The present invention provides methods of treating cancer, comprising administering a therapeutically effective amount of a FOLR1 binding agent to a subject (e.g., a subject in need of treatment). In certain modalities, cancer is a cancer selected from the group consisting of colorectal cancer, pancreatic cancer, lung cancer, ovarian cancer, liver cancer, breast cancer, brain cancer, kidney cancer, prostate cancer, cancer gastrointestinal, melanoma, cervical cancer, bladder cancer, glioblastoma, neck and head cancer. In certain modalities the cancer is ovarian cancer. In certain modalities the cancer is lung cancer. In certain modalities, the subject is a human.
[000252] The present invention further provides methods for inhibiting tumor growth using the antibodies or other agents described herein. In certain embodiments, the method of inhibiting tumor growth comprises contacting the cell with a FOLR1 binding agent (e.g., antibody) in vitro. For example, an immortalized cell line or a cancer cell line that expresses FOLR1 is cultured in the medium to which antibody or other agent to inhibit tumor growth is added. In some embodiments, tumor cells are isolated from a patient sample, such as, for example, a tissue biopsy, pleural effusion, or blood sample, and cultured in a medium to which a binding agent is added. FOLR1 to inhibit tumor growth.
[000253] In some embodiments, the method of inhibiting tumor growth is to contact the tumor or tumor cells with the FOLR1 binding agent (e.g., antibody) in vivo. In certain embodiments, contacting a tumor cell or tumor with a FOLR1 binding agent is performed in an animal model. For example, FOLR1 binding agents can be administered to xenografts that express one or more FOLR1s that have been grown in immunocompromised mice (e.g., NOD/SCID) to inhibit tumor growth. In some modalities, cancer stem cells are isolated from a patient sample, such as, for example, a tissue biopsy, pleural effusion, or blood sample and injected into immunocompromised mice that are then administered with a FOLR1 binding agent to inhibit tumor cell growth. In some embodiments, the FOLR1 binding agent is administered at the same time or shortly after the introduction of tumor cells into the animal to prevent tumor growth. In some embodiments, the FOLR1 binding agent is administered as a therapeutic agent after the tumor cells have grown to a specified size.
In certain embodiments, the method of inhibiting tumor growth comprises administering to a subject a therapeutically effective amount of a FOLR1 binding agent. In certain modalities, the subject is a human. In certain embodiments, the subject has a tumor or has had a tumor removed.
In certain embodiments, the tumor expresses the folate receptor to which the FOLR1 binding agent or antibody binds. In certain modalities, the tumor overexpresses human FOLR1.
[000256] In certain embodiments, the tumor is a tumor selected from the group consisting of brain tumor, colorectal tumor, pancreas tumor, lung tumor, ovarian tumor, liver tumor, breast tumor, kidney tumor, prostate tumor, gastrointestinal tumor, melanoma, cervical tumor, bladder tumor, glioblastoma, head and neck tumor. In certain embodiments, the tumor is an ovarian tumor.
[000257] Furthermore, the invention provides a method of reducing the tumorigenicity of a tumor in a subject, comprising administering a therapeutically effective amount of a FOLR1 binding agent to the subject. In certain modalities, the tumor comprises cancer stem cells. In certain modalities, the frequency of cancer stem cells in the tumor is reduced by administration of the agent.
[000258] Thus, in certain embodiments the invention provides methods for treating cancer using the huMov19 antibody and immunoconjugates. In certain embodiments, the huMov19 immunoconjugate is huMov19-SPDB-DM4; huMov19-sul ib-SPP-DM 1 ; huMov19-SPP-DM1; or huMov 19-PEG4-Mal-DM4.
[000259] The invention further provides methods of differentiating tumorigenic cells into non-tumorigenic cells comprising contacting the tumorigenic cells with a FOLR1 binding agent (for example, by administering the FOLR1 binding agent to a subject who has a tumor including tumorigenic cells or who have had such a tumor removed). In certain embodiments, tumorigenic cells are ovarian tumor cells.
[000260] The present invention further provides methods for reducing myofibroblast activation in the stroma of a solid tumor, comprising contacting the stroma with an effective amount of the binding agent to FOLR1, polypeptide or antibody.
[000261] The present invention further provides pharmaceutical compositions comprising one or more of the FOLR1 binding agents described herein. In certain embodiments, the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier. These pharmaceutical compositions find use in inhibiting tumor growth and treating cancer in human patients.
[000262] In certain embodiments, formulations are prepared for storage and use by combining an antibody or purified agent of the present invention with a pharmaceutically acceptable carrier (e.g., carrier, excipient) (Remington, The Science and Practice of Pharmacy 20a Edition, Editora Mack, 2000). Suitable pharmaceutically acceptable carriers include, but are not limited to, non-toxic buffers such as phosphate, citrate and other organic acids; salts such as sodium chloride; antioxidants including ascorbic acid and methionine; preservatives (eg, octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride, benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohols; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol, 3-pentanol, and m-cresol); low molecular weight polypeptides (eg, less than about 10 amino acid residues); proteins such as serum albumin, gelatin or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; carbohydrates, such as monosaccharides, disaccharides, glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (eg Zn-protein complexes), and nonionic surfactants such as TWEEN or polyethylene glycol (PEG).
[000263] The pharmaceutical compositions of the present invention can be administered in any number of forms for local or systemic treatment. Administration can be topical (for example, to mucous membranes, including vaginal and rectal delivery) such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders; pulmonary (e.g., by inhalation or by insufflation of powder or aerosols, including by nebulizer; intratracheal, intranasal, transdermal and epidermal), orally, or parenterally, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion , or intracranial administration (for example, intrathecal or intraventricular).
[000264] An antibody or immunoconjugate of the invention can be combined in a pharmaceutical combination formulation, or dosing regimen as combination therapy with a second compound having the anticancer properties. The second compound of the pharmaceutical combination formulation or dosing regimen may have complementary activities to the combination's ADC in such a way that they do not adversely affect each other. Pharmaceutical compositions comprising the FOLR1 binding agent and the second anti-cancer agent are also provided.
[000265] For the treatment of disease, the appropriate dosage of an antibody or agent of the present invention depends on the type of disease to be treated, the severity and course of the disease, the responsiveness of the disease, whether the antibody or agent is administered for therapeutic or preventive purposes, prior therapy, the patient's medical history, and so on, all at the discretion of the treating physician. The antibody or agent may be administered once or during a series of treatments lasting from a few days to several months, or until a cure is effected, or a decrease in the disease state is achieved (eg, reduction in tumor size ). Optimal dosage schedules can be calculated from measurements of drug accumulation in the patient's body and will vary with the relative potency of an individual antibody or agent. The administering physician can easily determine optimal dosages, dosing methodologies and repetition rates. In certain embodiments, the dosage is from 0.01 µg to 100 mg per kg of body weight, and may be given once or more daily, weekly, monthly, or annually. In certain embodiments, the antibody or other FOLR1 binding agent is administered once every two weeks or once every three weeks. In certain embodiments, the dosage of antibody or other FOLR1 binding agent is from about 0.1 mg to about 20 mg per kg of body weight. The attending physician can estimate repeat dosing rates based on measured residence times and drug concentrations in bodily fluids or tissues.
[000266] Combination therapy can provide "synergy" and prove to be "synergistic", ie the effect achieved when the active ingredients are used together is greater than the sum of the effects that results from using the compounds separately. A synergistic effect can be achieved when the active ingredients are: (1) co-formulated and administered or distributed simultaneously in a combined unit dosage formulation, (2) distributed alternately or in parallel as separate formulations, or (3) by some other regimen . When delivered in alternating therapy, a synergistic effect can be achieved when the compounds are administered or delivered sequentially, for example, by different injections in separate syringes. In general, during alternating therapy, an effective dosage of each active ingredient is administered sequentially, i.e., serially, whereas in combination therapy, effective dosages of two or more active ingredients are administered together. SAW. Kits comprising FOLR1 binding agents
[000267] The present invention provides kits comprising the antibodies, immunoconjugates or other agents described herein and which can be used to carry out the methods described herein. In certain embodiments, a kit comprises at least one antibody to purified folate 1 receptor in one or more containers. In some embodiments, kits contain all the necessary and/or sufficient components to perform a detection assay, including all controls, instructions for performing the assays, as well as any software necessary for analyzing and reporting results. One of skill in the art will readily recognize that the described antibodies, immunoconjugates or other agents of the present invention can be readily incorporated into one of the established kit formats that are well known in the art.
[000268] In addition, kits are provided which comprise a FOLR1 binding agent (eg a FOLR1 binding antibody) as well as a second anti-cancer agent. In certain embodiments, the second anticancer agent is a chemotherapeutic agent (eg, gemcitabine or irinotecan).
The embodiments of the present disclosure may be further defined by reference to the following non-limiting examples, which describe in detail the preparation of certain antibodies of the present disclosure and methods for using the antibodies of the present disclosure. It will be evident to those skilled in the art that many modifications, both in materials and methods, can be practiced without departing from the scope of the present disclosure. EXAMPLES
[000270] It is understood that the examples and modalities described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to those skilled in the art and should be included within the spirit and scope of this document. Example 1 Chimerization of Mov19 murine monoclonal antibody
[000271] The variable region amino acid sequences for Mov19 were obtained from the NCBI database (accessions CAA68253 for light chain (SEQ ID NO:24) and CAA68252 for heavy chain (SEQ ID NO:23)) and then the codon optimized and synthesized by Blue Heron Biotechnology. The light chain variable region was cloned into the EcoRI and BsiWI sites of plasmid pAbKZeo and the heavy chain variable region was cloned into the HindIII and Apal sites of plasmid pAbGlNeo. Example 2 Humanization of Mov19 and FR1-21 murine monoclonal antibodies
[000272] The Mov19 antibody was humanized following the structure surface recomposition methods described previously (Roguska M. et al, Proc. Natl. Acad. Sci. USA 1994 Feb; 91 :969-973) and (Roguska et al. ., Protein Eng. 9(10):895-904 (1996)). In summary, the average solvent accessibility for each variable region framework residue was calculated using very closely related dissolved antibody frameworks from the PDB database, and positions with greater than 30% average accessibility were tagged as surface residues (Pedersen JT et. al, J. Mol. Biol. 1994; 235: 959-973). The human surface replacement sequence was selected by aligning the surface positions of the murine antibody sequences with the corresponding positions of the human antibody germline sequences in the Kabat database (Johnson, G. and Wu, TT (2001) Nucleic Acids Research, 29: 205-206). The most homologous human light chain variable region surface (clone DPK19, IMGT site IGKV2D-30*01 for Mov19 and IMGT site IGKV1/OR2-0*01 for FR1-21) and the surface human heavy chain variable region plus homolog (clone 8M27, IMGT local IGHV1 -69*08 for Mov19 and IMGT local IGHV5-51 *02 for FR1-21) was selected to replace the surface positions of the murine Mov19 structure, leaving the 6 CDRs (Table 1) unchanged . The surface positions of murine and human Mov19 and FR1-21 and residues are given in Figures 1A-D.

[000273] None of the residue changes raised questions to impact the interactions of either the Mov19 or FR1-21 CDRs with their target epitopes on the folate 1 receptor, thus no dorsal surface mutations were considered for the humanized sequences of both antibodies. The coated Mov19 sequence, however, introduced a consensus N-linked glycosylation site into the light chain N74 (light chain version 1.00), so a second version of the humanized light chain was made to remove this site. A review of Kabat's human light chain sequence database revealed that threonine is the most common residue found at light chain position 74 so the humanized Mov19 light chain version 1.60 was constructed with a threonine at position 74. Position 74 is not a surface residue so this residue substitution had no impact on humanization by surface recomposition. Variable region sequence alignments from murine and humanized Mov19, and FR1-21 are given in Figure 2.
[000274] The variable region sequences for humanized Mov19 and FR 1-21 were codon optimized and synthesized by Blue Heron Biotechnology. The sequences are flanked by restriction enzyme sites to facilitate cloning in-frame with their respective constant sequences into single-stranded mammalian expression plasmids. The light chain variable region was cloned into the EcoRI and BsiWI sites of plasmid pAbKZeo. The resulting plasmid DNAs encoding the light chain huMov19 were deposited with the ATCC as ATCC Deposit Nos. PTA-10773 and PTA-10774 and the resulting plasmid DNA encoding light chain huFR1-21 was deposited as ATCC Deposit No. PTA-10776. The heavy chain variable region was cloned into the HindIII and Apa1 sites of plasmid pAbGlNeo. The resulting plasmid DNA encoding heavy chain huMov19 was deposited with the ATCC as ATCC Deposit No. PTA-10772 and the resulting plasmid DNA encoding heavy chain huFR1-21 was deposited as ATCC Deposit No. PTA-10772. These plasmids , were then transfected as described in Example 3 to produce huMov19. The plasmid encoding both light chain huMov19 (ie, which deposited as ATCC Deposit No. PTA-10773 or PTA-10774) can be paired with the plasmid encoding heavy chain huMov19 to create a huMov19 antibody according to the methods provided here and as are well known to a person skilled in the art. Example 3 Expression of Recombinant Antibody
[000275] Chimeric and humanized antibody constructs were transiently produced in either adherent HEK-293T cells using a standard calcium phosphate procedure (BD Biosciences, CalPhos Mammalian Transfection Kit, Cat # 631312) or in HEK-293T cells adapted by suspension using a modified PEI procedure [Durocher Y, Perret S, Kamen A High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res. 2002 Jan 15;30(2):E9] in roller bottles. Transient PEI transfections were performed as described previously (Durocher, Y. et al., Nucleic Acids Res. 30(2):E9 (2002)), except for HEK-293T cells which were grown in Freestyle 293 (Invitrogen) and the culture volume was left undiluted after addition of the PEI-DNA complexes. Both transient adherent and suspension transfections were incubated for one week and then the clean supernatant was purified by a Protein A column followed by a CM column ion exchange chromatography as described below. As shown in Figure 3, expression of huMov19 was at least 10-fold greater than expression of chimeric Mov19 in transfected cells. Example 4 Purification of antibody
[000276] Antibodies were purified from clean cell culture supernatants using standard methods such as, for example, Protein A or G chromatography (HiTrap Protein A or G HP, 1 mL, Amersham Biosciences). Briefly, the supernatant was prepared by chromatography by the addition of 1/10 volume of 1 M Tris/HCl buffer, pH 8.0. The pH-adjusted supernatant was filtered through a 0.22 µm filter membrane and loaded onto a column equilibrated with binding buffer (PBS, pH 7.3). The column was washed with binding buffer until a stable baseline was obtained with no absorbance at 280 nm. The antibody was eluted with 0.1 M acetic acid buffer containing 0.15 M NaCl, pH 2.8, using a flow rate of 0.5 ml/min. Fractions of approximately 0.25 mL were collected and neutralized by adding 1/10 volume of 1M Tris/HCl, pH 8.0. The peak fraction(s) was dialyzed overnight twice against 1 x PBS and sterilized by filtration through a 0.2 µm filter membrane. Purified antibody was quantified by absorbance at A280/
[000277] The purified Protein A fractions were further purified using ion exchange chromatography (IEX) with carboxymethyl chromatography (CM). Briefly, samples from the protein A purification were buffer exchanged into the starting buffer (10 mM potassium phosphate, 10 mM sodium chloride, pH 7.5) and filtered through a 0.22 µm filter. The prepared sample was then loaded onto a CM fast flow resin (GE Lifesciences) which was equilibrated with the starting buffer at a flow rate of 120 cm/hr. The column size was chosen to have sufficient capacity to bind all antibodies in the sample. The column was then washed with binding buffer until a stable baseline was obtained with no absorbance at 280 nm. Antibody was eluted by priming a gradient from 10 mM to 500 mM sodium chloride in column volume 20 (CV). Fractions with a UV reading above 50 raAu of the major peak were collected. Purity (the percentage of soluble high molecular weight monomers and aggregates) was assessed with size exclusion chromatography (SEC) on a TSK gel G3000SWXL, 7.8 300 mm with a guard column SWXL, 6.0 x 40 mm (Tosoh Bioscience, Montgomeryville, PA) using an Agilent HPLC 1100 system (Agilent, Santa Clara, CA). Fractions with the desired purity (>95%) were pooled, the buffer exchanged to PBS (pH 7.4) using the TFF system, and sterilized by filtration through a 0.2 µm filter membrane. The purified antibody was further tested for purity by SEC and the IgG concentration was determined by measuring the absorbance at 280 nm using an extinction coefficient of 1.47. Dilution was done if necessary. Alternatively, ceramic hydroxyapatite (CHT) can be used to polish both murine and humanized antibodies with enhanced selectivity. Type II CHT resin with a particle size of 40 µm (Bio-Rad Laboratories) was applied for the polishing of antibodies with similar protocol as IEX chromatography. The starting buffer for CHT was 20 mM sodium phosphate, pH 7.0 and antibody was eluted with a gradient of 20-160 mM sodium phosphate over 20 CV. Example 5 Development of murine anti-FOLR1 antibodies
[000278] There were two different immunization/screening series. The first set led to the generation of the FR1-21 clone, the second set resulted in the generation of FR1-48, FR1-49, FR1-57 and FR1-65 clones. In the first series mice were subcutaneously immunized with approximately 5 x 106 KB cells expressing FOLR1 (American Tissue Culture Collection, ATCC CCL-17). In the second series 300-19 cells expressing human FOLR1 on their surface were used to immunize mice. To make these cells, the human FOLR1 amino acid sequence was obtained from the NCBI website (accession NP_057937), then codon-optimized and synthesized by Blue Heron Biotechnologies, flanked by EcoR1 and Xba1 restriction sites to facilitate cloning into mammalian expression vector pSRa. 300-19 cells, a pre-B cell line from a Balb/c mouse (Reth et al., Nature, 317:353-355 (1985)), were transfected with the pSRa-FOLR1 expression plasmid for de stably express high levels of human FOLR1 on a cell surface. Standard immunization protocols known to those skilled in the art, for example, as used in ImmunoGen, Inc were applied to both series. Immunized mice were challenged with antigen three days before being sacrificed for hybridoma generation. Mice spleens were collected according to standard animal protocols, such as grinding tissue between two sterile microscope slides to obtain a single cell suspension in RPMI-1640 medium. Spleen cells were centrifuged, pelleted, washed, and fused with a murine myeloma such as P3X63Ag8.653 cells (Kearney et al., J. Immunol., 123: 1548-1550 (1979)) using polyethylene glycol - 1500 (Roche 783 641). Functional cells were resuspended in RPMI-1640 selection medium containing hypoxanthine-aminopterin-thymidine (HAT) (Sigma H-0262) and selected for growth in 96-well flat-bottomed culture plates (Corning-Costar 3596, 0.2 ml of cell suspension per well) at 37°C with 5% CO2. After 5 days of incubation, 0.1 ml of the culture supernatant was removed from each well and replaced with 0.1 ml of RPMI-1640 medium containing hypoxanthine-thymidine (HT) supplement (Sigma H-0137). Incubation at 37°C with 5% CO 2 was continued until the hybridoma clones were ready for antibody screening. Other hybridoma production immunization techniques can also be used, including those described in Langone et al. (Eds., "Immunochemical Techniques, Part I", Methods in Enzymology, Academic Press, volume 121, Florida) and Harlow et al. ("Antibodies: A Laboratory Manual"; Cold Spring Harbor Laboratory Press, New York (1988)).
Example 6 Hybridoma Screening and Selection
[000279] FOLR1 -300-19 cells transfected with human FOLR1 and KB cells were used in the first and second series of screens correspondingly. Culture supernatants from the hybridoma were screened by flow cytometry for secretion of mouse monoclonal antibodies that bind to FOLR1 positive cells, such as 300-19 cells expressing FOLR1 or KB cells, but not to FOLR1 negative cells, such as 300-19 untransfected cells. 0.1 ml of the hybridoma supernatants was incubated for 3 h with either FOLR1 positive cells or the untransfected 300-19 cells (1 x 105 cells per sample) in 0.1 ml of FACS buffer (RPMI-1640 medium supplemented with 2% normal goat serum). Then, cells were centrifuged, pelleted, washed, and incubated for 1 hour with 0.1 ml of PE-conjugated goat anti-mouse IgG antibody (as obtainable from eg Jackson Laboratory, 6 μg/ml in the FACS buffer). Cells were centrifuged, pelleted again, washed with FACS buffer and resuspended in 0.2 ml PBS containing 1% formaldehyde. Cell-associated fluorescence was measured using a FACSCalibur flow cytometer with the HTS multiwell sampler or a FACS array flow cytometer and analyzed using CellQuest Pro (all from BD Biosciences, San Diego, US). Positive hybridoma clones were subcloned by limiting the dilution. A subclone from each hybridoma, which showed the same reactivity against FOLR1 as the parental cells by flow cytometry, was chosen for subsequent analysis. Stable subclones were cultured and the isotope of each secreted anti-FOLR1 antibody was identified using commercial isotyping reagents (Roche 1493027). Murine antibodies were purified by protein A from the clean hybridoma medium as described above. These antibodies were called FR-1 antibodies. Example 7 Purification of murine monoclonal antibody
[000280] Antibodies were purified from the hybridoma subclone supernatants using standard methods such as, for example, Protein A or G chromatography (HiTrap Protein A or G HP, 1 ml, Amersham Biosciences). Briefly, the supernatant was prepared by chromatography by the addition of 1/10 volume of 1 M Tris/HCl buffer, pH 8.0. The pH-adjusted supernatant was filtered through a 0.22 µm filter membrane and loaded onto a column equilibrated with binding buffer (PBS, pH 7.3). The column was washed with binding buffer until a stable baseline was obtained with no absorbance at 280 nm. The antibody was eluted with 0.1 M acetic acid buffer containing 0.15 M NaCl, pH 2.8, using a flow rate of 0.5 ml/min. Fractions of approximately 0.25 mL were collected and neutralized by adding 1/10 volume of 1M Tris/HCl, pH 8.0. The peak fraction(s) was dialyzed overnight twice against 1 x PBS and sterilized by filtration through a 0.2 µm filter membrane. Purified antibody was quantified by absorbance at A280. Example 8 Flow cytometry binding characterization
[000281] The binding specificity was tested by flow cytometry using purified antibodies. FACS histograms demonstrating binding of anti-FOLR1 to 300-19 cells expressing FOLR1 and the absence of binding to parental 300-19 cells are shown in Figure 4. Each antibody was incubated for 3 hours with both 300-19 cells expressing FOLR1 or untransfected 300-19 cells (1 x 105 cells per sample) in 0.1 ml of FACS buffer (RPMI-1640 medium supplemented with 2% normal goat serum). Then, cells were pelleted, washed, and incubated for 1 hour with 0.1 ml of FITC-conjugated Goat Anti-Mouse IgG Antibody (as obtainable from eg Jackson Laboratory, 6 μg/ml in the FACS buffer). Cells were pelleted again, washed with FACS buffer and resuspended in 200 µl PBS containing 1% formaldehyde. Samples were acquired using a FACSCalibur flow cytometer with the HTS multiwell sampler or a FACS array flow cytometer and analyzed using CellQuest Pro (all from BD Biosciences, San Diego, US). FACS histograms of anti-FOLR1 antibodies showed a fluorescent shift, whereas parental 300-19 cells did not. Also, no significant fluorescent shift was detected when one of the cell lines was incubated only with FITC-conjugated Goat Anti-Human IgG Antibody. Example 9 Cloning and sequencing of the VL and VH regions of muFR1-21
[000282] Total cellular RNA was prepared from 5 x 106 hybridoma cells using an RNeasy kit (QIAgen) according to the manufacturer's protocol. cDNA was subsequently synthesized from total RNA using the Superscript II cDNA synthesis kit (Invitrogen). The procedure for the first round degenerates the PCR reaction on cDNA derived from the hybridoma cells was based on the methods described in Wang et al. ((2000) J Immunol Methods. Jan 13;233(1-2):167-77) and Co et al. ((1992) J Immunol. Feb 15; 148(4): 1149-54). The VH sequences were amplified by PCR using the following degeneration primers: EcoMUl CTTCCGGAATTCSARGTNMAGCTGSAGSAGTC (SEQ ID NO:50) EcoMR1 CTTCCGGAATTCSARGTNMAGCTGSAGSAGTCWGG (SEQ ID NO:5 1 ) and BamIgGl GGAGGATCCATAGACAGATTNOTCGGTG (SEQ ID NO:50) VL sequences were amplified by PCR using the following degeneration primers: SacIMK GGAGCTCGAYATTGTGMTSACMCARWCTMCA (SEQ ID NO:53) and HindKL TATAGAGCTCAAGCTTGGATGGTGGGAAGATGGATACAGTTGGTG C (SEQ ID NO:54). (Mixed bases are defined as follows: N=G+A+T+C, S=G+C, Y=C+T, M=A+C, R=A+G, W=A+T).
[000283] The PCR reaction mixes were then run on a 1% low melting agarose gel, bands from 300 to 400 were cut out, purified using Zymo DNA mini columns, and sent to Agencourt Biosciences for sequencing. The respective 5' and 3' PCR primers were used as sequencing primers to generate the variable region cDNAs from both directions. The amino acid sequences of the VH and VL regions were obtained by translating the DNA sequencing results with the VectorNTI software.
[000284] To identify the 5' end primer sequencing artifacts in the variable region cDNA sequences preliminarily, the NCBI IgBlast site (www.ncbi.nlm.nih.gov/igblast/) was used to search for the lineage sequences germline cells from which the antibody sequences were derived. The cleared variable region sequences were then combined with the NCBI reference sequences for the specific antibody constant regions to assemble the expected full-length murine antibody sequences. The expected molecular weight of Fr1-21 murine light and heavy chains was then calculated and compared to the mass measured by liquid chromatography/mass spectrophotometric (LC/MS) analyses. Murine FR1-21 heavy chain matched the measured mass, but the light chain required a sequencing booster follow-up to determine the 5' end sequence. The primer CD37-1LClead1 PCR (ttttgaattcgccaccatgaagtttccttctcaacttct) was designed to hybridize to the leader sequence linked to the murine antibody germline such that this new PCR reaction would yield a complete variable region cDNA sequence, unaltered by the primers. PCR reactions, band purifications, and sequencing were performed as described above and the new complete sequence encoded the light chain that corresponded to the Fr1-21 chain mass measured by LC/MS. Example 10 Expression of reference antibodies
[000285] Morphotech's anti-FOLR1 antibody, MorAb-003 (Farletuzumab), amino acid sequence was obtained from the list of the World Health Organization (WHO) International Nonproprietary Names for Pharmaceutical Substances (INN) and was codon optimized and synthesized by Blue Heron Biotechnology. The light chain variable region sequence is flanked by the EcoRI and BsiWI restriction enzyme sites and the heavy chain variable region sequence flanked by the HindIII and Apa1 restriction enzyme sites for cloning in frame with the respective constant sequences in plasmid plasmids. single-chain mammalian expression. Cloning, expression and purification were performed as described for humanized Mov19 and FR1-21 above. Example 11 ADCC Activity of huMov19
[000286] A lactate dehydrogenase (LDH) release assay was used to measure antibody-dependent cell-mediated cytotoxicity (ADCC) of tumor cell lines using freshly isolated human natural killer (NK) cells as effector cells (eg. Shields, J. Biol. Chem., 276(9):6591 - 6604 (2001)). NK cells were first isolated from human blood from a normal donor (Research Blood Components, Inc., Brighton, MA) using a protocol modified for the NK Isolation Kit 11 (Miltenyi Biotech, 130-091 - 152). Blood was diluted 2-fold with 1x PBS. 25 mL of the diluted blood was carefully placed on 25 mL of Ficoll Paque in a 50 mL conical tube and centrifuged at 400 g for 45 min at RT. Peripheral blood mononuclear cells (PBMC) were collected from the interface, transferred to a new 50mL conical tube, and washed once with 1 x PBS. PBMC were resuspended in 2 mL of NK isolation buffer (1 x PBS, 0.5% BSA, 2 mM EDTA), and then 500 µL of Biotin Antibody Cocktail was added to a cell suspension. Biotin Antibody Cocktail contains biotinylated antibodies that bind to lymphocytes, except to NK cells, resulting in a negative selection of NK cells. The mixture was incubated at 4°C for 10 minutes, and then 1.5 ml of NK isolation buffer and 1 ml of Anti-Biotin Micro Beads was added. An antibody mixture from the cell was incubated an additional 15 minutes at 4°C. Then, the cells were washed once with 50 ml of the NK isolation buffer and resuspended in 3 ml of the NK isolation buffer. Then, a MACS LS column was mounted on the autoMACS separator (Miltenyi Biotech) and pre-washed with 3 ml of the NK isolation buffer. The cell suspension was automatically applied to the column, washed and the effluent fraction with unmarked NK cells was collected in a new 50mL conical tube. The resulting NK cells were plated in 30 ml of complete RPMI medium (RPMI-1640 supplemented with 5% fetal bovine serum, 1% penicillin-streptomycin, 1 mM HEPES, 1 mM Sodium Pyruvate, 1% 100X MEM Non-essential Amino Acid Solution) overnight. The subsequent assay and all dilutions were performed in RHBP medium (RPMI 1640 medium supplemented with 20 mM HEPES, pH 7.4, 0.1% BSA and 1% penicillin streptomycin). Various antibody concentrations in the RHBP medium were aliquoted in duplicate at 50 µl/well in a 96-well round-bottom plate. Target cells were resuspended at 106 cells/ml in RHBP medium and added at 100 µl/well to each well containing antibody dilutions. The plate containing the target cells and antibody dilutions was incubated for 30 minutes at 37°C. NK cells were then added to wells containing the target cells at 50 µl/well. The typical ratio was about 1 target cell to 3-4 NK cells. At least the following controls were defined for each experiment: NK cells alone, target cells alone (spontaneous LDH release), target cells with NK cells (antibody independent LDH release), target cells with 10% TritonX-100 (maximum LDH release). The mixtures were incubated at 37°C for 4 hours to allow cell lysis. The plates were centrifuged for 10 minutes at 1200 rpm, and 100 µl of the supernatant was carefully transferred to a new 96-well plate at the bottom. LDH reaction mixture (100 µl/well) from the Cytotoxicity Detection Kit (Roche 1 644 793) was added to each well and incubated at room temperature for 5 to 30 min. The optical density of the samples was measured at 490 nm (OD490). The percent specific lysis of each sample was determined using the following formula: percent specific lysis = (sample value - spontaneous release)/ (maximum release - spontaneous release) *100.
[000287] Incubation with huMov19 led to good ADCC activity against IGROV-1 cells in the presence of human NK effector cells. ADCC activity in IGROV-1 cells was compared to huMov19, huFR-1-21, Mor003, and chTKl (isotype control) (Figure 6). Treatment with 0.9 ng/ml huMov19 resulted in approximately 30% cell lysis of IGROV-1, similar to the activity that was observed with the other anti-FOLR1 antibodies. ADCC activity by huMov19 had an EC50 of 0.20 ng/mL, huFr-1 -21 had an EC50 of 0.11 ng/mL, Mor003 of 0.16 ng/mL and chTKl dID NO:1 showed no activity against IGROV-1 cells. Example 12 Preparation of anti-FOLR1 immunoconjugates Preparation of huMO V 19v 1.6-sulfo-SPDB-DM4
[000288] Exemplary 2-sulfo-SPDB linker was dissolved in DMA. The huMOV19v1.6 antibody was incubated at 8 mg/ml with a 12-fold molar excess of the 2-sulfo-SPDB linker for approximately 2 hours at 25°C at pH 7.5. The reaction mixture was purified using a SEPilADEX™ G25F column equilibrated with 50 mM potassium phosphate buffer containing 50 mM NaCl, 2 mM EDTA, pH 6.5. Maytansinoid DM4 was dissolved in dimethylacetamide (DMA, final concentration is 5%) and a 1.7-fold molar excess compared to the linker was added dropwise to the modified sulfo-SPDB antibody. The reaction mixture was adjusted to pH 7.5 with 1 M HEPES buffer. After overnight incubation at room temperature, the conjugated antibody was purified by chromatography on SEPHADEX™ G25F equilibrated with 10 mM histidine, 250 mM glycine, 1 % sucrose, pH 5.5. The number of DM4 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and maytansinoid (Widdison, WC, et al.] Med Chem, 49:43924408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 molecules of DM4 per huMov19v1.6 antibody were obtained with <1% present as unconjugated maytansinoid. Preparation of huMOV19vl .6-SPP-DM1
[000289] The exemplary N-succinimidyl 4-(2-pyridyldithio)pentanoate (SPP) linker was dissolved in ethanol. The huMOV19v1.6 antibody was incubated at 8 mg/ml with a 6.5 to 6-fold molar excess of the SPP ligand for approximately 2 hours at room temperature in 50 mM potassium phosphate buffer (pH 6.5) containing 50 mM NaCl, 2 mM EDTA, and 5% ethanol. The modified SPP antibody was diluted 2-fold in PBS, pH 6.5 and modified with a 1.5-fold molar excess of maytansinoid DM1 by the addition of a concentrated (15-30 mM) solution of DM1 in dimethylacetamide (DMA). The DMA concentration was adjusted to 5% and after overnight incubation at room temperature, the conjugated antibody was purified by chromatography on SEPHADEX™ G25F equilibrated with 10 mM, 250 mM glycine, 1% sucrose pH 5.5. The number of DM1 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and DM1 (Liu et al., Proc. Natl. Acad. Sci. USA, 93, 8618-8623 (1996)) . The percentage of free maytansinoid present after the conjugation reaction was determined by injecting 20 to 50 μg of the conjugate onto a HiSepTM column equilibrated in 25% acetonitrile in 100 mM ammonium acetate buffer, pH 7.0, and elution in acetonitrile. The peak area of the total free maytansinoid species (eluted in the gradient and identified by comparing the elution time with known standards) was measured using an absorbance detector set to a wavelength of 252 nm and compared to the peak area related to bound maytansinoid (eluted at peak conjugate in fractions through flow) to calculate percentage of total free maytansinoid species. Conjugates with 3.5-4 of DM1 molecules by huMOV19v1.6 were obtained with <1% present as unconjugated maytansinoid. Preparation of huMOV19v1.6 SPDB-DM4
[000290] The exemplary N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB) linker was dissolved in ethanol. The huMOV19v1.6 antibody was incubated at 8 mg/ml with a 5.5-5 fold molar excess of the SPDB linker for approximately 2 hours at room temperature in 50 mM potassium phosphate buffer (pH 6.5) containing 50 mM NaCl , 2 mM EDTA, and 3% ethanol. The modified SPDB antibody was diluted 2-fold in PBS, pH 6.5 and modified with a 1.5-fold molar excess of maytansinoid DM4 by the addition of a concentrated (15-30 mM) solution of DM4 in dimethylacetamide (DMA). After overnight incubation at room temperature, the conjugated antibody was purified by chromatography on SEPHADEX™ G25F equilibrated with 10 mM histidine, 250 mM glycine, 1% sucrose pH 5.5. The number of DM4 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and maytansinoid (Widdison, WC, et al.] Med Chem, 49:4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 DM4 molecules per huMOV19v 1.6 antibody were obtained with <1% present as unconjugated maytansinoid. Preparation of huMov19v1.0-3-sulfo-mal-DM4
[000291] The linker NHS-3-sulfo-mal and DM4 was dissolved separately in DMA. The linker and DM4 thiol were mixed together in a DMA solution containing 40% 200mM succinate buffer, 2mM EDTA, pH5.0 to provide a molar ratio of DM4 to linker of 1.6:1 and a final concentration of DM4 equal to 10 mM. The mixture was reacted for 2 hours at 25°C. Without purification, the reaction mixture was added such that a 9.6 equivalent molar excess of the linker to the antibody was added to a solution of huMOV19v1. The antibody in phosphate buffer (pH7.5) under final conjugation conditions of 4mg/ml per antibody, 90% phosphate buffer/10% DMA pH7.5 (v/v). After an overnight incubation at room temperature, the conjugation mixture was purified by chromatography on SEPHADEX G25 equilibrated in PBS pH7.5. The huMOV 19v1.0-3-sulfo-mal-DM4 was then dialyzed in a buffer containing 9.55mM Phosphate, 139.6mM NaCl, pH6.5. The number of DM4 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and maytansinoid (Widdison, WC, et al.] Med Chem, 49:4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 molecules of DM4 per huMOV19v1.0 antibody were obtained with <1% present as unconjugated maytansinoid. Preparation of huMOV19v1.0-SMCC-DM1
[000292] The NHS-sulfo-SMCC and DM1 linker were dissolved separately in DMA. The binder and DM1 thiol were mixed together in a DMA solution containing 40% 200mM succinate buffer, 2mM EDTA, pH5.0 to provide a molar ratio of DM1 to a binder of 1.2:1 and the final concentration of DM1 equal to 3.75mM. The mixture was reacted for 75 minutes at 20°C. Without purification, the reaction mixture was added such that a 6.4 molar excess equivalent of the antibody linker was added to a solution of huMOV19v1.0 antibody in phosphate buffer (pH7.5) under final antibody conjugation conditions of 4mg/ml, 88% 50mM Potassium phosphate, 50mM NaCl, 2mM EDTA, pH 7.5/12% DMA pH7.5 (v/v). After a 2 hour incubation at 20°C, the conjugation mixture was purified by chromatography on SEPHADEX G25 equilibrated in PBS pH7.5. The huMOV19v1.0-SMCC-DM1 was then dialyzed in a buffer containing 250 mM Glycine, 10 mM Histidine pH5.5. The number of DM1 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and maytansinoid (Widdison, WC, et al.] Med Chem, 49:4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 of DM1 molecules per huMOV19v1.0 antibody were obtained with <2.8% present as unconjugated maytansinoid. Preparation of huMOV19v1.0-PEG4-mal-DM1
[000293] 1-step reagent NHS-PEG4-mal-DM1 was dissolved in DMA. The huMov19v1.0 antibody was incubated at 5mg/ml with a 5.7 fold molar excess of NHS-PEG4-mal-DM1 overnight at 25°C in 50mM KPi, 50mM NaCl, 2mM EDTA, pH 7.5 and 10% DMA by volume. The reaction mixture was purified by SEPHADEX G25 column equilibrated in PBS pH7.5. huMOV19v1.0-PEG4-mal-DM1 was dialyzed in buffer containing 250 mM Glycine, 10 mM Histidine pH5.5. The number of DM1 molecules bound per antibody molecule was determined using the previously reported extinction coefficients for antibody and maytansinoid (Widdison, WC, et al.] Med Chem, 49:4392-4408 (2006)). The percentage of total free maytansinoid species was determined as described above. Conjugates with 3.5-4 molecules of DM1 per huMov19v1.0 antibody were obtained with <1.1% present as unconjugated maytansinoid. Example 13 Binding Affinity of Antibodies and Conjugates
Binding affinities of anti-FOLR1 antibodies and their conjugates SPDB-DM4, PEG4Mal-DM4, SMCC-DM1, or anti-FOLR1 -sulfo-SPDB-DM4 were tested by flow cytometry. SKOV3 cells expressing FOLR1 were incubated with varying concentrations of anti-FOLR1 antibodies or their conjugates and processed as described above for flow cytometric analysis. Data analysis was performed using CellQuest Pro (BD Biosciences, San Diego, US) and for each sample the mean fluorescence intensity for FL1 (MFI) was exported and plotted against antibody concentration in a semi-log graph. A dose-response curve was generated by non-linear regression and the value for the apparent equilibrium dissociation constant (%) of test samples for binding to SKOV3 cells was calculated using GraphPad Prism v4 (GraphPad software, San Diego, CA ) and shown in Figure 5. The results demonstrate that conjugation to either DM1 or DM4 through both of the linkers used, does not noticeably alter the affinity of both antibodies (eg, huMov19). Example 14 In vitro Cytotoxicity Assays
The ability of exemplary muFR1-9, muFR1-13, muFR1-22, muFR1-23, huFR1-23, muFR1-21, and huFR1-21 conjugates to inhibit cell growth was measured using in vitro cytotoxicity assays by method described in Kovtun YV et al. (Cancer Res 66: 3214-3221 (2006)). A PEG4-mal-DM4 conjugate at various concentrations was added to KB cells expressing FOLR1 in a 96-well plate at 1,000 cells per well in 100 µL in complete RPMI medium (RPMI-1640, 10% fetal bovine serum, 2 mM glutamine , 1% gentamicin, all Invitrogen reagents). Antibodies and conjugates were diluted in complete RPMI medium using 3-fold dilution series and 100 µL was added per well. Final concentration typically ranged from 3 x 10-8 M to 4.6 x 1012 M. Control wells containing cells and medium but without the conjugates, and wells containing medium only were incubated in each assay plate. The plates were incubated for four to six days at 37°C in a humidified atmosphere containing 5% CO2. WST-8 reagent, 10% v/v (Dojindo Molecular Technologies, Gaithersburg, MD, US) was then added to the wells and the plates were incubated at 37°C for 2-6 h. WST-8 is reduced by dehydrogenases in living cells to an orange culture medium (maximum formazan product that is soluble in tissue culture medium. The amount of formazan produced is directly proportional to the number of living cells. Plates were analyzed by measuring absorbance at 450 nm (A450) and at 650 nm (A650) in a multi-well plate reader First, the opal background of the cells (A650) was subtracted from A650. The resulting OA*450 was then used to determine a cell survival fraction. The background absorbance A*450 was that of the wells with the medium and WST-8 only. The survival fraction was calculated as follows: Percent viability = 100 x (A*450 treated sample - A* 450 background)/ (A*450 untreated sample - A*450 background) Survival fraction values were plotted against antibody or conjugate concentration in a semi-log plot for each treatment. IC50 were then determined by us. using GraphPad Prism v4 (GraphPad software, San Diego, CA) and presented in Figure 5. The results shown in Figure 5 demonstrate that all conjugates are similarly active in their cytotoxic potency against KB cells expressing FOLR1. To further verify the specificity of the anti-FOLR1 maytansinoid conjugates towards FOLR1, their activities were evaluated in the presence of an excess of unconjugated antibodies against KB cells. The addition of an excess of the unconjugated antibody competing to the conjugates suppressed their cytotoxicity, as seen in Figure 7. These data indicate that the conjugates kill KB cells in an antigen-dependent manner. Additional data demonstrated that huMov19-SPDB- DM4 induced cell cycle arrest in G2/M phase in KB cells in in vitro assays. Example 15 In vivo Efficacy of huMov19-PEG4Mal-DM4 and huMov19-SPDB-DM4 Conjugates Compared to Similar Non-Target Conjugates in a KB Xenograft Model
[000296] The FOLR1 targeted cleavable conjugate huMov 19-SPDB-DM4 compared to non-target huC242-SPDB-DM4, and non-cleavable conjugate huMov19-PEG4-Mal-DM4 compared to non-target huC242-PEG4Mal-DM4 were tested using an established xenograft model of KB cells implanted subcutaneously in the SCID mouse. Mice were randomized by body weight into treatment groups and treated either solely (SPDB conjugates) on day 3 after cell inoculation, or three times a week on days 3, 10, and 17 after cell inoculation with 5 and 10 mg/kg of a conjugate, respectively. The mean tumor volume of the different treatment groups is plotted in Figure 8. Treatments with either huMov19-SPDB-DM4, or huMov19-PEG4Mal-DM4 resulted in a decrease in mean tumor volume compared to PBS control, while treatments with one of the respective non-target conjugates did not produce any significant effect. Example 16 In Vivo Efficacy of Anti-FOLR1-PEG4Mal-DM4 Conjugates in a KB Xenograft Model
PEG4Mal-DM4 Conjugates of the exemplary anti-FOLR1 antibodies huMov19, muFR-1-9, muFR-1-13, muFR-1-22, muFR-1-23, and huFR-1-21 were tested using a model of established KB cell xenograft implanted subcutaneously in the SCID mouse. Mice were randomized by body weight into treatment groups and treated once on day 3 after cell inoculation with 10 mg/kg of one of the conjugates listed above or with PBS alone. HuMov19-PEG4Mal-DM4 was shown above to be similar to PEG4Mal-DM4 conjugates of muFR-1-9, muFR-1-13, muFR-1-22, muFR-1-23, and huFR-1-21 in their potency cytotoxic in vitro. HuMov 19-PEG4Mal-DM4 and huFR-1-21-PEG4Mal-DM4 were significantly more potent in vivo than either of the other conjugates, resulting in a more pronounced decrease in mean tumor volume (Figures 9 and 10). Potency was also demonstrated to be dose-dependent (Figure 11) and ligand choice also played a role (Figures 12 and 13). Example 17 In Vivo Efficacy of Anti-FOLR 1 -sulfo-SPDB-DM4 Conjugates in a Xenograft Model
[000298] Anti-FOLR1 huMov19-sulfo-SPDB-DM4 conjugates were tested in three ovarian serous adenocarcinoma xenografts: OVCAR-3, IGROV-1, and OV-90. Each of these xenograft tumors showed FOLR1 expression levels comparable to the patient's tumors when measured using a calibrated immunohistochemical staining (IHC) method on paraffin-fixed formalin embedded sections. Mice bearing the established subcutaneous xenograft tumors (approximately 100 mm3) were treated with a single intravenous injection of the huMov19-sulfo-SPDB-DM4 conjugate at 1.2, 2.5, and 5.0 mg/kg (based on antibody concentration; Figures 14 to 16 show the concentration of the maytansanoid conjugate in μg/kg. The conjugate was active in all three models evaluated. In OVCAR-3 xenografts, the minimally effective dose (MED) was 1.2 mg/ kg (Figure 14) The highest dose levels were highly active, resulting in complete regressions (CR) in 4/6 and 2/6 mice in 2.5 and 5.0 mg/kg treatment groups, respectively. Conjugate treatment resulted in strong anti-tumor activity in both the IGROV-1 and OV-90 xenograft models, with a MED of 2.5 mg/kg, single injection (Figures 15 and 16). strong anti-tumor activity of huMov19-sulfo-SPDB-DM4 conjugates against ovarian xenograft tumors with FOLR expression levels 1 comparable to the patient's tumors. Example 18 Effect of Ligands on Immunoconjugate Efficacy
The huMov19 anti-FOLR1 antibody was linked to DM1 or DM4 via a cleavable linker containing SPP, SPDB, or sulfo-SPDB disulfide, or via the non-cleavable linker SMCC. The in vitro cytotoxic activities of these conjugates on KB, IGROV-1 and JEG-3 cell lines were examined. FACS analyzes indicated that KB (cervical) cells had >2,000,000 antibody binding sites per cell. IGROV-1 (ovarian) cells had 260,000 antibody binding sites per cell, and JEG-3 (choriocarcinoma) cells had 40,000 antibody binding sites per cell. The results of in vitro cytotoxicity are summarized in Table 2 below. The cleavable conjugates exhibited markedly greater in vitro activities compared to those of the SMCC conjugate. Table 2: Effect of immunoconjugate ligands on in vitro cytotoxicity.

[000300] The in vivo activities of the conjugates in FOLR1 KB- and OVCAR-3-positive tumor models were also tested. The results shown in Figure 17 demonstrate that the cleavable SPDB-DM4 and sulfo-SPDB-DM4 conjugates are more potent than the non-cleavable SMCC-DM1 conjugates in vivo. Furthermore, within the cleavable conjugates, the SPP-DM1 conjugate was less active than either the SPDB-DM4 or sulfo-SPDB-DM4 conjugates in both xenograft models (Figure 18). The last two conjugates were similarly active against KB tumors, while the sulfo-SPDB-DM4 conjugate was more active against the OVCAR-3 model. Data obtained using the OVCAR-3 model are summarized in Table 3 below. Table 3: Effect of immunoconjugate ligands on tumor size in the OVCAR-3 xenograft model.

[000301] These data demonstrate that immunoconjugates containing a cleavable linker show increased efficacy both in vitro and in vivo, and anti-FOLR1 immunoconjugates containing sulfo-SPDB are highly active in tumor models. Example 19 In Vitro and In Vivo Efficacy of huFR1 SMCC-DM1 Antibody Conjugate
[000302] The anti-FOLR1 conjugate huFR1-48, huFR1-49, huFRl-57, and huFRl-65 were evaluated with the SMCC linker and DM1 and the effects on KB cells, and in vivo using the xenograft models described above were analyzed as described above. While each of the antibodies showed similar efficacy in the KB cell model, the huFR1-48, huFR1-49, huFR1-57, and huFR1-65 immunoconjugates showed variable but significant in vivo efficacy at a dose of 200 μg/kg in a xenograft model system (Table 4 and Figure 19). Table 4: In vitro and in vivo efficacy of huFR1 SMCC-DM1 antibody conjugate

[000303] All publications, patents, patent applications, internet sites, database sequences/accession number (including both polypeptide and polynucleotide sequences) cited herein are hereby incorporated by reference in their entirety for all purposes, to the same extent as if each individual publication, patent, patent application, internet site, or database/accession number sequence were specifically and individually named and then incorporated by reference.

权利要求:
Claims (26)
[0001]
1. Humanized antibody or antigen-binding fragment thereof that specifically binds to a human folate receptor 1, characterized in that the antibody comprises: (a) a heavy chain CDR1 comprising GYFMN (SEQ ID NO:1) ; a heavy chain CDR2 comprising RIHPYDGDTFYNQKFQG (SEQ ID NO: 2); and a heavy chain CDR3 comprising YDGSRAMDY (SEQ ID NO:3); and (b) a light chain CDR1 comprising KASQSVSFAGTSLMH (SEQ ID NO:7); a light chain CDR2 comprising RASNLEA (SEQ ID NO:8); and a light chain CDR3 comprising QQSREYPYT (SEQ ID NO:9).
[0002]
2. Humanized antibody or antigen-binding fragment thereof, characterized by the fact that it is encoded by plasmid DNA deposited with the ATCC on April 7, 2010 and having ATCC deposit No. PTA-10772, PTA-10773, or 10774 .
[0003]
3. Humanized antibody or antigen-binding fragment thereof, according to claim 1, characterized in that it comprises a heavy chain variable domain comprises SEQ ID NO:4, and a light chain variable domain comprises SEQ ID NO :10 or SEQ ID NO:11.
[0004]
4. Humanized antibody or antigen-binding fragment thereof, according to claim 1, characterized in that it comprises (i) a heavy chain comprising the same amino acid sequence as the heavy chain amino acid sequence encoded by the deposited plasmid in the American Type Culture Collection (ATCC) as PTA-10772 and (ii) a light chain comprising the same amino acid sequence as the light chain amino acid sequence encoded by the plasmid deposited with the ATCC as PTA-10774.
[0005]
5. Antibody or antigen-binding fragment thereof, according to any one of claims 1 to 3, characterized in that it is an antigen-binding fragment.
[0006]
6. Antigen-binding fragment according to claim 5, characterized in that said antigen-binding fragment comprises a Fab, a Fab', an F(ab')2, a single-chain Fv (scFv ), a disulfide-linked Fv, an intrabody, an IgG-CH2, a minibody, a tetrabody, a triabody, a diabody, DVD-Ig, mAb2, an (scFv)2, or an scFv-Fc.
[0007]
7. Antibody or antigen-binding fragment thereof, according to any one of claims 1 to 6, characterized in that it binds to a human folate receptor 1 with a Kd of 1.0 nM or more, or between 1.0 and 10 nM.
[0008]
8. Method for preparing an antibody or antigen-binding fragment thereof, as defined in any one of claims 1 to 7, characterized in that it comprises (a) culturing a cell that expresses said antibody; and (b) isolating the antibody from said cultured cell.
[0009]
9. Immunoconjugate, characterized by the fact that it has the formula (A) - (L) - (C) or (C)-(L)-(A), in which: (A) is an antibody or binding fragment to antigen as defined in any one of claims 1 to 7; (L) is a linker; and (C) is a cytotoxic agent; wherein said linker (L) links (A) to (C).
[0010]
10. Immunoconjugate according to claim 9, characterized in that said ligand is a cleavable ligand.
[0011]
11. Immunoconjugate according to claim 9, characterized in that said ligand is selected from the group consisting of a non-cleavable ligand, a hydrophilic ligand and a ligand based on dicarboxylic acid.
[0012]
12. Immunoconjugate according to claim 9, characterized in that said ligand is selected from the group consisting of: N-succinimidyl 4-(2-pyridyldithio)pentanoate (SPP) or N-succinimidyl 4-(2- pyridyldithio)-2-sulfopentanoate (sulfo-SPP); N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB) or N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); N-succinimidyl 4-(maleimidomethyl) cyclohexanecarboxylate (SMCC); N-sulfosuccinimidyl 4-(maleimidomethyl) cyclohexanecarboxylate (sulfoSMCC); N-succinimidyl-4-(iodoacetyl)-aminobenzoate (SIAB); and N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide).
[0013]
13. Immunoconjugate according to any one of claims 9 to 12, characterized in that said cytotoxic agent is selected from the group consisting of a maytansinoid, maytansinoid analogue, benzodiazepine, taxoid, CC-1065, analog of CC- 1065, duocarmycin, duocarmycin analogue, calicheamicin, dolastatin, dolastatin analogue, auristatin, tomaymycin derivative, and leptomycin derivative or a prodrug of the agent.
[0014]
14. Immunoconjugate according to any one of claims 9 to 12, characterized in that said cytotoxic agent is N(2')-deacetyl-N(2')-(3-mercapto-1-oxopropyl)-maytansine (DM1) or N(2')-deacetyl-N(2')-(4-mercapto-4-methyl-1-oxopentyl) maytansine (DM4).
[0015]
15. Immunoconjugate according to claim 9, characterized in that said immunoconjugate comprises (A) an antibody or antigen-binding fragment thereof comprising the heavy chain variable domain of SEQ ID NO:4 and the variable domain light chain of SEQ ID NO:10 or SEQ ID NO:11; and (C) a maytansinoid.
[0016]
16. Immunoconjugate, characterized in that it comprises: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11 ; (L) N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide); N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB); or N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N(2')-(4-mercapto-4-methyl-1-oxopentyl) maytansine (DM4); where (L) connects (A) to (C).
[0017]
17. Immunoconjugate according to claim 16, characterized in that said immunoconjugate comprises (A) a humanized antibody comprising a heavy chain comprising the same amino acid sequence as the heavy chain amino acid sequence encoded by the plasmid deposited at American Type Culture Collection (ATCC) as PTA-10772 and a light chain comprising the same amino acid sequence as the light chain amino acid sequence encoded by the plasmid deposited with the ATCC as PTA-10774; (L) N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N(2')-(4-mercapto-4-methyl-1-oxopentyl) maytansine (DM4).
[0018]
18. Immunoconjugate according to any one of claims 9 to 17, characterized in that it further comprises 2 to 6 cytotoxic agents.
[0019]
19. Diagnostic reagent, characterized in that it comprises the antibody or antigen-binding fragment, as defined in any one of claims 1 to 7, wherein said antibody is labeled.
[0020]
20. Diagnostic reagent according to claim 19, characterized in that said label is selected from the group consisting of a radioactive label, a fluorophore, a chromophore, an imaging agent and a metal ion.
[0021]
21. Use of a therapeutically effective amount of antibody, antigen-binding fragment, or immunoconjugate, as defined in any one of claims 1 to 7 and 9 to 18, characterized in that it is in the preparation of a pharmaceutical composition to inhibit growth of tumor in an individual.
[0022]
22. Use of a therapeutically effective amount of the immunoconjugate having the formula (A) - (L) - (C) or (C)-(L)-(A), wherein: (A) is an antibody or binding fragment to the antigen thereof as defined in any one of claims 1 to 7, which specifically binds to a human folate receptor 1; (L) is a linker; and (C) is a cytotoxin selected from the group consisting of a maytansinoid and a maytansinoid analogue; wherein said linker (L) links (A) to (C), said use being characterized in that it is in the preparation of a pharmaceutical composition for treating cancer in a subject.
[0023]
23. Use according to claim 22, characterized in that said immunoconjugate comprises: (A) a humanized antibody comprising the heavy chain variable domain of SEQ ID NO:4, and the light chain variable domain of SEQ ID NO:10 or SEQ ID NO:11; (L) N-succinimidyl-[(N-maleimidopropionamido)-tetraethylene glycol] ester (NHS-PEG4-maleimide); N-succinimidyl 4-(2-pyridyldithio)butanoate (SPDB); or N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N(2')-(4-mercapto-4-methyl-1-oxopentyl) maytansine (DM4).
[0024]
24. Use according to claim 22, characterized in that said immunoconjugate comprises: (A) a humanized antibody comprising a heavy chain comprising the same amino acid sequence as the amino acid sequence of the heavy chain encoded by the plasmid deposited in American Type Culture Collection (ATCC) as PTA-10772 and a light chain comprising the same amino acid sequence as the light chain amino acid sequence encoded by the plasmid deposited with the ATCC as PTA-10774; (L) N-succinimidyl 4-(2-pyridyldithio)-2-sulfobutanoate (sulfo-SPDB); and (C) N(2')-deacetyl-N(2')-(4-mercapto-4-methyl-1-oxopentyl) maytansine (DM4).
[0025]
25. Use according to claim 22, characterized in that said immunoconjugate comprises (A) an antibody or antigen-binding fragment thereof comprising the heavy chain variable domain of SEQ ID NO:4 and the variable domain of light chain of SEQ ID NO:10 or SEQ ID NO:11; (C) a maytansinoid.
[0026]
26. Use according to any one of claims 21 to 25, characterized in that the tumor or cancer is selected from the group consisting of ovarian cancer, brain cancer, breast cancer, uterine cancer, endometrial cancer, pancreatic cancer, kidney cancer, peritoneum cancer and lung cancer.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10752683B2|2020-08-25|Folate receptor 1 antibodies and immunoconjugates and uses thereof

---

AU2017279600B2|2019-11-28|Folate Receptor 1 Antibodies and Immunoconjugates and Uses Thereof

同族专利:

---

公开号 | 公开日

---

CA3014767A1|2011-09-01|

---

US20190345248A1|2019-11-14|

---

KR101759057B1|2017-07-18|

---

ZA201508660B|2017-11-29|

---

SG10201606573SA|2016-10-28|

---

US20210032327A1|2021-02-04|

---

JP2016153412A|2016-08-25|

---

TW201817746A|2018-05-16|

---

JP2019213522A|2019-12-19|

---

US9133275B2|2015-09-15|

---

JP2018021069A|2018-02-08|

---

KR20130012117A|2013-02-01|

---

MX367345B|2019-08-15|

---

EP3196212A1|2017-07-26|

---

RS55738B1|2017-07-31|

---

ES2617283T3|2017-06-16|

---

MY165151A|2018-02-28|

---

US10752683B2|2020-08-25|

---

MX340437B|2016-07-08|

---

KR102028531B1|2019-10-04|

---

JP6039751B2|2016-12-07|

---

JP2013524773A|2013-06-20|

---

EP2538976A1|2013-01-02|

---

US20160096887A1|2016-04-07|

---

IL269530D0|2019-11-28|

---

ES2813549T3|2021-03-24|

---

US9670278B2|2017-06-06|

---

US9657100B2|2017-05-23|

---

KR102287474B1|2021-08-06|

---

MX2019009654A|2019-10-07|

---

US9598490B2|2017-03-21|

---

US20160083471A1|2016-03-24|

---

KR102346223B1|2022-01-03|

---

RU2012135395A|2014-03-27|

---

RU2610663C2|2017-02-14|

---

JP5778700B2|2015-09-16|

---

CN103037900A|2013-04-10|

---

US9670280B2|2017-06-06|

---

AU2011220728A1|2012-08-30|

---

IL221241A|2017-05-29|

---

US20160060339A1|2016-03-03|

---

US10301385B2|2019-05-28|

---

PL2538976T3|2017-08-31|

---

KR20220017432A|2022-02-11|

---

CA2790412C|2018-10-02|

---

KR101580713B1|2015-12-29|

---

RU2017102988A|2019-01-17|

---

KR20150031488A|2015-03-24|

---

KR20200106987A|2020-09-15|

---

AR080301A1|2012-03-28|

---

NZ724971A|2019-06-28|

---

US20160096888A1|2016-04-07|

---

TWI504408B|2015-10-21|

---

IL255013D0|2017-12-31|

---

JP6860614B2|2021-04-14|

---

CN105777907A|2016-07-20|

---

KR20180093131A|2018-08-20|

---

KR20210098560A|2021-08-10|

---

HRP20170281T1|2017-04-21|

---

JP2016000729A|2016-01-07|

---

DK2538976T3|2017-02-27|

---

IL247615A|2018-04-30|

---

JP2021100430A|2021-07-08|

---

HUE030854T2|2017-06-28|

---

LT2538976T|2017-03-27|

---

KR20170085143A|2017-07-21|

---

RU2017102988A3|2020-05-18|

---

RU2740479C2|2021-01-14|

---

CY1118668T1|2017-07-12|

---

US20130295119A1|2013-11-07|

---

US8557966B2|2013-10-15|

---

US20120009181A1|2012-01-12|

---

AU2011220728B2|2014-07-31|

---

CN103037900B|2016-04-06|

---

NZ709390A|2016-11-25|

---

KR20190114019A|2019-10-08|

---

UA123257C2|2021-03-10|

---

NZ601617A|2014-03-28|

---

SG10201801636QA|2018-03-28|

---

IL221241D0|2012-10-31|

---

SI2538976T1|2017-05-31|

---

KR20160083962A|2016-07-12|

---

WO2011106528A1|2011-09-01|

---

TWI622402B|2018-05-01|

---

IL269530A|2020-11-30|

---

BR112012021296A2|2017-09-19|

---

PT2538976T|2017-03-08|

---

EP2538976B8|2017-05-24|

---

EP3760643A1|2021-01-06|

---

SG10201501342UA|2015-04-29|

---

EP3196212B1|2020-06-03|

---

US20160075781A1|2016-03-17|

---

SG183144A1|2012-09-27|

---

EP2538976B1|2016-11-30|

---

TWI672318B|2019-09-21|

---

TW201138816A|2011-11-16|

---

US9670279B2|2017-06-06|

---

US20170327575A1|2017-11-16|

---

CA2790412A1|2011-09-01|

---

TW202012446A|2020-04-01|

---

MY171234A|2019-10-04|

---

MX2012009754A|2012-11-21|

---

EP2538976A4|2013-07-24|

---

KR101637138B1|2016-07-06|

---

NZ621938A|2015-07-31|

---

CN105777907B|2020-03-17|

---

IL255013A|2019-10-31|

---

TW201607555A|2016-03-01|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3720760B1|1968-09-06|1984-02-07|Pharmacia Ab|

---

US4307016A|1978-03-24|1981-12-22|Takeda Chemical Industries, Ltd.|Demethyl maytansinoids|

---

US4256746A|1978-11-14|1981-03-17|Takeda Chemical Industries|Dechloromaytansinoids, their pharmaceutical compositions and method of use|

---

JPS55102583A|1979-01-31|1980-08-05|Takeda Chem Ind Ltd|20-acyloxy-20-demethylmaytansinoid compound|

---

JPS55162791A|1979-06-05|1980-12-18|Takeda Chem Ind Ltd|Antibiotic c-15003pnd and its preparation|

---

JPS6253158B2|1979-09-19|1987-11-09|Takeda Chemical Industries Ltd|

---

JPH0115514B2|1979-09-21|1989-03-17|Takeda Chemical Industries Ltd|

---

EP0028683A1|1979-09-21|1981-05-20|Takeda Chemical Industries, Ltd.|Antibiotic C-15003 PHO and production thereof|

---

WO1982001188A1|1980-10-08|1982-04-15|Takeda Chemical Industries Ltd|4,5-deoxymaytansinoide compounds and process for preparing same|

---

US4450254A|1980-11-03|1984-05-22|Standard Oil Company|Impact improvement of high nitrile resins|

---

US4313946A|1981-01-27|1982-02-02|The United States Of America As Represented By The Secretary Of Agriculture|Chemotherapeutically active maytansinoids from Trewia nudiflora|

---

US4315929A|1981-01-27|1982-02-16|The United States Of America As Represented By The Secretary Of Agriculture|Method of controlling the European corn borer with trewiasine|

---

US4563304A|1981-02-27|1986-01-07|Pharmacia Fine Chemicals Ab|Pyridine compounds modifying proteins, polypeptides or polysaccharides|

---

JPH0114918B2|1981-05-20|1989-03-14|Takeda Chemical Industries Ltd|

---

US4588585A|1982-10-19|1986-05-13|Cetus Corporation|Human recombinant cysteine depleted interferon-β muteins|

---

US4816567A|1983-04-08|1989-03-28|Genentech, Inc.|Recombinant immunoglobin preparations|

---

EP0229046B1|1985-03-30|1994-05-04|BALLIVET, Marc|Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique|

---

US6492107B1|1986-11-20|2002-12-10|Stuart Kauffman|Process for obtaining DNA, RNA, peptides, polypeptides, or protein, by recombinant DNA technique|

---

US4676980A|1985-09-23|1987-06-30|The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services|Target specific cross-linked heteroantibodies|

---

US5618920A|1985-11-01|1997-04-08|Xoma Corporation|Modular assembly of antibody genes, antibodies prepared thereby and use|

---

DE3600905A1|1986-01-15|1987-07-16|Ant Nachrichtentech|METHOD FOR DECODING BINARY SIGNALS AND VITERBI DECODERS AND APPLICATIONS|

---

US5681718A|1986-03-14|1997-10-28|Celltech Limited|Methods for enhanced production of tissue plasminogen activator in cell culture using alkanoic acids or salts thereof|

---

US5225539A|1986-03-27|1993-07-06|Medical Research Council|Recombinant altered antibodies and methods of making altered antibodies|

---

US4946778A|1987-09-21|1990-08-07|Genex Corporation|Single polypeptide chain binding molecules|

---

WO1989006692A1|1988-01-12|1989-07-27|Genentech, Inc.|Method of treating tumor cells by inhibiting growth factor receptor function|

---

GB8823869D0|1988-10-12|1988-11-16|Medical Res Council|Production of antibodies|

---

GB8826530D0|1988-11-12|1988-12-14|Ped Capacitors Ltd|Electrical capacitors|

---

US20040049014A1|1988-12-28|2004-03-11|Protein Design Labs, Inc.|Humanized immunoglobulins|

---

US5530101A|1988-12-28|1996-06-25|Protein Design Labs, Inc.|Humanized immunoglobulins|

---

US5108921A|1989-04-03|1992-04-28|Purdue Research Foundation|Method for enhanced transmembrane transport of exogenous molecules|

---

CA2016841C|1989-05-16|1999-09-21|William D. Huse|A method for producing polymers having a preselected activity|

---

EP0478627A4|1989-05-16|1992-08-19|William D. Huse|Co-expression of heteromeric receptors|

---

CA2016842A1|1989-05-16|1990-11-16|Richard A. Lerner|Method for tapping the immunological repertoire|

---

US5208020A|1989-10-25|1993-05-04|Immunogen Inc.|Cytotoxic agents comprising maytansinoids and their therapeutic use|

---

US5705337A|1990-06-11|1998-01-06|Nexstar Pharmaceuticals, Inc.|Systematic evolution of ligands by exponential enrichment: chemi-SELEX|

---

US5683867A|1990-06-11|1997-11-04|Nexstar Pharmaceuticals, Inc.|Systematic evolution of ligands by exponential enrichment: blended SELEX|

---

US5270163A|1990-06-11|1993-12-14|University Research Corporation|Methods for identifying nucleic acid ligands|

---

US5496938A|1990-06-11|1996-03-05|Nexstar Pharmaceuticals, Inc.|Nucleic acid ligands to HIV-RT and HIV-1 rev|

---

US6344321B1|1990-06-11|2002-02-05|Gilead Sciences, Inc.|Nucleic acid ligands which bind to hepatocyte growth factor/scatter factor or its receptor c-met|

---

US20030054360A1|1999-01-19|2003-03-20|Larry Gold|Method and apparatus for the automated generation of nucleic acid ligands|

---

US20030148406A1|1992-03-17|2003-08-07|David John King|Multivalent antigen-binding proteins|

---

US6916605B1|1990-07-10|2005-07-12|Medical Research Council|Methods for producing members of specific binding pairs|

---

GB9015198D0|1990-07-10|1990-08-29|Brien Caroline J O|Binding substance|

---

AT181571T|1991-09-23|1999-07-15|Medical Res Council|METHODS FOR PRODUCING HUMANIZED ANTIBODIES|

---

US6172197B1|1991-07-10|2001-01-09|Medical Research Council|Methods for producing members of specific binding pairs|

---

US5625126A|1990-08-29|1997-04-29|Genpharm International, Inc.|Transgenic non-human animals for producing heterologous antibodies|

---

US5661016A|1990-08-29|1997-08-26|Genpharm International Inc.|Transgenic non-human animals capable of producing heterologous antibodies of various isotypes|

---

US5545806A|1990-08-29|1996-08-13|Genpharm International, Inc.|Ransgenic non-human animals for producing heterologous antibodies|

---

US5633425A|1990-08-29|1997-05-27|Genpharm International, Inc.|Transgenic non-human animals capable of producing heterologous antibodies|

---

CA2089661C|1990-08-29|2007-04-03|Nils Lonberg|Transgenic non-human animals capable of producing heterologous antibodies|

---

WO1992009690A2|1990-12-03|1992-06-11|Genentech, Inc.|Enrichment method for variant proteins with altered binding properties|

---

US5840867A|1991-02-21|1998-11-24|Gilead Sciences, Inc.|Aptamer analogs specific for biomolecules|

---

PT1024191E|1991-12-02|2008-12-22|Medical Res Council|Production of anti-self antibodies from antibody segment repertoires and displayed on phage|

---

US5582981A|1991-08-14|1996-12-10|Gilead Sciences, Inc.|Method for identifying an oligonucleotide aptamer specific for a target|

---

US5766886A|1991-12-13|1998-06-16|Xoma Corporation|Modified antibody variable domains|

---

US6004554A|1992-03-05|1999-12-21|Board Of Regents, The University Of Texas System|Methods for targeting the vasculature of solid tumors|

---

US5965132A|1992-03-05|1999-10-12|Board Of Regents, The University Of Texas System|Methods and compositions for targeting the vasculature of solid tumors|

---

DK0563475T3|1992-03-25|2000-09-18|Immunogen Inc|Conjugates of Cell Binding Agents and Derivatives of CC-1065|

---

US5756291A|1992-08-21|1998-05-26|Gilead Sciences, Inc.|Aptamers specific for biomolecules and methods of making|

---

US5639641A|1992-09-09|1997-06-17|Immunogen Inc.|Resurfacing of rodent antibodies|

---

AU691811B2|1993-06-16|1998-05-28|Celltech Therapeutics Limited|Antibodies|

---

US5731168A|1995-03-01|1998-03-24|Genentech, Inc.|Method for making heteromultimeric polypeptides|

---

US5641870A|1995-04-20|1997-06-24|Genentech, Inc.|Low pH hydrophobic interaction chromatography for antibody purification|

---

DK1143006T3|1995-08-18|2008-07-14|Morphosys Ip Gmbh|Vectors / DNA sequences from human combinatorial antibody libraries|

---

US6828422B1|1995-08-18|2004-12-07|Morphosys Ag|Protein/peptide libraries|

---

AU7378096A|1995-09-28|1997-04-17|Alexion Pharmaceuticals, Inc.|Porcine cell interaction proteins|

---

US5714352A|1996-03-20|1998-02-03|Xenotech Incorporated|Directed switch-mediated DNA recombination|

---

US6596850B1|1998-01-30|2003-07-22|Ixsys, Incorporated|Anti-αv3β3 recombinant human antibodies, nucleic acids encoding same|

---

EP1150688A4|1998-10-19|2004-06-16|Yeda Res & Dev|Treatment of systemic lupus erythematosus by down-regulating the autoimmune response to autoantigens|

---

US20040031072A1|1999-05-06|2004-02-12|La Rosa Thomas J.|Soy nucleic acid molecules and other molecules associated with transcription plants and uses thereof for plant improvement|

---

JP4794789B2|1999-07-02|2011-10-19|モルフォシス・アクチェンゲゼルシャフト|Generation of specific binding partners for genomic DNA fragments or peptides encoded by ESTs|

---

US20020068066A1|1999-08-20|2002-06-06|Wenyuan Shi|Method for the treatment and prevention of dental caries|

---

IT1307309B1|1999-12-30|2001-10-30|Enea Ente Nuove Tec|STABILIZING PEPTIDES, POLYPEPTIDES AND ANTIBODIES THAT INCLUDE THEM.|

---

EA005823B1|2000-03-31|2005-06-30|Пердью Рисерч Фаундейшн|Method of treatment using immunogen conjugates|

---

RU2280650C2|2000-04-17|2006-07-27|Шанхай Фармко Рисерч, Инк.|Complex of folic acid or derivative thereof, pharmaceutical composition and uses of complex|

---

DE10037759A1|2000-08-03|2002-07-04|Gruenenthal Gmbh|screening process|

---

US6333410B1|2000-08-18|2001-12-25|Immunogen, Inc.|Process for the preparation and purification of thiol-containing maytansinoids|

---

EP2322648A1|2000-09-26|2011-05-18|Duke University|RNA aptamers and methods for identifying the same|

---

US7430476B2|2001-02-19|2008-09-30|Merck Patent Gmbh|Method for identification of t-cell epitopes and use for preparing molecules with reduced immunogenicity|

---

AU2002258518A1|2001-03-14|2002-09-24|Millennium Pharmaceuticals, Inc.|Nucleic acid molecules and proteins for the identification, assessment, prevention, and therapy of ovarian cancer|

---

US7740854B2|2001-05-02|2010-06-22|Purdue Research Foundation|Treatment of macrophage mediated disease|

---

US6441163B1|2001-05-31|2002-08-27|Immunogen, Inc.|Methods for preparation of cytotoxic conjugates of maytansinoids and cell binding agents|

---

US6716821B2|2001-12-21|2004-04-06|Immunogen Inc.|Cytotoxic agents bearing a reactive polyethylene glycol moiety, cytotoxic conjugates comprising polyethylene glycol linking groups, and methods of making and using the same|

---

GB0202319D0|2002-02-01|2002-03-20|Calex Electronics Ltd|Apparatus|

---

WO2003070984A1|2002-02-15|2003-08-28|Somalogic, Inc.|Methods and reagents for detecting target binding by nucleic acid ligands|

---

US7314974B2|2002-02-21|2008-01-01|Monsanto Technology, Llc|Expression of microbial proteins in plants for production of plants with improved properties|

---

WO2003074704A1|2002-03-01|2003-09-12|Japan Envirochemicals, Ltd.|Proteins capable of binding to female sex hormones and process for producing the same|

---

AU2003224073C1|2002-04-22|2010-03-11|AgroProtect GmbH|Antibodies, recombinant antibodies, recombinant antibody fragments and fusions mediated plant disease resistance against fungi|

---

KR100480244B1|2002-06-03|2005-04-06|삼성전자주식회사|Laser module|

---

US7538195B2|2002-06-14|2009-05-26|Immunogen Inc.|Anti-IGF-I receptor antibody|

---

US20050124565A1|2002-11-21|2005-06-09|Diener John L.|Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics|

---

GB0216648D0|2002-07-18|2002-08-28|Lonza Biologics Plc|Method of expressing recombinant protein in CHO cells|

---

SI1578446T1|2002-11-07|2015-07-31|Immunogen, Inc.|Anti-cd33 antibodies and method for treatment of acute myeloid leukemia using the same|

---

AU2003295411A1|2002-11-07|2004-06-03|Celltech R & D|Human monoclonal antibodies to heparanase|

---

US20050255114A1|2003-04-07|2005-11-17|Nuvelo, Inc.|Methods and diagnosis for the treatment of preeclampsia|

---

US20050025763A1|2003-05-08|2005-02-03|Protein Design Laboratories, Inc.|Therapeutic use of anti-CS1 antibodies|

---

KR101351122B1|2003-05-09|2014-01-14|듀크 유니버시티|CD20-Specific Antibodies and Methods of Employing Same|

---

CA2737127C|2003-05-14|2016-07-26|Immunogen, Inc.|Maytansinoid-antibody conjugate compositions|

---

US7276497B2|2003-05-20|2007-10-02|Immunogen Inc.|Cytotoxic agents comprising new maytansinoids|

---

EP1481993A1|2003-05-28|2004-12-01|Xerion Pharmaceuticals AG|Modulation of the poliovirus receptor function|

---

CA2530393A1|2003-07-02|2005-01-13|Genentech, Inc.|Compositions and methods for the diagnosis and treatment of tumor|

---

US7329742B2|2003-09-04|2008-02-12|The Regents Of The University Of California|Aptamers and methods for their in vitro selection and uses thereof|

---

US8088387B2|2003-10-10|2012-01-03|Immunogen Inc.|Method of targeting specific cell populations using cell-binding agent maytansinoid conjugates linked via a non-cleavable linker, said conjugates, and methods of making said conjugates|

---

CA2548942C|2003-12-05|2013-10-15|Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Health|Anti-sars monoclonal antibodies|

---

JP4805848B2|2004-02-12|2011-11-02|モルフォテック、インク．|Monoclonal antibodies that specifically block the biological activity of tumor antigens|

---

EP1725585A2|2004-03-10|2006-11-29|Lonza Ltd|Method for producing antibodies|

---

FR2867784B1|2004-03-17|2006-06-09|Commissariat Energie Atomique|APTAMERS SELECTED FROM TUMOR LIVING CELLS AND THEIR APPLICATIONS|

---

US20050239134A1|2004-04-21|2005-10-27|Board Of Regents, The University Of Texas System|Combinatorial selection of phosphorothioate single-stranded DNA aptamers for TGF-beta-1 protein|

---

JP5128273B2|2004-04-27|2013-01-23|ガラパゴス・ナムローゼ・フェンノートシャップ|Methods, agents, and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts|

---

AU2005279347A1|2004-08-30|2006-03-09|Lonza Biologics Plc.|Affinity- plus ion exchange- chromatography for purifying antibodies|

---

RU2007119382A|2004-10-25|2008-11-27|Мерк энд Ко., Инк. |ANTIBODIES AGAINST ADDL AND THEIR APPLICATION|

---

CA2875402C|2004-12-21|2021-09-28|Monsanto Technology Llc|Transgenic plants with enhanced agronomic traits|

---

JP2008526205A|2004-12-31|2008-07-24|ジェネンテック・インコーポレーテッド|Polypeptides that bind to BR3 and uses thereof|

---

EP2153848A3|2005-01-27|2010-07-21|The Regents of the University of California|Therapeutic monoclonal antibodies that neutralize botulinium neurotoxins|

---

US7608413B1|2005-03-25|2009-10-27|Celera Corporation|Kidney disease targets and uses thereof|

---

DK1866339T3|2005-03-25|2013-09-02|Gitr Inc|GTR-binding molecules and their applications|

---

JP2008537778A|2005-03-30|2008-09-25|パーデュー・リサーチ・ファウンデーション|Cancer prognosis by quantification of cellular folate vitamin receptor|

---

EP1878007A4|2005-04-18|2010-07-07|Lg Electronics Inc|Operating method of music composing device|

---

EP1879922A2|2005-04-22|2008-01-23|Morphotek, Inc.|Antibodies with immune effector activity and that internalize in folate receptor alpha-positive cells|

---

EP1888639A1|2005-05-12|2008-02-20|Oncotherapy Science, Inc.|Methods for damaging cells using effector function of anti-dsc2 antibody|

---

EP1915394B1|2005-05-20|2021-01-27|Lonza Biologics plc.|High-level expression of recombinant antibody in a mammalian host cell|

---

CN101273063A|2005-05-24|2008-09-24|阿维斯塔金格兰技术有限公司|A method for the production of a monoclonal antibody to CD20 for the treatment of b-cell lymphoma|

---

EP1904183B1|2005-07-05|2014-10-15|Purdue Research Foundation|Pharmaceutical composition for the treatment of osteoarthritis|

---

US7521195B1|2005-07-21|2009-04-21|Celera Corporation|Lung disease targets and uses thereof|

---

US8124076B2|2005-08-18|2012-02-28|Ramot At Tel Aviv University Ltd.|Single chain antibodies against β-amyloid peptide|

---

US7906116B2|2005-09-01|2011-03-15|Parkash Gill|Methods for using and identifying modulators of Delta-like 4|

---

US8044179B2|2005-09-13|2011-10-25|National Research Council Of Canada|Methods and compositions for modulating tumor cell activity|

---

AU2006304605A1|2005-10-17|2007-04-26|Institute For Systems Biology|Tissue-and serum-derived glycoproteins and methods of their use|

---

EP1790664A1|2005-11-24|2007-05-30|Ganymed Pharmaceuticals AG|Monoclonal antibodies against claudin-18 for treatment of cancer|

---

CN110776566A|2005-12-20|2020-02-11|Sbi 生物技术有限公司|anti-ILT 7 antibodies|

---

CA2685300C|2006-06-01|2017-01-03|Mayo Foundation For Medical Education And Research|Immunity to folate receptors|

---

EP2032701B1|2006-06-23|2013-11-27|Alethia Biotherapeutics Inc.|Polynucleotides and polypeptides involved in cancer|

---

US7910702B2|2006-07-28|2011-03-22|The Governors Of The University Of Alberta|Recombinant antibodies to sclerotinia antigens|

---

JP5244103B2|2006-08-09|2013-07-24|ホームステッドクリニカルコーポレイション|Organ-specific protein and method of use thereof|

---

JP4711910B2|2006-08-24|2011-06-29|パナソニック株式会社|Paper packaging box|

---

EP1900752A1|2006-09-15|2008-03-19|DOMPE' pha.r.ma s.p.a.|Human anti-folate receptor alpha antibodies and antibody fragments for the radioimmunotherapy of ovarian carcinoma|

---

NZ576855A|2006-10-12|2012-08-31|Forerunner Pharma Res Co Ltd|Diagnosis and treatment of cancer using anti-ereg antibody|

---

CA2672581A1|2006-12-14|2008-06-19|Forerunner Pharma Research Co., Ltd.|Anti-claudin 3 monoclonal antibody and treatment and diagnosis of cancer using the same|

---

KR101378302B1|2006-12-20|2014-03-28|엠엠알글로벌, 인코포레이티드|Antibodies and methods for making and using them|

---

US20080227704A1|2006-12-21|2008-09-18|Kamens Joanne S|CXCL13 binding proteins|

---

US7691980B2|2007-01-09|2010-04-06|Bio-Rad Laboratories, Inc.|Enhanced capacity and purification of antibodies by mixed mode chromatography in the presence of aqueous-soluble nonionic organic polymers|

---

WO2008101231A2|2007-02-16|2008-08-21|Endocyte, Inc.|Methods and compositions for treating and diagnosing kidney disease|

---

EP2604283A1|2007-02-16|2013-06-19|KTB Tumorforschungsgesellschaft mbH|Receptor And Antigen Targeted Prodrug|

---

CN101678124A|2007-03-14|2010-03-24|恩多塞特公司|Binding ligand linked drug delivery conjugates of tubulysins|

---

WO2008145136A1|2007-05-30|2008-12-04|Aarhus Universitet|Stat3 inactivation by inhibition of the folate receptor pathway|

---

CN101784565B|2007-06-25|2014-12-10|恩多塞特公司|Conjugates containing hydrophilic spacer linkers|

---

CN101139613B|2007-08-01|2011-06-08|姜荣锡|Antineoplastic dibasic polypeptide and application and preparation method thereof|

---

BRPI0821401A2|2007-12-21|2014-10-14|Novartis Ag|ORGANIC COMPOUNDS|

---

DE202008000527U1|2008-01-11|2009-03-05|Bucyrus Dbt Europe Gmbh|First chisel carrier adjustment and securing element for this|

---

CN101918450A|2008-01-11|2010-12-15|国立大学法人东京大学|Anti-CLDN6 antibody|

---

US8093364B2|2008-01-18|2012-01-10|Bio-Rad Laboratories, Inc.|Enhanced purification of antibodies and antibody fragments by apatite chromatography|

---

JP5470817B2|2008-03-10|2014-04-16|日産自動車株式会社|Battery electrode, battery using the same, and manufacturing method thereof|

---

WO2009132081A2|2008-04-24|2009-10-29|The Research Foundation Of State University Of New York|Monoclonal antibody-based targeting of folate receptors|

---

KR101764081B1|2008-04-30|2017-08-01|이뮤노젠 아이엔씨|Cross-linkers and their uses|

---

SG189817A1|2008-04-30|2013-05-31|Immunogen Inc|Potent conjugates and hydrophilic linkers|

---

US8383351B2|2008-06-11|2013-02-26|Oxford Brookes University|Antibody to inhibin/ activin β-B subunit|

---

CA2737496A1|2008-09-17|2010-03-25|Endocyte, Inc.|Folate receptor binding conjugates of antifolates|

---

WO2010033913A1|2008-09-22|2010-03-25|Icb International, Inc.|Antibodies, analogs and uses thereof|

---

CN101440130B|2008-11-21|2011-07-27|中国人民解放军第四军医大学|Variable regions of heavy chain and light chain of antihuman IL-13R alpha 2 monoclonal antibody|

---

RU2545080C2|2009-02-05|2015-03-27|Иммьюноджен, Инк.|Novel benzodiazepine derivatives|

---

EP2995953B1|2009-03-24|2017-11-29|Biocept, Inc.|Devices and methods of cell capture and analysis|

---

CN102574915B|2009-08-06|2014-10-22|伊缪纳斯制药株式会社|Antibodies that specifically bind to A beta oligomers and use thereof|

---

WO2011100398A1|2010-02-10|2011-08-18|Immunogen, Inc.|Cd20 antibodies and uses thereof|

---

NZ724971A|2010-02-24|2019-06-28|Immunogen Inc|Folate receptor 1 antibodies and immunoconjugates and uses thereof|

---

EP3130605B1|2010-11-05|2020-01-08|Eisai Inc.|Folate receptor alpha as a diagnostic and prognostic marker for folate receptor alpha-expressing cancers|

---

CN103619357A|2011-03-29|2014-03-05|伊缪诺金公司|Process for manufacturing conjugates of improved homogeneity|

---

EA201991268A3|2011-03-29|2020-01-31|Иммуноджен, Инк.|OBTAINING MAYTANSINOID-ANTIBODIES CONJUGATES IN ONE-STEP METHOD|

---

DK2694106T3|2011-04-01|2018-03-05|Immunogen Inc|METHODS FOR INCREASING EFFECT OF FOLR1 CANCER THERAPY|

---

WO2012138749A1|2011-04-04|2012-10-11|Immunogen, Inc.|Methods for decreasing ocular toxicity of antibody drug conjugates|

---

LT2731972T|2011-07-15|2018-03-26|Eisai R&D Management Co., Ltd.|Anti-folate receptor alpha antibodies and uses thereof|

---

KR20200079565A|2012-08-31|2020-07-03|이뮤노젠 아이엔씨|Diagnostic assays and kits for detection of folate receptor 1|

---

WO2014055842A1|2012-10-04|2014-04-10|Immunogen, Inc.|Process for preparing stable antibody maytansinoid conjugates|

---

JP6136279B2|2013-01-15|2017-05-31|株式会社ジェイテクト|Rolling bearing device|

---

TWI503850B|2013-03-22|2015-10-11|Polytronics Technology Corp|Over-current protection device|

---

WO2014186403A2|2013-05-14|2014-11-20|Immunogen Inc.|Anti-folr1 immunoconjugate dosing regimens|

---

US9637547B2|2013-08-30|2017-05-02|Immunogen, Inc.|Monoclonal antibodies for detection of folate receptor 1|

---

TWI510996B|2013-10-03|2015-12-01|Acer Inc|Methods for controlling a touch panel and portable computers using the same|

---

US20150132323A1|2013-10-08|2015-05-14|Immunogen, Inc.|Anti-FOLR1 Immunoconjugate Dosing Regimens|

---

US20150297744A1|2014-03-28|2015-10-22|Immunogen, Inc.|Anti-FOLR1 Immunoconjugate Dosing Regimens|

---

MA42844A|2015-09-17|2018-07-25|Immunogen Inc|THERAPEUTIC COMBINATIONS INCLUDING ANTI-FOLR1 IMMUNOCONJUGATES|

---

US9816280B1|2016-11-02|2017-11-14|Matthew Reitnauer|Portable floor|US20110166319A1|2005-02-11|2011-07-07|Immunogen, Inc.|Process for preparing purified drug conjugates|

---

US7612181B2|2005-08-19|2009-11-03|Abbott Laboratories|Dual variable domain immunoglobulin and uses thereof|

---

AU2006283726C1|2005-08-24|2015-05-07|Immunogen, Inc.|Process for preparing maytansinoid antibody conjugates|

---

KR101764081B1|2008-04-30|2017-08-01|이뮤노젠 아이엔씨|Cross-linkers and their uses|

---

RU2545080C2|2009-02-05|2015-03-27|Иммьюноджен, Инк.|Novel benzodiazepine derivatives|

---

KR20200090974A|2009-06-03|2020-07-29|이뮤노젠 아이엔씨|Conjugation methods|

---

NZ724971A|2010-02-24|2019-06-28|Immunogen Inc|Folate receptor 1 antibodies and immunoconjugates and uses thereof|

---

US10273294B2|2010-10-11|2019-04-30|University Of Southern California|Compositions and methods for treating HIF-1α over-expressing cancers|

---

MX346635B|2011-02-15|2017-03-27|Immunogen Inc|Cytotoxic benzodiazepine derivatives.|

---

WO2012135522A2|2011-03-29|2012-10-04|Immunogen, Inc.|Process for manufacturing conjugates of improved homogeneity|

---

EA201991268A3|2011-03-29|2020-01-31|Иммуноджен, Инк.|OBTAINING MAYTANSINOID-ANTIBODIES CONJUGATES IN ONE-STEP METHOD|

---

DK2694106T3|2011-04-01|2018-03-05|Immunogen Inc|METHODS FOR INCREASING EFFECT OF FOLR1 CANCER THERAPY|

---

SG10201605041VA|2011-06-21|2016-08-30|Immunogen Inc|Novel maytansinoid derivatives with peptide linker and conjugates thereof|

---

US8790651B2|2011-07-21|2014-07-29|Zoetis Llc|Interleukin-31 monoclonal antibody|

---

KR101312698B1|2011-08-26|2013-09-27|주식회사 태하|Eco-friendly floor sheet for salt plant|

---

EP2887965A1|2012-08-22|2015-07-01|ImmunoGen, Inc.|Cytotoxic benzodiazepine derivatives|

---

KR20200079565A|2012-08-31|2020-07-03|이뮤노젠 아이엔씨|Diagnostic assays and kits for detection of folate receptor 1|

---

NZ707091A|2012-10-04|2018-12-21|Immunogen Inc|Use of a pvdf membrane to purify cell-binding agent cytotoxic agent conjugates|

---

WO2014055771A1|2012-10-05|2014-04-10|The Trustees Of The University Of Pennsylvania|Human alpha-folate receptor chimeric antigen receptor|

---

WO2014089177A2|2012-12-04|2014-06-12|Massachusetts Institute Of Technology|Compounds, conjugates and compositions of epipolythiodiketopiperazines and polythiodiketopiperazines|

---

AU2013355931B2|2012-12-07|2019-03-14|Kyowa Kirin Co., Ltd.|Anti-FOLR1 antibody|

---

PT2935259T|2012-12-21|2019-04-04|Abgenomics Int Inc|Hydrophilic self-immolative linkers and conjugates thereof|

---

EP2961435B1|2013-02-28|2019-05-01|ImmunoGen, Inc.|Conjugates comprising cell-binding agents and cytotoxic agents|

---

EP2961434A2|2013-02-28|2016-01-06|ImmunoGen, Inc.|Conjugates comprising cell-binding agents and cytotoxic agents|

---

US20140302037A1|2013-03-15|2014-10-09|Amgen Inc.|BISPECIFIC-Fc MOLECULES|

---

WO2014186403A2|2013-05-14|2014-11-20|Immunogen Inc.|Anti-folr1 immunoconjugate dosing regimens|

---

WO2014194030A2|2013-05-31|2014-12-04|Immunogen, Inc.|Conjugates comprising cell-binding agents and cytotoxic agents|

---

US9637547B2|2013-08-30|2017-05-02|Immunogen, Inc.|Monoclonal antibodies for detection of folate receptor 1|

---

US20150132323A1|2013-10-08|2015-05-14|Immunogen, Inc.|Anti-FOLR1 Immunoconjugate Dosing Regimens|

---

MX2016008498A|2013-12-27|2016-10-07|Chugai Pharmaceutical Co Ltd|Method for purifying antibody having low isoelectric point.|

---

EP3593812A3|2014-03-15|2020-05-27|Novartis AG|Treatment of cancer using chimeric antigen receptor|

---

US20150297744A1|2014-03-28|2015-10-22|Immunogen, Inc.|Anti-FOLR1 Immunoconjugate Dosing Regimens|

---

RU2017101662A3|2014-06-20|2018-12-10|

---

WO2016014530A1|2014-07-21|2016-01-28|Novartis Ag|Combinations of low, immune enhancing. doses of mtor inhibitors and cars|

---

EP3311846A1|2014-09-02|2018-04-25|ImmunoGen, Inc.|Methods for formulating antibody drug conjugate compositions|

---

EP3189056B1|2014-09-03|2020-06-10|ImmunoGen, Inc.|Cytotoxic benzodiazepine derivatives|

---

JP2017527562A|2014-09-03|2017-09-21|イミュノジェン・インコーポレーテッド|Cytotoxic benzodiazepine derivatives|

---

SG11201701565PA|2014-09-03|2017-03-30|Immunogen Inc|Conjugates comprising cell-binding agents and cytotoxic agents|

---

CN107592813A|2014-11-19|2018-01-16|伊缪诺金公司|Method for preparing cell binding agent cytotoxic agent conjugate|

---

SI3221355T1|2014-11-20|2021-01-29|F. Hoffmann-La Roche Ag|Combination therapy of t cell activating bispecific antigen binding molecules cd3 and folate receptor 1and pd-1 axis binding antagonists|

---

WO2016090034A2|2014-12-03|2016-06-09|Novartis Ag|Methods for b cell preconditioning in car therapy|

---

WO2016123143A1|2015-01-26|2016-08-04|The University Of Chicago|CAR T-CELLS RECOGNIZING CANCER-SPECIFIC IL 13Rα2|

---

JP2018506301A|2015-01-26|2018-03-08|ザ ユニバーシティー オブ シカゴ|IL13Rα2 binding agents and their use in cancer therapy|

---

WO2016126608A1|2015-02-02|2016-08-11|Novartis Ag|Car-expressing cells against multiple tumor antigens and uses thereof|

---

WO2016172583A1|2015-04-23|2016-10-27|Novartis Ag|Treatment of cancer using chimeric antigen receptor and protein kinase a blocker|

---

CN106267225B|2015-05-29|2020-03-06|上海新理念生物医药科技有限公司|Trimaleimide-type linker and use thereof|

---

US10898579B2|2015-06-29|2021-01-26|Immunogen, Inc.|Conjugates of cysteine engineered antibodies|

---

BR112017027254A2|2015-06-29|2019-05-14|Immunogen, Inc.|anti-cd123 antibodies and conjugates and derivatives thereof|

---

JP2018522018A|2015-07-21|2018-08-09|イミュノジェン・インコーポレーテッド|Process for the preparation of cytotoxic benzodiazepine derivatives|

---

US20180230193A1|2015-08-07|2018-08-16|Andreas Loew|Treatment of cancer using chimeric cd3 receptor proteins|

---

MA42844A|2015-09-17|2018-07-25|Immunogen Inc|THERAPEUTIC COMBINATIONS INCLUDING ANTI-FOLR1 IMMUNOCONJUGATES|

---

EP3380620A1|2015-11-23|2018-10-03|Novartis AG|Optimized lentiviral transfer vectors and uses thereof|

---

JP2019501139A|2015-11-25|2019-01-17|イミュノジェン・インコーポレーテッド|Pharmaceutical formulations and uses thereof|

---

WO2017120534A1|2016-01-08|2017-07-13|Bioalliance C.V.|Tetravalent anti-psgl-1 antibodies and uses thereof|

---

CN105542004B|2016-01-12|2019-02-19|中国人民解放军军事医学科学院生物工程研究所|A kind of neutralizing monoclonal antibody of anti-tetanus toxin and its application|

---

CN108601848A|2016-02-05|2018-09-28|伊缪诺金公司|It is used to prepare the effective ways of cell binding agent-cytotoxic agent conjugate|

---

US20200281973A1|2016-03-04|2020-09-10|Novartis Ag|Cells expressing multiple chimeric antigen receptormolecules and uses therefore|

---

WO2017165683A1|2016-03-23|2017-09-28|Novartis Ag|Cell secreted minibodies and uses thereof|

---

CA3021027A1|2016-04-15|2017-10-19|Novartis Ag|Compositions and methods for selective protein expression|

---

WO2017197045A1|2016-05-11|2017-11-16|Movassaghi Mohammad|Convergent and enantioselective total synthesis of communesin analogs|

---

EP3490590A2|2016-08-01|2019-06-05|Novartis AG|Treatment of cancer using a chimeric antigen receptor in combination with an inhibitor of a pro-m2 macrophage molecule|

---

WO2018031968A1|2016-08-12|2018-02-15|L.E.A.F. Holdings Group Llc|Alpha and gamma-d polyglutamated antifolates and uses thereof|

---

WO2018031979A1|2016-08-12|2018-02-15|L.E.A.F. Holdings Group Llc|Alpha and gamma-d polyglutamated antifolates and uses thereof|

---

JP2020512276A|2016-11-23|2020-04-23|イミュノジェン・インコーポレーテッド|Selective sulfonation of benzodiazepine derivatives.|

---

WO2018111340A1|2016-12-16|2018-06-21|Novartis Ag|Methods for determining potency and proliferative function of chimeric antigen receptor -t cells|

---

WO2018119425A2|2016-12-22|2018-06-28|Icahn School Of Medicine At Mount Sinai|Anti-lilrb3 antibodies and methods of use thereof|

---

EP3574005B1|2017-01-26|2021-12-15|Novartis AG|Cd28 compositions and methods for chimeric antigen receptor therapy|

---

CN110582509A|2017-01-31|2019-12-17|诺华股份有限公司|Treatment of cancer using chimeric T cell receptor proteins with multispecific properties|

---

US20200048359A1|2017-02-28|2020-02-13|Novartis Ag|Shp inhibitor compositions and uses for chimeric antigen receptor therapy|

---

RU2765098C2|2017-02-28|2022-01-25|Иммуноджен, Инк.|Maitanzinoid derivatives with self-splitting peptide linkers and their conjugates|

---

CA3058944A1|2017-04-19|2018-10-25|Elstar Therapeutics, Inc.|Multispecific molecules and uses thereof|

---

WO2018195243A1|2017-04-20|2018-10-25|Immunogen, Inc.|Cytotoxic benzodiazepine derivatives and conjugates thereof|

---

JP2020519675A|2017-05-16|2020-07-02|イミュノジェン・インコーポレーテッド|Combination of anti-FOLR1 immunoconjugate and anti-PD-1 antibody|

---

WO2018229715A1|2017-06-16|2018-12-20|Novartis Ag|Compositions comprising anti-cd32b antibodies and methods of use thereof|

---

MA50098A|2017-09-05|2020-07-15|Immunogen Inc|METHODS FOR DETECTION OF FOLATE RECEPTOR 1 IN A SAMPLE FROM A PATIENT|

---

US10640508B2|2017-10-13|2020-05-05|Massachusetts Institute Of Technology|Diazene directed modular synthesis of compounds with quaternary carbon centers|

---

EP3697436A1|2017-10-18|2020-08-26|Novartis AG|Compositions and methods for selective protein degradation|

---

US20200370012A1|2017-10-25|2020-11-26|Novartis Ag|Methods of making chimeric antigen receptor-expressing cells|

---

WO2019081983A1|2017-10-25|2019-05-02|Novartis Ag|Antibodies targeting cd32b and methods of use thereof|

---

WO2019089798A1|2017-10-31|2019-05-09|Novartis Ag|Anti-car compositions and methods|

---

AU2018371271A1|2017-11-27|2020-06-11|Purdue Pharma L.P.|Humanized antibodies targeting human tissue factor|

---

JP2021508714A|2017-12-28|2021-03-11|イミュノジェン・インコーポレーテッド|Benzodiazepine derivative|

---

SG11202007494TA|2018-03-13|2020-09-29|Phanes Therapeutics Inc|Anti-folate receptor 1 antibodies and uses thereof|

---

KR102275930B1|2018-03-14|2021-07-12|알테오젠|Antibody specifically binding to FOLR1 and Use thereof|

---

EP3784351A1|2018-04-27|2021-03-03|Novartis AG|Car t cell therapies with enhanced efficacy|

---

EP3788369A1|2018-05-01|2021-03-10|Novartis Ag|Biomarkers for evaluating car-t cells to predict clinical outcome|

---

WO2019227003A1|2018-05-25|2019-11-28|Novartis Ag|Combination therapy with chimeric antigen receptortherapies|

---

EP3802825A1|2018-06-08|2021-04-14|Intellia Therapeutics, Inc.|Compositions and methods for immunooncology|

---

TW202019472A|2018-07-09|2020-06-01|大陸商艾比瑪特生物醫藥（上海）有限公司|Antibodies specific to folate receptor alpha|

---

AR116109A1|2018-07-10|2021-03-31|Novartis Ag|DERIVATIVES OF 3-PIPERIDINE-2,6-DIONA AND USES OF THE SAME|

---

BR112021011874A2|2018-12-20|2021-09-08|Novartis Ag|DOSAGE SCHEME AND PHARMACEUTICAL COMBINATION INCLUDING DERIVATIVES OF 3-PIPERIDINE-2,6-DIONE|

---

KR20210129671A|2019-02-15|2021-10-28|노파르티스 아게|3-isoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof|

---

CN113329792A|2019-02-15|2021-08-31|诺华股份有限公司|Substituted 3-piperidine-2, 6-dione derivatives and uses thereof|

---

CN113631194A|2019-03-21|2021-11-09|伊缪诺金公司|Method for preparing cell-binding agent-drug conjugates|

---

EP3947395A1|2019-03-29|2022-02-09|ImmunoGen, Inc.|Cytotoxic bis-benzodiazepine derivatives and conjugates thereof with cell-binding agents for inhibiting abnormal cell growth or for treating proliferative diseases|

---

WO2020219742A1|2019-04-24|2020-10-29|Novartis Ag|Compositions and methods for selective protein degradation|

---

TW202106691A|2019-04-26|2021-02-16|美商伊繆諾金公司|Camptothecin derivatives|

---

TW202100557A|2019-04-29|2021-01-01|美商免疫遺傳股份有限公司|Biparatopic fr-alpha antibodies and immunoconjugates|

---

WO2021026310A1|2019-08-06|2021-02-11|L.E.A.F. Holdings Group Llc|Processes of preparing polyglutamated antifolates and uses of their compositions|

---

TW202135858A|2019-12-20|2021-10-01|瑞士商諾華公司|USES OF ANTI-TGFβ ANTIBODIES AND CHECKPOINT INHIBITORS FOR THE TREATMENT OF PROLIFERATIVE DISEASES|

---

WO2021252920A1|2020-06-11|2021-12-16|Novartis Ag|Zbtb32 inhibitors and uses thereof|

---

WO2021260528A1|2020-06-23|2021-12-30|Novartis Ag|Dosing regimen comprising 3-piperidine-2,6-dione derivatives|

---

CN111690061A|2020-06-28|2020-09-22|中国人民解放军东部战区疾病预防控制中心|Humanized antibody against Yersinia pestis antigen F1 and application|

---

WO2022029573A1|2020-08-03|2022-02-10|Novartis Ag|Heteroaryl substituted 3-piperidine-2,6-dione derivatives and uses thereof|

---

CN112794911B|2021-04-14|2021-08-03|上海偌妥生物科技有限公司|Humanized anti-folate receptor 1 antibody and application thereof|

法律状态:
2018-01-23| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|

---

2019-05-28| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-07-09| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2020-02-04| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2021-01-05| B06A| Patent application procedure suspended [chapter 6.1 patent gazette]|

---

2021-05-04| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-06-15| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 10 (DEZ) ANOS CONTADOS A PARTIR DE 15/06/2021, OBSERVADAS AS CONDICOES LEGAIS. PATENTE CONCEDIDA CONFORME ADI 5.529/DF |

优先权:

---

申请号 | 申请日 | 专利标题

---

US30779710P| true| 2010-02-24|2010-02-24|

---

US61/307,797|2010-02-24|

---

US34659510P| true| 2010-05-20|2010-05-20|

---

US61/346,595|2010-05-20|

---

US41317210P| true| 2010-11-12|2010-11-12|

---

US61/413,172|2010-11-12|

---

PCT/US2011/026079|WO2011106528A1|2010-02-24|2011-02-24|Folate receptor 1 antibodies and immunoconjugates and uses thereof|

---