transgenic microbial host cell, methods for producing a polypeptide, for degrading or converting a c

专利摘要:
polypeptide, polynucleotide, method for making the polypeptide, for producing a mutant of a percus cell, for inhibiting expression of a polypeptide, for producing a protein, for degrading or converting a cellulosic material or xylan-containing material, for producing a fermentation product and to ferment a cellulosic material or material containing xylan, transgenic plant, plant part or transformed plant cell, and double stranded inhibitory RNA molecule. The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors and host cells comprising polynucleotides as well as methods for producing and using polypeptides.
公开号:BR112012008286B1
申请号:R112012008286-8
申请日:2010-11-05
公开日:2018-11-21
发明作者:Elena Vlasenko；Brett McBrayer；Dominique Skovlund；Sara Landvik
申请人:Novozymes, Inc. E Novozymes A/S；
IPC主号:

专利说明:

(54) Title: TRANSGENIC MICROBIAL HOSTED CELL, METHODS TO PRODUCE A POLYPEPTIDE, TO DEGRAD OR CONVERT A CELLULOSIC MATERIAL OR MATERIAL CONTAINING XYLANE, TO PRODUCE A FERMENTATION PRODUCT, TO FERMENT A NUTRITION MATERIAL, KNOWLEDGE MATERIAL E, VECTOR OF EXPRESSION (73) Holder: NOVOZYMES, INC. AND NOVOZYMES A / S. Address: 1445 DrewAvenue, Davis, California 95618, United States of America and Krogshoejvej 36, DK-2880 Bagsvaerd, DENMARK (DK) (72) Inventor: ELENA VLASENKO; BRETT MCBRAYER; DOMINIQUE SKOVLUND; SARA LANDVIK.
Control Code: 81769FBA3CB4C8C4 9470371E6A704BA3
Validity Term: 20 (twenty) years from 11/05/2010, subject to legal conditions
Issued on: 11/21/2018
Digitally signed by:
Alexandre Gomes Ciancio
Substitute Director of Patents, Computer Programs and Topographies of Integrated Circuits “TRANSGENIC MICROBIAL HOST CELL, METHODS TO PRODUCE A POLYPEPTIDE, TO DEGRAD OR CONVERT A CELLULOSIC OR MATERIAL CONTAINING XYLANE, TO PRODUCE A PHARMACEUTICAL PRODUCT, A PHARMACEUTICAL PRODUCT MATERIAL CONTAINING XYLAN, NUCLEIC ACID CONSTRUCTIONS, AND, EXPRESSION VECTOR. ”
Reference to a sequence listing
This order contains a sequence listing in computer readable form, which is incorporated here by reference.
Reference to a Biological Material Deposit
This order contains a reference to a deposit of biological material, the deposit of which is incorporated into it by reference.
Fundamentals of the invention
Field of invention
The present invention concerns polypeptides having xylanase activity and polynucleotides that encode polypeptides. The invention also relates to nucleic acid constructs, vectors and host cells that comprise polynucleotides as well as methods of producing and using polypeptides.
Description of the related technique
Cellulose is a simple sugar glucose polymer linked by beta-1,4 bonds. Many organisms produce enzymes that hydrolyze beta-linked glycans. These enzymes include endoglycanases, cellobiohydrolases and beta-glycosidases. Endoglycanases differ the cellulose polymer at random locations, opening them up to attack by cellobiohydrolases. At
Petition 870180062814, of 20/07/2018, p. 16/22 cellobiohydrolases sequentially release cellobiose molecules from the ends of the cellulose polymer. Cellobiosis is a water-soluble beta-1,4 linked dimer of glucose. Beta-glycosidases hydrolyze cellobiosis to glucose.
Lignocellulose, the most renewable biomass resource in the world, is composed mainly of lignin, cellulose and hemicellulose, most of which is xylan. Xylanases (for example, endo-1,4-betaxylanase, EC 3.2.1.8) hydrolyze the internal 1,4-xylosidic bonds in xylan to produce xylose of lower molecular weight and xyloligomers. Xylans are polysaccharides formed from D-xylanopyranes linked by 1,4-glucoside.
The conversion of lignocellulosic feed stocks into ethanol has the advantages of ready bioavailability of large amounts of feed stock, the desirability of avoiding burning or filling the earth with materials and cleaning the ethanol fuel. Wood, agricultural residues, herbaceous crops and municipal solid residues were considered as food stocks for the production of ethanol. These materials consist primarily of cellulose, hemicellulose and lignin. Once cellulose and hemicellulose are converted to glucose and xylose, glucose and xylose can be fermented by yeast in ethanol.
There is a need in the art to improve cellulolytic enzyme compositions by supplementing with additional enzymes to increase efficiency and to improve efficiency and to provide cost-effective enzyme solutions for lignocellulose degradation.
The present invention provides polypeptides having xylanase and polynucleotide activity that encode the polypeptides.
Summary of the Invention
The present invention relates to isolated polypeptides having xylanase activity selected from the group consisting of:
(a) a polypeptide having at least 65% sequence identity to the mature polypeptide of SEQ ID NO: 2;
(b) a polypeptide encoded by a polynucleotide that hybridizes under medium stringency conditions to (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) the genomic DNA sequence encoding the mature polypeptide of SEQ ID NO: 1 or (iii) the full length complementary filament of (i) or (ii);
(c) a polypeptide encoded by a polynucleotide having at least 65% sequence identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence thereof;
(d) a variant comprising a substitution, deletion and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2 and (e) a fragment of the polypeptide of (a), (b), ( c) or (d) that has xylanase activity.
The present invention also relates to isolated polynucleotides that encode the polypeptides of the present invention; nucleic acid constructs, recombinant expression vectors, and recombinant host cells comprising the polynucleotides and methods of producing the polypeptides.
The present invention also relates to methods for degrading or converting a cellulosic material or material containing xylan, which comprises: treating the cellulosic material or material containing xylan with an enzyme composition in the presence of a polypeptide having the xylanase activity of the present invention. In a preferred aspect, the method further comprises recovering the degraded or converted cellulosic material or material containing xylan.
The present invention also relates to methods of producing a fermentation product, which comprises: (a) saccharifying a cellulosic material or material containing xylan with an enzyme composition in the presence of a polypeptide having the xylanase activity of the present invention; (b) fermenting the saccharified cellulosic material or material containing xylan with one or more (several) fermentation microorganisms for the production of the fermentation product and (c) recovering the fermentation product from the fermentation.
The present invention also concerns methods of fermenting a cellulosic material or material containing xylan, which comprises: fermenting the cellulosic material or material containing xylan with one or more (several) fermentation microorganisms, wherein the cellulosic material is saccharified with a composition of enzyme in the presence of a polypeptide having xylanase activity of the present invention. In a preferred aspect, fermentation of the cellulosic material or material containing xylan produces a fermentation product. In one aspect, the method further comprises recovering the fermentation product from the fermentation.
The present invention also relates to a polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2, which is operably linked to a gene that encodes a protein; nucleic acid constructs, expression vectors and recombinant host cells comprising polynucleotides and methods of producing a protein.
Brief Description of the Figures
Figure 1 shows the cDNA sequence and the deduced amino acid sequence of the Trichophaea saccata xylanase gene CBS 804.70 (SEQ ID NO 1 and 2, respectively).
Figure 2 shows a variation of Trichophaea saccata GH10 xylanase and 10% addition (0.35 mg protein per g cellulose) to a high temperature enzyme composition (3.5 mg protein per g cellulose) in hydrolysis of washed PCS ground at 50 ° C, 55 ° C and 60 ° C.
Figure 3 shows a variation of Trichophaea saccata xylanase GH10 for synergy with a high temperature enzyme composition in the hydrolysis of washed PCS ground at 50 ° C, 55 ° C and 60 ° C. Trichophaea saccata GH10 xylanase was added in different levels (1.25%, 2.5%, 5%, 10% and 20%) at a constant load of the high temperature enzyme composition (3 mg of protein per g of cellulose).
Figures 4A and 4B show a comparison of improved high temperature enzyme composition containing Trichophaea saccata xylanase GH10 (60 ° C) with cellulase based on Trichoderma reesei XCL533 (50 ° C) in the hydrolysis of washed and non-washed PCS (A) washed (B).
Definitions
Cellulolytic enzyme or hemicellulase: The term "hemicellulolytic enzyme" or "hemicellulase" means one or more (several) enzymes that hydrolyze a hemicellulosic material. See, for example, Shallom, D. and Shoham, Y. Microbial hemicellulases. Current Opinion In Microbiology, 2003, 6 (3): 219-228). Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a furoyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, an mannosidase, a xylanase, and a xylosidase. The substrates of these enzymes, hemicelluloses, are a heterogeneous group of branched and linear polysaccharides that are linked by means of hydrogen bonds to the cellulose microfibrils on the plant cell wall, their crosslinking in a robust network. Hemicelluloses are also covalently linked to lignin, forming together with cellulose a highly complex structure. The variable structure and organization of hemicelluloses requires the combined action of many enzymes for their complete degradation.
The catalytic modules of hemicellulases are glycoside hydrolases (GHs) that hydrolyze the glycosidic bonds or carbohydrate esterases (CEs), which hydrolyze the ester bonds of secondary groups of acetate or ferulic acid. These catalytic modules, based on the homology of their primary sequence, can be indicated in the GH and CE Families marked by numbers. Some families with similar totals can still be grouped into clans, marked alphabetically (for example, GH-A). A more informative and up-to-date classification of these and other active carbohydrate enzymes is available in the Active Carbohydrate Enzyme Database (CAZy). Hemicellulolytic enzyme activities can be measured according to Ghose and Bisaria, 1987, Pure & Appl. Chem. 59: 1739-1752.
Xylan degradation activity or xylanolitic activity: The term "xylan degradation activity" or "xylanolitic activity" means a biological activity that hydrolyzes the material containing xylan. The two basic methods for measuring xylanolitic activity include: (1) measuring total xylanolitic activity and (2) measuring total xylanolitic activities (for example, endoxylanases, beta-xylosidases, arabinofuranosidases, alfaglucuronidases, acetylxylan esterases, feruloil esterases and alpha- glucuronyl esterases). Recent progress in the testing of xylanolitic enzymes has been summarized in several publications including Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and Agriculture 86 (11): 1636-1647; Spanikova and Biely, 2006, Glucuronoyl esterase - Novel carbohydrate esterase produced by Schizophyllum commune, FEBS Letters 580 (19): 4597-4601; Herrman, Vrsanska, Jurickova, Hirsch, Biely, and Kubicek, 1997, The beta-Dxylosidase of Trichoderma reesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal 321: 375-381.
The total degradation activity of xylan can be measured by determining the reduction of sugars formed from various types of xylan, including, for example, oat, spelled, beech and larch wood xylans or by photometric determination of Fragments of pigmented xylans released from various covalently pigmented xylans. The most common total xylanolitic activity test is based on the production of reducing sugars from polymeric 4-O-methyl glucuronoxylane as described in Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23 (3): 257-270. Xylanase activity can also be determined with AZCL-0.2% arabinoxylan as the substrate in 100% Triton X-100 and 200 mM sodium phosphate buffer pH 6 at 37 ° C. One unit of xylanase activity is defined as 1.0 gmol of azurine produced per minute at 37 ° C, pH 6 of AZCL-arabinoxylan 0.2% as substrate in 200 mM sodium phosphate buffer pH 6.
For the purposes of the present invention, xylan degradation activity is determined by measuring the increase in birch wood xylan hydrolysis (Sigma Chemical Co., Inc., St. Louis, MO, USA) by xylan degradation enzymes under the following typical conditions: reactions of 1 ml, 5 mg / ml of substrate (total solids), 5 mg of xylanolitic protein / g of substrate, 50 mM sodium acetate pH 5, 50 ° C, 24 hours, analysis of sugar using p-hydroxybenzoic acid hydrazide assay as described by Lever, 1972, A new reaction for colorimetric determination of carbohydrates, Anal. Biochem 273-279.
Xylanase: The term "xylanase" means one means a 1,4beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endohydrolysis of 1,4-D-xylosidic bonds in xylans. For the purposes of the present invention, xylanase activity is determined with 0.2% AZCL-arabinoxylan (wheat; (Megazyme Intemational Ireland, Ltd., Bray, Co. Wicklow, Ireland)) as the substrate in 200 mM phosphate sodium pH 6 containing 0.01% TRITON® X-100 at 37 ° C. One unit of xylanase activity is defined as 1.0 gmole of azurine produced per minute at 37 ° C, pH 6 of AZCL-arabinoxylan at 0 , 2% in 0.2 M sodium phosphate pH 6.0 containing 0.01% TRITON® X-100.
The polypeptides of the present invention are at least 20%, for example, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% and at least minus 100% of the cellobiohydrolase activity of the mature polypeptide of SEQ ID NO: 2.
Cellulolytic enzyme or cellulase: The term "cellulolytic enzyme" or "cellulase" means one or more (several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglycanase (s), cellobiohydrolase (s), beta-glycosidase (s), or combinations thereof. The two basic methods for measuring cellulolytic activity include: (1) measuring total cellulolytic activity and (2) measuring individual cellulolytic activities (endoglycanases, cellobiohydrolases and beta-glucosidases) as reviewed in Zhang et al., Outlook for cellulase improvement: Screening and selection strategies, 2006, Biotechnology Advances 24: 452-481. Total cellulolytic activity is usually measured using insoluble substrates, including Whatman NM filter paper, microcrystalline cellulose, bacterial cellulose, algae cellulose, cotton, pretreated lignocellulose, etc. The most common total cellulolytic activity assay is the paper filter assay using Whatman NO 1 filter paper as the substrate. The assay was established by the Intemational Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, Pure Appl. Chem. 59: 257-68).
For the purposes of the present invention, cellulolytic enzyme activity is determined by measuring the increase in the hydrolysis of a cellulosic material by cellulolytic enzymes under the following conditions: 1 to 20 mg of cellulolytic enzyme protein / g of cellulose in PCS by 3 to 7 days at 50 ° C compared to a control hydrolysis without the addition of cellulolytic enzyme protein. Typical conditions are 1 ml reactions, PCS washed or not washed, insoluble solids at 5%, 50 mM sodium acetate pH 5, 1 mM MnSO ₄ , 50 ° C, 72 hours, sugar analysis by AMINEX® column HPX-87H (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Endoglycanase: The term "endoglycanase" means an endo1,4- (1,3; 1,4) -beta-D-glycan 4-glycanhydrolase (EC 3.2.1.4), which catalyzes the endhydrolysis of 1,4-beta- bonds Cellulose D-glycosides, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenine, beta-1,4 bonds in mixed beta-1,3 glycans such as beta-D-glycans or cereal xyloglycans and other plant material containing cellulosic components. Endoglycanase activity can be determined by measuring the reduction in substrate viscosity or increase in the reducing ends determined by a reduction sugar assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). For the purposes of the present invention, endoglycanase activity is determined using carboxymethyl cellulose (CMC) as a substrate according to the procedure of Ghose, 1987, Pure andAppl. Chem. 59: 257-268, at pH 5.40 ° C.
Cellobiohydrolase: The term “cellobiohydrolase” means a 1,4beta-D-glycan cellobiohydrolase (EC 3.2.1.91), which catalyzes the hydrolysis of 1,4-beta-D-glycosidic bonds in cellulose, celloligosaccharides or any polymer containing glucose bound by beta-1,4, cellobiosis release from reducing or non-reducing ends of the chain (Teeri, 1997, Crystalline cellulose degradation: New insight into the function of cellobiohydrolases, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Trichoderma reesei cellobiohydrolases: why so efficient on crystalline cellulose , Biochem. Soc. Trans. 26: 173-178). For the purposes of the present invention, the activity of cellobiohydrolase activity is determined according to the procedures described by Lever et al., 1972, Anal. Biochem. ΑΊ: 273-279; van Tilbeurgh et al., 1982, FEES Letters, 149: 152-156; van
Tilbeurgh and Claeyssens, 1985, FEES Letters, 187: 283-288 and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581. In the present invention, the method of Lever et al. It can be used to estimate cellulose hydrolysis in corn forage, while the methods of van Tilbeurgh et al. and Tomme et al. They can be used to determine cellobiohydrolase activity in a fluorescent disaccharide derivative, 4-methylumbelliferyl-P-D-lactoside.
Beta-glycosidase: The term “beta-glycosidase” means a beta-D-glycoside glycohydrolase (E.C. 3.2.1.21), which catalyzes the hydrolysis of non-reducing reducers of beta-D-glucose with the release of beta-D-glucose. For the purposes of the present invention, betaglycosidase activity is determined according to the basic procedure described by Venturi et al., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var. coprophilum: production, purification and some biochemical properties, J. Basic Microbiol. 42: 55-66. A unit of beta-glucidasidase is defined as 1.0 pmol of p-nitrophenolate anion produced per minute at 25 ° C, pH 4.8 of 1 mM p-nitrophenyl-beta-D-glycopyranoside as the substrate in 50 mM citrate sodium containing 0.01% TWEEN®20.
Polypeptide having cellulolytic enhancing activity: The term "polypeptide having cellulolytic enhancing activity" means a GH61 polypeptide that catalyzes the intensification of the hydrolysis of a cellulosic material by the enzyme having cellulolytic activity. For the purposes of the present invention, cellulolytic enhancing activity is determined by measuring the increase in reducing sugars or the increase in the total cellobiose and glucose of the hydrolysis of a cellulosic material by cellulolytic enzyme under the following conditions: 1 to 50 mg of total protein / g of cellulose in PCS, where the total protein is comprised of 50 to 99.5% w / w of cellulolytic enzyme protein and 0.5 to 50% w / w of protein of a GH61 polypeptide having cellulolytic enhancing activity for 1 to 7 days a
50 ° C compared to a control hydrolysis with equal total protein loading without cellulolytic enhancing activity (1 to 50 mg cellulolytic protein / g cellulose in PCS). In a preferred aspect, a mixture of CELLUCLAST® 1.5L (Novozymes A / S, Bagsvrd, Denmark) in the presence of 2 to 3% by weight of total protein Aspergillus oryzae betaglicosidase (recombinantly produced in Aspergillus oryzae according to WO 02 / 095014) or 2 to 3% by weight of total protein Aspergillus fumigatus beta-glycosidase (recombinantly produced in Aspergillus oryzae as described in WO 2002/095014) cellulase protein loading is used as the source of cellulolytic activity.
GH61 polypeptides having cellulolytic enhancing activity intensifies the hydrolysis of an enzyme-catalyzed cellulosic material having cellulolytic activity by reducing the amount of cellulolytic enzyme required to achieve the same degree of hydrolysis preferably at least 1.01 times, more preferably at least 1.05 times once, more preferably at least 1.10 times, more preferably at least 1.25 times, more preferably at least 1.5 times, more preferably at least 2 times, more preferably at least 3 times, more preferably at least 4 times, more preferably at least 5 times, even more preferably at least 10 times, and more preferably at least 20 times.
Glycoside hydrolase family 10: The term "Glycoside hydrolase family 10" or "GH10 family" or "GH10" means a polypeptide that is in the family of glycoside hydrolase Family 10 according to Henrissat B., 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 280: 309-316, and Henrissat B., and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. J. 316: 695-696.
Glycoside hydrolase family 61: The term "Glycoside hydrolase family 61" or "GH61 family" or "GH61" means a polypeptide that is in the glycoside hydrolase Family 61 according to Henrissat B., 1991, A classification of glycosyl hydrolases based on aminoacid sequence similarities, Biochem. J. 280: 309-316, and Henrissat B., and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. J. 316: 695-696.
Beta-xylosidase: The term “beta-xylosidase” means a betaD-xyloside xylohydrolase (EC 3.2.1.37) that catalyzes the exohydrolysis of beta (4) -xylooligosaccharides, for the removal of successive D-xylose residues from the non-terminals reducers. For the purposes of the present invention, a beta-xylosidase unit is defined as 1.0 pmole of pnitrophenolate anion produced per minute at 40 ° C, pH 5 of 1 mM p-nitrophenyl beta-D-xyloid as the substrate in 100 mM sodium citrate containing 0.01% TWEEN® 20.
Acetylxylan esterase: The term "acetylxylan esterase" means a carboxylesterase (EC 3.1.1.72) that catalyzes the hydrolysis of polymeric xylan acetyl groups, acetylated xylose, acetylated glucose, alpha-naphthyl acetate and p-nitrophenyl acetate. For the purposes of the present invention, acetylxylan esterase activity is determined using 0.5 mM pnitrophenylacetate as the substrate in 50 mM sodium acetate pH 5.0 containing 0.01% TWEEN ™ 20. One unit of acetylxylan esterase is defined as the amount of enzyme capable of releasing 1 pmole of p-nitrophenolate anion per minute at pH 5, 25 ° C.
Feruloyl esterase: The term "feruloyl esterase" means a 4hydroxy-3-methoxy-aminoyl-sugar hydrolase (EC 3.1.1.73) that catalyzes the hydrolysis of the 4-hydroxy-3-methoxy-aminoyl group (feruloyl) of an esterified sugar, which is usually arabinose on “natural” substrates, for the production of ferulate (4-hydroxy-3-methoxycinnamate). Feruloyl esterase is also known as ferulic acid esterase, hydroxycinnamoyl esterase, FAE13
III, cinnamyl ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. For the purposes of the present invention, feruloyl esterase activity is determined using 0.5 mM p-nitrophenylferulate as the substrate in 50 mM sodium acetate pH 5.0. One unit of feruloyl esterase equals the amount of enzyme capable of releasing 1 pmol of p-nitrophenolate anion per minute at pH 5, 25 ° C.
Alpha-glucuronidase: The term "alpha-glucuronidase" means an alpha-D-glycosiduronate glucuronohydrolase (EC 3.2.1.139) that catalyzes the hydrolysis of an alpha-D-glucuranoside to D-glucuronate and an alcohol. For the purposes of the present invention, alpha-glucuronidase activity is determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha-glucuronidase equals the amount of enzyme capable of releasing 1 pmol of glucuronic acid or 4-O-methylglucuronic acid per minute at pH 5, 40 ° C.
Alpha-L-arabinofuranosidase: The term "alpha-Larabinofuranosidase" means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55) that catalyzes the hydrolysis of non-reducing alpha-L-arabinofuranoside residues to alpha-L-arabinosides. The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1,3) and / or (1,5) bonds, arabinoxylans and arabinogalactans. Alpha-Larabinofuranosidase is also known as arabinosidase, alfaarabinosidase, alpha-L-arabinosidase, alpha-arabinofuranosidase, alpha-L-arabinofuranosidase polysaccharide, alpha-L-arabinofuranoside hydrolase, Larabinosidase or alpha-L-arabinanase. For the purposes of the present invention, alpha-L-arabinofuranosidase activity is determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) per ml of 100 mM of sodium acetate pH 5 in a total volume of 200 pl for 30 minutes at 40 ° C followed by the analysis of arabinose by AMINEX® HPX-87H column chromatography (Bio-Rad
Laboratories, Inc., Hercules, CA, USA).
Cellulosic material: The cellulosic material can be any material containing cellulose. The predominant polysaccharide in the primary cell wall of the biomass is cellulose, the second most abundant is hemicellulose and the third is pectin. The secondary cell wall, produced after the cell has stopped developing, also contains polysaccharides and is strengthened by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is an anhydrocelobiose homopolymer and, therefore, a linear beta (1-4) -D-glycan, while hemicelluloses include a variety of compounds, such as xylans, xyloglycans, arabinoxylans and mannans in complex branched structures with a spectrum substituents. Although, in general, polymorphic cellulose is found in plant tissue, primarily as an insoluble crystalline matrix of parallel glycan chains. Hemicelluloses, usually, hydrogen bond to cellulose, as well as other hemicelluloses, which help to stabilize the cell wall matrix.
Cellulose is generally found, for example, in the branches, leaves, bark and ears of plants or leaves, branches and wood of trees. Cellulosic material can be, but is not limited to, herbaceous material, agricultural waste, forest waste, municipal solid waste, waste paper and pulp and paper shredding waste (see, for example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington DC; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25: 695 -719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocelulosics, in Advances in Biochemical Engineering / Biotechnology, T. Scheper, managing editor, Volume 65, pp.2340, Springer-Verlag, New York). It is understood that cellulose may be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose and hemicellulose and a mixed matrix. In a preferred aspect, the cellulosic material is lignocellulose.
In one aspect, the cellulosic material is herbaceous material. In another aspect, the cellulosic material is agricultural waste. In another aspect, the cellulosic material is forest waste. In another aspect, cellulosic material is municipal solid waste. In another aspect, the cellulosic material is waste paper. In another aspect, the cellulosic material is pulp and paper shredding residue.
In another aspect, the cellulosic material is corn forage. In another aspect, the cellulosic material is corn fiber. In another aspect, the cellulosic material is ear of corn. In another aspect, the cellulosic material is orange peel. In another aspect, the cellulosic material is rice straw. In another aspect, the cellulosic material is wheat straw. In another aspect, the cellulosic material is grassy. In another aspect, the cellulosic material is miscanthus. In another aspect, the cellulosic material is bagasse.
In another aspect, the cellulosic material is microcrystalline cellulose. In another aspect, the cellulosic material is bacterial cellulose. In another aspect, the cellulosic material is algae cellulose. In another aspect, the cellulosic material is cotton lint. In another aspect, the cellulosic material is cellulose treated with amorphous phosphoric acid. In another aspect, the cellulosic material is filter paper.
The cellulosic material can be used as is or can be subjected to pretreatment, using conventional methods known in the art, as described here. In a preferred aspect, the cellulosic material is pre-treated.
Pre-treated corn forage: The term "PCS" or "Pre-treated corn forage" means a cellulosic material derived from corn forage by treatment with heat and dilute sulfuric acid.
Xylan-containing material: The term "xylan-containing material" is defined here as any material comprising a plant cell wall polysaccharide containing a chain of beta- (1-4) linked xylose residues. Terrestrial plant xylans are heteropolymers that have a beta- (1-4) -D-xylopyranose backbone, which is branched into short carbohydrate chains. These comprise D-glucuronic acid or its 4O-methyl ether, L-arabinose and / or various oligosaccharides, composed of D-xylose, L-arabinose, D- or L-galactose and D-glucose. Xylan-like polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino) glucuronoxylans, (glucurono) arabinoxylans, arabinoxylans and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Know. 186: 1-67.
In the methods of the present invention, any material containing xylan can be used. In a preferred aspect, the material containing xylan is lignocellulose.
Isolated or Purified: The term "isolated" or "purified" means a polypeptide or polynucleotide that is removed from at least one component with which it is naturally associated. For example, a polypeptide can be at least 1% pure, for example, at least 5% pure, at least 10% pure, at least 20% pure, at least 40% pure, at least 60% pure, at least 80% pure , at least 90% pure or at least 95% pure, as determined by SDS-PAGE and a polynucleotide can be less than 1% pure, for example, at least 5% pure, at least 10% pure, at least 20% pure at least 40% pure, at least 60% pure, at least 80% pure, at least 90% pure or at least 95% pure, as determined by agarose electrophoresis.
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translation modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 20 to 398 of SEQ ID NO: 2 based on the SignalP program (Nielsen et al., 1997, Protein Engineering 10: 1-6) which predicts amino acids 1 to 19 of SEQ ID NO : 2 are a signal peptide. It is known in the art that a host cell can produce a mixture of two of the most different mature polypeptides (i.e., with a different C-terminal and / or N-terminal amino acid) expressed by the same polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide having xylanase activity. In one aspect, the mature polypeptide encoding sequence is nucleotides 58 to 1194 of SEQ ID NO: 1 based on the SignalP program (Nielsen et al., 1997, supra) that predicts nucleotides 1 to 57 of SEQ ID NO: 1 that encode a signal peptide. In another aspect, the sequence encoding mature polypeptide is the genomic DNA sequence of nucleotides 58 to 1194 of SEQ ID NO: 1.
Sequence identity: The relationship between the two amino acid sequences or between the two nucleotide sequences is described by the parameter "sequence identity".
For the purposes of the present invention, the degree of sequence identity between the two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 3.0.0 or later. The optional parameters used are a slot opening penalty of 10, a slot extension penalty of 0.5, and the replacement of the EBLOSUM62 matrix (EMBOSS version of BLOSUM62). The output of the “longest identity” labeled by Needle (obtained using option 18 nobrief) is used as the percentage identity and is calculated as follows:
(Identical residues x 100) / (Alignment length Total crack numbers in alignment)
For the purposes of the present invention, the degree of Sequence Identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL replacement matrix (EMBOSS version of NCBI NUC4.4). The output of the “longest identity” labeled by Needle (obtained using the -nobrief option) is used as the percentage identity and is calculated as follows:
(Identical deoxyribonucleotides x 100) / (Alignment length - Total gap numbers in alignment)
Fragment: The term "Fragment" means a polypeptide having one or more (several) amino acids deleted from the amino and / or carboxyl terminus of a mature polypeptide; where the fragment has xylanase activity. In one aspect, a fragment contains at least 320 amino acid residues, for example, at least 340 amino acid residues or at least 360 amino acid residues.
Subsequence: The term "subsequence" means a polypeptide having one or more (several) deleted nucleotides from the 5 'and / or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having xylanase activity. In one aspect, the subsequence contains at least 960 nucleotides, for example, at least 1020 nucleotides or at least 1080 nucleotides.
Allelic variant: The term "allelic variant" means any one of two or more alternative forms of a gene that occupies the same chromosome site. The allelic variant appears naturally through mutation and can result in polymorphism within populations. Genetic mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides having altered amino acid sequences. An allele variant of a polypeptide is a polypeptide encoded by an allele variant of a gene.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are, in general, determined by an open reading frame, which usually begins with an ATG start codon or alternative start codons such as GTG and TTG and ends with an interrupt codon such as TAA, TAG and TGA. The coding sequence can be a DNA, cDNA, synthetic or recombinant polynucleotide.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription of a mature joined mRNA molecule obtained from a eukaryotic cell. The cDNA loses intron sequences that may be present in the corresponding genomic DNA. Primary RNA transcription is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Nucleic acid construction: The term "nucleic acid construction" means a single or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a way that , otherwise, it must not exist in a natural state or that it is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the amino acid construct contains the control sequences required for the expression of the coding sequence of the present invention.
Control sequences: The term "control sequences" means all components necessary for the expression of a polynucleotide that encodes a polypeptide of the present invention. Each control sequence can be natural or foreign to the polynucleotide encoding the polypeptide or natural or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence and transcription terminator. At a minimum, control sequences include a promoter and transcription and translation interruption signals. Control sequences can be provided with linkers for the purpose of introducing specific restriction sites that facilitate the binding of control sequences to the polynucleotide coding region that encodes a polypeptide.
Operationally linked: The term "operationally linked" means a configuration in which a control sequence is placed in an appropriate position with respect to the coding sequence of a polynucleotide, such as the control sequence directed to the expression of the coding sequence.
Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.
Expression vector The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide that encodes a polypeptide and is operationally linked to additional nucleotides that provide its expression.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction and the like with a nucleic acid construct or expression vector that comprises a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a precursor cell that is not identical to the precursor cell due to mutations that occur during replication.
Variant: The term "variant" means a polypeptide having xylanase activity that comprises a change, that is, a substitution, insertion and / or elimination of one or more (several) amino acid residues in one or more (several) positions. A substitution means a substitution for an amino acid that occupies a position with a different amino acid; an elimination means the removal of an amino acid that occupies a position and an insertion means the addition of one or more (several) amino acids, for example, 1 to 5 amino acids, adjacent to an amino acid that occupies a position.
Detailed Description of the Invention
Polypeptides having xylanase activity
The present invention relates to isolated polypeptides having xylanase activity selected from the group consisting of:
(a) a polypeptide having at least 65% sequence identity to the mature polypeptide of SEQ ID NO: 2;
(b) a polypeptide encoded by a polynucleotide that hybridizes under medium stringency conditions to (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) the genomic DNA sequence encoding the mature polypeptide of SEQ ID NO: 1 or (iii) the full length complementary filament of (i) or (ii);
(c) a polypeptide encoded by a polynucleotide having at least 65% sequence identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence thereof;
(d) a variant comprising a substitution, deletion and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2 and (e) a fragment of a polypeptide from (a), (b), (c) or (d) that has xylanase activity.
The present invention relates to isolated polypeptides having a sequence activity to the mature polypeptide of SEQ ID NO: 2 of at least 65%, for example, at least 70%, at least 75%, at least 80%, at least 85% at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%, which have xylanase activity. In one respect, polypeptides differ by no more than ten amino acids, for example, by five amino acids, by four amino acids, by three amino acids, by two amino acids, and by one amino acid of the mature polypeptide of SEQ ID NO: 2.
A polypeptide of the present invention preferably comprises or consists of an amino acid sequence of SEQ ID NO: 2 or an allelic variant thereof or is a fragment thereof having xylanase activity. In another aspect, the polypeptide comprises or consists of the mature polypeptide of SEQ ID NO: 2. In a preferred aspect, the polypeptide comprises or consists of amino acids 20 to 398 of SEQ ID NO: 2.
The present invention also concerns isolated polypeptides having xylanase activity that are encoded by polynucleotides that hybridize under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions or conditions very high stringency with (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) the genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) the complementary length strand total of (i) or (ii) (J. Sambrook, EF Fritsch and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2nd editions, Cold Spring Harbor, New York).
The polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO: 2 or a fragment thereof, can be used to design nucleic acid probes to identify and clone DNA encoding polypeptides having activity of xylanase of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic DNA or cDNA of the genus or species of interest, following standard Southem blotting procedures, in order to identify and isolate their corresponding gene. Such probes can be considerably shorter than the total sequence, but must be at least 14, for example, at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, for example, at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled to detect the corresponding gene (for example, with ³² P, 3H, 35S, biotin or avidin). Such probes are covered by the present invention.
A DNA or cDNA library prepared from such other strains can be evaluated for DNA that hybridizes to the probes described above and encodes a polypeptide having xylanase activity. Genomic DNA or other such strains can be separated by agarose or polyacrylamide gel electrophoresis or other separation techniques. The DNA from the libraries or the separated DNA can be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that is homologous to SEQ ID NO: 1 or a subsequence thereof, the carrier material is preferably used in a Southem blot.
For the purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to SEQ ID NO: 1; the sequence encoding mature polypeptide of SEQ ID NO: 1; the genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1; its complementary full-length filament or a subsequence thereof; under very low to very high stringency conditions. Molecules whose nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film.
In one aspect, the nucleic acid probe is the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence thereof. In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2 or the mature polypeptide thereof or a fragment thereof. In a preferred aspect, the nucleic acid probe is SEQ ID NO: 1 or a genomic DNA sequence therefrom. In another aspect, the nucleic acid probe is the polynucleotide contained in plasmid pTF12Xyll70 which is contained in E. coli NRRL B-50309, where the polynucleotide encodes a polypeptide having xylanase activity. In another aspect, the nucleic acid probe is the region encoding mature polypeptide contained in plasmid pTF12Xyll70 that is contained in E. coli NRRL B-50309.
For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 micrograms / ml sperm DNA of divided and denatured salmon, and 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies or 50% formamide for very high and wing stringencies, following standard Southem blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45 ° C (very low stringency), 50 ° C (low stringency), up to 55 ° C (medium stringency) ), at 60 ° C (medium-high stringency), 65 ° C (high stringency), and 70 ° C (very high stringency).
For short probes of about 15 nucleotides to about 70 nucleotides in length, stringent conditions are defined as prehybridization and hybridization at about 5 ^o C to about 10 ° C below the calculated Tm using the calculation according to with Bolton and McCarthy (1962, Proc. Natl. Acad. Sci. USA 48: 1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% of NP-40, IX Denhardt's solution, 1 mM of pyrous sodium phosphate, 1 mM of monobasic sodium phosphate, 0.1 mM of ATP and 0.2 mg of yeast RNA per ml of standard Southem blotting procedures for 12 to 24 hours optimally. The carrier material is finally washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC of 5 ^o C to 10 ° C below the calculated Tm.
The present invention also relates to isolated polypeptides having xylanase activity encoded by polynucleotides having sequence activity to the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence thereof of at least 65%, for example, by at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least least 96%, at least 97%, at least 98%, at least 99% or 100%.
The present invention also relates to variants that comprise a substitution, deletion and / or insertion of one or more (or more) amino acids of the mature polypeptide of SEQ ID NO: 2 or a homologous sequence thereof. Preferably, the amino acid changes are of a minor nature, i.e. conservative amino acid substitutions or insertions that do not significantly affect protein fold and / or activity; small deletions, typically from one to about 30 amino acids; small amino or carboxyl terminal extensions, such as an amino terminal methionine residue; a small binding peptide of up to about 20 to 25 residues or a small extension that facilitates purification by changing the net charge or other function, such as a polyhistidine tract, an antigenic epitope or a binding domain.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that generally do not alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring changes Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, LeuNal, Ala / Glu and Asp / Gly.
Alternatively, the amino acid changes are of such a nature that the physical and chemical properties of the polypeptides are altered. For example, amino acid changes can improve the thermal stability of the polypeptide, change the substrate specificity, change the optimum pH and others.
The essential amino acids in a precursor polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scan mutagenesis (Cunningham and Wells, 1989, Science 244: 10811085). In the latter technique, simple alanine mutations are introduced into each residue in the molecule and the resulting mutant molecules are tested for xylanase activity to identify amino acid residues that are critical to the molecule's activity. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of the structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photo-affinity labeling, in conjunction with the contact site amino acid mutation putative. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identities of essential amino acids can also be inferred from identity analyzes with polypeptides that are related to the precursor polypeptide.
Single or multiple substitutions, deletions and / or insertions can be made and tested using known methods of mutagenesis, recombination and / or mixing, followed by a relevant evaluation procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988 , Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Know. USA 86: 2152-2156; WO 95/17413 or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (eg, Lowman et al., 1991, Biochemistry 30: 10832-10837; US Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).
Mutagenesis / mixing methods are also combined with automated high-throughput screening methods to detect the activity of cloned mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology Ί: 893-896). DNA molecules encoding active polypeptides can be recovered from host cells and quickly sequenced using standard methods in the art. These methods allow rapid determination of the importance of individual amino acid residues in a polypeptide.
The total number of amino acid substitutions, deletions and / or insertions of the mature polypeptide of SEQ ID NO: 2 is not greater than 10, for example 1, 2, 3, 4, 5, 6, 7, 8 or 9.
The polypeptide can be a hybrid polypeptide in which a portion of a polypeptide is fused at the N-terminus or the C-terminus of a portion of another polypeptide.
The polypeptide can be a fused polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention. A fused polypeptide is produced by fusing a polynucleotide that encodes another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art and include linking a coding sequence that encodes the polypeptides so that they are in structure and that the expression of the fused polypeptide is under the same promoters and terminators. Fusion proteins can also be built using intein technology in which fusions are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
A fusion polypeptide can still comprise a cleavage site between the two polypeptides. In the secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503 and Contreras et al., 1991, Biotechnology 9: 378-381; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240248 and Stevens, 2003, Drug Discovery World 4: 35-48.
Polypeptide Sources having Xylanase Activity
A polypeptide having xylanase activity of the present invention can be obtained from microorganisms of any gender. For the purposes of the present invention, the term "obtained from" as used here in connection with the given source must mean that the polypeptide encoded by a polynucleotide is produced by the source or by a strain into which the polynucleotide from the source has been inserted. In one aspect, the polypeptide obtained from a given source is secreted extracellularly.
The polypeptide can be a bacterial polypeptide. For example, the polypeptide can be a gram positive bacterial polypeptide such as a Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus or Streptomyces polypeptide having a xylanase or bacterial polypeptide activity polypeptide from Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neis seria, Pseudomonas, Salmonella or Ureaplasmum.
In one aspect, the polypeptide is a polypeptide from Bacillus alkalophilus, Bacillus amiloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megillum, Bacillus megillum, Bacillus licheniformis, Bacillus megillateris
Bacillus stearothermophilus, Bacillus subtilis or Bacillus thuringiensis.
In another aspect, the polypeptide is a polypeptide from Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis or Streptococcus equi subsp. Zooepidemicus.
In another aspect, the polypeptide is a Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus or Streptomyces lividans.
The polypeptide can also be a fungal polypeptide. For example, the polypeptide can be a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowium polypeptide or a filamentous fungal polypeptide such as an Acremonium, Agaricus, Botany, Aspergus, Amalia, Botany, Aureus, Botany, Aureus, Botany, Aureus Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryptococcus, Diplodia, Exidia, Filibasidium, Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinor, Magnetic, Leptor, Molecular, Leptospor Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Pseudoplectania,
Pseudotrichonympha, Rhizomucor, Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella or Xilarium.
In another aspect, the polypeptide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis polypeptide.
In another aspect, the polypeptide is a polypeptide from Acremonium celulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus,
Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium pannicola, Chrysosporium queenslandum Fusarium, Fusarium, terrarium, Fusarium, terrarium, Fusarium, terrarium, Fusarium , Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenaturn, Humicola grisex, Humicola insis, Humicola, miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium funiculosum, Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimpori, Thielavia microspor lavia ovispora, Thielavia peruviana, Thielavia setosa, Thielavia spededonium, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianurn, Trichoderma koningii, Trichoderma Iongibrachiatum, Trichoderma reesei or Trichoderma vir ide.
In another aspect, the polypeptide is a polypeptide from Trichophaea saccatum having xylanase activity. In another aspect, the polypeptide is a Trichophaea saccata CBS 804.70 polypeptide having xylanase activity, for example, the polypeptide comprising the mature polypeptide of SEQ ID NO: 2.
It will be understood that for the species already mentioned the invention covers both perfect and imperfect states and other taxonomic equivalents, for example, anamorphic, with respect to the species name for which they are known. Those skilled in the art will easily recognize the identity of appropriate equivalents.
Strains of these species are easily accessible to the public in several culture collections, such as American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ), Centraalbureau Voor Schimmelcultures (CBS) and Agricultural Research Service Patent Culture Collection, Northem Regional Research Center (NRRL).
The polypeptide can be identified and obtained from other sources including microorganisms isolated from nature (for example, soil, compounds, water, etc.) using the probes mentioned above. Techniques for isolating microorganisms from natural habitats are well known in the art. The polynucleotide encoding the polypeptide can then be obtained by similarly evaluating a DNA library or cDNA from another microorganism or mixed DNA sample. Once a polynucleotide encoding a polypeptide has been detected with the probes, the polynucleotide can be isolated or cloned using techniques that are well known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989, supra).
Polynucleotides
The present invention also relates to isolated polynucleotides that encode a polypeptide of the present invention.
Techniques used to isolate or clone a polynucleotide that encodes a polypeptide are known in the art and include isolation of genomic DNA, cDNA preparation or a combination of these. Cloning of polynucleotides from such genomic DNA can be performed, for example, using the well-known polymerase chain reaction (PCR) or antibody evaluation of expression libraries for the detection of cloned DNA fragments with structural characteristics shared. See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures, such as a ligase chain reaction (LCR), ligation-activated transcription (LAT) and polynucleotide-based amplification (NASBA) can be used. Polynucleotides can be cloned from a strain of Trichophaea or a related organism, and thus, for example, it can be an allelic or species variant of the polypeptide encoding the polynucleotide region.
The present invention also relates to isolated polynucleotides that comprise or consist of polynucleotides having a degree of sequence identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence of at least 65%, for example, by at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least at least 96%, at least 97%, at least 98%, at least 99% or 100%, which encodes a polypeptide having xylanase activity.
Modification of a polynucleotide encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some way designed from the polypeptide isolated from its natural source, for example, variants that differ in specific activity, thermostability, optimal pH or the like. The variant can be constructed on the basis of the polynucleotide presented as the sequence encoding mature polypeptide of SEQ ID NO: 1 or a genomic DNA sequence thereof, for example, the subsequence of this and / or by introducing nucleotide substitutions that do not result in a change in the amino acid sequence of the polypeptide, but which corresponds to the use of the codon of the intended host organism for the production of the enzyme or by the introduction of nucleotide substitutions that may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.
The present invention also relates to isolated polynucleotides that encode polypeptides of the present invention, which hybridize under very low stringency conditions, low stringency conditions, medium stringency conditions, medium-high stringency conditions, high stringency conditions or stringency conditions very high with (i) the mature polypeptide encoding sequence of SEQ ID NO: 1, (ii) or the genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) the full length complementary strand of (i) or (ii) or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein.
In one aspect, the polynucleotide comprises or consists of SEQ ID NO: 1, the sequence encoding mature polypeptide of SEQ ID NO: 1, or the sequence contained in plasmid pTF12Xyll70 that is contained in E. coli NRRL B-50309 or a sub- sequence of SEQ ID NO: 1 encoding a fragment of SEQ ID NO: 2 having xylanase activity, such as nucleotide polynucleotide 58 to 1194 of SEQ ID NO: 1.
Nucleic acid constructions
The present invention also relates to nucleic acid constructs that comprise a polynucleotide of the present invention operably linked to one or more (several) control sequences that direct expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences .
A polynucleotide can be manipulated in a variety of ways to provide polypeptide expression. The manipulation of the polynucleotide before insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.
The control sequence can be a promoter sequence, a polynucleotide that is recognized by a host cell for the expression of a polynucleotide that encodes a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences that mediate polypeptide expression. The promoter can be any polynucleotide that exhibits transcription activity in the host cell of choice including mutant, truncated and hybrid promoters and can be obtained from genes encoding homologous or heterologous extracellular or intracellular polypeptides to the host cell.
Examples of suitable promoters to target the transcription of the nucleic acid constructs of the present invention in a bacterial host cell are the promoters obtained from the Bacillus amiloliquefaciens alpha amylase gene (amyQ), Bacillus licheniformis alpha amylase (amyL) gene, gene Bacillus licheniformis penicillinase (penP), Bacillus stearothermophilus (amyM) maltogenic amylase gene, Bacillus subtilis levansucrase (sacB) gene, Bacillus subtilis xilA and xilB genes, E. coli operon lac, agarase gene de agyrase (dagA) and prokaryotic beta-lactamase gene (Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proc Natl. Acad. Sci. USA 80: 21-25). Additional promoters are described in "Useful proteins from recombinant bacteria" in Gilbert et al., 1980, Scientific American, 242: 74-94 and in Sambrook et al., 1989, supra.
Examples of suitable promoters to target the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, neutral alpha-amylase from Aspergillus niger, alpha-amylase stable in acid Aspergillus niger, glycoamylase from Aspergillus niger or Aspergillus awamori (glaA), TAKA amylase from Aspergillus oryzae, alkaline protease from Aspergillus oryzae, triose phosphate isomerase from Aspergillus oryzae, Fusarium oxyporosiline (Fusarium oxyporosine7) similar to 96% WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reiosi cellobiohydrolase I, Trichoderma reiosi , Trichoderma reesei endoglycanase I, Trichoderma reesei endoglycanase II, Trichoderma reesei endo glycanase III, Trichoderma reesei endoglycanase IV, Trichoderma reesei endoglycanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a promoter modified from a gene that is modified from an alpha gene -aspergilli-neutral amylase in which the untranslated leader was replaced by an untranslated leader of a gene encoding triose phosphate isomerase in Aspergilli; non-limiting examples include modified promoters of the gene encoding neutral alpha-amylase in Aspergillus niger where the untranslated leader has been replaced by an untranslated leader of the gene encoding triose phosphate isomerase in Aspergillus nidulans or Aspergillus oryzae and mutant, runcado and mutant promoters hybrids of these.
In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactocinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADHI, ADH2) cerevisiae triose phosphate isomerase (TP1), Saccharomyces cerevisiae metallothionein (CUP1) and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423488.
The control sequence can also be a suitable transcription terminator sequence, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3 'terminal of the polynucleotide that encodes the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present invention.
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glycoamylase, Aspergillus niger alpha-glycosidase, Aspergillus oryzae TAKA amylase and Fusarium oxysporum protease similar to trypsin.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1) and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence can also be a suitable reader sequence, when transcribed into an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5 'end of the polynucleotide that encodes the polypeptide. Any leader sequence that is functional in the host cell of choice can be used.
The preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
The leaders suitable for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alfa-factor and Saccharomyces cerevisiae alcohol dehydrogenaselgliceraldehyde-3 phosphate dehydrogenaseGehydrate (3)
The control sequence can also be a polyadenylation sequence, a sequence operably linked to the 3 'terminal of the polynucleotide and when transcribed, is recognized by the host cell as a signal to add the polyadenosine residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell of choice can be used.
The preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glycoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum protease similar to trypsin and Aspergillus niger alpha-glucosidase.
Polyadenylation sequences useful for yeast host cells are described by Guo and Sherman, 1995, Mol. Celular Biol. 15: 5983-5990.
The control sequence can also be a signal peptide coding region that encodes a signal peptide attached to the N-terminus of a polypeptide and directs the polypeptide in the cell's secretory path. The 5 'end of the polynucleotide coding sequence can inherently contain a naturally occurring signal peptide coding sequence in the translation reading frame with the segment of the coding sequence encoding the polypeptide. Alternatively, the 5 'end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. The foreign signal peptide coding sequence may be required when it does not naturally contain a signal peptide coding sequence. Alternatively, the foreign signal peptide coding sequence can simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the polypeptide expressed in the secretory path of a host cell of choice can be used.
The effective signal peptide coding sequences for bacterial host cells are the signal peptide coding sequences obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisina, Bacillus licheniformis betalactamase, Bacillus stearothermophilus alfa-amilase, Bacillus stearothermophilus, neutralis nprS, nprM) and Bacillus subtilis prsA. Additional signaling peptides are described by Simonen and Paiva, 1993, Microbiological Reviews 57: 109-137.
The effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for neutral Aspergillus niger amylase, Aspergillus niger glycoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endogensosa lipase and Rhizomucor miehei aspartic proteinase.
Signal peptides useful for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alfa-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.
The control sequence can also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide. The resulting polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolipeptide, in general, inactive and can be converted to an active polypeptide by catalytic or auto-catalytic cleavage of the propolipeptide propeptide. The propeptide coding sequence can be obtained from the genes for Bacillus subtilis protease alkaline (aprE), Bacillus subtilis protease neutral (nprT), Myceliophthora thermophila lacase (WO 95/33836), Rhizomucor miehei aspartic proteinase and Saccharomyces cerevisiae alfafatore alfafatore alfafatore.
When both the signal peptide and the sequence of propeptides are present at the N-terminus of a polypeptide, the pro-peptide sequence is positioned close to the N-terminus of a polypeptide and the signal peptide sequence is positioned close to the N-terminus of the sequence of pro-peptide.
It may also be desirable to add regulatory sequences that allow regulation of polypeptide expression with respect to host cell development. Examples of regulatory systems are those that cause gene expression to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include lac, tac and trp operator systems. In yeast, the ADH2 system or GAL1 system can be used. In filamentous fungi, the Aspergillus niger glycoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter and Aspergillus oryzae glycoamylase promoter can be used. Other examples of regulatory sequences are those that allow genetic amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide must be operationally linked with the regulatory sequence. Expression Vectors
The present invention also relates to recombinant expression vectors that comprise a polynucleotide of the present invention, a promoter and transcription and translation interruption signals.
The various nucleotide and control sequences can be joined to produce a recombinant expression vector that can include one or more (several) convenient restriction sites to allow insertion or replacement of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct that comprises the sequence into an appropriate vector for expression. In the creation of the expression vector, the coding sequence is located in the vector so that the coding sequence is operationally linked with the appropriate control sequences for the expression.
The recombinant expression vector can be any vector (for example, a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can perform polynucleotide expression. The choice of the vector will typically depend on the vector's compatibility with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.
The vector can be an autonomously replicating vector, that is, a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means to guarantee self-replication. Alternatively, the vector can be one that, when introduced into the host cell, is integrated into the genome and replicated along with the chromosomes into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the host cell genome or a transposon can be used.
The vector preferably contains one or more (several) selectable markers that allow easy selection of transformed, transfected, transduced or similar cells. A selectable marker is a product gene that provides resistance to biocide or viral, resistance to heavy metals, prototrophy to auxotrophs and others.
Examples of selectable bacterial markers are the Bacillus subtilis or Bacillus licheniformis dal genes or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3. Selectable markers for use in a filamentous fungal cell include, but are not limited to, amdS (acetamidase), argB (omitin carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (adenyltransferase sulfate) and trpC (anthranilate synthase), as well as their equivalents. The amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus are preferred for use in an Aspergillus cell.
The vector preferably contains an element that allows integration of the vector into the host cell's genome or autonomous replication in the genome-independent cell.
For integration into the host cell genome, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides to direct integration by homologous recombination into the host cell genome at a similar location on the chromosomes. To increase the likelihood of integration at a precise location, the integrational elements must contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding allo sequence to enhance the likelihood of homologous recombination. The integrational elements can be any sequence that is homologous to the target sequence in the host cell genome. In addition, the integrational elements can be non-coding or coding nucleotides. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.
For autonomous replication, the vector can still comprise a source of replication that allows the vector to replicate autonomously in the host cell in question. The origin of replication can be any replicator plasmid that mediates autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that allows the plasmid or vector to replicate in vivo.
Examples of bacterial origins of replication are in the origins of replication of plasmids pBR322, pUC19, pACYC177 and pACYC184 that allow replication in E. coli and pUBllO, pE194, pTAlOoO and pAMRl that allow replication in Bacillus.
Examples of origins of replication for use in a yeast host cell are the origin of 2 microns of replication, ARS1, ARS4, the combination of ARS1 and CEN3 and the combination of ARS4 and CEN6.
Examples of useful origins of replication in a filamentous fungal cell are AMAI and ANSI (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00 / 24883). Isolation of the AMAI gene and construction of plasmids or vectors comprising the gene can be performed according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention can be inserted into a host cell to increase production of a polypeptide. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including a selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene and thereby additional copies of the polynucleotide, can be selected by culturing the cells in the presence of the appropriate selectable agent.
The procedures used for ligating the elements described above for the construction of the recombinant expression vectors of the present invention are well known to a person skilled in the art (see, for example, Sambrook et al., 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, which comprise a polynucleotide of the present invention operably linked to one or more (several) control sequences that direct the production of a polypeptide of the present invention. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integral or as a self-replicating extrachromosomal vector as described above. The term "host cell" encompasses any progeny of a precursor cell that is not identical to the precursor cell due to mutations that occur during replication. The choice of a host cell will depend, to some extent, on the gene encoding the polypeptide and its source.
The host cell can be any cell in the recombinant production of a polypeptide of the present invention, for example, a prokaryote or a eukaryote.
The prokaryotic host cell can be any gram-positive or gram-negative bacteria. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus,
Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, E. coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella and Ureaplasma.
The bacterial host cell can be any Bacillus cell including, but not limited to, Bacillus alkalophilus cells, Bacillus amiloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus lichenormorm megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis cells.
The bacterial host cell can also be any Streptococcus cell including, but not limited to, Streptococcus equisimilis cells, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subsp. Zooepidemicus.
The bacterial host cell can also be any Streptomyces cell including, but not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus and Streptomyces lividans cells.
The introduction of DNA into a Bacillus cell can, for example, be effected by the transformation of protoplasts (see, for example, Chang and Cohen, 1979, Mol. Gen. Genet. 168: 111-115), by the use of competent cells ( see, for example, Young and Spizizen, 1961, J. Bacteriol. 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, J. Mol. Biol. 56: 209-221), by electroporation (see, for example , Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, for example, Koehler and Thome, 1987, J. Bacteriol. 169: 5271-5278). The introduction of DNA into an E. coli cell can, for example, be effected by the transformation of protoplasts (see, for example, Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, for example , Dower et al., 1988, Nucleic Acids Res. 16:
6127-6145). The introduction of DNA into a Streptomyces cell can, for example, be effected by the transformation of protoplasts and electroporation (see, for example, Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), by conjugation ( see, for example, Mazodier et al., 1989, J. Bacteriol. 171: 35833585), or by transduction (see, for example, Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289- 6294). The introduction of DNA into a Pseudomonas cell can, for example, be carried out by electroporation (see, for example, Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or by conjugation (see, for example, Pinedo and Smets, 2005, Appl. Environ, Microbiol. 71: 51-57). The introduction of DNA into a Streptococcus cell can, for example, be carried out by natural competence (see, for example, Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), by the transformation of protoplasts (see, for example , Catt and Jollick, 1991, Microbios 68: 189-207), by electroporation (see, for example, Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804) or by conjugation (see, for example , Clewell, 1981, Microbiol. Rev. 45: 409-436). However, any method known in the art for introducing DNA into a host cell can be used.
The host cell can also be a eukaryote, such as a mammalian, insect, plant or fungal cell.
The host cell can be a fungal cell. The "fungi" as used in this include the phyla Ascomycota, Basidiomycota, Chytridiomycota and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB Intemational, University Press, Cambridge, UK ) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
The fungal host cell can be a yeast cell. The "yeast" as used in this includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast and yeast that belongs to the Imperfecti fungi (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, SM and Davenport, RR eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
The yeast host cell can be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticces, Saccharomyces, Sacromromyces, Sacred , or Yarrowia lipolytica.
The fungal host cell can be a filamentous fungal cell. "filamentous fungi" include all filamentous forms in the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are generally characterized by a mycelial wall compound of chitin, cellulose, glycan, chitosan, mannan and other polysaccharides in the complex. Vegetative development is by Hyphal elongation and carbon catabolism is mandatory aerobic. In contrast, yeast vegetative development such as Saccharomyces cerevisiae is by budding from a single-celled stem and carbon catabolism can be fermentative.
The filamentous fungal host cell can be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocalla, Neocallima, Neocallima, Neocallima , Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma.
For example, the filamentous fiingic host cell may be an Aspergillus awamori cell, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporio, Ceriporisiopisisorio, Cerio , Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicumuser, Fusarium, cinnamon, Chrysosporium, Chrysosporium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulaturn, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum , Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogemim, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryichichis, Trichoderma, Thuringia, Thuringia Iongibrachiatum, Trichoderma reesei, or Trichoderma viride.
Fungal cells can be transformed by a process that involves the formation of protoplasts, transformation of protoplasts and regeneration of the cell wall in a manner known to itself. The suitable procedure for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Know. USA 81: 1470-1474 and Christensen et al., 1988, Bio / Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147
156 and WO 96/00787. Yeast can be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I. editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163 and Hinnen et al., 1978, Proc. Natl. Acad. Know. USA 75: 1920.
Production methods
The present invention also relates to methods of producing a polypeptide of the present invention, which comprises: (a) cultivating a cell, which in its wild type produces the polypeptide, under conditions conducive to the production of the polypeptide and (b) recovery of the polypeptide. In a preferred aspect, the cell is of the Trichophaea genus. In a more preferred aspect, the cell is Trichophaea saccata. In a more preferred aspect, the cell is Trichophaea saccata CBS 804.70.
The present invention also relates to methods of producing a polypeptide of the present invention, which comprises: (a) growing a recombinant host cell of the present invention under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide.
Host cells are grown in a nutrient medium suitable for the production of the polypeptide using methods well known in the art. For example, the cell can be grown by cultivating a small-scale and large-scale shake and fermentation flask (including solid-state, batch-fed, batch or continuous fermentations) in industrial fermenters or laboratories performed in a suitable medium and under conditions that allow the polypeptide to be expressed and / or isolated. Cultivation takes place in a suitable nutrient medium that comprises sources of carbon and nitrogen and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or can be prepared according to published compositions (for example, in American Type Culture Collection catalogs). If the polypeptide is secreted into the nutrient medium, the polypeptide can be directly recovered from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
The polypeptide can be detected using methods known in the art that are specific to the polypeptides. These detection methods can include the use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the polypeptide.
The polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration extraction, spray drying evaporation, or precipitation.
The polypeptide can be purified by a variety of procedures known in the art including, but not limited to, chromatography (eg, ion exchange, affinity, hydrophobic, chromatofocusing and size exclusion) electrophoretic procedures (eg, preparative isoelectric focusing), differential solubility (for example, ammonium sulfate precipitation), SDSPAGE, or extraction (see, for example, Protein Purification, J.-C. Janson and Lars Ryden editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides .
In an alternative aspect, the polypeptide is not recovered, but rather than the host cell of the present invention that expresses the polypeptide is used as a source of the polypeptide.
Plants
The present invention also relates to plants, for example, a transgenic plant, plant part, or plant cell, which comprises a polynucleotide isolated from the present invention in this way to express and produce the polypeptide in recoverable amounts. The polypeptide can be recovered from the plant or plant part. Alternatively, the plant or plant part containing the polypeptide can be used as such to improve the quality of a food or feed, for example, to improve nutritional value, palatability and rheological properties, or to destroy an anti-nutritive factor.
The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Festuca, Lolium, temperate grass, such as Agrostis and cereals, for example, wheat, oats, rye, barley, rice, sorghum and corn.
Examples of dicot plants are tobacco, vegetables, such as lupins, potatoes, beets, peas, beans and soybeans and cruciferous plants (Brassicaceae family), such as cauliflower, rapeseed and closely related model organism Arabidopsis thaliana.
Examples of plant parts are stalk, callus, leaves, roots, fruits, seeds and tubers as well as the individual tissues comprising these parts, for example, epidermis, mesophyll, parenchyma, vascular tissues, meristems. Specific plant cell compartments, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. In addition, any plant cell, whatever the origin of the tissue, is considered to be a plant part. Otherwise, plant parts such as specific tissues and cells isolated to facilitate the use of the invention are also considered plant parts, for example, embryo endosperm, aleurone and seed coatings.
Also included within the scope of the present invention are the progeny of such plants, plant parts and plant cells.
The transgenic plant or plant cell that expresses a polypeptide can be constructed according to methods known in the art. In summary, the plant or plant cell is constructed by incorporating one or more (diverse) expression constructs that encode a polypeptide in the plant host genome or protoplasm genome and propagation of the resulting modified plant or plant cell into a transgenic plant or cell of plant.
The expression construct is conveniently a nucleic acid construct that comprises a polynucleotide that encodes a polypeptide operably linked with appropriate regulatory sequences required by the expression of the polynucleotide in a plant or plant part of choice. In addition, the expression construct may comprise a selectable marker useful for the identification of host cells into which an expression construct has been integrated and DNA sequences necessary for the introduction of the construct into a plant in question (the latter depends on the method of introduction of DNA to be used).
The choice of regulatory sequences, such as terminator and promoter sequences and optionally transit or signal sequences, is determined, for example, on the basis of when, where and how the polypeptide is desired to be expressed. For example, the expression of the gene encoding a polypeptide can be constitutive or inducible, or a specific stage or tissue can be developed and the gene product can be targeted to a specific tissue or plant part such as seeds or leaves. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
For constitutive expression, 35S-Ca MV, corn ubiquitin 1 and rice actin promoter 1 can be used (Franck et al., 1980, Cell 21: 285-294; Christensen et al., 1992, Plant Mol. Biol. 18: 675-689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters can be, for example, the promoter from storage sink tissues such as seeds, potato tubers and fruits (Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from metabolic sink tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863878), a specific seed promoter such as glutelin, prolamine, globulin, or albumin promoter from rice ( Wu et al., 1998, Plant Cell Physiol. 39: 885-889), a Vicia faba promoter from the B4 legumin and unknown Vicia faba seed protein gene (Conrad et al., 1998, J. Plant Physiol. 152: 708-711), a promoter from a seed oil body protein (Chen et al., 1998, Plant Cell Physiol. 39: 935-941), the napA promoter of Brassica napus storage protein, or any other seed-specific promoter known in the art, for example, as described in WO 91/14772. In addition, the promoter may be a leaf-specific promoter such as the rbcs promoter from rice or tomato (Kyozuka et al., 1993, Plant Physiol. 102: 991-1000), the promoter of the adenine methyltransferase gene from chlorella virus (Mitra and Higgins, 1994, Plant Mol. Biol. 26 '. 85-93), the promoter of the aldP gene from rice (Kagaya et al., 1995, Mol. Gen. Genet. 248: 668-674 ), or a wound-inducible promoter such as the pin2 potato promoter (Xu et al., 1993, Plant Mol. Biol. 22: 573-588). Otherwise, the promoter can be induced by abiotic treatments such as temperature, dryness or alternatively in salinity or induced by exogenously applied substances that activate the promoter, for example, ethanol, estrogens, plant hormones such as ethylene, abscisic acid and gibberellic acid and heavy metals.
A promoter enhancing element can also be used to achieve the highest expression of a polypeptide in the plant. For example, the promoter enhancing element may be an intron that is placed between the promoter and the polynucleotide that encodes a polypeptide. For example, Xu et al., 1993, supra, discloses the use of the first intron of the rice actin gene 1 to enhance expression.
The selectable marker gene and any other part of the expression construct can be chosen from that available in the art.
The nucleic acid construct is incorporated into the plant genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biological transformation and electroporation (Gasser et al., 1990, Science 244 : 1293; Potrykus, 1990, Bio / Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
Soon, gene transfer mediated by Agrobacterium tumefaciens is the method of choice for the generation of transgenic dicots (for a summary, see Hooykas and Schilperoort, 1992, Plant Mol. Biol. 19: 15-38) and can also be used to the transformation of monocots, although other methods of transformation are often used from these plants. Soon, the method of choice for the generation of transgenic monocots is the particle bombardment (particles of tungsten or microscopic gold coated with transformation DNA) from embryonic callus or developmental embryos (Christou, 1992, Plant J. 2: 275 -281; Shimamoto, 1994, Curr. Opin. Biotechnol. 5: 158-162; Vasil et al., 1992, Bio / Technology 10: 667-674). An alternative method for transforming monocots is based on transfoplating protoplasts as described by Omirulleh et al., 1993, Plant Mol. Biol. 21: 415-428. Additional transformation methods for use in accordance with the present disclosure include those described in U.S. Patent NO. 6,395,966 and 7,151,204 (both of which are incorporated by reference in their entirety).
Following the transformation, the transformants having incorporated the expression construct are selected and regenerated in total plants according to methods well known in the art. Often the transformation procedure is indicated by the selective elimination of the selection genes during regeneration or in the following generations by use, for example, co-transformation with two separate T-DNA constructs or site-specific excision of the selection gene by the specific recombinase .
In addition to the direct transformation of a particular plant genotype with a construction prepared in accordance with the present invention, transgenic plants can be made by crossing one plant having the construction to a second plant required for construction. For example, a construct that encodes a polypeptide can be introduced into a particular plant variety by crosslinking, if necessary still directly transforming a plant of that given variety. Therefore, the present invention does not only cover a plant directly regenerated from the cells that have been transformed in accordance with the present invention, but also the progeny of such plants. As used herein, the progeny can refer to the progeny of any generation of a precursor plant prepared in accordance with the present invention. Such a progeny can include a DNA construct prepared in accordance with the present invention, or a portion of a DNA construct prepared in accordance with the present invention. The results of crossing a transgene introduction into a plant line by cross-pollination at a starting line with a donor plant line. Non-limiting examples of such steps are still articulated in U. S. Patent No. 7,151,204.
Plants can be generated through a rear cross conversion process. For example, plants include plants referred to as a cross-converted, line, innate or hybrid genotype.
Genetic markers can be used to assist in the introgression of one or more transgenes of the invention from one genetic foundation to another. Marker assisted selection offers advantages over conventional breeding in that it can be used to avoid errors caused by phenotypic variations. In addition, genetic markers can provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait that would otherwise have a non-agronomically desired genetic foundation is crossed into an elite precursor, genetic markers can be used to select the progeny that not only have the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to subject introgression to one or more traits on a particular genetic basis is minimized.
The present invention also relates to methods of producing a polypeptide of the present invention comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide that encodes the polypeptide under conditions conducive to the production of the polypeptide and (b) polypeptide recovery.
Removal or reduction of xylanase activity
The present invention also concerns methods of producing a precursor cell mutant, which comprises interrupting or eliminating a polynucleotide or a portion thereof, which encodes a polypeptide of the present invention, which results in the mutant cell producing less of the polypeptide than the cell precursor when grown under the same conditions.
The mutant cell can be constructed by reducing or eliminating polynucleotide expression using methods well known in the art, for example, insertions, disruptions, substitutions or deletions. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated can be, for example, the coding region or a part of it essential for the activity, or a regulatory element required by the expression of the coding region. An example of such a control or regulatory sequence may be a promoter sequence or a functional part thereof, that is, a part that is sufficient to affect the expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, pro-peptide sequence, signal peptide sequence, transcription terminator and transcriptional activator.
Modification or inactivation of the polynucleotide can be accomplished by subjecting the precursor cell to mutagenesis and selection for mutant cells in which the expression of the polynucleotide has been reduced or eliminated. Mutagenesis, which can be specific or random, can be performed, for example, by using a suitable chemical or physical mutagenesis agent, by using a suitable oligonucleotide, or by subjecting the DNA Sequence to generated mutagenesis. In addition, mutagenesis can be performed using any combination of the mutagenic agents.
Examples of a physical or chemical mutagenic agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), 0-methyl hydroxylamine, ethyl acid methane sulfonate nitrous (EMS), sodium disulfide, formic acid and nucleotide analogs.
When such agents are used, mutagenesis is typically performed by incubating the precursor cell to be mutagenized in the presence of the mutagenesis agent of choice under suitable conditions and evaluation and / or selection for mutant cells exhibiting reduced or not expression of the gene.
The modification or inactivation of the polynucleotide can be accompanied by the introduction, replacement or removal of one or more (several) nucleotides in the gene or a regulatory element required by its transcription or translation. For example, nucleotides can be inserted or removed as to result in the introduction of an interrupt codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation can be accompanied by site-directed mutagenesis or mutagenesis generated by PCR according to methods known in the art. Although, in principle, the modification can be carried out in vivo, that is, directly in the cell expressing the polynucleotide to be modified, it is preferred that the modification is carried out in vitro as exemplified below.
An example of a convenient way to eliminate or reduce the expression of a polynucleotide is based on techniques for gene replacement, gene deletion or gene disruption. For example, no method of gene disruption, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the precursor cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that can be used to select transformants in which the polynucleotide has been modified or destroyed. In a particularly preferred aspect, the polynucleotide is disrupted with a selectable marker such as that described herein.
The present invention also concerns methods of inhibiting the expression of a polypeptide having xylanase activity in a cell, which comprises administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule in which the dsRNA comprises a subsequence of a polynucleotide of the present invention. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex length nucleotides.
The dsRNA is preferably a minor interfering RNA (siRNA) or a micro RNA (miRNA). In a preferred aspect, dsRNA is minor interference RNA (siRNAs) for inhibiting transcription. In a preferred aspect, dsRNA is micro RNA (miRNAs) for translation inhibition.
The present invention also relates to such double stranded RNA molecules (dsRNA), which comprises a portion of the sequence encoding mature polypeptide of SEQ ID NO: 1 for inhibiting expression of the polypeptide in a cell. While a present invention is not limited by any particular mechanism of action, dsRNA can enter a cell and cause degradation of a single stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi).
The dsRNAs of the present invention can be used to silence the gene. In one aspect, the invention provides methods for selectively degrading RNA using a dsRNAi of the present invention. The process can be practiced in vitro ex vivo or in vivo. In one respect, dsRNA molecules can be used to generate a loss of the mutation of function in a cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Patent NO. 6,489,127; 6,506,559; 6,511,824 and 6,515,109.
The present invention further relates to a precursor cell mutant cell comprising a disruption or elimination of a polynucleotide encoding the polypeptide or a control sequence thereof or a muted gene encoding the polypeptide, which results in the mutant cell producing less of the polypeptide. or no polypeptide compares to the precursor cell.
Polypeptide-deficient mutant cells are particularly useful as host cells for the expression of heterologous and natural polypeptides. Therefore, the present invention also concerns methods of producing a natural or heterologous polypeptide, which comprises: (a) cultivating the mutant cell under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide. The term "heterologous polypeptides" means that polypeptides that are not natural to the host cell, for example, a variant of a natural protein. The host cell can comprise more than one copy of a polynucleotide that encodes the natural or heterologous polypeptide.
The methods used for cultivating and purifying the product of interest can be carried out by methods known in the art.
The methods of the present invention for producing an essentially xylanase-free product are of particular interest in the production of eukaryotic polypeptides in particular fungal proteins such as enzymes. Xylanase-deficient cells can also be used to express heterologous proteins of pharmaceutical interest such as hormones, development factors, receptors and the like. The term "eukaryotic polypeptides" includes not only polypeptides, but also those polypeptides, for example, enzymes, which have been modified by amino acid substitutions, deletions or additions, or other such modifications to enhance activity, thermostability, pH tolerance and others .
In a further aspect, the present invention relates to a protein product essentially free from the xylanase activity that is produced by a method of the present invention.
Compositions
The present invention also relates to compositions that comprise a polypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptide. The term enriched indicates that the cellobiohydrolase activity of the composition has been increased, for example, with an enrichment factor of at least 1.1.
The composition can comprise a polypeptide of the present invention as the major enzyme component, for example, a mono-component composition. Alternatively, the composition may comprise multiple enzyme activities, such as one or more (several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an expansin, an esterase, a laccase, a ligninolytic enzyme, a pectinase, a peroxidase, a protease and a swolenin.
Polypeptide compositions can be prepared according to methods known in the art and can be in the form of a liquid or dry composition. For example, the polypeptide composition can be in the form of a granulate or a microgranulate. The polypeptide to be included in the composition can be stabilized according to methods known in the art.
Examples are given below of the preferred uses of the polypeptide compositions of the invention. The dosage of the polypeptide composition of the invention and other conditions under which a composition is used can be determined on the basis of methods known in the art.
Uses
The present invention is also directed to methods of using polypeptides having xylanase activity, or compositions thereof. The polypeptides of the present invention can be used to degrade or convert plant cell walls or any material containing xylan, for example, lignocellulose, originating from plant cell walls (see, for example, WO 2002/18561). Examples of various uses are described below. The dosage of the polypeptides of the present invention and other conditions under which the polypeptides are used can be determined on the basis of methods known in the art.
The enzymatic degradation of a material containing xylan is facilitated by the total or partial removal of secondary branches. The polypeptides of the present invention are preferably used in conjunction with other enzymes that degrade xylan such as xylanases, acetylxylan esterases, arabinofuranosidases, xylosidases, feruloyl esterases, glucuronidases and a combination thereof, in the processes in which the material containing xylan will be degraded. For example, acetyl groups can be removed by acetylxylan esterases; arabinose groups by alpha-arabinosidases; feruloyl groups by feruloil esterases and glucuronic acid groups by alfaglucuronidases. Oligomers released by xylanases, or a combination of xylanases and secondary branching hydrolyzing enzymes, can still be degraded by free xylose by beta-xylidasidases.
The present invention also relates to methods for degrading or converting a material containing xylan or cellulosic, which comprises: treating the material containing xylan or cellulosic with an enzyme composition in the presence of a polypeptide having xylanase activity of the present invention. In a preferred aspect, the method further comprises recovering the degraded or converted material containing xylan or cellulosic.
The present invention also relates to methods for producing a fermentation product, which comprises: (a) saccharifying material containing xylan or cellulosic with an enzyme composition in the presence of a polypeptide having the xylanase activity of the present invention; (b) fermenting the saccharified material containing xylan or cellulosic with one or more (several) fermentation microorganisms for the production of the fermentation product and (c) recovering the fermentation product from the fermentation.
The present invention also concerns methods of fermenting a material containing xylan or cellulosic, which comprises: fermenting the material containing xylan or cellulosic with one or more (several) fermentation microorganisms, in which the material containing xylan or cellulosic is saccharified with a enzyme composition in the presence of a polypeptide having xylanase activity of the present invention. In a preferred aspect, fermentation of the material containing xylan or cellulosic produces a fermentation product. In another preferred aspect, the method further comprises recovering the fermentation product from the fermentation.
The methods of the present invention can be used to saccharify a material containing xylan or cellulosic to fermentable sugars and convert fermentable sugars into many useful substances, for example, fuel, potable ethanol and / or fermentation products (for example, acids, alcohol , ketones, gases and others). The production of a desired fermentation product from material containing xylan or cellulosic typically involves pretreatment, enzymatic hydrolysis (saccharification) and fermentation.
The processing of the material containing xylan or cellulosic according to the present invention can be followed using conventional processes in the art. In addition, the methods of the present invention 25 can be implemented using any conventional biomass processing mechanism configured to operate in accordance with the invention.
Hydrolysis (saccharification) and fermentation, separate or simultaneous, includes, but is not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and fermentation (HHCF) and direct microbial conversion (DMC). SHF uses separate process steps from the first enzymatically hydrolyzed material containing xylan or cellulosic to fermentable sugars, for example, glucose, cellobiose, cellotriose and pentose sugars (for example, xylose) and then ferment the fermentable sugars to ethanol. In SSF, the enzymatic hydrolysis of the material containing xylan or cellulosic and the fermentation of sugars to ethanol are combined in one step (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed. , Taylor & Francis, Washington, DC, 179-212). SSCF involves cofermentation of multiple sugars (Sheehan, J. and Himmel, M., 1999, Enzymes, energy and the environment: A strategic perspective on the US Department of Energy's research and development activities for bioethanol, Biotechnol. Prog. 15: 817 -827). HHF involves a separate hydrolysis step and, in addition, a simultaneous saccharification and hydrolysis step, which can be carried out in the same reactor. The steps in an HHF process can be carried out at different temperatures, that is, high temperature enzymatic saccharification followed by SSF at a lower temperature than the fermentation strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis and fermentation) in one or more steps where the same organism is used to produce the enzymes for converting material containing xylan or cellulosic to fermentable sugars and to convert fermentable sugars into a product final (Lynd, LR, Weimer, PJ, van Zyl, WH and Pretorius, IS, 2002, Microbial cellulose utilization: Fundamentals and biotechnology, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood herein that any method known in the art which comprises pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof can be used in the practice of the methods of the present invention.
A conventional mechanism may include a batch agitated reactor, a batch agitated reactor, a continuous flow agitated reactor with ultrafiltration and / or a continuous buffer flow column reactor (Fernanda de Castilhos Corazza, Flavio Faria de Moraes, Gisella Maria Zanin and No Neitzel, 2003, Optimal control in fed-batch reactor for the cellobiose hydrolysis, Acta Scientiarum. Technology 25: 33-38; Gusakov, AV and Sinitsyn, AP, 1985, Kinetics of a enzymatic hydrolysis of cellulose: 1 A mathematical model for a batch reactor process, Enz. Microb. Technol. Ί 346-352), a friction reactor (Ryu, SK and Lee, JM, 1983, Bioconversion of waste cellulose by using an attrition bioreactor, Biotechnol. Bioeng. 25: 53-65), or a reactor with intensive agitation induced by an electromagnetic field (Gusakov, AV, Sinitsyn, AP, Davydkin, IY, Davydkin, VY, Protas, Ο. V., 1996, Enhancement of enzymatic cellulose hydrolysis using a novel type of bioreacto r with intensive stirring induced by electromagnetic field, Appl. Biochem. Biotechnol. 56: 141 to 153). Additional types of reactors include: fluidized bed, upward flow blanket, extruder and immobilized reactors for hydrolysis and / or fermentation.
Pre-treatment. In practice the methods of the present invention, any pretreatment process known in the art can be used to break up cell wall components of material containing xylan and / or cellulosic (Chandra et al., 2007, Pretreatment substrate: The key to effective enzymatic hydrolysis of lignocellulosics - Adv. Biochem. Engin./Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Pretreatment of cellulosic lignomaterial for efficient bioethanol production, Adv. Biochem. Engin. / Biotechnol. 108: 41 to 65; Hendriks and Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol. 100: 10-18; Mosier et al., 2005, Features of promising technologies for pretreatment of lignocellulosic biomass, Bioresource Technol. 96: 673-686;
Taherzadeh and Karimi, 2008, Pretreatment of lignocellulosic wastes to improve ethanol and biogas production: A review, Int. J. of Mol. Sei. 9: 1621 to 1651; Yang and Wyman, 2008, Pretreatment: the key to unlocking low-cost cellulosic ethanol, Biofuels Bioproducts and Biorefining-Biofpr. 2 26-40).
Xylan-containing or cellulosic material can also be subjected to particle size reduction, pre-saturation, wetting, washing or conditioning prior to pre-treatment using methods known in the art.
Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), diluted acid pretreatment, hot water pretreatment, alkaline pretreatment, lime pretreatment, wet oxidation, explosion wet, ammonia fiber explosion, organosolvent pretreatment and biological pretreatment. Additional pretreatments include ammonia filtration, ultrasound, electroporation, microwave, supercritical CO _2, supercritical H ₂ O, ozone and gamma irradiation pretreatments.
Xylan-containing or cellulosic material can be pre-treated prior to hydrolysis and / or fermentation. Pre-treatment is preferably carried out before hydrolysis. Alternatively, pretreatment can be carried out simultaneously with enzyme hydrolysis to release fermentable sugars, such as glucose, xylose and / or cellobiosis. In more cases, the pre-treatment step alone results in some conversion of biomass to fermentable sugars (even in the absence of enzymes).
Pre-treatment with steam. In the steam pretreatment, material containing xylan or cellulosic is heated to break up the components of the plant cell wall, including lignin, hemicellulose and cellulose to manufacture cellulose and other fractions, for example, hemicellulose, accessible to enzymes. The material containing xylan or cellulosic is passed to or through a reaction vessel where the steam is injected to increase the temperature at the required temperature and pressure and is retained therein for the desired reaction time. The steam pretreatment is preferably done at 140 to 230 ° C, more preferably 160 to 200 ° C and more preferably 170 to 190 ° C, where the optimal temperature range depends on any addition of a chemical catalyst. The residence time for the steam pretreatment is preferably 1 to 15 minutes, more preferably 3 to 12 minutes and most preferably 4 to 10 minutes, where the optimal residence time depending on the temperature range and any addition of a chemical catalyst . Pre-treatment with steam allows relatively high solid loads, so that the material containing xylan or cellulosic material is generally only wet during the pre-treatment. Steam pretreatment is often combined with an explosive discharge of the material after pretreatment, which is known as a steam explosion, that is, rapid flicker at atmospheric pressure and turbulent flow of the material to increase the surface area accessible by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1 to 33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; US Patent Application NO. 20020164730). During pre-treatment with steam, groups of acetyl hemicellulose are cleaved and the resulting acid autocatalyzes the partial hydrolysis of hemicellulose to monosaccharides and oligosaccharides. Lignin is removed only to a limited extent.
A catalyst such as H ₂ SO ₄ or SO ₂ (typically 0.3 to 3% w / w) is often pre-treated with steam, which decreases time and temperature, increases recovery and improves enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509-523; Sassner et al., 2006, Enzyme Microb Technol 39: 756-762).
Chemical pre-treatment: The term "chemical treatment" refers to any chemical pre-treatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, freeze explosion / ammonia fiber (AFEX), ammonia filtration (APR) and solvent solvent pretreatments. .
In the diluted acid pretreatment, material containing xylan or cellulosic is mixed with diluted acid, typically H ₂ SO ₄ and water to form a paste, heated by steam to the desired temperature and after a residence time flickered at atmospheric pressure. Diluted acid pretreatment can be performed with a number of reactor designs, for example, flow buffer reactors, countercurrent reactors, or countercurrent shrinking bed reactors (Duff and Murray, 1996, supra; Schell et al ., 2004, Bioresource Technol. 91: 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).
Various methods of pretreatment under alkaline conditions can also be used. These alkaline pretreatments include, but are not limited to, pretreatment with lime, wet oxidation, ammonia filtration (APR) and freeze / ammonia fiber burst (AFEX).
Pre-treatment with lime is carried out with calcium carbonate, or ammonia at low temperatures of 85-150 ° C and residence times of 1 hour over several days (Wyman et al., 2005, Bioresource Technol. 96: 19591966; Mosier et al., 2005, Bioresource Technol. 96: 673-686). WO 2006/110891, WO 2006/11899, WO 2006/11900 and WO 2006/110901 discloses pretreatment methods using ammonia.
Wet oxidation is a thermal pretreatment typically carried out at 180 to 200 ° C for 5 to 15 minutes with the addition of an oxidizing agent such as hydrogen peroxide or oxygen super-pressure (Schmidt and Thomsen, 1998, Bioresource Technol. 64 : 139-151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117: 1 to 17; Varga et al., 2004,
Biotechnol. Bioeng. 88: 567-574; Martin et al., 2006, J. Chem. Technol. Biotechnol. 81: 1669-1677). Pre-treatment is carried out in preferably 1 to 40% dry substance, more preferably 2 to 30% dry substance and more preferably 5 to 20% dry substance and often the initial pH is increased by the addition of an alkali such as carbonate sodium.
A modification of the wet oxidation pretreatment method, known as a wet burst (combination of wet oxidation and steam burst), can handle dry substance up to 30%. In the wet explosion, the oxidizing agent is introduced during the pre-treatment after a certain period of residence. The pretreatment is then completed by atmospheric pressure scintillation (WO 2006/032282).
The explosion of ammonia fiber (AFEX) involves the treatment of material containing xylan or cellulosic with liquid or gaseous ammonia at moderate temperatures such as 90 to 100 ° C and high pressure such as 17 to 20 bar for 5 to 10 minutes, where the dry substance content can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231; Alizadeh et al., 2005, Appl. Biochem. Biotechnol. 121: 1133-1141; Teymouri et al., 2005, Bioresource Technol. 96: 2014-2018). The results of AFEX pretreatment in the depolymerization of cellulose and partial hydrolysis of hemicellulose. Lignin-carbohydrate complexes are cleaved.
The organosolvent pretreatment delignifies the material containing xylan or cellulosic by extraction using aqueous ethanol (40 to 60% ethanol) at 160 to 200 ° C for 30 to 60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90: 473-481; Pan et al., 2006, Biotechnol. Bioeng. 94: 851 to 861; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121: 219-230). Sulfuric acid is usually added as a catalyst. In organosolvent pretreatment, most hemicellulose is removed.
Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. and Biotechnol. 105108, p. 69-85 and Mosier et al., 2005, Bioresource Technology 96: 673-686 and U.S. Published Application 2002/0164730.
In one aspect, the chemical pretreatment is preferably carried out as an acidic treatment and more preferably as a mild and / or continuous diluted acidic treatment. The acid is typically sulfuric acid, but other acids can also be used, such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof. The mild acid treatment is conducted in the pH range of preferably 1 to 5, more preferably 1 to 4 and more preferably 1 to 3. In one aspect, the acid concentration is in the range of preferably 0.01 to 20% by weight of the acid, more preferably 0.05 to 10% by weight of the acid, even more preferably 0.1 to 5% by weight of the acid and more preferably 0.2 to 2.0% by weight of the acid. The acid is contacted with material containing xylan or cellulosic and heated to a temperature in the range of preferably 160 to 220 ° C and more preferably 165 to 195 ° C, for periods ranging from seconds to minutes for, for example, 1 second to 60 minutes .
In another aspect, the pretreatment is carried out as an explosion of ammonia fiber stage (AFEX pretreatment stage).
In another aspect, pretreatment takes place in an aqueous paste. In preferred aspects, material containing xylan or cellulosic is present during the pretreatment in amounts preferably between 10 to 80% by weight, more preferably between 20 to 70% by weight and more preferably between 30 to 60% by weight, such as about 50% by weight. Pretreated material containing xylan or cellulosic material can be washed or unwashed using any method known in the art, for example, washed with water.
Mechanical pretreatment: The term mechanical pretreatment refers to various types of crushing or grinding (for example, dry grinding, wet grinding, or vibrating ball grinding). In a preferred aspect, mechanical pretreatment is carried out in a batch process, a steam gun hydrolyzing system that uses high pressure and high temperature as defined above, for example, a Sunds hydrolyzer available from Sunds Defibrator AB, Sweden.
Physical pretreatment: The term physical pretreatment refers to any pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin from material containing xylan or cellulosic. For example, physical pretreatment may involve irradiation (eg microwave irradiation), vaporization / explosion of steam, hydrothermolysis and combinations of these.
Physical pretreatment may involve high pressure and / or high temperature (vapor explosion). In one aspect, high pressure means pressure in the range of preferably about 300 psi (2.06MPa) to about 600 psi (4.13MPa), more preferably about 350 (2.41MPa) to about 550 psi ( 3.79MPa) and more preferably at about 400 (2.75MPa) to about 500 (3.44MPa) psi, such as about 450 psi (3.10MPa). In another aspect, high temperature means temperatures in the range of about 100 to about 300 ° C, preferably about 140 to about 235 ° C.
Combined chemical and physical pretreatment: Material containing xylan or cellulosic can be pretreated both physically and chemically. For example, the pre-treatment step may involve the treatment of mild or diluted acid and high temperature and / or pressure treatment. Chemical and physical pretreatments can be carried out sequentially or simultaneously, as desired. A mechanical pretreatment can also be included.
Consequently, in a preferred aspect, material containing xylan or cellulosic is subjected to physical, chemical or mechanical pretreatment, or any combination thereof, to promote the separation and / or release of cellulose, hemicellulose and / or lignin.
Biological pretreatment: The term biological pretreatment refers to any biological pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin from material containing xylan or cellulosic. Biological pretreatment techniques may involve the application of lignin solubilizing microorganisms (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic / microbial conversion of cellulosic biomass, Adv. Appl. Microbiol. 39: 295-333; McMillan, JD, 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, Μ. E., Baker, JO and Overend, RP, eds., ACS Symposium Series 566, American Chemical Society, Washington, DC, chapter 15; Gong, CS, Cao, NJ, Du, J. and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany , 65: 207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz. Microb. Tech. 18: 312-331 and Vallander and Eriksson, 1990, Production of ethanol from cellulosic lignomaterial: State of the art, Adv. Biochem. Eng./Biotechnol. 42: 63-95).
Saccharification. In the hydrolysis step, also known as saccharification, the material containing xylan or cellulosic, for example, pretreated, is hydrolyzed to break down cellulose and hemicellulose to fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose and / or soluble oligosaccharides. Hydrolysis is carried out enzymatically by an enzyme composition in the presence of a polypeptide having xylanase activity of the present invention. The components of the enzyme composition can also be added sequentially.
Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions that can be readily determined by a person skilled in the art. In a preferred aspect, hydrolysis is carried out under conditions suitable for enzyme activity, that is, optimal for enzymes. Hydrolysis can be carried out as a continuous or batch batch process where the pretreated cellulosic material (substrate) is gradually fed to, for example, an enzyme-containing hydrolysis solution.
Saccharification is usually performed in stirred tank reactors or fermenters under controlled pH, temperature and mixing conditions. The appropriate process time, temperature and pEl conditions can be readily determined by a person skilled in the art. For example, saccharification can last up to 200 hours, but is typically carried out for preferably about 12 to about 96 hours, more preferably about 16 to about 72 hours and most preferably about 24 to about 48 hours . The temperature is in the range of preferably about 25 ° C to about 70 ° C, more preferably about 30 ° C to about 65 ° C and more preferably about 40 ° C to 60 ° C, in particular at about 50 ° C. The pEI is in the range of preferably about 3 to about 8, more preferably about 3.5 to about 7 and most preferably about 4 to about 6, in particular at about pH 5. The dry solids content is in the range of preferably about 5 to about 50% by weight, more preferably about 10 to about 40% by weight and most preferably about 20 to about 30% by weight.
The optimal amounts of enzymes and polypeptides having xylanase activity depends on several factors including, but not limited to, the mixture of component enzymes, the material containing xylan or cellulosic material, the concentration of the material containing xylan or cellulosic material, the pretreatments of the material containing xylan or cellulosic, temperature, time, pH and inclusion of the fermentation organism (for example, yeast by simultaneous saccharification and fermentation).
In one aspect, an effective amount of cellulolytic enzymes and / or xylan degrading enzymes to the material containing xylan or cellulosic is about 0.5 to about 50 mg, preferably about 0.5 to about 40 mg, more preferably at about 0.5 to about 25 mg, more preferably at about 0.75 to about 20 mg, most preferably at about 0.75 to about 15 mg, even more preferably at about 0, 5 to about 10 mg and more preferably to about 2.5 to about 10 mg per g of the material containing xylan or cellulosic.
In another aspect, an effective amount of polypeptides having xylanase activity in the material containing xylan or cellulosic is from about 0.01 to about 50.0 mg, preferably at about 0.01 to about 40 mg, more preferably at about 0.01 to about 30 mg, more preferably to about 0.01 to about 20 mg, more preferably to about 0.01 to about 10 mg, most preferably to about 0.01 to about 5 mg, more preferably at about 0.025 to about 1.5 mg, more preferably at about 0.05 to about 1.25 mg, more preferably at about 0.075 to about 1.25 mg, most preferably at about 0.1 to about 1.25 mg, even more preferably to about 0.15 to about 1.25 mg and most preferably to about 0.25 to about 1.0 mg per g of the material containing xylan or cellulosic.
In another aspect, an effective amount of polypeptides having xylanase activity with respect to cellulolytic enzymes and / or xylan degrading enzymes is about 0.005 to about 1.0 g, preferably about 0.01 to about 1 .0 g, more preferably at about 0.15 to about 0.75 g, more preferably at about 0.15 to about 0.5 g, more preferably at about 0.1 to about 0.5 g, even more preferably at about 0.1 to about 0.5 g and more preferably at about 0.05 to about 0.2 g per g of cellulolytic enzymes.
In one aspect, the enzyme composition comprises or further comprises one or more (several) proteins selected from the group consisting of a cellulase, a GH61 polypeptide having cellulolytic enhancing activity, a hemicellulase, an expansin, an esterase, a laccase, an enzyme ligninolytic, pectinase, peroxidase, protease and swolenin. In another aspect, cellulase is preferably one or more (several) enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase and a beta-glucosidase. In another aspect, hemicellulase is preferably one or more (several) enzymes selected from the group consisting of an acetylmannan esterase, an acetixylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase , a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase and a xylosidase.
In another aspect, the enzyme composition comprises one or more (diverse) cellulolytic enzymes. In another aspect, the enzyme composition comprises or still comprises one or more (several) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (diverse) cellulolytic enzymes and one or more (diverse) hemicellulolytic enzymes. In another aspect, the enzyme composition comprises one or more (several) enzymes selected from the group of cellulolytic enzymes and hemicellulolytic enzymes. In another aspect, the enzyme composition comprises an endoglucanase. In another aspect, the enzyme composition comprises a cellobiohydrolase. In another aspect, the enzyme composition comprises a beta-glucosidase. In another aspect, the enzyme composition comprises a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a cellobiohydrolase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a beta-glucosidase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase and a cellobiohydrolase. In another aspect, the enzyme composition comprises an endoglucanase and a beta-glucosidase. In another aspect, the enzyme composition comprises a cellobiohydrolase and a beta-glucosidase. In another aspect, the enzyme composition comprises an endoglucanase, a cellobiohydrolase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase, a beta-glucosidase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises a cellobiohydrolase, a beta-glucosidase and a polypeptide having cellulolytic enhancing activity. In another aspect, the enzyme composition comprises an endoglucanase, a cellobiohydrolase and betaglucosidase and a polypeptide having cellulolytic enhancing activity.
In another aspect, the enzyme composition comprises an acetylmannan esterase. In another aspect, the enzyme composition comprises an acetixylan esterase. In another aspect, the enzyme composition comprises an arabinanase (for example, alpha-L-arabinanase). In another aspect, the enzyme composition comprises an arabinofuranosidase (for example, alpha-L-arabinofuranosidase). In another aspect, the enzyme composition comprises coumaric acid esterase. In another aspect, the enzyme composition comprises a feruloyl esterase. In another aspect, the enzyme composition comprises a galactosidase (for example, alfagalactosidase and / or beta-galactosidase). In another aspect, the enzyme composition comprises a glucuronidase (for example, alpha-D-glucuronidase). In another aspect, the enzyme composition comprises a glucuronoyl esterase. In another aspect, the enzyme composition comprises a mannanase. In another aspect, the enzyme composition comprises a mannosidase (for example, beta-mannosidase). In another aspect, the enzyme composition comprises a xylanase. In a preferred aspect, xylanase is a 10 xylanase family. In another aspect, the enzyme composition comprises a xylosidase (for example, beta-xylosidase). In another aspect, the enzyme composition comprises an expansin. In another aspect, the enzyme composition comprises an esterase. In another aspect, the enzyme composition comprises a laccase. In another aspect, the enzyme composition comprises a ligninolytic enzyme. In a preferred aspect, the ligninolytic enzyme is a manganese peroxidase. In another preferred aspect, the ligninolytic enzyme is a lignin peroxidase. In another preferred aspect, the ligninolytic enzyme is an enzyme that produces H ₂ O ₂ . In another aspect, the enzyme composition comprises a pectinase. In another aspect, the enzyme composition comprises a peroxidase. In another aspect, the enzyme composition comprises a protease. In another aspect, the enzyme composition comprises a swolenin.
In the methods of the present invention, enzymes can be added before or during fermentation, for example, during saccharification or during or after the propagation of the fermentation microorganisms.
One or more (several) components of the enzyme composition can be wild type proteins, recombinant proteins or a combination of wild type proteins and recombinant proteins. For example, one or more (diverse) components can be natural proteins in a cell, which is used as a host cell to recombinantly express one or more (diverse) other components of the enzyme composition. One or more (several) components of the enzyme composition can be produced as monocomponents, which are then combined to form the enzyme composition. The enzyme composition can be the combination of single-component and multi-component protein preparations.
The enzymes used in the methods of the present invention can be in any form suitable for use, such as, for example, a crude fermentation broth with or without the cells removed, a cell lysate with or without cell debris, a purified enzyme preparation or semipurified, or a host cell as a source of enzymes. The enzyme composition can be a dry or granulated powder, a non -usting granulate, a liquid, a stabilized liquid, or a protected stabilized enzyme. Liquid enzyme preparations can, for example, be stabilized by the addition of stabilizers such as sugar, sugar alcohol or other polyol and / or lactic acid or other organic acid according to the established procedures.
Enzymes can be derived from or obtained from any suitable source, including bacterial, fungal, yeast, vegetable or mammalian origin. The term "obtained" means that the enzyme can be isolated from an organism that naturally produces the enzyme as a natural enzyme. The term "obtained" also means that the enzyme can be recombinantly produced in a host organism using the methods described therein, where the recombinantly produced enzyme is natural or foreign to the host organism or has a modified amino acid sequence, for example, having a or more (diverse) amino acids that are deleted, inserted and / or substituted, that is, a recombinantly produced enzyme ie a mutant and / or a fragment of a natural amino acid sequence or an enzyme produced by the nucleic acid mixing processes in technical. Covered within the meaning of a natural enzyme are natural variants and within the meaning of a foreign enzyme are recombinantly obtained variants, such as by site-directed mutagenesis or mixture.
The polypeptide having enzyme activity can be a bacterial polypeptide. For example, the polypeptide can be a gram positive bacterial polypeptide such as a Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus, or Oceanobacillus polypeptide having a gram-negative polypeptide as a gram-negative polypeptide E. coli polypeptide, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fusobacterium, llyobacter, Neisseria, or Ureaplasma having enzyme activity.
In a preferred aspect, the polypeptide is a Bacillus alkalophilus polypeptide, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megillus, Bacillus megillus, Bacillus michillus subtilis, or Bacillus thuringiensis having enzyme activity.
In another preferred aspect, the polypeptide is a polypeptide Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. Zooepidemicus having enzyme activity.
In another preferred aspect, the polypeptide is a polypeptide Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, or Streptomyces lividans having enzyme activity.
The polypeptide having enzyme activity can also be a fungal polypeptide and more preferably a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia polypeptide; or more preferably a filamentous fungal polypeptide such as an Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Crypticia, Cryptography, Cryptocidia, Cryptocidia , Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Poitrasia, Poitrasia, Poitrasia , Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylaria having enzyme activity.
In a preferred aspect, the polypeptide is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis polypeptide having enzyme activity.
In another preferred aspect the polypeptide is an Acremonium cellulolyticus polypeptide, Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus nidulans, Aspergillus niger, Aspergosusporporus, or inops, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminurn, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium, fusarium, Fusarium, fusarium, Fusarium, fusarium, Fusarium Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium fuass niculosum, Penicillium purpurogenum, Phanerochaete chrysosporium, Thielavia achromatica, Thielavia albomyces, Thielavia albopilosa, Thielavia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia spededich, Trieloderma, Thielavia spededich, Thielavia Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride, or Trichophaea saccata having enzyme activity.
Protein-designed or chemically modified mutants of polypeptides having enzyme activity can also be used.
One or more (several) components of the enzyme composition can be a recombinant component, that is, produced by cloning a DNA sequence that encodes the single component and subsequent cell transformed with the DNA Sequence and expressed in a host (see, for example, WO 91/17243 and WO 91/17244). The host is preferably a heterologous host (enzyme is foreign to the host), but the host may under certain conditions be a homologous host (enzyme is natural to the host). Mono-component cellulolytic enzymes can also be prepared by purifying such a protein from a fermentation broth.
In one aspect, one or more (diverse) cellulolytic enzymes comprises a commercial cellulolytic enzyme preparation. Examples of commercial cellulolytic enzyme preparations suitable for use in the present invention include, for example, CELLIC ^1M CTec (Novozymes A / S), CELLIC ™ CTec2 (Novozymes A / S / CELLUCLAST ™ (Novozymes A / S), NOVOZYM ™ 188 (Novozymes A / S / CELLUZYME ™ (Novozymes A / S / CEREFLO ™ (Novozymes A / S) and ULTRAFLO ™ (Novozymes A / S /, ACCELERASE ™ (Genencor Int.), LAMINEX ™ (Genencor Int.), SPEZYME ™ CP (Genencor Int.), ROHAMENT ™ 7069 W (Rohm GmbH), FIBREZYME® LDI (Dyadic Intemational, Inc.), FIBREZYME® LBR (Dyadic Intemational, Inc.), or VISCOSTAR® 150L (Dyadic Intemational, Inc.). Cellulase enzymes are added in effective amounts of about 0.001 to about 5.0% by weight of solids, more preferably from about 0.025 to about 4.0% by weight of solids and more preferably from about 0.005 to about 2.0% by weight of solids.
Examples of bacterial endoglucanases that can be used in the methods of the present invention include, but are not limited to, an Acidothermus cellulolyticus endoglucanase (WO 91/05039; WO 93/15186; US Patent NO. 5,275,944; WO 96/02551; Patent US NO. 5,536,655, WO 00/70031, WO 05/093050); Thermobifida fusca endoglucanase III (WO 05/093050) and Thermobifida fusca endoglucanase V (WO 05/093050).
Examples of fungal endoglucanases that can be used in the present invention include, but are not limited to, a Trichoderma reesei endoglucanase I (Penttila et al., 1986, Gene 45: 253-263; Trichoderma reesei Cel7B endoglucanase I; GENBANKTM accession NO. Ml5665) ; Trichoderma reesei endoglucanase II (Saloheimo, et al., 1988, Gene 63:11 to 22; Trichoderma reesei Cel5A endoglucanase II; GENBANK ™ accession NO. M19373); Trichoderma reesei endoglucanase III (Okada et al., 1988, Appl. Environ. Microbiol. 64: 555-563; GENBANK ^rM accession NO. AB003694); Trichoderma reesei endoglucanase V (Saloheimo et al., 1994, Molecular Microbiology 13: 219-228; GENBANKTM accession NO. Z33381);
Aspergillus aculeatus endoglucanase (Ooi et al., 1990, Nucleic Acids
Research 18: 5884); Aspergillus kawachii endoglucanase (Sakamoto et al., 1995, Current Genetics 27: 435-439); Erwinia carotovara endoglucanase (Saarilahti et al., 1990, Gene 90: 9-14); Fusarium oxysporum endoglucanase (GENBANKTM accession NO. L29381); Humicola grisea var. thermoidea endoglucanase (GENBANK ™ accession NO. AB003107); Melanocarpus albomyces endoglucanase (GENBANK ™ accession NO. MAL515703); Neurospora crassa endoglucanase (GENBANKTM accession NO. XM_324477); Humicola insolens endoglucanase V); Myceliophthora thermophila CBS 117.65 endoglucanase; basidiomycete CBS 495.95 endoglucanase; basidiomycete CBS 494.95 endoglucanase; Thielavia terrestris NRRL 8126 CEL6B endoglucanase; Thielavia terrestris NRRL 8126 CEL6C endoglucanase; Thielavia terrestris NRRL 8126 CEL7C endoglucanase; Thielavia terrestris NRRL 8126 CEL7E endoglucanase; Thielavia terrestris NRRL 8126 CEL7F endoglucanase; Cladorrhinum foecundissimum ATCC 62373 CEL7A endoglucanase and Trichoderma reesei strain NO. VTT-D-80133 endoglucanase (GENBANKTM accession NO. M15665).
Examples of cellobiohydrolases useful in the present invention include, but are not limited to, Trichoderma reesei cellobiohydrolase I; Trichoderma reesei cellobiohydrolase II; Humicola insolens cellobiohydrolase I); Myceliophthora thermophila cellobiohydrolase II; Thielavia terrestris cellobiohydrolase II (CEL6A); Chaetomium thermophilum cellobiohydrolase I and Chaetomium thermophilum cellobiohydrolase II, Aspergillus fumigatus celobioidrolase I and Aspergillus fumigatus celobioidrolase II.
Examples of beta-glucosidases useful in the present invention include, but are not limited to, Aspergillus oryzae beta-glucosidase; Aspergillus fumigatus beta-glucosidase; Penicillium brasilianum IBT 20888 betaglucosidase; Aspergillus niger beta-glucosidase and Aspergillus aculeatus betaglucosidase. Aspergillus oryzae beta-glucosidase can be obtained according to WO 2002/095014. Aspergillus fumigatus beta-glucosidase can be obtained according to WO 2005/047499. Penicillium brasilianum betaglucosidase can be obtained according to WO 2007/019442. Aspergillus niger beta-glucosidase can be obtained according to Dan et al., 2000, J. Biol. Chem. 275: 4973-4980. Aspergillus aculeatus betaglucosidase can be obtained according to Kawaguchi et al., 1996, Gene 173: 287-288.
Beta-glucosidase can be a fusion protein. In one aspect, beta-glucosidase is a variant BG fusion protein Aspergillus oryzae beta-glucosidase or the Aspergillus oryzae betaglucosidase fusion protein obtained according to WO 2008/057637.
Other useful endoglucanases, cellobiohydrolases and beta-glucosidases are disclosed in numerous families of glycosyl hydrolase using the classification according to Henrissat B., 1991, A classification of glycosyl hydrolases based on the similarities of the amino acid sequence, Biochem. J. 280: 309-316 and Henrissat B. and Bairoch A., 1996, Updating the classification based on the glycosyl hydrolase sequence, Biochem. J. 316: 695-696.
Other cellulolytic enzymes that may be useful in the present invention are described in EP 495,257, EP 531,315, EP 531,372, WO 89/09259, WO 94/07998, WO 95/24471, WO 96/11262, WO 96/29397, WO 96 / 034108, WO 97/14804, WO 98/08940, WO 98/012307, WO 98/13465, WO 98/015619, WO 98/015633, WO 98/028411, WO 99/06574, WO 99/10481, WO 99 / 025846, WO 99/025847, WO 99/031255, WO 2000/009707, WO 2002/050245, WO 2002/0076792, WO 2002/101078, WO 2003/027306, WO 2003/052054, WO 2003/052055, WO 2003 / 052056, WO 2003/052057, WO 2003/052118, WO 2004/016760, WO 2004/043980, WO 2004/048592, WO 2005/001065, WO 2005/028636, WO 2005/093050, WO 2005/093073, WO 2006 / 074005, WO 2006/117432, WO 2007/071818, WO
2007/071820, WO 2008/008070, WO 2008/008793, U.S. Patent NO. 4,435,307, U.S. Patent NO. 5,457,046, U.S. Patent NO. 5,648,263, U.S. Patent NO. 5,686,593, U.S. Patent NO. 5,691,178, U.S. Patent NO. 5,763,254 and U.S. Patent NO. 5,776,757.
In the methods of the present invention, any polypeptide having cellulolytic enhancing activity can be used.
In a first aspect, the polypeptide having cellulolytic intensifying activity comprises the following reasons:
[ILMV] -PX (4,5) -GXY- [ILMV] -XRX- [EQ] -X (4) - [HNQ] and [FW] - [TF] -K- [AIV], where X is any amino acid, X (4,5) is any amino acid at 4 or 5 continuous positions and X (4) is any amino acid at 4 continuous positions.
The polypeptide comprising the reasons noted above may still comprise: HX (1,2) -GPX (3) - [YW] - [AILMV], [EQ] -XYX (2) -CX- [EHQN] - [FILV] -X- [ILV], or
HX (1,2) -GPX (3) - [YW] - [AILMV] and [EQ] -XYX (2) -CX [EHQN] - [FILV] -X- [ILV], where X is any amino acid , X (1, 2) is any amino acid at 1 position or 2 continuous positions, X (3) is any amino acid at 3 continuous positions and X (2) is any amino acid at 2 continuous positions. In the above reasons, the simple letter IUPAC amino acid abbreviation is used.
In a preferred aspect, the polypeptide having cellulolytic enhancing activity still comprises H-X (1,2) -G-P-X (3) - [YW] [AILMV]. In another preferred aspect, the isolated polypeptide having cellulolytic enhancing activity still comprises [EQ] -X-Y-X (2) -C-X- [EHQN] [FILV] -X- [ILV]. In another preferred aspect, the polypeptide having cellulolytic enhancing activity still comprises HX (1,2) -GPX (3) - [YW] [AILMV] and [EQ] -XYX (2) -CX- [EHQN] - [FILV] -X- [ILVJ.
In a second aspect, the polypeptide having cellulolytic enhancing activity comprises the following reason:
[ILMV] -Px (4,5) -GxY- [ILMV] -xRx- [EQ] -x (3) -A- [HNQ], where x is any amino acid, x (4,5) is any amino acid at 4 or 5 continuous positions ex (3) is any amino acid at 3 continuous positions. In the above reason, the amino acid abbreviation of the single letter acceptable IUPAC is used.
Examples of polypeptides having cellulolytic enhancing activity useful in the methods of the present invention include, but are not limited to, polypeptides having Thielavia terrestris cellulolytic enhancing activity (WO 2005/074647); polypeptides having cellulolytic intensifying activity of Thermoascus aurantiacus (WO 2005/074656); polypeptides having cellulolytic enhancing activity of Trichoderma reesei (WO 2007/089290) and polypeptides having cellulolytic enhancing activity of Myceliophthora thermophila (WO 2009/085935, WO 2009/085864, WO 2009/085864 and WO 2009/085868). WO 2008/151043 discloses methods of increasing the activity of a polypeptide having cellulolytic enhancing activity by adding a soluble activating bivalent metal cation to a composition comprising the polypeptide having cellulolytic enhancing activity.
In one aspect, one or more (diverse) hemicellulolytic enzymes comprise a commercial hemicellulolytic enzyme preparation. Examples of preparing commercial hemicellulolytic enzymes suitable for use in the present invention include, for example, SHEARZYME ™ (Novozymes A / S), CELLIC ™ HTec (Novozymes A / S /, CELLIC ™ HTec2 (Novozymes A / S), VISCOZYME® (Novozymes A / S), ULTRAFLO® (Novozymes A / S), PULPZYME® HC (Novozymes A / S), MULTIFECT® Xylanase (Genencor), ECOPULP® TX-200A (AB Enzymes), HSP 6000 Xylanase (DSM), DEPOL ™ 333P (Biocatalysts Limit, Wales, UK),
DEPOL ™ 740L. (Biocatalysts Limit, Wales, UK) and DEPOL ™ 762P (Biocatalysts Limit, Wales, UK).
Examples of xylanases useful in the methods of the present invention include, but are not limited to, Aspergillus aculeatus xylanase (GeneSegP: AAR63790; WO 94/21785), Aspergillus fumigatus xylanases (WO 2006/078256) and Thielavia terrestris NRRL 8126 xylanases (WO 2009/079210 ).
Examples of beta-xylosidases useful in the methods of the present invention include, but are not limited to, Trichoderma reesei beta-xylosidase (UniProtKB / TrEMBL accession number Q92458), Talaromyces emersonii (SwissProt accession number Q8X212) and Neurospora crassa (SwissProt accession number Q7SOW4).
Examples of acetylxylan esterases useful in the methods of the present invention include, but are not limited to, Hypocrea jecorin acetylxylan esterase (WO 2005/001036), Neurospora crassa acetylxylan esterase (UniProt accession number q7s259), Thielavia terrestris NRRL 8126 acetylxilan esterase (WO 2009 042846), Chaetomium globosum acetylxylan esterase (Uniprot accession number Q2GWX4), Chaetomium gracile acetylxylan esterase (GeneSeqP accession number AAB82124), Phaeosphaeria nodorum acetylxylan esterase (Uniprot accession number QOUilHil9 and 9xH10HHnH1) ).
Examples of ferulic acid esterases useful in the methods of the present invention include, but are not limited to, Humicola insolens DSM 1800 feruloyl esterase (WO 2009/076122), Neurospora crassa feruloyl esterase (UniProt accession number Q9HGR3) and Neosartorya fischeri feruloil esterase (UniProt Accession number Al D9T4).
Examples of arabinofuranosidases useful in the methods of the present invention include, but are not limited to, Humicola insolens DSM 1800 arabinofúranosidase (WO 2009/073383) and Aspergillus niger arabinofuranosidase (GeneSeqP accession number AAR94170).
Examples of alpha-glucuronidases useful in the methods of the present invention include, but are not limited to, Aspergillus clavatus alfaglucuronidase (UniProt accession number alccl2), Trichoderma reesei alfaglucuronidase (Uniprot accession number Q99024), Talaromyces emersonii alpha-glucuronidase number (UniProtonion alpha-glucuronidase number Q8X211), Aspergillus niger alfa-glucuronidase (Uniprot accession number Q96WX9), Aspergillus terreus alfa-glucuronidase (SwissProt accession number QOCJP9) and Aspergillus fumigatus alfa-glucuronidase (SwissProt accession number Q4W45).
The enzymes and proteins used in the methods of the present invention can be produced by fermenting the microbial strains noted above in a nutrient medium containing suitable carbon and sources of nitrogen and inorganic salts, using procedures known in the art (see, for example, Bennett, JW and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991). Suitable media are available from commercial suppliers or can be prepared according to published compositions (for example, in American Type Culture Collection catalogs). Temperature ranges and other conditions suitable for enzyme development and production are known in the art (see, for example, Bailey, J.E. and Ollis, D.F., Fundamental Biochemical Engineering, McGraw-Hill Book Company, NY, 1986).
Fermentation can be any method of culturing a cell resulting in the expression or isolation of an enzyme. Fermentation can therefore be understood as comprising shaking flask cultivation, or smaller or larger scale fermentation (including solid-state, batch-fed, batch or continuous fermentations) in the laboratory or industrial fermenters carried out in a suitable medium and under conditions that allow the enzyme to be expressed or isolated. The resulting enzymes produced by the methods described above can be recovered from the fermentation medium and purified by conventional procedures.
Fermentation. The fermentable sugars obtained from the hydrolyzed cellulosic material can be fermented by one or more (several) fermentation microorganisms capable of fermenting the sugars directly or indirectly in a desired fermentation product.
The Fermentation or Fermentation Process refers to any Fermentation Process or any process that comprises the fermentation stage. Fermentation processes also include fermentation processes used in the consumed alcohol industry (eg, beer and wine), dairy industry (eg, fermented dairy products), leather industry and tobacco industry. The fermentation conditions depend on the desired fermentation product and fermentation organism and can be easily determined by a person skilled in the art.
In the fermentation step, sugars, released from the cellulosic material as a result of pretreatment and enzymatic hydrolysis steps, are fermented to a product, for example, ethanol, by a fermentation organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separated or simultaneous, as described in this.
Any suitable hydrolyzed cellulosic material can be used in the fermentation step in the practice of the present invention. The material is generally selected on the basis of the desired fermentation product, that is, the substance to be obtained from the fermentation and the process used, as is well known in the art.
The term fermentation medium is understood here to refer to a medium before the fermentation microorganisms are added, such as, a medium resulting from the saccharification process, as well as a medium used in a simultaneous saccharification and Fermentation process (SSF) .
The fermentation microorganism refers to any microorganism, including bacterial and fungal organisms, suitable for use in the desired Fermentation process to produce a fermentation product. The fermentation organism can be C ₆ and / or C ₅ fermentation organisms, or a combination thereof. Both C ₆ and C ₅ fermentation organisms are well known in the art. Suitable fermentation microorganisms are capable of fermenting, i.e. converting, sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, or oligosaccharides, directly or indirectly into the desired fermentation product.
Examples of bacterial and fungal fermentation organisms that produce ethanol are described by Lin et al., 2006, Appl. Microbiol. Biotechnol. 69: 627-642.
Examples of fermentation microorganisms that can ferment C ₆ sugars include bacterial and fungal organisms, such as yeast. The preferred yeast includes strains of Saccharomyces spp., Preferably Saccharomyces cerevisiae.
Examples of fermentation organisms that can ferment C ₅ sugars include bacterial and fungal organisms, such as some yeast. Preferred C ₅ fermentation yeast includes strains of Pichia, preferably Pichia stipitis, such as Pichia stipitis CBS 5,773; strains of Candida, preferably Candida boidinii, Candida brassicae, Candida sheatae, Candida diddensii, Candida pseudotropicalis, or Candida utilis.
Other fermentation organisms include strains of Zymomonas, such as Zymomonas mobilis; Hansenula, such as anomalous Hansenula; Kluyveromyces, such as K. fragilis; Schizosaccharomyces, such as S. pombe; E. coli, especially E. coli strains that have been genetically modified to improve ethanol yield; Clostridium, such as Clostridium acetobutylicum, Chlostridium thermocellum and Chlostridium phytofermentans; Geobacillus sp .; Thermoanaerobacter, such as Thermoanaerobacter saccharolyticum and Bacillus, such as Bacillus coagulans.
In a preferred aspect, the yeast is Saccharomyces spp. In a more preferred aspect, the yeast is Saccharomyces cerevisiae. In another more preferred aspect, the yeast is Saccharomyces distaticus. In another more preferred aspect, the yeast is Saccharomyces uvarum. In another preferred aspect, the yeast is a Kluyveromyces. In another more preferred aspect, the yeast is Kluyveromyces marxianus. In another more preferred aspect, the yeast is Kluyveromyces fragilis. In another preferred aspect, the yeast is a Candida. In another more preferred aspect, the yeast is Candida boidinii. In another more preferred aspect, the yeast is Candida brassicae. In another more preferred aspect, the yeast is Candida diddensii. In another more preferred aspect, the yeast is Candida pseudotropicalis. In another more preferred aspect, the yeast is Candida utilis. In another preferred aspect, the yeast is a Clavispora. In another more preferred aspect, the yeast is Clavispora lusitaniae. In another more preferred aspect, the yeast is Clavispora opuntiae. In another preferred aspect, the yeast is a Pachysolen. In another more preferred aspect, the yeast is Pachysolen tannophilus. In another preferred aspect, the yeast is a Pichia. In another more preferred aspect, the yeast is a Pichia stipitis. In another preferred aspect, the yeast is a Bretannomyces. In another more preferred aspect, the yeast is Bretannomyces clausonii (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212) .
Bacteria that can efficiently ferment hexose and pentose to ethanol include, for example, Zymomonas mobilis, Clostridium acetobutylicum, Clostridium thermocellum, Chlostridium phytofermentans, Geobacillus sp., Thermoanaerobacter saccharolyticum and Bacillus coagulans (Philippidis, 1996, supra.
In a preferred aspect, the bacterium is a Zymomonas. In a more preferred aspect, the bacterium is a Zymomonas mobilis. In another preferred aspect, the bacterium is a Clostridium. In another more preferred aspect, the bacterium is a Clostridium thermocellum.
Commercially available yeast suitable for ethanol production includes, for example, ETHANOL REDTM yeast (FermentislLesaffre, USA), FALI ™ (Fleischmann's Yeast, USA), SUPERSTART ™ fresh yeast and THERMOSACC ™ (Ethanol Technology, WI, USA), BIOFERM ™ AFT and XR (NABC - North American Bioproducts Corporation, GA, USA), GERT STRAND ™ (Gert Strand AB, Sweden) and FERMIOL ™ (DSM Specialties).
In a preferred aspect, the fermentation microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as use of xylose, use of arabinose and xylose and micro-organisms from co-use of arabinose.
The cloning of heterologous genes in various fermentation microorganisms has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (cofermentation) (Chen and Ho, 1993, Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae, Appl Biochem. Biotechnol. 39-40: 135-147; Ho et al., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy, 1993, Xylose Fermentation by Saccharomyces cerevisiae, Appl. Microbiol. Biotechnol. 38: 776-783; Walfridsson et al., 1995, Xylosemetabolizing Saccharomyces cerevisiae strains overexpressing the TKL1 and
TALI genes finding the pentose phosphate pathway enzymes transketolase and transaldolase, Appl. Environ. Microbiol. 61: 4184-4190; Kuyper et al., 2004, Minimal metabolic engineering from Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of principle, FEMS Yeast Research 4: 655-664; Beall et al., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech. Bioeng. 38: 296-303; Ingram et al., 1998, Metabolic engineering of bacteria for ethanol production, Biotechnol. Bioeng. 58: 204-214; Zhang et al., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis, Science 267: 240-243; Deanda et al., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ. Microbiol. 62 ‘. 4465-4470; WO 2003/062430, xylose isomerase).
In a preferred aspect, the genetically modified fermentation microorganism is Saccharomyces cerevisiae. In another preferred aspect, the genetically modified fermentation microorganism is Zymomonas mobilis. In another preferred aspect, the genetically modified fermentation microorganism is Escherichia coli. In another preferred aspect, the genetically modified fermentation microorganism is Klebsiella oxytoca. In another preferred aspect, the genetically modified fermentation microorganism is Kluyveromyces sp.
It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.
The fermentation microorganism is typically added to lignocellulose or degraded hydrolyzate and fermentation is carried out for about 8 to about 96 hours, such as about 24 to about 60 hours. The temperature is typically between about 26 ° C to about 60 ° C, in particular about 32 ° C or 50 ° C and about pH 3 to about pH 8, such as about pH 4-5 , 6, or 7.
In a preferred aspect, yeast and / or another microorganism is applied to the degraded cellulosic material and fermentation is carried out for about 12 to about 96 hours, as is typically 24 to 60 hours. In a preferred aspect, the temperature is preferably between about 20 ° C to about 60 ° C, more preferably at about 25 ° C to about 50 ° C and most preferably at about 32 ° C to about 50 ° C, in particular at about 32 ° C or 50 ° C and the pH is generally from about pH 3 to about pH 7, preferably at about pH 4-7. However, some fermentation organisms, for example, bacteria, have a higher fermentation temperature. Yeast or other microorganisms are preferably applied in amounts of approximately 10 to 10, preferably
10 8 approximately 10 to 10, especially approximately 2 x 10 viable cell count per ml of fermentation broth. Additional guidance regarding the use of yeast by fermentation can be seen in, for example, The Alcohol Textbook (Editors K. Jacques, TP Lyons and DR Kelsall, Nottingham University Press, United Kingdom 1999), which is therefore incorporated into this by reference .
For ethanol production, following fermentation, the fermented paste is distilled to the ethanol extract. The ethanol obtained according to the methods of the invention can be used as, for example, fuel ethanol, ethanol for drinks, i.e., potable neutral alcohols, industrial ethanol.
A fermentation stimulator can be used in combination with any of the processes described herein to improve the fermentation process and in particular, the performance of the fermentation microorganism, such as, intensification of the ethanol rate and yield. A fermentation stimulator refers to stimulators for the development of fermentation microorganisms, in particular, yeast. Preferred fermentation stimulators for development include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavins and vitamins A, B, C, D and E. See, for example, Alfenore et al ., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is therefore incorporated into this by reference. Examples of minerals include minerals and minerals that can provide nutrients that comprise P, K, Mg, S, Ca, Fe, Zn, Mn and Cu.
Fermentation products: A fermentation product can be any substance derived from fermentation. The fermentation product can be, without limitation, an alcohol (for example, arabinitol, butanol, ethanol, glycerol, methanol, 1,3-propanediol, sorbitol and xylitol); an organic acid (for example, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diceto-D-gluconic acid, formic acid, fumaric acid, gluconic acid, gluconic acid, glucuronic acid, glutaric acid , 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid and xylonic acid); a ketone (for example, acetone); an amino acid (for example, aspartic acid, glutamic acid, glycine, lysine, serine and threonine) and a gas (for example, methane, hydrogen (H ₂ ), carbon dioxide (CO ₂ ) and carbon monoxide (CO)) . The fermentation product can also be protein as a high value product.
In a preferred aspect, the fermentation product is an alcohol. It will be understood that the term "alcohol" includes a substance that contains one or more hydroxyl moieties. In a more preferred aspect, the alcohol is arabinitol. In another more preferred aspect, the alcohol is butanol. In another more preferred aspect, the alcohol is ethanol. In another more preferred aspect, the alcohol is glycerol. In another more preferred aspect, the alcohol is methanol. In another more preferred aspect, the alcohol is 1,3-propanediol. In another more preferred aspect, the alcohol is sorbitol. In another more preferred aspect, the alcohol is xylitol. See, for example, Gong, CS, Cao, NJ, Du, J. and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Silveira, Μ. M. and Jonas, R., 2002, The biotechnological production of sorbitol, Appl. Microbiol. Biotechnol. 59: 400-408; Nigam, P. and Singh, D., 1995, Processes for fermentative production of xylitol - a sugar substitute, Process Biochemistry 30 (2): 117-124; Ezeji, T. C., Qureshi, N. and Blaschek, Η. P., 2003, Production of acetone, buthanol and ethanol by Clostridium beijerinckii BA101 and in situ recovery by gas stripping, World Journal of Microbiology andBiotechnology 19 (6): 595-603.
In another preferred aspect, the fermentation product is an organic acid. In another more preferred aspect, the organic acid is acetic acid. In another more preferred aspect, the organic acid is acetonic acid. In another more preferred aspect, the organic acid is adipic acid. In another more preferred aspect, the organic acid is ascorbic acid. In another more preferred aspect, the organic acid is citric acid. In another more preferred aspect, the organic acid is 2,5-diceto-D-gluconic acid. In another more preferred aspect, the organic acid is formic acid. In another more preferred aspect, the organic acid is fumaric acid. In another more preferred aspect, the organic acid is glucaric acid. In another more preferred aspect, the organic acid is gluconic acid. In another more preferred aspect, the organic acid is glucuronic acid. In another more preferred aspect, the organic acid is glutaric acid. In another preferred aspect, the organic acid is 3-hydroxypropionic acid. In another more preferred aspect, the organic acid is itaconic acid. In another more preferred aspect, the organic acid is lactic acid. In another more preferred aspect, the organic acid is malic acid. In another more preferred aspect, the organic acid is malonic acid. In another more preferred aspect, the organic acid is oxalic acid. In another more preferred aspect, the organic acid is propionic acid. In another more preferred aspect, the organic acid is succinic acid. In another more preferred aspect, the organic acid is xylonic acid. See, for example, Chen, R. and Lee, Y. Y., 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl. Biochem. Biotechnol. 63-65: 435-448.
In another preferred aspect, the fermentation product is a ketone. It will be understood that the term "ketone" includes a substance that contains one or more portions of ketone. In another more preferred aspect, the ketone is acetone. See, for example, Qureshi and Blaschek, 2003, supra.
In another preferred aspect, the fermentation product is an amino acid. In another more preferred aspect, the organic acid is aspartic acid. In another more preferred aspect, the amino acid is glutamic acid. In another more preferred aspect, the amino acid is glycine. In another more preferred aspect, the amino acid is lysine. In another more preferred aspect, the amino acid is serine. In another more preferred aspect, the amino acid is threonine. See, for example, Richard, A. and Margaritis, A., 2004, Empirical modeling of batch Fermentation kinetics for poly (glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering 87 (4): 501 a515.
In another preferred aspect, the fermentation product is a gas. In another more preferred aspect, the gas is methane. In another more preferred aspect, the gas is H ₂ . In another more preferred aspect, the gas is CO ₂ . In another more preferred aspect, the gas is CO. See, for example, Kataoka, N., A. Miya and K. Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and
Technology 36 (6-7): 41 to 47 and Gunaseelan V.N. in Biomass and Bioenergy, Vol. 13 (1 to 2), pp. 83-114, 1997, Anaerobic digestion of biomass for methane production: A review.
Recovery. Fermentation products can optionally be recovered from the fermentation medium using any method known in the art including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation, or extraction. For example, alcohol is separated from the fermented cellulosic material and purified by conventional distillation methods. Ethanol with a purity of up to about 96% by volume can be obtained, which can be used as, for example, fuel ethanol, ethanol for beverages, that is, neutral potable alcohols, industrial ethanol.
Other uses
The polypeptides of the present invention can also be used with limited activity from other xylanolitic enzymes to degrade xylans for the production of oligosaccharides. Oligosaccharides can be used as bulking agents, similar to arabinoxylan oligosaccharides released from the cereal cell wall material, or mannan or less purified arabonixilans from cereals.
The polypeptides of the present invention can also be used in combinations with other xylanolitic enzymes to degrade xylans to xylose and other monosaccharides (U.S. Patent No. 5,658,765). The released xylose can be converted to other compounds.
The polypeptides of the present invention can be used together with other glucanase-like enzymes to improve oil extraction from oil-rich plant material, similar to corn oil and corn embryos.
The polypeptides of the present invention can also be used in cooking to improve the development, elasticity and / or stability of dough and / or the volume, fragmented structure and / or anti-aging properties of the baked product (see US Patent No. 5,693,518 ). Polypeptides can also be used for the preparation of pasta or baked products prepared from any type of flour or cereal (for example, based on cereal, rye, barley, oats or corn). Baked products produced with a polypeptide of the present invention include breads, baguettes and the like. For cooking purposes a polypeptide of the present invention can be used as only or greater enzyme activity, or can be used in combinations with other enzymes such as a xylanase, a lipase, an amylase, an oxidase (eg, glucose oxidase, peroxidase ), a laccase and / or a protease.
The polypeptides of the present invention can also be used to modify animal feeds, they can exert their effects in vitro (by modifying food components) or in vivo to improve the digestibility of feed and increase the efficiency of this use (US Patent No. 6,245 .546). Polypeptides can be added to animal feed compositions containing high amounts of arabinoxylans and glucuronoxylans, for example, food containing cereals such as barley, cereal, rye, oats or corn. When added to the food, the polypeptide will improve the in vivo breakdown of plant cell wall material partially due to a reduction in intestinal viscosity (Bedford et al., 1993, Proceedings of the 1st Symposium on Enzymes in Animal Nutrition, pp. 73-77) , therefore the improved utilization of plant nutrients by the animal is achieved. Therefore, the rate of development and / or conversion rate of the food (i.e., the weight of the food eaten relative to the weight gain) of the animal is improved.
The polypeptides of the present invention can also be used in the pulp and paper industry, inter alia, in bleaching processes to enhance the brightness of bleached pulps by which an amount of
100 chlorine used in the bleaching stages is reduced and to increase the freedom of the recycled paper process (Eriksson, 1990, Wood Science and Technology 24: 79-101; Paice et al., 1988, Biotechnol. And Bioeng. 32: 235 -239 and Pommier et al., 1989, Tappi Journal 187-191). The treatment of lignocellulosic pulp can be carried out, for example, as described in U.S. Patent NO. 5,658,765, WO 93/08275, WO 91/02839 and WO 92/03608.
The polypeptides of the present invention can also be used in the preparation of beer, in particular to improve the filterability of must containing, for example, barley and / or sorghum malt (WO 2002/24926). Polypeptides can be used in the same way as pentosanases conventionally used for preparation, for example, as described by Vietor et al., 1993, J. Inst. Brew. 99: 243-248 and EP 227159. In addition, polypeptides can be used to treat spent brewer's grain, i.e. residues from the production of beer must containing malted barley or barley or other cereals, in order to improve utilization waste by, for example, animal feed.
The polypeptides of the present invention can be used for the separation of components from plant cell materials, in particular from cereal components, such as wheat components. Of particular interest is the separation of wheat into gluten and starch, that is, components of considerable commercial interest. The separation process can be carried out using methods known in the art, such as the so-called dough process (or wet grinding process) carried out as a decanter or hydroclone process. In the dough process, the material and starting is a pumpable diluted dispersion of the plant material such as wheat to be subjected to separation. In a wheat separation process the dispersion is usually made from wheat flour and water.
The polypeptides of the invention can also be used in the preparation of fruit or vegetable juices in order to increase yield (see,
101 for example, U.S. Patent NO. 6,228,630).
The polypeptides of the present invention can also be used as a component of an enzymatic textile counting system (see, for example, U.S. Patent No. 6,258,590).
The polypeptides of the present invention can also be used in laundry detergent applications in combinations with other enzyme functionalities (see, for example, U.S. Patent No. 5,696,068).
Flag peptide
The present invention also relates to an isolated polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2. The polynucleotide may further comprise a gene that encodes a protein, which is operably linked to the signal peptide. The protein is preferably foreign to the signal peptide. In one aspect, the polynucleotide for the signal peptide are nucleotides 1 to 57 of SEQ ID NO: 1.
The present invention also relates to the nucleic acid constructs, expression vectors and recombinant host cells that comprise such a polynucleotide.
The present invention also concerns methods of producing a protein, which comprises: (a) cultivating a recombinant host cell comprising such a polynucleotide and (b) recovering the protein.
The protein can be natural or heterologous to a host cell. The term "protein" is not meant here to refer to a specific length of the encoded product and therefore encompasses peptides, oligopeptides and polypeptides. The term "protein" also encompasses two or more polypeptides combined to form the encoded product. Proteins also include hybrid polypeptides and fused polypeptides.
102
Preferably, the protein is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody, or portion thereof, or reporter. For example, the protein may be an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esteroxidase, galactose, esteroxidase, betagalactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, other lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylan.
The gene can be obtained from any prokaryotic, eukaryotic or other source.
The present invention is further described by the following examples which should not be construed as limiting the scope of the invention. Material Examples
The chemicals used as buffers and substrates were commercial products of at least reagent grade.
Strains
The strain Trichophaea saccata CBS 804.70 was used as the source of a gene that encodes a GH10 xylanase family. Saccharomyces cerevisiae strain W3124 (MATa; ura 3-52; read 2-3, 112; his 3D200; pep 4-1137; prcl :: HIS3; prbl :: LEU2; cir ⁺ ) was used for the evaluation of the expression libraries of strain Trichophaea saccata CBS 804.70 for xylanase activity. The Aspergillus oryzae BECh2 strain (alpha-amylase-negative) was used for the expression of the Trichophaea saccata ghlOa gene.
Means and solutions
The PDA plates were composed of 39 g of potato dextrose agar and 1 liter deionized water.
103
The ΜΕΧ-1 medium was composed of 20 g of soy flour, 15 g of wheat bran, 10 g of microcrystalline cellulose (AVICEL®; FMC, Philadelphia, PA, USA), 5 g of maltodextrin, 3 g of Bactopeptone, 0.2 g pluronic, 1 g olive oil and 1 liter deionized water.
The LB medium was composed of 10 g of tryptone, 5 g of yeast extract and 5 g of sodium chloride and deionized water to 1 liter.
The LB ampicillin medium was composed of 50 mg of ampicillin (sterilized by filter, added after autoclaving) per liter of LB medium.
The LB ampicillin plates were composed of 15 g of bacto agar per liter of LB ampicillin medium.
The YPD medium was composed of 1% yeast extract, 2% peptone and 2% sterilized glucose by filter added after autoclave.
The SC-URA medium with glucose or galactose was composed of 100 ml of 10X Basal salts, 25 ml of 20% casamino acids without vitamins, 10 ml of 1% tryptophan, 4 ml of 5% threonine (sterilized by filter, added after autoclave) and 100 ml of 20% glucose or 100 ml of 20% galactose (sterilized by filter, added after autoclave) and 1-liter deionized water.
The 10X Basal saline solutions consisted of 75 g of yeast nitrogen base, 113 g of succinic acid, 68 g of NaOH and 1 liter deionized water.
The SC agar plates were composed of 20 g of agar per liter of the SC-URA medium (with glucose or galactose as indicated).
The 0.1% AZCL xylan SC-URA agar plates with galactose were composed of 20 g agar per liter of SC-URA galactose medium and 0.1% AZCL xylan oatmeal (Megazyme, Wicklow, Ireland).
The SC-URA medium with galactose was composed of 900 ml of SC-Grund agar (subjected to autoclave), 4 ml of 5% threonine (filter sterilized) and 100 ml of 20% galactose (filter sterilized).
104
SC-Grund agar was composed of 7.5 g of yeast nitrogen base (without amino acids), 11.3 g of succinic acid, 6.8 g of sodium hydroxide, 5.6 g of casamino acids, 0.1 g of L-tryptophan, 20 g of agar and deionized water at 1 liter.
The COVE plates were composed of 342.3 g of sucrose, 25 g of Noble agar, 20 ml of COVE saline solutions, 10 mM acetamide, 20 mM CsCl and 1 liter deionized water. The solution was adjusted to pH 7.0 before the autoclave.
The COVE saline solutions were composed of 26 g of KC1, 26 g of MgSO ₄ 7H ₂ O, 76 g of KH ₂ PO ₄ , 50 ml of trace metal COVE solution and 1 liter deionized water.
The COVE trace metal solution was composed of 0.04 g of NaB ₄ O710H ₂ O, 0.4 g of CuSO ₄ 5H ₂ O, 1.2 g of FeSO ₄ 7H ₂ O, 0.7 g of MnSO ₄ H ₂ O, 0.8 g Na ₂ MoO ₂ 2H ₂ O, 10 g ZnSO ₄ 7H ₂ O and deionized water at 1 liter.
The MDU2BP medium was composed of 45 g of maltose, 1 g of MgSO ₄ 7H ₂ O, 1 g of NaCl, 2 g of K ₂ SO ₄ , 12 g of KH ₂ PO ₄ , 7 g of yeast extract, 2 g of urea, 0.5 ml of AMG trace metal solution; pH 5.0 and 1 liter deionized water.
The AMG trace metal solution was composed of 14.3 g of ZnSO ₄ '7H ₂ O, 2.5 g of CuSO ₄ 5H ₂ O, 0.5 g of NiCl ₂ 6H ₂ O, 13.8 g of FeSO ₄ 7H ₂ O, 8.5 g of MnSO ₄ 7H ₂ O, 3 g of citric acid and deionized water at 1 liter.
Example 1: Construction of Trichophaea saccata CBS 804.70 cDNA expression libraries in Saccharomyces cerevisiae
Trichophaea saccata CBS 804.70 was inoculated on a PDA plate and incubated for 7 days at 28 ° C. Several mycelium PDA agar buffers were inoculated into 750 ml of shaking flasks containing 100 ml of MEX-1 medium. The flasks were shaken at 150 rpm for 9 days at 37 ° C.
105 fungal mycelia were collected by filtration through M1RACLOTH® (Calbiochem, San Diego, CA, USA) before being frozen in liquid nitrogen. The mycelia were then sprayed into a powder by grinding the frozen mycelia together with an equal volume of dry ice in a ground coffee pre-cooled with liquid nitrogen. The powder was transferred to a pestle pre-cooled with liquid nitrogen and crushed into a powder with a smaller amount of cooked quartz sand. The mycelial material in powder form was kept at -80 ° C until use.
Total RNA was prepared from the powdered mycelium, frozen Trichophaea saccata CBS 804.70 by extraction with guanidium thiocyanate followed by ultracentrifugation using a 5.7 M CsCl pad according to Chirgwin et al., 1979, Biochemistry 18 : 5294-5299. PolyA-enriched RNA was isolated by oligo (dT) -cellulose affinity chromatography according to aviv et al., 1972, Proc. Natl. Acad. Know. USA 69: 1408-1412.
The double stranded cDNA was synthesized according to the general methods of Gubler and Hoffman, 1983, Gene 25: 263-269; Sambrook, J., Fritsch, EF and Maniantis, T. Molecular Cloning: A Laboratory Manual, 2 ed, 1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York and Kofod et al, 1994, J. Biol... Chem. 269: 29182-29189, using a polyA-Not I primer (Promega Corp., Madison, Wisconsin, USA). After synthesis, the cDNA was treated with mung bean nuclease, abrupt end with T4 DNA polymerase and linked to a 50-fold molar excess of Eco RI adapters (Invitrogen Corp., Carlsbad, CA, USA). The cDNA was cleaved with Not I and the cDNA was fractionated by size by 0.8% agarose gel electrophoresis using 44 mM Tris base, 44 mM boric acid, 0.5 mM EDTA buffer (TBE). The 700 bp and more cDNA fraction was taxed from the gel and purified using a GFX® PCR DNA and Gel Strip Purification Kit (Amersham Biosciences, United Kingdom) according to the instructions of the
106 manufacturer.
The size-fractionated, directional cDNA was ligated into Eco RI-Not I cleaved pYES 2.0 (Invitrogen, Carlsbad, CA, USA). The binding reactions were performed by incubation at 16 ° C for 12 hours, then heated to 70 ° C for 20 minutes and finally adding 10 μΐ of water to each tube. One μΐ of each ligation mixture was electroporated into 40 μΐ of electrocompetent E. coli DH10B cells (Invitrogen Corp., Carlsbad, CA, USA) as described by Sambrook et al., 1989, supra.
The Trichophaea saccata CBS 804.70 library was established in E. coli consisting of groups. Each group was made by expanding E. coli transformed into LB ampicillin plates, producing 15,000-30,000 colonies / plates after incubation at 37 ° C for 24 hours. Twenty ml of LB medium was added to the plates and the cells were resuspended there. The cell suspension was shaken in a 50 ml tube per hour at 37 ° C.
Plasmid DNA from several library groups of T. saccata CBS 804.70 was isolated using a Midi Plasmid kit plasmid (QIAGEN Inc., Valencia, CA, USA), according to the manufacturer's instructions and stored at -20 ° C.
Example 2: Evaluation of Trichophaea saccata CBS 804.70 expression libraries for xylanase activity
One μΐ aliquots of plasmid DNA purified from several library groups were transformed into S. cerevisiae W3124 by electroporation (Becker and Guarante, 1991, Methods Enzymol. 194: 182187) and the transformants were placed on SC agar plates containing 2 % glucose and incubated at 30 ° C. In total, 50 to 100 plates containing 250 to 400 yeast colonies were obtained from each group. After 3 to 5 days of incubation, the SC agar plates were replicated placed in a series of 0.1% AZCL xylan (oat) SC-URA agar plates with galactose. The plates were incubated for 2 to 4 days at 30 ° C and xylanase positive colonies
107 were identified as colonies surrounded by a blue halo. The positive clones were purified for trace and obtained as simple colonies. Example 3: Characterization of the Trichophaea saccata CBS 804.70 ghlOa gene
Yeast colonies expressing xylanase were inoculated into 5 ml of YPD medium in 25 ml tubes. The tubes were shaken overnight at 30 ° C. One ml of culture was centrifuged to clear the yeast cells.
The DNA was isolated according to WO 94/14953 and dissolved in 50 μΐ of water. The DNA was transformed into E. coli DH10B using standard procedures (Sambrook et al., 1989, supra).
Plasmid DNA was isolated from E. coli transformants using standard procedures (Sambrook at al., 1989, supra). The plasmids were sequenced using both pYES primers as sequencing primers. A specific 1283 bp plasmid clone indicated TF12Xyll70 was observed to encode a 10 glycoside hydrolase protein family and was further characterized. The most reliable sequence was obtained by further sequencing the fragment using the specific primers shown below designed based on the initial sequence:
TF12Xyll70Fl:
5’-TGAAATGGGATGCTACTGA-3 '(SEQ ID NO: 3)
TF12Xyll70F2:
5-CAACGACTACAACATCGAGG-3 '(SEQ ID NO: 4)
TF12Xyll70Rl:
5'-ATTTGCTGTCCACCAGTGAA-3 '(SEQ ID NO: 5)
A plasmid matching the original cDNA sequence was indicated pTF12Xyll70 and the E. coli strain containing this clone was indicated E. coli pTF12Xyll70 and deposited on July 28, 2009, with the Agricultural Research Service Patent Culture Collection, Northem Regional Research Center, Peoria, IL, USA and designs the accession number NRRL B108
50309.
The nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of the Trichophaea saccata ghlOa gene are shown in Figure 1. The coding sequence is 1197 bp including the stop codon. The predicted encoded protein contains 398 amino acids. The% G + C of the gene coding region is 53.6% and the mature polypeptide coding region is also 53.6%. Using the SignalP program, version 3 (Nielsen et al., 1997, Protein Engineering 10: 1 to 6), a 19-residue signal peptide was predicted. The predicted mature protein contains 379 amino acids with a predicted molecular mass of 40.4 kDa.
Analysis of the deduced amino acid sequence of the ghlOa gene with the Interproscan program (Zdobnov and Apweiler, 2001, Bioinformatics 17: 847-848) showed that the GH10A protein contained in the typical core sequence of a 10 glycoside hydrolase family, which extends from approximately amino acid residue 65 to residue 377 of the predicted mature polypeptide. The GH10A protein also contains the sequence signature of a type I fungal cellulose binding domain (CBMI). This sequence signature known as Prosite Entry PS00562 (Sigrist et al., 2002, Brief Bioinform. 3: 265-274) is present from amino acid residue 8 to residue 35 of the predicted mature polypeptide.
A global alignment in the form of comparative pairs of amino acid sequences was determined using the NeedlemanWunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the EMBOSS Needle Program with slit opening penalty of 10, crack extension penalty of 0.5 and the EBLOSUM62 matrix. The alignment showed that the deduced amino acid sequence of the Trichophaea saccata gene encoding the mature GH10A polypeptide formed 62.6% and 62.0% identity (exclusion slits) to the deduced amino acid sequence of the 10 hydrolase protein family.
109 Phanerochaete chrysosporium and Meripilus giganteus glycoside, respectively (UNIPROT accession numbers: B7SIW2 and GENESEQP: AAW23327, respectively).
Example 4: Expression of the Trichophaea saccata CBS 804.70 ghlOa gene in Aspergillus oryzae.
The Trichophaea saccata CBS 804.70 ghlOa gene was labeled from pTF12xyll70 using Barn HI and Xho I and ligated into the Aspergillus expression vector pDAulO9 (WO 2005/042735), also digested with Bam HI and Xho I, using standard methods (Sambrook et al., 1989, supra). The ligation reaction was transformed into chemically competent E. coli TOP 10 cells according to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA). Eight colonies were grown overnight on ampicillin LB and plasmid DNA was isolated using a QlAprep Spin Miniprep kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's directions. Plasmids containing the correct sized inserts were sequenced to determine the integrity and orientation of the inserts. Plasmid pDAu81 # 5 was found to be error free and was therefore chosen by scale-up.
The protoplasts of Aspergillus oryzae BECH2 were prepared as described in WO 95/02043. A. oryzae BECh2 was constructed as described in WO 00/139322. One hundred microliters of protoplast suspension were mixed with 5-25 pg of the Aspergillus pDAu81 # 5 expression vector in 10 μΐ STC composed of 1.2 M sorbitol, 10 mM TrisHC1, pH 7.5, 10 mM CaCl ₂ (Christensen et al., 1988, Bio / Technology 6: 1419-1422). The mixture was left at room temperature for 25 minutes. Two hundred microliters of 60% PEG 4000 (BDH, Poole, England) (polyethylene glycol, molecular weight 4,000), 10 mM CaCl ₂ and 10 mM TrisHC1 pH 7.5 were added and gently mixed and finally 0.85 ml of the same solution was added and gently mixed. The mixture was
110 left at room temperature for 25 minutes and then centrifuged at 2,500 x g for 15 minutes. The granule was resuspended in 2 ml of 1.2 M sorbitol. This sedimentation process was repeated and the protoplasts were dispersed in the COVE plates. After incubation for 4 to 7 days at 37 ° C, spores were selected and expanded in COVE plates containing 0.01% TRITON® X-100 in order to isolate the simple colonies. The expansion was repeated twice more in COVE sucrose medium (Cove, 1996, Biochim. Biophys. Acta 133: 51 to 56) containing 1 M sucrose and 10 mM sodium nitrate.
Ten of the transformants were each inoculated into 10 ml of the YPG medium. After 3 to 4 days of incubation at 30 ° C, 200 rpm, the supernatants were removed and analyzed by SDSPAGE 10% Bis-Tris gels (Invitrogen, Carlsbad, CA, USA) as recommended by the manufacturer. The gels were stained with Coomassie blue and all isolates presented a diffuse group between 35 and 45 kDa. These transformants were further analyzed for xylanase activity at pH 6.0 using a modified AZCL-arabinoxylan as a substrate (wheat; Megazyme Intemational Ireland, Ltd., Bray, Co. Wicklow, Ireland) in 0.2 M sodium phosphate buffer pH 6.0 containing 0.01% TRITON® X-100 according to the manufacturer's instructions. The transformant that produces the highest level of activity was chosen for the production of xylanase.
The transformant that produces the highest level of activity was developed using standard methods. The broth was filtered using Whatmann GF / D, GF / A, GF / C, GF / F glass filters (2.7 pm, 1.6 pm, 1.2 pm and 0.7 pm, respectively) (Whatman , Piscataway, NJ, USA) followed by filtration using a 0.45 pm filter from the top of the NALGENE® flask (Thermo Fisher Scientific, Rochester, NY, USA).
The ammonium sulfate was added to the filtered broth at a final concentration of 3 M and the precipitate was collected after centrifugation at 10,000 x g for 30 minutes. The precipitate was dissolved in 10 mM of
111
Tris / HCI pH 8.0 and dialyzed against 10 mM Tris / HCI pH 8.0 overnight. The dialyzed preparation was applied to a 150 ml Q SEPHAROSE® Fast flow column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 10 mM Tris / HCI pH 8.0 and the enzyme was eluted with a 1050 linear salt gradient ml (7 column volumes) from 0 to 1 M NaCl in 10 mM Tris / HCI pH 8.0. Elution was followed at 280 nm and fractions were collected and subjected to the xylanase activity assay using 0.2% wheat AZCLarabinoxylan in 0.2 M sodium phosphate buffer pH 6.0 containing 0.01% TRITON® X-100 at 37 ° C. Fractions containing xylanase activity were joined and stored at -20 ° C.
Example 5: Preparation of Aspergillus fumigatus NN055679 Cel7A cellobiohydrolase I
A tfasty search (Pearson et al., 1997, Genomics 46: 24-36) for the partial genome sequence Aspergillus fumigatus (The Institute for Genomic Research, Rockville, MD) was performed using a Trichoderma cell7 cellobiohydrolase sequence as a question reesei (Accession NO. P00725). Several genes have been identified as GH7 homologues of the putative family based on a high degree of similarity of the sequence in question at the amino acid level. A genomic region with significant identity of the sequence in question was chosen by the additional study and the corresponding gene was named cel7A.
Two synthetic oligonucleotide primers shown below were designed by PCR Amplification to a cellobiohydrolase I gene Aspergillus fumigatus NN055679 cel7A (SEQ ID NO: 6 [DNA sequence] and SEQ ID NO: 7 [deduced amino acid sequence]) from genomic DNA Aspergillus fumigatus prepared as described in WO 2005/047499.
Advanced launcher:
5'-gggcATGCTGGCCTCCACCTTCTCC-3 '(SEQ ID NO: 8)
112
Reverse launcher:
5'-gggttaattaaCTACAGGCACTGAGAGTAA-3 '(SEQ ID NO: 9)
The upper case letters represent the coding sequence. The remainder of the sequence provides the Sph I and Pac I restriction endonuclease sites in the forward and reverse sequences, respectively. Using these primers, the Aspergillus fumigatus cel7A gene was amplified using standard PCR methods and the reaction product isolated by 1% agarose gel electrophoresis using 40 mM Tris base 20 mM sodium acetate 1 mM EDTA (TAE) buffer and purified using a QIAQUICK® gel extraction kit (QIAGEN Inc., Valencia, CA, USA) according to the manufacturer's instructions.
The fragment was digested with Sph I and Pac I and ligated into the expression vector pAlLo2 (WO 2004/099228) also digested with Sph I and Pac I according to standard procedures. The ligation products were transformed into E. coli XL10 SOLOPACK® cells (Stratagene, La Jolla, CA, USA) according to the manufacturer's instructions. An E. coli transformant containing a plasmid of the correct size was detected by restriction digest and plasmid DNA was prepared using a BIOROBOT® 9600 (QIAGEN Inc., Valencia, CA, USA). DNA sequencing of the insertion gene from the plasmid was performed with an automatic DNA sequencer model Perkin-Elmer Applied Biosystems 377 XL (Perkin-Elmer / Applied Biosystems, Inc., Foster City, CA, USA) using dye- terminator (Giesecke et al., 1992, Journal of Virology Methods 38: 47-60) and primer walking strategy. The nucleotide sequence data were examined for quality and all sequences were compared on each other with assistance from the PHRED / PHRAP software (University of Washington, Seattle, WA, USA).
The nucleotide sequence has been shown to match
113 genomic sequences determined by TIGR (SEQ ID NO: 6 [DNA sequence] and SEQ ID NO: 7 [deduced amino acid sequence]). The resulting plasmid was named pEJG93.
The Aspergillus oryzae JaL250 protoplasts (WO 99/61651) were prepared according to the method of Christensen et al., 1988, supra and transformed with 5 pg of pEJG93 (as well as pAlLo2 as a vector control). The transformation produced about 100 transformants. Ten transformants were isolated to individual plate PDAs.
The confluent plate PDAs from five of the ten transformants were washed with 5 ml of 0.01% TWEEN® 20 and separately inoculated in 25 ml of the MDU2BP medium in 125 ml glass shake flasks and incubated at 34 ° C, 250 rpm . Five days after incubation, 0.5 μΐ of supernatant from each culture was analyzed using 8 to 16% of the Tris-Glycine SDS-PAGE gels (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The SDS-PAGE profiles of the cultures shown that one of the transformants has a larger group of approximately 70 kDa. This transformant was named Aspergillus oryzae JaL250EJG93.
Five hundred ml of the shake bottle medium was added to a 2800 ml shake bottle. The shake flask medium was composed of 45 g of maltose, 2 g of K ₂ HPO ₄ , 12 g of KH ₂ PO ₄ , 1 g of NaCl, 1 g of MgSO ₄ 7H ₂ O, 7 g of yeast extract , 2 g of urea, 0.5 ml of trace element solution and 1 liter deionized water. The trace element solution was composed of 13.8 g FeSO ₄ 7H ₂ O, 14.3 g ZnSO ₄ 7H ₂ O, 8.5 g MnSO ₄ H ₂ O, 2.5 g CuSO ₄ 5H ₂ O, 0.5 g of NiCl ₂ 6H ₂ O, 3 g of citric acid and deionized water at 1 liter. Two shake flasks were inoculated with a suspension of a PDA plate of Aspergillus oryzae JaL250EJG93 with 0.01% TWEEN® 80 and incubated at 34 ° C on an orbital shaker at 200 rpm for 120 hours. The broth was filtered using a 0.7 pm Whatman GF / F glass filter (Whatman, Piscataway, NJ,
114
USA) followed by a 0.22 pm EXPRESS ™ Plus membrane (Millipore, Bedford, MA, USA).
The filtered broth was concentrated and buffered with 20 mM Tris-NCI pH 8.5 using a tangential flow concentrator (Pall Filtron, Northborough, MA, USA) equipped with a 10 kDa polyethersulfone membrane (Pall Filtron, Northborough, MA, USA). The protein concentration was determined using a Microplate BCA ™ Protein Assay Kit (Thermo Fischer Scientific, Waltham, MA, USA) in which bovine serum albumin was used as a standard protein.
Example 6: Preparation of Myceliophthora thermophila CBS 117.65 CelóA cellobiohydrolase II
Myceliophthora thermophila CBS 117.65 CelóA cellobiohydrolase II (SEQ ID NO: 10 [DNA sequence] and SEQ ID NO: 11 [deduced amino acid sequence]) was obtained according to the procedure described below.
One hundred ml of the shake flask medium was added to a 500 ml shake flask. The shake flask medium was composed of 15 g of glucose, 4 g of K ₂ HPO ₄ , 1 g of NaCl, 0.2 g of MgSO4'7H ₂ O, 2 g of free acid MES, 1 g of Bacto Peptona , 5 g of yeast extract, 2.5 g of citric acid, 0.2 g of CaCl ₂ 2H ₂ O, 5 g of NH4NO3, 1 ml of trace element solution and 1 liter deionized water. The trace element solution was composed of 1.2 g FeSC> 4 7H ₂ O, 10 g ZnSO ₄ 7H ₂ O, 0.7 g MnSO ₄ H ₂ O, 0.4 g CuSO ₄ 5H ₂ O , 0.4 g Na ₂ B ₄ O ₇ 10H ₂ O, 0.8 g Na ₂ MoO ₂ 2H ₂ O and deionized water at 1 liter. The shaking flask was inoculated with two buffers from the solid plate culture of the strain Myceliophthora thermophila CBS 117.65 and incubated at 45 ° C with shaking at 200 rpm for 48 hours. Fifty ml of the broth from the shake flask was used to inoculate a 2 liter fermentation vessel.
The fermentation batch medium was composed of 5 g of
115 yeast extract, 176 g of cellulose in powder form, 2 g of glucose, 1 g of NaCl, 1 g of Bacto Peptone, 4 g of K ₂ HPO ₄ , 0.2 g of CaCl ₂ -2H ₂ O, 0.2 g of MgSO ₄ 7H ₂ O, 2.5 g of citric acid, 5 g of NH ₄ NO ₃ , 1.8 ml of defoamer, 1 ml of trace element solution (above) and deionized water at 1 liter. The fermentation feed medium was composed of water and anti-foam.
A total of 1.8 liters of the fermentation batch medium was added in a 2 liter glass-lined fermenter (Applikon Biotechnology, Schiedam, Netherlands). The fermentation feed medium was dosed at a rate of 4 g / l / hour over a period of 72 hours. The fermentation vessel was maintained at a temperature of 45 ° C and the pH was controlled using an Applikon 1030 control system (Applikon Biotechnology, Schiedam, Netherlands) at a setpoint of 5.6 +1 to 0.1. Air was added to the container at a rate of 1 wm and the broth was stirred by the Rushton impeller rotating at 1100 to 1300 rpm. At the end of fermentation, the total broth was collected from the container and centrifuged at 3000 x g to remove the biomass.
The broth collected above was centrifuged in 500 ml flasks at 13,000 xg for 20 minutes at 4 ^o C and then filtered sterile using a 0.22 pm polyethersulfone membrane (Millipore, Bedford, MA, USA). The filtered broth was concentrated and exchanged for buffer with 20 mM Tris-HCl pH 8.5 using a tangential flow concentrator equipped with a 10 kDa polyethersulfone membrane at approximately 20 psi (0.13kPa). To decrease the amount of pigment, the concentrate was applied to a 60 ml Q SEPHAROSE ™ Big Bead column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 20 mM Tris-HCl pH 8.5 and step eluted with equilibration buffer containing 600 mM NaCl. Flow and eluate fractions were analyzed on 8-16% CRITERION® SDS-PAGE gels (Bio-Rad Laboratories, Inc., Hercules, CA, USA) stained with GELCODE® Blue Pretreating Reagent (Bio-Rad Laboratories, Inc ., Hercules, CA, USA). THE
The flow fraction contains Myceliophthora thermophila Cel6A cellobiohydrolase as judged by the presence of a corresponding molecular weight group of the apparent weight protein by SDS-PAGE (approximately 75 kDa).
The flow fraction was concentrated using an ultrafiltration device (Millipore, Bedford, MA, USA) equipped with a 10 kDa polyethersulfone membrane at 40 psi, 4 ^o C and mixed with an equal volume of 20 mM Tris-HCl pH 7.5 containing 3.4 M ammonium sulfate to a final concentration of 1.7 M ammonium sulfate. The sample was filtered (0.2 μΜ syringe filter, polyethersulfone membrane, Whatman, Maidstone, United Kingdom) to remove the particulate substance before loading onto a PHENYL SUPEROSE ™ column (HR 16/10, GE Healthcare, Piscataway , NJ, USA) equilibrated with 1.7 M ammonium sulfate in 20 mM Tris-HCl pH 7.5. The binding proteins were eluted with a column 12 volume decreasing the salt gradient from 1.7 M ammonium sulfate to 0 M ammonium sulfate in 20 mM Tris-HCl pH 7.5. The fractions were analyzed by 8 to 16% SDS-PAGE gel electrophoresis as described above, which revealed that Myceliophthora thermophila Cel6A cellobiohydrolase elutes at the end of the gradient (approximately 20 mM ammonium sulfate).
Fractions containing Cel6A cellobiohydrolase II were pooled and diluted 10 times in 20 mM Tris-HCl pH 9.0 (decreasing salt and increasing pH) and then applied to the 1 ml RESOURCE ™ Q column (GE Healthcare, Piscataway, NJ , USA) equilibrated with 20 mM Tris-HCl pH 9.0. The binding proteins were eluted with a volume gradient 20 column of 0 mM salt to 550 mM NaCl in 20 mM Tris-HCl pH 9.0. M. thermophila Cel6A cellobiohydrolase II eluted as an early simple peak in the gradient (approximately 25 mM NaCl). Cellobiohydrolase II was> 90% pure as judged by SDS-PAGE. Concentrations of
117 protein were determined using a BCA protein assay kit in which bovine serum albumin was used as a standard protein.
Example 7: Preparation of Trichoderma reesei RutC30 Cel7B endoglucanase I
Trichoderma reesei RutC30 Cel7B endoglucanase I (EGI) (SEQ ID NO: 12 [DNA sequence] and SEQ ID NO: 13 [deduced amino acid sequence]) was recombinantly prepared according to WO 2005/067531 using Aspergillus oryzae JaL250 as a host .
The collected broth was centrifuged in 500 ml flasks at 13,000 xg for 20 minutes at 4 ^o C and then filtered sterile using a 0.22 pm polyethersulfone membrane (Millipore, Bedford, MA, USA). The filtered broth was concentrated and exchanged for buffer with 20 mM Tris-HCl pH 8.5 using a tangential flow concentrator equipped with a 10 kDa polyethersulfone membrane. The sample was loaded onto a high performance Q SEPHAROSE® column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 20 mM Tris-HCl pH 8.5 and step eluted with equilibration buffer containing 600 mM NaCl. The flow and eluate fractions were analyzed by SGS-PAGE using a CRITERION ™ pretend-free imaging system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The eluate fractions containing Trichoderma reesei Cel7B EGI were pooled, concentrated and exchanged for buffer in 20 mM Tris-HCl pH 8.5. The protein concentration was determined using a Microplate BCA ™ protein assay kit in which bovine serum albumin was used as a standard protein.
Example 8: Preparation of Myceliophthora thermophila CBS 202.75 Cel5A endoglucanase II
Myceliophthora thermophila CBS 202.75 Cel5A endoglucanase II (EGII) (SEQ ID NO: 14 [DNA sequence] and SEQ ID NO: 15 [deduced amino acid sequence]) was recombinantly prepared from
118 according to WO 2007/109441 using Aspergillus oryzae HowB104 as a host.
The culture filtrate was desalted and buffered in 20 mM Tris pH 8.0 using a HIPREP® 26/10 desalination column (GE Healthcare, Piscataway, NJ, USA) according to the manufacturer's instructions. The buffer exchange sample was applied to a MonoQ® column (GE Healthcare, Piscataway, NJ, USA) equilibrated with 20 mM Tris pH 8.0 and the bound protein was eluted with a 0 to 500 mM chloride gradient sodium. The fractions were combined and concentrated in 20 mM Tris pH 8.0. The protein concentration was determined using a Microplate BCA ™ protein assay kit in which bovine serum albumin was used as a standard protein.
Example 9: Preparation of Thermoascus aurantiacus CGMCC 0583 GH61A polypeptide having cellulolytic intensifying activity
The Thermoascus aurantiacus CGMCC 0583 GH61A polypeptide having cellulolytic enhancing activity (SEQ ID NO: 16 [DNA sequence] and SEQ ID NO: 17 [deduced amino acid sequence]) was recombinantly prepared according to WO 2005/074656 using Aspergillus oryzae JaL250 as a host. The recombinantly produced Thermoascus aurantiacus GH61A polypeptide was first concentrated by ultrafiltration using a 10 kDa membrane, exchanged for buffer in 20 mM Tris-HCl pH 8.0 and then purified using a 100 ml Q SEPHAROSE® Big Beads column with 600 ml of 600 ml of a 0-600 mM NaCl linear gradient in the same buffer. The 10 ml fractions were collected and joined based on SDS-PAGE.
The joined fractions (90 ml) were then further purified using a 20 ml MONO Q® column (GE Healthcare, Piscataway, NJ, USA) with 500 ml of a 0-500 mM linear gradient of NaCl in the same buffer. The 6 ml fractions were collected and joined based on SDSPAGE. Fractions
119 units (24 ml) were concentrated by ultrafiltration using a 10 kDa membrane and chromatographed using a 320 ml SUPERDEX® 75 SEC column (GE Healthcare, Piscataway, NJ, USA) with isocratic elution of approximately 1.3 liters of 150 mM NaCl -20 mM Tris-HCl pH 8.0. The 20 ml fractions were collected and joined based on SDS-PAGE. The protein concentration was determined using a Microplate BCA ^1M protein assay kit in which bovine serum albumin was used as a standard protein.
Example 10: Preparation of Thielavia terrestris NRRL 8126 GH61E polypeptide having cellulolytic intensifying activity
The Thielavia terrestris NRRL 8126 GH61E polypeptide having cellulolytic enhancing activity (SEQ ID NO: 18 [DNA sequence] and SEQ ID NO: 19 [deduced amino acid sequence]) was recombinantly prepared according to U.S. Patent NO. 7,361,495 using Aspergillus oryzae JaL250 as a host.
The filtered culture broth was desalted and buffered in 20 mM sodium acetate-150 mM NaCl pH 5.0 using a HIPREP® 26/10 desalination column according to the manufacturer's instructions. The protein concentration was determined using a Microplate BCA ™ protein assay kit in which bovine serum albumin was used as a standard protein.
Example 11: Preparation of Penicillium brasilianum IBT 20888 Cel3A betaglucosidase
Penicillium brasilianum IBT 20888 Cel3A beta-glucosidase (SEQ ID NO: 20 [DNA sequence] and SEQ ID NO: 21 [deduced amino acid sequence]) was recombinantly prepared according to WO 2007/019442 using Apergillus oryzae as a host.
The filtered broth was concentrated and exchanged for buffer using a tangential flow concentrator (Pall Filtron, Northborough, MA, USA)
120 equipped with a 10 kDa polyethersulfone membrane (Pall Filtron, Northborough, MA, USA) with 20 mM Tris-HCl pH 8.0. The sample was loaded onto a Q SEPHAROSE® High Performance Column balanced in 20 mM Tris pH 8.0 and the binding proteins were eluted with a 0-600 mM sodium chloride gradient. The fractions were concentrated in 20 mM Tris pH 8.0. The protein concentration was determined using a Microplate BCA ™ protein assay kit in which bovine serum albumin was used as a standard protein.
Example 12: Pre-treated maize hydrolysis test
Corn forage was treated at the U.S. Department of Energy National Renewable Energy Laboratory (NREL) using 1.4% by weight sulfuric acid at 165 ° C and 107 psi (7.38 bar) for 8 minutes. Water-insoluble solids in pre-treated corn forage (PCS) containing 56.5% cellulose, 4.6% hemicellulose and 28.4% lignin. Cellulose and hemicellulose were determined by a two-stage sulfuric acid hydrolysis with subsequent analysis of sugars by high performance liquid chromatography using standard analytical procedure NREL # 002. Lignin was gravimetrically determined after hydrolyzing the cellulose and hemicellulose fractions with sulfuric acid using standard analytical procedure NREL # 003.
The unwashed or unwashed PCS (total paste PCS) was prepared by adjusting the pH of PCS to 5.0 by adding 10 M NaOH with extensive mixing and then autoclaving for 20 minutes at 120 ° C. The weight total PCS dry matter was 29%. The PCS was used unwashed or washed with water. Ground unwashed PCS (dry weight 32.35%) was prepared by the total paste ground PCS in a wet multi-utility grinder Cosmos ICMG 40 (EssEmm Corporation, Tamil Nadu, India). Milled washed PCS (dry weight 32.35%) was prepared in the same way, with subsequent washing with deionized water and decanted from the supernatant fraction
121 repeatedly.
PCS hydrolysis was conducted using 2.2 ml of deep reservoir plates (Axygen, Union City, CA, USA) in a total reaction volume of 1.0 ml. Hydrolysis was performed with 50 mg of PCS (insoluble solids in the case of unwashed PCS and total solids in the case of washed PCS) per ml of 50 mM sodium acetate buffer pH 5.0 containing 1 mM manganese sulfate and various protein shipments of various enzyme compositions (expressed as protein mg per gram of cellulose). Enzyme compositions were prepared and then added simultaneously to all reservoirs in a volume ranging from 50 μΐ to 200 μΐ, for a final volume of 1 ml in each reaction. The plate was then sealed using an ALPS-300 plate heat sealer (Abgene, Epsom, United Kingdom), thoroughly mixed and incubated at a specific temperature for 72 hours. All related experiments were carried out in triplicate.
Following hydrolysis, the samples were filtered using a 0.45 pm MULTISCREEN® 96 well filter plate (Millipore, Bedford, MA, USA) and the filtrates analyzed for sugar content as described below. When not used immediately, the filtered aliquots were frozen at -20 ° C. The sugar concentrations of the samples diluted in 0.005 M H ₂ SO ₄ were measured using a 4.6 x 250 mm AMINEX® HPX-87H (Bio- Rad Laboratories, Inc., Hercules, CA, USA) by eluting with 0.05% w / w benzoic acid-0.005 M H ₂ SO ₄ at 65 ° C at a flow rate of 0.6 ml per minute and quantification by the integration of glucose, cellobiose and xylose signals from the detection of the refractive index (CHEMSTATION®, AGILENT® 1100 HPLC, Agilent Technologies, Santa Clara, CA, USA) calibrated by pure sugar samples. The resulting glucose and cellobiose equivalents were used to calculate the percentage of cellulose conversion for each reaction.
122
Glucose, cellobiosis and xylose were measured individually. The measured sugar concentrations were adjusted to the appropriate dilution factor. In the case of unwashed PCS, the network concentrations of enzymatically produced sugars were determined by adjusting the measured sugar concentrations to corresponding base sugar concentrations in unwashed PCS at the zero time point. All HPLC data processing was performed using MICROSOFT EXCEL ™ software (Microsoft, Richland, WA, USA).
The degree of conversion from cellulose to glucose was calculated using the following equation:% conversion = glucose concentration / glucose concentration in a limit digestion. To calculate the total conversion, the glucose and cellobiose values were combined. The cellobiose concentration was multiplied by 1.053 in order to convert to glucose equivalents and added to the glucose concentration. The degree of total cellulose conversion was calculated using the following equation:% conversion = [glucose concentration + 1.053 x (cellobiose concentration)] / [(glucose concentration + 1.053 x (cellobiose concentration) in a limit digestion] The 1.053 factor for cellobiosis takes into account the increase in mass when cellobiose is converted to glucose In order to calculate% conversion, 100% of the conversion point was presented based on a cellulase control (50 to 100 mg of Trichoderma reesei cellulase per gram of cellulose) and all values were divided by this number and then multiplied by 100. The triple data points were measured and the standard deviation was calculated.
Example 13: Evaluation of Trichophaea saccata GH10 xylanase by synergy with a high temperature enzyme composition at 50 ° C, 55 ° C and 60 ° C using washed washed PCS
Trichophaea saccata GH10 xylanase was subjected to testing by synergy with a high temperature enzyme composition at 50 ° C, 55 ° C and 60 ° C. The included high temperature enzyme composition 45%
123
Aspergillus fumigatus Cel7A CBHI, 25% Myceliophthora thermophila Cel6A CBHII, 5% Trichoderma reesei Cel7B EGI, 5% Myceliophthora thermophila Cel5A EG1I, 5% Thermoascus aurantiacus GH61A polypeptide having cellulolytic intensifying activity, cellulolytic intensifying activity and 10% Penicillium brasilianum Cel3A beta-glucosidase. Trichophaea saccata GH10 xylanase was added to 0.35 mg of protein per g of cellulose (10%) to a high temperature enzyme composition, which was loaded at 3.5 mg of protein per g of cellulose. The results for the composition supplemented by xylanase (3.85 mg of protein per g of cellulose) were compared with the results for the non-supplemented composition, which was tested on two protein loads, 3.5 and 3.85 mg of protein per g of cellulose.
The assay was performed as described in Example 12. Reactions of 1 ml with 5% ground-washed PCS were conducted for 72 hours in 50 mM sodium acetate buffer pH 5.0 containing 1 mM manganese sulfate. All reactions were carried out in triplicate and involves simple mixing at the beginning of hydrolysis. The results are shown in Figure 2.
Trichophaea saccata GH10 xylanase showed significant synergy with a high temperature enzyme composition. The enzyme composition supplemented with Trichophaea saccata GH10 xylanase significantly achieved the higher conversion of cellulose to glucose in 72 hours compared to the enzyme composition of high temperature not supplemented in an equivalent protein load (3.85 mg of protein per g of cellulose) .
Example 14: Addition of different levels of Trichophaea saccata GH10 xylanase to a constant loading of a high temperature enzyme composition and comparison with Trichoderma reesei-based cellulase SaMe-MF268 (XCL-533)
124
The ability of Trichophaea saccata GH10 xylanase to synergize with a high temperature enzyme composition at 60 ° C was further examined by adding different levels of Trichophaea saccata GH10 xylanase (1.25%, 2.5%, 5%, 10% and 20%) at constant loading of a high temperature enzyme composition (3 mg protein per g of cellulose), The high temperature enzyme composition included 45% Aspergillus fumigatus Cel7A CBHI, 25% Myceliophthora thermophila CelóA CBHII, 5 % Trichoderma reesei Cel7B EGI, 5% Myceliophthora thermophila Cel5A EGII, 5% Thermoascus aurantiacus GH61A polypeptide having cellulolytic intensifying activity, 5% Thielavia terrestris GH61 polypeptide And cellulolytic intensifying activity and 10% of Penicillium-Brasilianiumumum beta3. The high temperature enzyme composition at 60 ° C was compared to a Trichoderma reesei based on SaMe-MF268 cellulase (XCL-533) at 50 ° C. The SaMe-MF268 enzyme composition based on Trichoderma reesei was obtained as described in WO 20081151079. The composition comprises a Thermoascus aurantiacus GH61A polypeptide having cellulolytic enhancing activity to beta-glucosidase fusion protein comprising a nucleic polypeptide endoglucanase V Humicola insolens fused to Aspergillus oryzae beta-glucosidase of wild type, Trichodermaese Cel7A), Trichoderma reesei cellobiohydrolase II (CelóA), Trichoderma reesei endoglucanase I (Cel7B), Trichoderma reesei endoglucanase II (Ce 15 A), Trichoderma reesei endoglucanase V (Ce 145 A) and Trichoderma reesei endoglucanase (Cel 145A) 12A).
The assay was performed as described in Example 12. Reactions of 1 ml with 5% washed with ground PCS were conducted for 72 hours in 50 mM sodium acetate buffer pH 5.0 containing 1 mM manganese sulfate. All reactions were carried out in triplicate and involves simple mixing at the beginning of hydrolysis.
125
The results shown in Figure 3 demonstrate that the addition of Trichophaea saccata GH10 xylanase to a high temperature enzyme composition significantly improves the degree of cellulose conversion of washed PCS after 72 hours of hydrolysis. The optimal level of addition for Trichophaea saccata GH10 xylanase was around 5%. The high temperature enzyme composition supplemented with 5% Trichophaea saccata GH10 xylanase achieved 83% cellulose conversion in 72 hours compared to 65% cellulose conversion obtained with an equivalent loading of the unsupplemented high temperature enzyme composition (3 , 15 mg of protein per g of cellulose). As shown in Figure 3, the high temperature enzyme composition supplemented with Trichophaea saccata GH10 xylanase at 60 ° C significantly performed on Trichoderma reesei based on SaMe-MF268 cellulase (XCL-533) at its optimum temperature of 50 ° C. Example 15: Comparison of a high temperature enzyme composition containing Trichophaea saccata GH10 xylanase with Trichoderma reesei based on SaMe-MF268 cellulase (XCL-533) in washed and unwashed PCS hydrolysis
In a separate experiment, the protein loading profiles of the improved high temperature enzyme composition containing Trichophaea saccata GH10 xylanase were compared to the Trichoderma reesei protein loading profiles based on SaMeMF268 cellulase (XCL-533) using washed PCS and not washed ground. The high temperature enzyme composition includes 45% Aspergillus fumigatus Cel7A CBHI, 25% Myceliophthora thermophila Cel6A CBHII, 5% Trichoderma reesei Cel7B EGI, 5% Myceliophthora thermophila Cel5A EGII, 5% Thermoascus aurantiacus GH61 polypeptide intensifying activity GH61 of polypeptide Thielavia terrestris GH61 E having cellulolytic intensifying activity, 5% Penicillium brasilianum Cel3A beta-glucosidase and 5% Trichophaea saccata GH10 xylanase. THE
126 high temperature enzyme composition and SaMe-MF268 (XCL-533) were tested on five different protein shipments, 2.0, 3.0, 4.0, 5.0 and 6.0 mg of protein per g of cellulose. All reactions with a high temperature enzyme composition were performed at 60 ° C, while all reactions with SaMe-MF268 (XCL-533) were performed at 50 ° C.
The assay was performed as described in Example 12. Reactions of 1 ml with ground or washed non-washed PCS were conducted for 72 hours in 50 mM sodium acetate buffer pH 5.0 containing 1 mM manganese sulfate. The washed PCS was used at 5% total solids and the unwashed PCS was used at 5% insoluble solids. All reactions were carried out in triplicate and involves simple mixing at the beginning of hydrolysis.
The results are shown in Table 1 and Figure 4. The high temperature enzyme composition containing Trichophaea saccata GH10 xylanase significantly performed SaMe-MF268 (XCL-533) in the washed broth and substrates of unwashed PCS, requiring significantly significant protein shipments smaller to achieve 80% cellulose to glucose conversion in 72 hours compared to SaMe-MF268 (XCL-533).
Table 1. Protein shipments required to achieve 80% cellulose conversion from washed and unwashed PCS (mg protein per g cellulose) in 72 hours. Temperature: 60 ° C for high temperature enzyme composition, 50 ° C by SaMe-MF268 (XCL-533).
Enzyme composition Washed PCS PCS not washed SaMe-MF268 (XCL-533) 3.62 4.88 High temperature enzyme composition with Trichophaea saccata GH10 xylanase 2.46 4.18
127
Biological material deposit
The following biological material has been deposited under the terms of the Budapest Treaty with the Agricultural Research Service Patent Culture Collection (NRRL), Northem Regional Research Center, 1815 University Street, Peoria, IL, USA and giving the following accession number: Deposit Accession number Deposit
E. coli TF12Xyll70 NRRL B-5030928 July 2009
The strain was deposited under conditions that guarantee that access to the crop will be available pending this Patent Application to one determined by the laws of the Foreign Patent to be titled in it. The deposit represents a substantially pure culture of the deposited strain. The deposit is available as required by Foreign Patent laws in countries where counterparties to the application of the matter, or their progeny are deposited. However, it will be understood that the availability of a deposit does not constitute a license to practice inventing the subject to the detriment of patent rights granted by the government.
The present invention is further described by the following numbered paragraphs:
[1] An isolated polypeptide having xylanase activity, selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 65% identity to the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions at least medium with (i) the mature polypeptide encoding sequence of SEQ ID NO: 1, (ii) the genomic DNA sequence of the polypeptide encoding sequence mature from SEQ ID NO: 1 or (iii) a complementary filament of full length of (i) or (ii); (c) a polypeptide encoded by a polynucleotide comprising a nucleotide sequence having at least 65% identity to the sequence encoding mature polypeptide from
128
SEQ ID NO: 1 and (d) a variant comprising a replacement, elimination and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2.
[2] The polypeptide according to paragraph 1, which comprises an amino acid sequence having at least 65% identity to the mature polypeptide of SEQ ID NO: 2.
[3] The polypeptide according to paragraph 2, which comprises an amino acid sequence having at least 70% identity to the mature polypeptide of SEQ ID NO: 2.
[4] The polypeptide according to paragraph 3, which comprises an amino acid sequence having at least 75% identity to the mature polypeptide of SEQ ID NO: 2.
[5] The polypeptide according to paragraph 4, which comprises an amino acid sequence having at least 80% identity to the mature polypeptide of SEQ ID NO: 2.
[6] The polypeptide according to paragraph 5, which comprises an amino acid sequence having at least 85% identity to the mature polypeptide of SEQ ID NO: 2.
[7] The polypeptide according to paragraph 6, which comprises an amino acid sequence having at least 90% identity to the mature polypeptide of SEQ ID NO: 2.
[8] The polypeptide according to paragraph 7, which comprises an amino acid sequence having at least 95% identity to the mature polypeptide of SEQ ID NO: 2.
[9] The polypeptide according to paragraph 8, which comprises an amino acid sequence having at least 97% identity to the mature polypeptide of SEQ ID NO: 2.
[10] The polypeptide according to paragraph 1, which comprises or consists of the amino acid sequence of SEQ ID NO: 2 or a
129 fragment of this having xylanase activity.
[11] The polypeptide according to paragraph 10, which comprises or consists of the amino acid sequence of SEQ ID NO: 2.
[12] The polypeptide according to paragraph 10, which comprises or consists of the mature polypeptide of SEQ ID NO: 2.
[13] The polypeptide according to paragraph 1, which is encoded by a polynucleotide that hybridizes under stringent conditions at least medium with (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) a genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii).
[14] The polypeptide according to paragraph 13, which is encoded by a polynucleotide that hybridizes under at least medium-high stringency conditions to (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii ) the genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii).
[15] The polypeptide according to paragraph 14, which is encoded by a polynucleotide that hybridizes under at least high stringency conditions to (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) a genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii).
[16] The polypeptide according to paragraph 15, which is encoded by a polynucleotide that hybridizes under conditions of at least very high stringency with (i) the sequence encoding mature polypeptide of SEQ ID NO: 1, (ii) the genomic DNA sequence of the sequence encoding mature polypeptide of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii).
130 [17] The polypeptide according to paragraph 1, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 65% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [18] The polypeptide from according to paragraph 17, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 70% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [19] The polypeptide according to paragraph 18, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 75% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [20] The polypeptide according to paragraph 19, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 80% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [21] The polypeptide according to paragraph 20, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 85% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [22] The polypeptide according to paragraph 21, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 90% identity to the mature polypeptide coding sequence of SEQ ID NO: 1 [23] The polypeptide according to paragraph 22, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 95% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [24] The polypeptide according to paragraph 23, which is
131 encoded by a polynucleotide comprising a nucleotide sequence having at least 97% identity to the sequence encoding mature polypeptide of SEQ ID NO: 1 [25] The polypeptide according to paragraph 1, which is encoded by a polynucleotide comprising or consists of the nucleotide sequence of SEQ ID NO: 1; or a subsequence thereof that encodes a fragment having xylanase activity.
[26] The polypeptide according to paragraph 25, which is encoded by a polynucleotide that comprises or consists of the nucleotide sequence of SEQ ID NO: 1.
[27] The polypeptide according to paragraph 25, which is encoded by a polynucleotide that comprises or consists of the sequence encoding mature polypeptide of SEQ ID NO: 1.
[28] The polypeptide according to paragraph 1, wherein the polypeptide is a variant comprising a replacement, deletion and / or insertion of one or more (several) amino acids from the mature polypeptide of SEQ ID NO: 2.
[29] The polypeptide according to paragraph 1, which is encoded by the polynucleotide contained in plasmid pTF12Xyll70 which is contained in E. coli / NRRL B-50309.
[30] The polypeptide according to any of paragraphs 1 to 29, wherein the mature polypeptide is amino acids 20 to 398 of SEQ ID NO: 2.
[31] The polypeptide according to any of paragraphs 1 to 30, wherein the mature polypeptide encoding sequence is nucleotides 58 to 1194 of SEQ ID NO: 1.
[32] An isolated polynucleotide that comprises a nucleotide sequence that encodes the polypeptide according to any of paragraphs 1 to 31.
132 [33] A nucleic acid construct that comprises the polynucleotide according to paragraph 32 operationally linked to one or more (several) control sequences that direct the production of the polypeptide in an expression host.
[34] A recombinant expression vector that comprises the polynucleotide according to paragraph 32.
[35] A recombinant host cell comprising the polynucleotide according to paragraph 32 operationally linked to one or more (several) control sequences that direct the production of a polypeptide having xylanase activity.
[36] A method of producing the polypeptide according to any of paragraphs 1 to 31, which comprises: (a) cultivating a cell, which in its wild type produces the polypeptide, under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide.
[37] A method of producing the polypeptide according to any one of paragraphs 1 to 31, comprising: (a) cultivating a host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive to the production of the polypeptide and (b) recovery of the polypeptide.
[38] A method of producing a precursor cell mutant, which comprises interrupting or eliminating a polynucleotide encoding the polypeptide or a portion thereof, according to paragraphs 1 to 31, which results in the mutant producing less of the polypeptide than than the precursor cell.
[39] A mutant cell produced by the method according to paragraph 38.
[40] The mutant cell according to paragraph 39, which
133 further comprises a gene that encodes a natural or heterologous protein.
[41] A method of producing a protein, which comprises: (a) cultivating the mutant cell according to paragraph 39 or 40 under conditions conducive to the production of the protein and (b) recovering the protein.
[42] A method of producing the polypeptide according to any of paragraphs 1 to 31, comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide that encodes the polypeptide under conditions conducive to production polypeptide and (b) recovering the polypeptide.
[43] A transgenic plant, part of the plant or plant cell transformed with a polynucleotide that encodes the polypeptide according to any of paragraphs 1 to 31.
[44] A double-stranded inhibitory RNA (dsRNA) molecule comprising a subsequence of the polynucleotide according to paragraph 32, wherein, optionally, the dsRNA is either a siRNA or a miRNA molecule.
[45] The double-stranded inhibitory RNA (dsRNA) molecule according to paragraph 44, which is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleotides long duplex.
[46] A method of inhibiting the expression of a polypeptide having xylanase activity in a cell, which comprises administering to the cell or expressing in the cell the double-stranded inhibitory RNA molecule according to paragraph 44 or 45.
[47] An isolated polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2.
[48] A nucleic acid construct that comprises a gene that encodes a protein operably linked to the polynucleotide
134 according to paragraph 47, where the gene is foreign to the polynucleotide.
[49] A recombinant expression vector that comprises the polynucleotide according to paragraph 47.
[50] A recombinant host cell comprising the polynucleotide according to paragraph 47 operationally linked to a gene encoding a protein, where the gene is foreign to the polynucleotide.
[51] A method of producing a protein, comprising: (a) cultivating a recombinant host cell comprising a gene that encodes a protein operably linked to the polynucleotide according to paragraph 47, where the gene is foreign to the polynucleotide under conditions conducive to protein production and (b) protein recovery.
[52] A composition comprising the polypeptide according to any of paragraphs 1 to 31.
[53] A method for degrading or converting a cellulosic material or material containing xylan, comprising: treating the cellulosic material or material containing xylan with an enzyme composition in the presence of the polypeptide according to any of paragraphs 1 to 31.
[54] The method according to paragraph 53, in which the cellulosic material or material containing xylan is pre-treated.
[55] The method according to paragraph 53 or 54, which further comprises recovering the degraded cellulosic material or material containing xylan.
[56] The method according to any of paragraphs 53 to 55, wherein the enzyme composition comprises one or more (several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an expansin, an esterase, an laccase, a lignoitic enzyme, a pectinase, a peroxidase, a protease and a swollenin.
135 [57] The method according to paragraph 56, in which cellulase is one or more (several) enzymes selected from the group consisting of an endoglycanase, a cellobiohydrolase and a beta-glucosidase.
[58] The method according to paragraph 56, in which a hemicellulase is one or more (several) enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a furoyl esterase, an arabinofuranosidase, a xylosidase and a glucuronidase.
[59] The method according to any of paragraphs 53 to 58, wherein the degraded cellulosic material or material containing xylan is a sugar.
[60] The method according to paragraph 59, in which sugar is selected from the group consisting of glucose, xylose, mannose, galactose and arabinose.
[61] A method for producing a fermentation product, which comprises: (a) saccharifying a cellulosic material or material containing xylan with an enzyme composition in the presence of the polypeptide according to any of paragraphs 1 to 31; (b) fermenting the saccharified cellulosic material with one or more (several) fermentation microorganisms for the production of the fermentation product and (c) recovering the fermentation product from the fermentation.
[62] The method according to paragraph 61, in which the cellulosic material or material containing xylan is pre-treated.
[63] The method according to paragraph 61 or 62, wherein the enzyme composition comprises one or more (several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an expansin, an esterase, a laccase, an lignoitic enzyme, a pectinase, a peroxidase, a protease and a swollenin.
[64] The method according to paragraph 63, in which cellulase is one or more (several) enzymes selected from the group consisting of
136 of an endoglycanase, a cellobiohydrolase and a beta-glycosidase.
[65] The method according to paragraph 63, in which a hemicellulase is one or more (several) enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a furoyl esterase, an arabinofuranosidase, a xylosidase and a glucuronidase.
[66] The method according to any of paragraphs 61 to 65, in which steps (a) and (b) are carried out simultaneously in simultaneous saccharification and fermentation.
[67] The method according to any of paragraphs 61 to 66, wherein the fermentation product is an alcohol, an organic acid, a ketone, an amino acid or a gas.
[68] A method of fermenting a cellulosic material or material containing xylan, which comprises: fermenting the cellulosic material with one or more (several) fermentation microorganisms, in which the cellulosic material or material containing xylan is saccharified with an enzyme composition in presence of the polypeptide according to any of paragraphs 1 to 31.
[69] The method according to paragraph 68, in which the cellulosic material or material containing xylan is pre-treated before saccharification.
[70] The method according to paragraph 68 or 69, wherein the enzyme composition comprises one or more (several) enzymes selected from the group consisting of a cellulase, a hemicellulase, an expansin, an esterase, a laccase, an lignoitic enzyme, a pectinase, a peroxidase, a protease and a swollenin.
[71] The method according to paragraph 70, in which cellulase is one or more (several) enzymes selected from the group consisting of an endoglycanase, a cellobiohydrolase and a beta-glucosidase.
[72] The method according to paragraph 70, in which a
137 hemicellulase is one or more (several) enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a furoyl esterase, an arabinofuranosidase, a xylosidase and a glucuronidase.
[73] The method according to any of paragraphs 68 to 72, wherein the fermentation of cellulosic material or material containing xylan produces a fermentation product.
[74] The method according to paragraph 73, which further comprises recovering the fermentation product from fermentation.
[75] The method according to either paragraph 73 or 74, wherein the fermentation product is an alcohol, an organic acid, a ketone, an amino acid or a gas.
The invention described and claimed here should not be limited in scope by the specific aspects disclosed here, since these aspects are intended as illustrations of various aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. In fact, various modifications of the invention in addition to those shown and described here will become evident to those skilled in the art in the technique of the preceding description. Such modifications are also intended to be within the scope of the appended claims. In the event of a conflict, this disclosure, including definitions, will control.

权利要求:
Claims (11)
[1]
1. Transgenic microbial host cell, characterized by the fact that it comprises a nucleic acid construct comprising a polynucleotide that encodes a polypeptide having
5 xylanase activity, where the polynucleotide consists of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1.
[2]
2. Transgenic microbial host cell according to claim 1, characterized by the fact that the polypeptide having xylanase activity consists of SEQ ID NO: 2 or amino acids 20 to 398 of SEQ ID
10 NO: 2.
[3]
3. Method for producing a polypeptide having xylanase activity, characterized by the fact that it comprises:
(a) cultivating the transgenic microbial host cell as defined in any one of claims 1-2, or a transgenic plant 15 or a transgenic plant cell comprising a nucleic acid construct comprising a polynucleotide encoding a polypeptide having xylanase activity, in that the polynucleotide consists of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1, under conditions suitable for the production of the polypeptide; and
(B) recovering the polypeptide.
[4]
4. Method for degrading or converting a cellulosic material or material containing xylan, characterized by the fact that it comprises: treating cellulosic material or material containing xylan with an enzyme composition in the presence of a polypeptide having xylanase activity
25 encoded by a polynucleotide consisting of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1.
[5]
Method according to claim 4, characterized in that it additionally comprises recovering the cellulosic material or material containing degraded xylan.
Petition 870180062814, of 20/07/2018, p. 17/22
[6]
6. Method for producing a fermentation product, characterized by the fact that it comprises:
(a) saccharifying a cellulosic material or material containing xylan with an enzyme composition in the presence of a polypeptide with xylanase activity encoded by a polynucleotide consisting of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1;
(b) fermenting the cellulosic material or material containing xylan saccharified with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from fermentation.
[7]
7. Method for fermenting a cellulosic material or material containing xylan, characterized by the fact that it comprises: fermenting the cellulosic material or material containing xylan with one or more fermenting microorganisms, in which the cellulosic material or material containing xylan is saccharified with a composition of enzyme in the presence of a polypeptide with xylanase activity encoded by a polynucleotide consisting of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1.
[8]
8. Method according to claim 7, characterized in that the fermentation of the cellulosic material or material containing xylan produces a fermentation product.
[9]
Method according to claim 8, characterized in that it comprises additionally recovering the fermentation product from the fermentation.
[10]
10. Nucleic acid construction, characterized by the fact that it comprises a polynucleotide that encodes a polypeptide having xylanase activity consisting of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1, operably linked to one or more sequences
Petition 870180062814, of 20/07/2018, p. 18/22 controls that direct the production of the polypeptide in an expression host.
[11]
11. Expression vector, characterized by the fact that it comprises a polynucleotide that encodes a polypeptide having xylanase activity 5 consisting of SEQ ID NO: 1 or nucleotides 58 to 1194 of SEQ ID NO: 1, operationally linked to one or more control sequences that direct the production of the polypeptide in a transgenic microbial host cell.
Petition 870180062814, of 20/07/2018, p. 19/22
1/4
MRTFSSLLGVALLLGAANAQVAVWG ATGCGTACCTTCTCGTCTCTTCTCGGTGTTGCCCTTCTCTTGGGTGCAGCTAATGCCCAGGTCGCGGTTTGGGGA
QCGGIGYSGSTTCAAGTTCVKLNDY CAGTGTGGTGGCATTGGTTACTCTGGCTCGACAACCTGCGCTGCGGGAACGACTTGTGTTAAGCTGAACGACTAC
YSQCQPGGTTLTTTTKPATTTTTTT TACTCCCAATGCCAACCCGGCGGTACCACTTTGACAACCACCACCAAACCCGCCACCACTACCACTACCACCACG
ATSPSSSPGLNALAQKSGRYFGSAT
GCAACTTCTCCCTCATCTTCTCCCGGATTAAATGCCCTGGCACZàAAAGAGCGGCCGGTACTTCGGTAGTGCAACT
DNPELSDAAYIAILSNKNEFGIITP GACAACCCAGAGCTCTCCGATGCGGCATACATTGCCATCCTGAGCAACAAAAACGAGTTTGGGATCATCACGCCT
GNSMKWDATEPSRGSFSFTGGQQIV GGAAACTCGATGAAATGGGATGCTACTGAACCGTCCCGCGGGAGTTTCTCGTTCACTGGTGGACAGCAAATTGTT dfaqgngqairghtlizwysqlpswv GATTTTGCGGGGGGGGGGG
TSGNFDKATLTSIMQNHITTLVSHW ACTAGCGGAAACTTCGATAAAGCTACATTGACATCGATCATGCAAAATCACATTACAACTCTTGTCAGCCACTGG kgqlaywdvvneafnddgtfrqnvf AAGGGCCAGCTCGGGGGGGGCA
YTTIGEDYIQLAFEAARAADPTAKL TACACAACCATTGGAGAGGACTACATCCAGCTCGCCTTCGAAGCCGCCCGTGCCGCCGACCCGACCGCAAAGCTC
CINDYNIEGTGAKSTAMYNLVSKLK TGCATCAACGACTACAACATCGAGGGCACTGGAGCCAAGTCAACAGCCATGTACAATCTCGTCTCGAAGCTGAAA
SAGVPIDCIGVQGHLIVGEVPTTIQ TCCGCCGGCGTTCCCATCGACTGTATTGGTGTTCAGGGACACCTCATCGTCGGTGAAGTTCCCACCACCATCCAA
ANLAQFASLGVDVAITELDIRMTLP GCAAACCTTGCCCAGTTTGCGTCTTTGGGTGTGGATGTCGCGATCACGGAGCTAGATATCAGAATGACGCTGCCA
STTALLQQQAKDYVSVVTACMNVPR TCTACGACTGCATTGCTCCAGCAGCAGGCTAAGGATTACGTCTCGGTTGTTACAGCCTGCATGAATGTTCCCAGG
CIGITIWDYTDKYSWVPQTFSGQGD
TGTATCGGTATCACCATCTGGGACTACACTGATAAATACTCTTGGGTGCCACAAACCTTCAGCGGCCAGGGCGAT ACPWDANLQKKPAYSAIASALAA *
GCTTGCCCATGGGATGCCAACCTGCAGAAGAAGCCAGCCTACTCCGCTATTGCGTCTGCTCTTGCGGCTTGA

类似技术:

---

公开号 | 公开日 | 专利标题

---

US10202592B2|2019-02-12|Polypeptides having xylanase activity and polynucleotides encoding same

---

US8129591B2|2012-03-06|Polypeptides having xylanase activity and polynucleotides encoding same

---

US9957493B2|2018-05-01|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same

---

BR112012000260B1|2020-11-17|transgenic microbial host cell, methods to produce a polypeptide, to produce a mutant of a precursor cell, to inhibit expression of a polypeptide, to produce a protein, to degrade or convert a cellulosic material, to produce a fermentation product, to ferment a cellulosic material, nucleic acid constructs, expression vector, isolated polypeptide having cellulolytic intensification activity, and isolated polynucleotide that encodes the same

---

US20120260371A1|2012-10-11|Polypeptides Having Cellobiohydrolase Activity and Polynucleotides Encoding Same

---

BR112012006978B1|2018-11-06|transgenic microbial host cell, methods for producing a polypeptide having xylanase activity, for degrading or converting a cellulosic material or a xylan containing material, for producing a fermentation product, for fermenting a cellulosic material or a xylane containing material, nucleic acid containing construct , and, expression vector.

---

BRPI1012923B1|2018-10-16|transgenic microbial host cell, methods for producing a polypeptide, for producing a mother cell mutant, for degrading or converting a cellulosic material, for producing a fermentation product, for fermenting a cellulosic material, nucleic acid construct, and, vector of expression

---

BRPI0914835B1|2019-04-24|TRANSGENIC MICROBIAN HOST CELL, METHODS FOR PRODUCING A POLYPEPTIDE AND FOR PRODUCING PROTEIN, NUCLEIC ACID CONSTRUCTIONS, AND, EXPRESSION VECTOR.

---

WO2010065448A1|2010-06-10|Polypeptides having feruloyl esterase activity and polynucleotides encoding same

---

US10731140B2|2020-08-04|Polypeptides having glucuronyl esterase activity and polynucleotides encoding same

---

US20150152455A1|2015-06-04|Polypeptides Having Berberine Bridge Enzyme Like Activity and Polynucleotides Encoding Same

---

US20170015985A1|2017-01-19|Polypeptides Having Alpha-Glucuronidase Activity And Polynucleotides Encoding Same

---

BR112012006032B1|2018-08-21|COMPOSITION, TRANSGENIC MICROBIAN HOST CELL, METHODS FOR PRODUCING A POLYPETIDE HAVING CELLULOLY ACTIVITIES, FOR DEGRADING A CELLULOSTIC MATERIAL, TO PRODUCE A COMPULSORY FERMENTATION, AND CELLULAR FERMENTATION PRODUCT,

同族专利:

---

公开号 | 公开日

---

CN104694517A|2015-06-10|

---

EP2496692A1|2012-09-12|

---

CN102639697A|2012-08-15|

---

US20170145395A1|2017-05-25|

---

ES2574054T3|2016-06-14|

---

EP2496692B1|2016-03-16|

---

US10202592B2|2019-02-12|

---

BR112012008286A2|2015-09-15|

---

US9534211B2|2017-01-03|

---

WO2011057083A1|2011-05-12|

---

CA2780198A1|2011-05-12|

---

CN102639697B|2015-03-25|

---

DK2496692T3|2016-06-27|

---

CN104694517B|2019-06-28|

---

US20120278952A1|2012-11-01|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DK187280A|1980-04-30|1981-10-31|Novo Industri As|RUIT REDUCING AGENT FOR A COMPLETE LAUNDRY|

---

FI87577C|1985-12-03|1993-01-25|Gist Brocades Nv|FOERFARANDE FOER FRAMSTAELLNING AV VOERT OCH OEL MED FOERBAETTRAD FILTRERBARHET OCH / ELLER LAEGRE Viscosite|

---

DK122686D0|1986-03-17|1986-03-17|Novo Industri As|PREPARATION OF PROTEINS|

---

US5776757A|1988-03-24|1998-07-07|Novo Nordisk A/S|Fungal cellulase composition containing alkaline CMC-endoglucanase and essentially no cellobiohydrolase and method of making thereof|

---

JP2728531B2|1988-03-24|1998-03-18|ノボノルディスクアクティーゼルスカブ|Cellulase preparation|

---

US5223409A|1988-09-02|1993-06-29|Protein Engineering Corp.|Directed evolution of novel binding proteins|

---

DK420289D0|1989-08-25|1989-08-25|Novo Nordisk As|METHOD OF TREATING LIGNOCELLULOSE PULP|

---

US5275944A|1989-09-26|1994-01-04|Midwest Research Institute|Thermostable purified endoglucanas from acidothermus cellulolyticus ATCC 43068|

---

US5110735A|1989-09-26|1992-05-05|Midwest Research Institute|Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus|

---

US5536655A|1989-09-26|1996-07-16|Midwest Research Institute|Gene coding for the E1 endoglucanase|

---

PT97110B|1990-03-23|1998-11-30|Gist Brocades Nv|PROCESS FOR CATALYSING ACCELERABLE REACTIONS BY ENZYMES, BY ADDING TO THE REACTIONAL MEDIUM OF TRANSGENIC PLANTS SEEDS AND FOR OBTAINING THE REFERED SEEDS|

---

US6395966B1|1990-08-09|2002-05-28|Dekalb Genetics Corp.|Fertile transgenic maize plants containing a gene encoding the pat protein|

---

DK115890D0|1990-05-09|1990-05-09|Novo Nordisk As|ENZYME|

---

JP3110452B2|1990-05-09|2000-11-20|ノボノルディスクアクティーゼルスカブ|Cellulase preparation comprising endoglucanase enzyme|

---

DK203490D0|1990-08-24|1990-08-24|Novo Nordisk As|PROCEDURE FOR TREATING LIGNOCELLULOS PULP AND APPARATUS FOR PERFORMING THE PROCESS|

---

IL99552D0|1990-09-28|1992-08-18|Ixsys Inc|Compositions containing procaryotic cells,a kit for the preparation of vectors useful for the coexpression of two or more dna sequences and methods for the use thereof|

---

DE69133035T2|1991-01-16|2003-02-13|Procter & Gamble|Compact detergent compositions with highly active cellulases|

---

DK175391D0|1991-10-18|1991-10-18|Novo Nordisk As|NEW ENZYMER|

---

EP0825254B1|1992-07-02|2001-10-04|Novozymes A/S|Alkalophilic Bacillus sp. AC13 and xylanase obtainable therefrom|

---

EP1431389A3|1992-10-06|2004-06-30|Novozymes A/S|Cellulase variants|

---

DE69333067T2|1992-12-23|2004-05-13|Novozymes A/S|ENZYME WITH ENDOGLUCANASE EFFECT|

---

AU679211B2|1993-03-10|1997-06-26|Novozymes A/S|Enzymes with xylanase activity from aspergillus aculeatus|

---

JP2807612B2|1993-03-12|1998-10-08|ノボノルディスクアクティーゼルスカブ|Novel xylanase, method for producing the same, pulp treatment method using the xylanase, and method for producing xylo-oligosaccharide|

---

DK81293D0|1993-07-06|1993-07-06|Novo Nordisk As|ENZYME|

---

DE4343591A1|1993-12-21|1995-06-22|Evotec Biosystems Gmbh|Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes|

---

US5605793A|1994-02-17|1997-02-25|Affymax Technologies N.V.|Methods for in vitro recombination|

---

EP1632557B1|1994-03-08|2011-02-23|Novozymes A/S|Novel alkaline cellulases|

---

DE69523052T2|1994-06-03|2002-06-20|Novo Nordisk Biotech Inc|PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS CODING THEM|

---

EP0777737B1|1994-06-30|2005-05-04|Novozymes Biotech, Inc.|Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein|

---

US6300114B1|1994-07-29|2001-10-09|Rohm Enzyme Finland Oy|Sequences of xylanase and xylanase expression vectors|

---

AU3604595A|1994-10-06|1996-05-02|Novo Nordisk A/S|An enzyme and enzyme preparation with endoglucanase activity|

---

CN1165614C|1995-01-26|2004-09-08|诺沃奇梅兹有限公司|Animal feed additives comprising xylanase|

---

CN102080070B|1995-03-17|2016-01-20|诺沃奇梅兹有限公司|new endoglucanase|

---

US6313081B1|1995-04-28|2001-11-06|Henkel Kommanditgesellschaft Auf Aktien |Detergents comprising cellulases|

---

US20030044956A1|1995-08-23|2003-03-06|Short Jay M.|Enzymes having carboxymethyl cellulase activity and methods of use thereof|

---

AU7299796A|1995-10-17|1997-05-07|Rohn Enzyme Finland Oy|Cellulases, the genes encoding them and uses thereof|

---

WO1997027290A1|1996-01-22|1997-07-31|Novo Nordisk A/S|An enzyme with xylanase activity|

---

WO1997041212A1|1996-04-25|1997-11-06|Novo Nordisk A/S|Alkaline lipolytic enzyme|

---

AU3938997A|1996-08-26|1998-03-19|Novo Nordisk A/S|A novel endoglucanase|

---

CN100362100C|1996-09-17|2008-01-16|诺沃奇梅兹有限公司|Cellulase variants|

---

US6451063B1|1996-09-25|2002-09-17|Genencor International, Inc.|Cellulase for use in industrial processes|

---

US6017870A|1996-10-09|2000-01-25|Genencor International, Inc.|Purified cellulase and method of producing|

---

US7883872B2|1996-10-10|2011-02-08|Dyadic International , Inc.|Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose|

---

US5811381A|1996-10-10|1998-09-22|Mark A. Emalfarb|Cellulase compositions and methods of use|

---

US5989899A|1996-12-23|1999-11-23|Genencor International, Inc.|Oversized cellulase compositions for use in detergent compositions and in the treatment of textiles|

---

EP1002102A1|1997-07-31|2000-05-24|Dsm N.V.|Cellulose degrading enzymes of aspergillus|

---

US5871550A|1997-08-26|1999-02-16|Genencor International, Inc.|Mutant Thermonospora spp. cellulase|

---

WO1999025846A2|1997-11-19|1999-05-27|Genencor International, Inc.|Cellulase produced by actinomycetes and method for producing same|

---

CA2330245C|1998-06-24|2011-12-20|Genencor International, Inc.|Cellulase producing actinomycetes, cellulase produced therefrom and method of producing same|

---

US6562612B2|1997-11-19|2003-05-13|Genencor International, Inc.|Cellulase producing actinomycetes, cellulase produced therefrom and method of producing same|

---

ES2267200T3|1997-11-19|2007-03-01|Genencor International, Inc.|CELLULOSE PRODUCED BY ACTINOMYCETES AND METHOD TO PRODUCE IT.|

---

DE69836227T2|1997-12-16|2007-08-23|Genencor International, Inc., Palo Alto|PROCESS FOR THE PREPARATION OF EGIII-SIMILAR ENZYMES|

---

US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|

---

EP1080210A2|1998-05-27|2001-03-07|Novo Nordisk Biotech, Inc.|Methods for producing a polypeptide by modifying the copy number of a gene|

---

DK1124949T3|1998-10-26|2006-11-06|Novozymes As|Construction and screening of a DNA library of interest in filamentous fungal cells|

---

US6258590B1|1998-11-02|2001-07-10|Novozymes A/S|Biopreparation of textiles at high temperatures|

---

EP1141371B1|1998-12-23|2008-11-19|Novozymes A/S|Methods for producing polypeptides in aspergillus mutant cells|

---

US6511824B1|1999-03-17|2003-01-28|Exelixis, Inc.|Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use|

---

JP4620253B2|1999-03-22|2011-01-26|ノボザイムス，インコーポレイティド|Promoter for gene expression in fungal cells|

---

AU5279100A|1999-05-19|2000-12-05|Midwest Research Institute|E1 endoglucanase variants y245g, y82r and w42r|

---

GB9928968D0|1999-12-07|2000-02-02|Danisco|Enzyme|

---

US6531644B1|2000-01-14|2003-03-11|Exelixis, Inc.|Methods for identifying anti-cancer drug targets|

---

ES2166316B1|2000-02-24|2003-02-16|Ct Investig Energeticas Ciemat|PROCEDURE FOR THE PRODUCTION OF ETHANOL FROM LIGNOCELLULOSIC BIOMASS USING A NEW THERMOTOLERING YEAST.|

---

CA2416801C|2000-07-21|2012-01-03|The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services|Adult human dental pulp stem cells in vitro and in vivo|

---

EP1184460A1|2000-08-29|2002-03-06|Dsm N.V.|Modified fungal xylanases|

---

JP4878428B2|2000-09-21|2012-02-15|ベーアーエスエフ・アクチエンゲゼルシャフト|Talalomyces xylanase|

---

JP2004518413A|2000-10-12|2004-06-24|エクセリクシス・インコーポレイテッド|Human ECT2 and usage|

---

US7151204B2|2001-01-09|2006-12-19|Monsanto Technology Llc|Maize chloroplast aldolase promoter compositions and methods for use thereof|

---

JP2004527261A|2001-05-18|2004-09-09|ノボザイムスアクティーゼルスカブ|Polypeptide having cellobiase activity and polynucleotide encoding the same|

---

DK2295544T3|2001-06-26|2016-09-26|Novozymes As|Polypeptides with cellobiohydrolase I activity and the same coding polynucleotides|

---

US6982159B2|2001-09-21|2006-01-03|Genencor International, Inc.|Trichoderma β-glucosidase|

---

US7045331B2|2001-12-18|2006-05-16|Genencor International, Inc.|EGVII endoglucanase and nucleic acids encoding the same|

---

US7005289B2|2001-12-18|2006-02-28|Genencor International, Inc.|BGL5 β-glucosidase and nucleic acids encoding the same|

---

US7056721B2|2001-12-18|2006-06-06|Genencor International, Inc.|EGVI endoglucanase and nucleic acids encoding the same|

---

US7049125B2|2001-12-18|2006-05-23|Genencor International, Inc.|EGVIII endoglucanase and nucleic acids encoding the same|

---

US7045332B2|2001-12-18|2006-05-16|Genencor International, Inc.|BGL4 β-glucosidase and nucleic acids encoding the same|

---

CA2474033C|2002-01-23|2013-06-04|Royal Nedalco B.V.|Fermentation of pentose sugars|

---

EP2305801B1|2002-08-16|2017-07-05|Danisco US Inc.|Novel variant hyprocrea jecorina CBH1 cellulases|

---

ES2601145T3|2002-11-07|2017-02-14|Danisco Us Inc.|Beta-glucosidase BGL6 and nucleic acids encoding it|

---

US7407788B2|2002-11-21|2008-08-05|Danisco A/S, Genencor Division|BGL7 beta-glucosidase and nucleic acids encoding the same|

---

EP2298876A1|2003-03-21|2011-03-23|Genencor International, Inc.|Novel cbh1 homologs and variant cbh1 cellulases|

---

CA2771875A1|2003-04-01|2005-01-06|Danisco Us Inc.|Variant hypocrea jecorina cbh1|

---

EP1622921B1|2003-05-02|2010-06-16|Novozymes Inc.|Variants of beta-glucosidases|

---

CA2525333C|2003-05-29|2016-03-01|Genencor International, Inc.|Trichoderma genes|

---

US7244605B2|2003-10-28|2007-07-17|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

DK1682655T3|2003-10-30|2010-01-11|Novozymes As|Carbohydrate binding modules from a new family|

---

WO2006011899A1|2003-11-25|2006-02-02|L-3 Communications Security and Detection Systems Corporation|Security system for detecting nuclear masses|

---

MXPA06006748A|2003-12-19|2006-09-04|Novozymes As|Mashing process.|

---

ES2357037T3|2004-01-16|2011-04-15|Novozymes, Inc.|METHODS FOR DEGRADING LIGNOCELLULOSIC MATERIALS.|

---

DK2314605T3|2004-01-30|2014-06-16|Novozymes Inc|Polypeptides with cellulolytic enhancing activity and polynucleotides encoding them|

---

WO2005074656A2|2004-02-06|2005-08-18|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US7960160B2|2004-02-12|2011-06-14|Novozymes, Inc.|Polypeptides having xylanase activity from Aspergillus fumigatus|

---

EP2354222A1|2004-03-25|2011-08-10|Genencor International, Inc.|Cellulase fusion protein and heterologous cellulase fusion construct encoding the same|

---

US8097445B2|2004-03-25|2012-01-17|Danisco Us Inc.|Exo-endo cellulase fusion protein|

---

EP1812547A1|2004-06-03|2007-08-01|Novozymes A/S|Mashing process and enzyme composition useful therein|

---

US20060004699A1|2004-06-30|2006-01-05|Nokia Corporation|Method and system for managing metadata|

---

JP2008508868A|2004-08-06|2008-03-27|ノボザイムスアクティーゼルスカブ|Botryosfa area rosina polypeptide|

---

CN101052721A|2004-08-06|2007-10-10|诺维信公司|Botryosphaeria rhodina polypeptide|

---

DK176540B1|2004-09-24|2008-07-21|Cambi Bioethanol Aps|Process for the treatment of biomass and organic waste in order to extract desired biologically based products|

---

EP2292747B1|2004-12-30|2017-01-25|Danisco US Inc.|Variant hypocrea jecorina cbh2 cellulases|

---

EP1869197A2|2005-04-12|2007-12-26|E.I. Dupont De Nemours And Company|Treatment of biomass to obtain ethanol|

---

MX2007013474A|2005-04-29|2008-04-02|Ab Enzymes Oy|Improved cellulases.|

---

CA2625933C|2005-08-04|2015-11-24|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

US7608689B2|2005-09-30|2009-10-27|Novozymes, Inc.|Methods for enhancing the degradation or conversion of cellulosic material|

---

DK1969123T3|2005-12-22|2017-08-28|Ab Enzymes Oy|Hitherto UNKNOWN ENZYMS|

---

FI120045B|2005-12-22|2009-06-15|Roal Oy|Treatment of cellulose materials and enzymes useful therein|

---

AT513907T|2006-03-20|2011-07-15|Novozymes Inc|POLYPEPTIDES WITH ENDOGLUCANASE ACTIVITY AND POLYNUCLEOTIDES FOR THEIR CODING|

---

US8304212B2|2006-07-10|2012-11-06|Dyadic International, Inc.|Methods and compositions for degradation of lignocellulosic material|

---

CA2658610A1|2006-07-21|2008-05-15|Novozymes, Inc.|Methods of increasing secretion of polypeptides having biological activity|

---

CN103436509A|2007-05-31|2013-12-11|诺维信股份有限公司|Methods of increasing the cellulolytic enhancing activity of a polypeptide|

---

WO2009042846A1|2007-09-28|2009-04-02|Novozymes A/S|Polypeptides having acetylxylan esterase activity and polynucleotides encoding same|

---

US8034599B2|2007-11-30|2011-10-11|Novozymes A/S|Polypeptides having arabinofuranosidase activity and polynucleotides encoding same|

---

CN101932704A|2007-12-05|2010-12-29|诺维信公司|Polypeptides having xylanase activity and polynucleotides encoding same|

---

EP2224822B1|2007-12-06|2014-05-21|Novozymes A/S|Polypeptides having acetylxylan esterase activity and polynucleotides encoding same|

---

US8034995B2|2007-12-07|2011-10-11|Novozymes A/S|Polypeptides having feruloyl esterase activity and polynucleotides encoding same|

---

JP2011507525A|2007-12-19|2011-03-10|ノボザイムスアクティーゼルスカブ|Polypeptide having cellulolytic enhancing activity and polynucleotide encoding the same|

---

US8575426B2|2007-12-19|2013-11-05|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

BRPI0821048A2|2007-12-19|2015-06-16|Novozymes As|Isolated polypeptide and polynucleotide, nucleic acid construct, recombinant host cell, methods for making the polypeptide, a precursor cell mutant, a protein and a fermentation product, to inhibit expression of a polypeptide, to degrade or convert a cellulosic material , and to ferment a cellulosic material, transgenic plant, plant part or plant cell, and inhibitory rna melecule|

---

US8455233B2|2007-12-19|2013-06-04|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

BRPI0908879B1|2008-02-29|2019-07-09|University Of Central Florida Research Foundation, Inc.|PLANT DEGRADATION METHOD, PLANT DEGRADATION COCKTAIL, HOMOGENIZED PLANT MATERIAL AND ENZYME COCKTAIL|

---

WO2009133036A1|2008-04-29|2009-11-05|Dsm Ip Assets B.V.|Cellobiohydrolase 1 from penicillium chysogenum and uses thereof|

---

DK3222716T3|2009-11-06|2020-11-16|Novozymes Inc|COMPOSITIONS FOR SACCHARIFICATION OF CELLULOSIS MATERIAL|

---

CA2780198A1|2009-11-06|2011-05-12|Novozymes, Inc.|Polypeptides having xylanase activity and polynucleotides encoding same|CA2780198A1|2009-11-06|2011-05-12|Novozymes, Inc.|Polypeptides having xylanase activity and polynucleotides encoding same|

---

EP2588604B1|2010-06-30|2016-06-29|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

US9267126B2|2010-08-30|2016-02-23|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

US9187742B2|2010-08-30|2015-11-17|Novozymes, Inc.|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2012030845A2|2010-08-30|2012-03-08|Novozymes A/S|Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same|

---

US20130212746A1|2010-08-30|2013-08-15|Novoyzmes A/S|Polypeptides Having Hemicellulolytic Activity And Polynucleotides Encoding Same|

---

EP3470514A1|2010-08-30|2019-04-17|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US8624082B2|2010-08-30|2014-01-07|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

DK2622070T3|2010-09-30|2016-11-21|Novozymes Inc|Variants of polypeptides having cellulolytic enhancing ACTIVITY AND POLYNUCLEOTIDES ENCODING THEM|

---

ES2594528T3|2010-09-30|2016-12-20|Novozymes, Inc.|Variants of polypeptides with cellulolytic enhancement activity and polynucleotides that encode them|

---

WO2012044915A2|2010-10-01|2012-04-05|Novozymes, Inc.|Beta-glucosidase variants and polynucleotides encoding same|

---

US20130260423A1|2010-10-26|2013-10-03|Novozymes North America, Inc.|Methods of Saccharifying Sugar Cane Trash|

---

ES2541492T3|2010-11-02|2015-07-21|Novozymes, Inc.|Methods for pretreating cellulosic material with GH61 polypeptide|

---

WO2012059053A1|2010-11-04|2012-05-10|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2012062220A1|2010-11-12|2012-05-18|Novozymes A/S|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

CN103517985B|2011-01-26|2016-12-07|诺维信公司|There is the polypeptide of cellobiohydrolase activity and encode the polynucleotide of this polypeptide|

---

DK2668265T3|2011-01-26|2017-10-16|Novozymes As|Hitherto unknown glycoside hydrolases from thermophilic fungi|

---

US9080161B2|2011-01-26|2015-07-14|Novozymes, Inc.|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

MX2013007720A|2011-01-26|2013-08-09|Novozymes As|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.|

---

DK2678352T3|2011-02-23|2018-03-05|Novozymes Inc|Polypeptides with cellulolysis enhancing activity and polynucleotides encoding them|

---

CN103608461B|2011-03-09|2016-08-03|诺维信公司|The method increasing the cellulolytic enhancing activity of polypeptide|

---

US9409958B2|2011-03-10|2016-08-09|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP3333258A3|2011-03-25|2018-07-25|Novozymes A/S|Method for degrading or converting cellulosic material|

---

EP2691519A1|2011-03-31|2014-02-05|Novozymes, Inc.|Cellulose binding domain variants and polynucleotides encoding same|

---

WO2012135659A2|2011-03-31|2012-10-04|Novozymes A/S|Methods for enhancing the degradation or conversion of cellulosic material|

---

DK2702153T3|2011-04-28|2019-03-18|Novozymes Inc|Polypeptides with endoglucanase activity and polynucleotides encoding them|

---

CN103797126A|2011-04-29|2014-05-14|诺维信股份有限公司|Methods for enhancing the degradation or conversion of cellulosic material|

---

EP2734633B1|2011-07-22|2019-05-01|Novozymes North America, Inc.|Processes for pretreating cellulosic material and improving hydrolysis thereof|

---

ES2672048T3|2011-08-04|2018-06-12|Novozymes Inc.|Polypeptides with xylanase activity and polynucleotides that encode them|

---

CN103703125B|2011-08-04|2016-09-07|诺维信公司|There is polypeptide and the coded polynucleotide thereof of endoglucanase activity|

---

BR112014004190A2|2011-08-24|2017-03-01|Novozymes Inc|method for constructing a filamentous fungal strain, filamentous fungal strain, method for producing multiple recombinant polypeptides, and tandem construct|

---

BR112014004188A2|2011-08-24|2017-03-21|Novozymes Inc|method for obtaining positive transformants from a filamentous fungal host cell, filamentous fungal host cell, method for producing multiple recombinant polypeptides, and tandem construct|

---

WO2013043910A1|2011-09-20|2013-03-28|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP2760885B1|2011-09-30|2017-07-26|Novozymes, Inc.|Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

WO2013064075A1|2011-10-31|2013-05-10|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP3382017A1|2011-11-18|2018-10-03|Novozymes A/S|Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same|

---

EP3597736A1|2011-11-21|2020-01-22|Novozymes A/S|Gh61 polypeptide variantsand polynucleotides encoding same|

---

EP3342860A1|2011-11-22|2018-07-04|Novozymes, Inc.|Polypeptides having beta-xylosidase activity and polynucleotides encoding same|

---

WO2013079015A1|2011-12-01|2013-06-06|Novozymes, Inc.|Polypeptides having beta-xylosidase activity and polynucleotides encoding same|

---

EP2791330B1|2011-12-16|2017-07-26|Novozymes, Inc.|Polypeptides having laccase activity and polynucleotides encoding same|

---

MX2014007255A|2011-12-19|2014-08-08|Novozymes As|Processes and compositions for increasing the digestibility of cellulosic materials.|

---

WO2013091547A1|2011-12-19|2013-06-27|Novozymes, Inc.|Polypeptides having catalase activity and polynucleotides encoding same|

---

CA2878019A1|2011-12-20|2013-06-27|Novozymes, Inc.|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2013096652A1|2011-12-21|2013-06-27|Novozymes, Inc.|Methods for determining the degradation of a biomass material|

---

WO2013163590A2|2012-04-27|2013-10-31|Novozymes, Inc.|Gh61 polypeptide variants and polynucleotides encoding same|

---

WO2014092832A2|2012-09-19|2014-06-19|Novozymes, Inc.|Methods for enhancing the degradation or conversion of cellulosic material|

---

CN104755617B|2012-10-08|2019-01-01|诺维信公司|Polypeptide with cellulolytic enhancing activity and the polynucleotides for encoding them|

---

WO2014066141A2|2012-10-24|2014-05-01|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

CA2892031A1|2012-11-27|2014-06-05|Novozymes A/S|Milling process|

---

EP2925790B1|2012-11-27|2021-07-07|Novozymes A/S|Milling process|

---

CN104870639A|2012-12-14|2015-08-26|诺维信公司|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US20150337280A1|2012-12-19|2015-11-26|Novozymes A/S|Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same|

---

DK2964760T3|2013-03-08|2021-07-26|Novozymes Inc|Cellobiohydrolase variants and polynucleotides encoding them|

---

WO2014182990A1|2013-05-10|2014-11-13|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

CA2919157A1|2013-09-04|2015-03-12|Novozymes A/S|Processes for increasing enzymatic hydrolysis of cellulosic material|

---

WO2015081139A1|2013-11-26|2015-06-04|Novozymes A/S|Enzyme compositions and uses thereof|

---

EP3511418B1|2014-01-07|2020-07-15|Novozymes A/S|Corollospora maritima mannanase and its use|

---

DK3152315T3|2014-06-06|2018-11-26|Novozymes As|ENZYME COMPOSITIONS AND APPLICATIONS THEREOF|

---

BR112017003847A2|2014-08-28|2018-02-27|Renescience As|process for solubilizing waste such as municipal solid waste , and process for producing a fermentation product|

---

WO2016037096A1|2014-09-05|2016-03-10|Novozymes A/S|Carbohydrate binding module variants and polynucleotides encoding same|

---

BR112017005914A2|2014-09-23|2017-12-12|Novozymes As|process for ethanol production, and recombinant fermenting organism.|

---

CN107002106A|2014-11-26|2017-08-01|诺维信公司|Ginding process|

---

SI3250697T1|2015-01-28|2020-02-28|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

CN107406862A|2015-01-28|2017-11-28|帝斯曼知识产权资产管理有限公司|The method of enzymatic hydrolysis ligno-cellulosic materials and sugar fermentation|

---

WO2016120298A1|2015-01-28|2016-08-04|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

US10557127B2|2015-02-24|2020-02-11|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2016145084A1|2015-03-09|2016-09-15|Novozymes A/S|Methods of introducing multiple expression constructs into a eukaryotic cell|

---

BR112017019332A2|2015-03-12|2018-07-24|Beta Renewables Spa|processes for improving a saccharification glucose or xylose yield of a lignocellulosic material and for producing a fermentation product from a lignocellulosic material|

---

EP3067428A1|2015-03-12|2016-09-14|BETA RENEWABLES S.p.A.|A process for producing a hydrolyzed mixture from a pre-treated ligno-cellulosic slurry comprising a slurry liquid and slurry solids|

---

US20180051306A1|2015-03-12|2018-02-22|Novozymes A/S|Enzymatic Hydrolysis with Hemicellulolytic Enzymes|

---

EP3268486A1|2015-03-12|2018-01-17|Novozymes A/S|Multi-stage enzymatic hydrolysis of lignocellulosic biomass employing an oxidoreductase with an aa9 polypeptide|

---

WO2016169893A1|2015-04-20|2016-10-27|Dsm Ip Assets B.V.|Whole fermentation broth|

---

WO2016169892A1|2015-04-20|2016-10-27|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2016188459A1|2015-05-27|2016-12-01|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2016207144A1|2015-06-22|2016-12-29|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

EP3325616A1|2015-07-24|2018-05-30|Novozymes, Inc.|Polypeptides having arabinofuranosidase activity and polynucleotides encoding same|

---

US20180216089A1|2015-07-24|2018-08-02|Novozymes, Inc.|Polypeptides Having Beta-Xylosidase Activity And Polynucleotides Encoding Same|

---

WO2017040907A1|2015-09-04|2017-03-09|Novozymes A/S|Methods of inhibiting aa9 lytic polysaccharide monooxygenase catalyzed inactivation of enzyme compositions|

---

US10479984B2|2015-09-22|2019-11-19|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2017070219A1|2015-10-20|2017-04-27|Novozymes A/S|Lytic polysaccharide monooxygenasevariants and polynucleotides encoding same|

---

CN114054481A|2015-11-02|2022-02-18|雷内科学有限公司|Dissolving municipal solid waste with mixed enzymes|

---

RU2710554C1|2016-02-19|2019-12-27|Интерконтинентал Грейт Брендс Ллк|Methods for formation of multiple valuable streams from biomass sources|

---

BR112018067371A2|2016-03-02|2019-01-15|Novozymes As|cellobiohydrolase variant, enzyme composition, whole broth formulation or cell culture composition, polynucleotide, recombinant host cell, plant, plant part or transgenic plant cell, methods for producing and obtaining a cellobio variant. hydrolase, transgenic plant, and processes for degradation of a cellulosic material, for production of a fermentation product and for fermentation of a cellulosic material|

---

EP3433358A1|2016-03-24|2019-01-30|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2017205535A1|2016-05-27|2017-11-30|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

EP3469090A1|2016-06-09|2019-04-17|DSM IP Assets B.V.|Seed train for large scale enzyme production|

---

WO2018019948A1|2016-07-29|2018-02-01|Dsm Ip Assets B.V.|Polypeptides having cellulolytic enhancing activity and uses thereof|

---

WO2018026868A1|2016-08-01|2018-02-08|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

WO2018085370A1|2016-11-02|2018-05-11|Novozymes A/S|Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material|

---

US20190276809A1|2016-11-24|2019-09-12|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2018096019A1|2016-11-24|2018-05-31|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2018185071A1|2017-04-03|2018-10-11|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2019072732A1|2017-10-09|2019-04-18|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2019086370A1|2017-10-30|2019-05-09|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

EP3704259A1|2017-10-30|2020-09-09|DSM IP Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

BR112020018791A2|2018-03-28|2020-10-13|Dsm Ip Assets B.V.|enzyme composition|

---

WO2019185681A1|2018-03-28|2019-10-03|Dsm Ip Assets B.V.|Enzyme composition|

---

BR112020023198A2|2018-05-17|2021-02-09|Dsm Ip Assets B.V.|process for producing a polypeptide|

---

WO2019229108A1|2018-05-30|2019-12-05|Dsm Ip Assets B.V.|Process for producing sugars from carbohydrate materials|

---

WO2020058248A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

WO2020058249A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

WO2020058253A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

EP3870715A1|2018-10-24|2021-09-01|DSM IP Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

US20220025348A1|2018-12-12|2022-01-27|Novozymes A/S|Polypeptides Having Xylanase Activity And Polynucleotides Encoding Same|

---

CN113544280A|2019-03-12|2021-10-22|帝斯曼知识产权资产管理有限公司|Method for producing a fermentation broth|

---

WO2021013464A1|2019-07-25|2021-01-28|Novozymes A/S|Filamentous fungal expression system|

---

WO2021026201A1|2019-08-05|2021-02-11|Novozymes A/S|Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct|

---

WO2021048164A1|2019-09-10|2021-03-18|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2022013148A1|2020-07-13|2022-01-20|Dsm Ip Assets B.V.|Process for the production of biogas|

法律状态:
2018-05-02| B07A| Technical examination (opinion): publication of technical examination (opinion)|

---

2018-10-09| B09A| Decision: intention to grant|

---

2018-11-21| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 05/11/2010, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US25900609P| true| 2009-11-06|2009-11-06|

---

US61/259006|2009-11-06|

---

PCT/US2010/055640|WO2011057083A1|2009-11-06|2010-11-05|Polypeptides having xylanase activity and polynucleotides encoding same|

---