transgenic microbial host cell, methods for producing a polypeptide having xylanase activity, for de

专利摘要:
isolated polypeptide, isolated polynucleotide, methods for making a polypeptide, for producing a precursor cell mutant, for inhibiting expression of a polypeptide, for producing a protein, for degrading or converting a material, for producing a fermentation product, and for fermenting a material, transgenic plant, plant part or plant cell, and double filming inhibitory RNA molecule. The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors and host cells comprising polynucleotides as well as methods for producing and using the polypeptides.
公开号:BR112012006978B1
申请号:R112012006978-0
申请日:2010-09-29
公开日:2018-11-06
发明作者:Lan Tang；Ye Liu；Junxin Duan；Hanshu Ding
申请人:Novozymes, Inc.；Novozymes A/S；
IPC主号:

专利说明:

(54) Title: TRANSGENIC MICROBIAL HOSTED CELL, METHODS TO PRODUCE A POLYPEPTIDE HAVING XYLANASE ACTIVITY, TO DEGRAD OR CONVERT A CELLULOSIC MATERIAL OR A MATERIAL CONTAINING XYLANE, TO PRODUCE A MATERIAL PRODUCT, FOR A FERMENTATION MATERIAL, FOR , CONSTRUCTION CONTAINING NUCLEIC ACID, AND, EXPRESSION VECTOR.
(51) Int.CI .: C12N 9/24; C07K 14/385.
(30) Unionist Priority: 29/09/2009 US 61/246887.
(73) Holder (s): NOVOZYMES, INC .; NOVOZYMES A / S.
(72) Inventors): LAN TANG; YE LIU; JUNXIN DUAN; HANSHU DING.
(86) PCT Order: PCT US2010050709 of 29/09/2010 (87) PCT Publication: WO 2011/041405 of 07/04/2011 (85) Date of the Beginning of the National Phase: 28/03/2012 (57) Summary: ISOLATED POLYPEPTIDE, ISOLATED POLYNUCLEOTIDE, METHODS TO PRODUCE A POLYPEPTIDE, TO PRODUCE A MUTANT OF A PRECURSING CELL, TO INHIBIT THE EXPRESSION OF A POLYPEPTIDE, TO PRODUCE A PROTEIN, TO DETERMINE OR DETERMINE OR DETERMINE OR CONTAIN A MATERIAL, TRANSGENIC PLANT, PART OF PLANT OR PLANT CELL, AND, DUAL FILMING INHIBITORY RNA MOLECULE. The present invention relates to isolated polypeptides having xylanase activity and isolated polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors and host cells that comprise polynucleotides as well as methods for producing and using the polypeptides.
“TRANSGENIC MICROBIAL HOSTED CELL, METHODS TO PRODUCE A POLYPEPTIDE HAVING XYLANASE ACTIVITY, TO DEGRAD OR CONVERT A CELLULOSIC MATERIAL OR A MATERIAL CONTAINING XYLANE, TO PRODUCE A FERMENTATION PRODUCT, MATERIAL DETERMINATION, PHARMACEUTICAL MATERIAL, CONTENT , E, VECTOR OF EXPRESSION. ”
Declarations Regarding the Rights of Inventions Made Under Federally Sponsored Research and Development
This invention was made in part with Government Support under the Cooperative Agreement DE-FC36-08GO18080 granted by the Department of Energy. The government has certain rights in this invention.
Reference to a sequence listing
This order contains a sequence listing in computer readable form. The computer-readable form is incorporated by reference here.
Reference to a deposit of biological material
This order contains a reference to a deposit of biological material, the deposit of which is incorporated by reference here.
Fundamentals of the invention
Field of invention
The present invention relates to isolated polypeptide having xylanase activity and isolated polynucleotides that encode the polypeptides. The invention also relates to nucleic acid constructs, vectors and host cells that comprise polynucleotides as well as methods of producing and using the polypeptides.
Description of the related technique
Petition 870180061048, of 07/16/2018, p. 18/24
Cellulose is a simple sugar glucose polymer linked by beta-1,4 bonds. Many microorganisms produce enzymes that hydrolyze beta-linked glycans. These enzymes include endoglycanases, cellobiohydrolases and beta-glycosidases. Endoglycanases digest the cellulose polymer at random locations, which open it up for attack by cellobiohydrolases. Cellobiohydrolases sequentially release cellobiose molecules from the ends of the cellulose polymer. Cellobiosis is a water-soluble beta-1,4 linked dimer of glucose. Beta-glycosidases hydrolyze cellobiose to glucose.
The conversion of lignocellulosic feed stocks into ethanol has the advantages of the rapid availability of large quantities of feed stocks, the desirability of avoiding the burning or filling of materials with earth and the cleaning of ethanol fuel. Wood, agricultural residues, herbaceous crops and municipal solid residues were considered as food stocks for the production of ethanol. These materials consist primarily of cellulose, hemicellulose and lignin. Once cellulose is converted to glucose, glucose is easily fermented by yeast in ethanol.
There is a need in the art to improve cellulosic protein compositions by supplementing with additional enzymes to increase efficiency and to improve cost-effective enzyme solutions for lignocellulose degradation.
The present invention provides polypeptides having xylanase and polynucleotide activity that encode the polypeptides.
Summary of the invention
The present invention concerns an isolated polypeptide having xylanase activity selected from the group consisting of:
(a) a polypeptide comprising an amino acid sequence having at least 90% identity to the mature polypeptide of
SEQ ID NO: 2;
(b) a polypeptide encoded by a polynucleotide that hybridizes under very high stringency conditions to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a polypeptide coding sequence mature from SEQ ID NO: 1 or (iii) a full length complementary filament of (i) or (ü);
(c) a polypeptide encoded by a polynucleotide comprising a nucleotide sequence having at least 90% identity to a mature polypeptide coding sequence of SEQ ID NO: 1 and (d) a variant comprising a substitution, deletion and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2.
The present invention also concerns isolated polynucleotides which encode polypeptides having xylanase activity, selected from the group consisting of:
(a) a polynucleotide encoding a polypeptide comprising an amino acid sequence having at least 90% identity to the mature polypeptide of SEQ ID NO: 2;
(b) a polynucleotide that hybridizes under very high stringency conditions to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1 or (iii) a complementary filament of total length of (i) or (ii);
(c) a polynucleotide comprising a nucleotide sequence having at least 90% identity to a mature polypeptide coding sequence of SEQ ID NO: 1 and (d) a polynucleotide encoding a variant comprising a substitution, deletion and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2.
The present invention also relates to nucleic acid constructs, recombinant expression vectors, recombinant host cells that comprise the polynucleotides and methods of producing the polypeptides having xylanase activity.
The present invention also concerns methods of inhibiting the expression of a polypeptide having xylanase activity in a cell, which comprises administering to the cell or expressing in the cell, a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence of a polynucleotide of the present invention. The present also relates to such a double-stranded inhibitor molecule (dsRNA), wherein optionally the dsRNA is a siRNA or a miRNA molecule.
The present invention also concerns a method of using polypeptides having xylanase activity for the degradation or conversion of cellulosic material or containing xylan.
The present invention also relates to plants that comprise an isolated polynucleotide that encodes a polypeptide having xylanase activity.
The present invention also relates to methods of producing a polypeptide having xylanase activity, which comprises: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide encoding the polypeptide having xylanase activity under conditions conducive to production polypeptide and (b) recovering the polypeptide.
The present invention further relates to an isolated polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2; to nucleic acid constructs, expression vectors and recombinant host cells that comprise the polynucleotide and to methods of producing a protein.
Brief description of the figures
Figure 1 shows a restriction map of pPpin3.
Figures 2A and 2B show the genomic DNA sequence and the deduced amino acid sequence of a Penicillium pinophilum xylanase gene NN046877 GH10 (SEQ ID NOs: 1 and 2, respectively).
Definitions
Xylanase: The term "xylanase" is defined here as a 1,4beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endohydrolysis of 1,4-beta-D-xylosidic bonds in xylan. For the purposes of the present invention, xylan activity is determined using birch wood xylan as a substrate. A unit of xylanase activity is defined as 1.0 pmol of reducing sugar (measured in glucose equivalents as described by Lever, 1972, A new reaction for colorimetric determination of carbohydrates, Anal. Biochem 47: 273-279) produced by minute during the initial hydrolysis period at 50 ° C, pH 5 of 2 g of birch wood xylan per liter as a substrate in 50 mM sodium acetate pH 5 containing 0.01% TWEEN® 20.
Xylan degradation activity: The terms "xylan degradation activity" OR "xylanolitic activity" are defined here as a biological activity that hydrolyzes the material containing xylan. The two basic methods for measuring xylanolitic activity include: (1) measuring total xylanolitic activity and (2) measuring individual xylanolitic activities (endoxylanases, beta-xylosidases, arabinofuranosidases, alpha-glucuronidases, acetyl xyluma esterases, ferulic acid esterases and alpha- glucuronyl esterases). Recent progress in xylanolitic enzyme assays is summarized in several publications including Biely and Puchard, Recent progress in the assays of xylanolytic enzymes, 2006, Journal of the Science of Food and
Agriculture 86 (11): 1636-1647; Spanikova and Biely, 2006, Glucuronoyl esterase - Novel carbohydrate esterase produced by Schizophyllum commune, FEBS Letters 580 (19): 4597-4601 and Herrmann, Vrsanska, Jurickova, Hirsch, Biely, and Kubicek, 1997, The beta-D-xilosidase of Trichoderma reesei is a multifunctional beta-D-xylan xylohydrolase, Biochemical Journal 321: 375-381.
The total xylan degradation activity can be measured by determining the reduction of sugars formed from various types of xylan, including oat, spelled, beech and larch xylans or by the polymeric determination of pigmented xylan fragments released from various xylans covalently pigmented. The most common total xylanolitic activity test is based on the production of polymeric 4-Omethyl glucuronoxylane reduction sugars as described in Bailey, Biely, Poutanen, 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23 (3 ): 257-270.
For the purposes of the present invention, xylan degradation activity is determined by measuring the increase in birch wood xylan hydrolysis (Sigma Chemical Co., Inc., St. Louis, MO, USA) by xylan degradation enzymes under the following typical conditions: reactions of 1 ml, 5 mg / ml of substrate (total solids), 5 mg of xylanolitic protein / g of substrate, 50 mM sodium acetate pH 5, 50 ° C, 24 hours, analysis of sugar using a hydroxybenzoic acid hydrazide (PHBAH) assay as described by Lever, 1972, A new reaction for colorimetric determination of carbohydrates, Anal. Biochem ΑΊ '. 273-279.
Beta-xylosidase: The term "beta-xylosidase" is defined here as a beta-D-xyloside xylohydrolase (EC 3.2.1.37) that catalyzes the exohydrolysis of short (1—> 4) -xylooligosaccharides beta, for the removal of residues from D-xylose successive from the non-reducing terminals. For the purposes of the present invention, a unit of beta-xylosidase activity is defined as 1.0 pmol of p-nitrophenol produced per minute at 40 ° C, pH 5 of 1 mM p-nitrophenyl-beta-D-xyloside as substrate in 100 mM sodium citrate pH 5 containing 0.01% TWEEN® 20.
Acetylxyluma esterase: The term "acetylxyluma esterase" is defined here as a carboxylesterase (EC 3.1.1.72) that catalyzes the hydrolysis of acetyl groups from polymeric xylan, acetylated xylose, acetylated glucose, alpha-naphthyl acetate and p- acetate nitrophenyl. For the purposes of the present invention, the activity of acetylxyluma esterase is determined using 0.5 mM pnitrophenylacetate as a substrate in 50 mM sodium acetate pH 5.0 containing 0.01% TWEEN ™ 20. One unit of activity of acetylxyluma esterase was defined as an amount of enzyme capable of releasing 1 pmol of pnitrophenolate anion per minute at pH 5.25 ° C.
Feruloyl esterase: The term "feruloyl esterase" means a 4hydroxy-3-methoxy-aminoyl-sugar hydrolase (EC 3.1.1.73) that catalyzes the hydrolysis of the 4-hydroxy-3-methoxy-aminoyl group (feruloyl) of an esterified sugar, which is usually arabinose on “natural” substrates, for the production of ferulate (4-hydroxy-3-methoxycinnamate). Feruloyl esterase is also known as ferulic acid esterase, hydroxynaminoyl esterase, FAEIII, cinnamyl ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. For the purposes of the present invention, feruloyl esterase activity is determined using 0.5 mM p-nitrophenylferulate as the substrate in 50 mM sodium acetate pH 5.0. One unit of feruloyl esterase equals the amount of enzyme capable of releasing 1 pmol of p-nitrophenolate anion per minute at pH 5, 25 ° C.
Alpha-glucuronidase: The term "alpha-glucuronidase" means an alpha-D-glycosiduronate glucuronohydrolase (EC 3.2.1.139) that catalyzes the hydrolysis of an alpha-D-glucuranoside to D-glucuronate and an alcohol. For the purposes of the present invention, alpha-glucuronidase activity is determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha-glucuronidase equals the amount of enzyme capable of releasing 1 pmol of glucuronic acid or 48
O-methylglucuronic per minute at pH 5.40 ° C.
Alpha-L-arabinofuranosidase: The term "alpha-Larabinofuranosidase" means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1,55) that catalyzes the hydrolysis of non-reducing alpha-L-arabinofuranoside residues into alpha-L-arabinosides . The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1,3) and / or (1,5) bonds, arabinoxylans and arabinogalactans. Alpha-Larabinofuranosidase is also known as arabinosidase, alfaarabinosidase, alpha-L-arabinosidase, alpha-arabinofuranosidase, alpha-L-arabinofuranosidase polysaccharide, alpha-L-arabinofuranoside hydrolase, Larabinosidase or alpha-L-arabinanase. For the purposes of the present invention, alpha-L-arabinofuranosidase activity is determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme Intemational Ireland, Ltd., Bray, Co. Wicklow, Ireland) per ml of 100 mM sodium acetate pH 5 in a total volume of 200 μΐ for 30 minutes at 40 ° C followed by arabinose analysis by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Cellulolytic enzyme or cellulase: The term "cellulolytic enzyme" or "cellulase" means one or more (several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglycanase (s), cellobiohydrolase (s), beta-glycosidase (s), or combinations thereof. The two basic methods for measuring cellulolytic activity include: (1) measuring total cellulolytic activity and (2) measuring individual cellulolytic activities (endoglycanases, cellobiohydrolases and beta-glucosidases) as reviewed in Zhang et al., Outlook for cellulase improvement: Screening and selection strategies, 2006, Biotechnology Advances 24: 452-481. Total cellulolytic activity is usually measured using insoluble substrates, including Whatman NM filter paper, microcrystalline cellulose, bacterial cellulose, algae cellulose, cotton, pretreated lignocellulose, etc. The most common total cellulolytic activity assay is the paper filter assay using Whatman No. 1 filter paper as the substrate. The assay was established by the Intemational Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Measurement of cellulase activities, PureAppl. Chem. 59: 257-68).
For the purposes of the present invention, cellulolytic enzyme activity is determined by measuring the increase in hydrolysis of a cellulosic material by cellulolytic enzymes under the following conditions: 1 to 20 mg of cellulolytic enzyme protein / g of cellulose in PCS for 3 to 7 days at 50 ° C compared to a control hydrolysis without the addition of cellulolytic enzyme protein. Typical conditions are 1 ml reactions, PCS washed or not washed, insoluble solids at 5%, 50 mM sodium acetate pH 5, 1 mM MnSO ₄ , 50 ° C, 72 hours, sugar analysis by AMINEX® column HPX-87H (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Endoglucanase: The term “endoglucanase” is defined here as a sequence of endo-1,4- (1,3; 1,4) -beta-D-glycan 4-glycanhydrolase (EC 3.2.1.4), which catalyzes the endhydrolysis of 1,4-beta-D-glycosidic bonds in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenine, beta-1,4 bonds in mixed beta-1,3 glycans such as beta-D-glycans or cereal xyloglycans and other plant material containing cellulosic components. Endoglycanase activity can be determined by measuring the reduction in substrate viscosity or increase in the reducing ends determined by a reduction sugar assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). For the purposes of the present invention, endoglycanase activity is determined using the hydrolysis of carboxymethyl cellulose (CMC) according to the procedure of Ghose, 1987, Pure andAppl. Chem. 59: 257-268.
Cellobiohydrolase: The term “cellobiohydrolase” means a 1,4beta-D-glycan cellobiohydrolase (EC 3.2.1.91), which catalyzes the hydrolysis of 1,4-beta-D-glycosidic bonds in cellulose, celloligosaccharides or any polymer containing glucose bound by beta-1,4, cellobiosis release from reducing or non-reducing ends of the chain (Teeri, 1997, Crystalline cellulose degradation: New insight into the function of cellobiohydrolases, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Trichoderma reesei cellobiohydrolases: why so efficient on crystalline cellulose , Biochem. Soc. Trans. 26: 173-178). For the purposes of the present invention, the activity of cellobiohydrolase activity is determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEES Letters, 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEESLetters, 187: 283-288.
Beta-glycosidase: The term “beta-glycosidase” means a betaD-glycoside glycohydrolase (E.C. 3.2.1.21), which catalyzes the hydrolysis of non-reducing terminal beta-D-glucose residues with the release of beta-D-glucose. For the purposes of the present invention, beta-glycosidase activity is determined according to the basic procedure described by Venturi et al., 2002, Extracellular beta-D-glucosidase from Chaetomium thermophilum var. coprophilum: production, purification and some biochemical properties, J. Basic Microbiol. 42: 55-66. One unit of beta-glucosidase is defined as 1.0 pmol of pnitrophenolate anion produced per minute at 25 ° C, pH 4.8 of 1 mM of p-nitrophenyl-betaD-glycopyranoside as the substrate in 50 mM of sodium citrate containing 0.01% TWEEN®20.
Polypeptide having cellulolytic intensifying activity: The term "polypeptide having cellulolytic intensifying activity" means a GH61 polypeptide that catalyzes the intensification of the hydrolysis of a cellulosic material by the enzyme having cellulolytic activity. For the purposes of the present invention, cellulolytic intensifying activity is determined by measuring the increase in reducing sugars or the increase in the total cellobiose and glucose of the hydrolysis of a cellulosic material by cellulolytic enzyme under the following conditions: 1 to 50 mg of total protein / g of cellulose in PCS, where the total protein is comprised of 50 to 99.5% w / w of cellulolytic enzyme protein and 0.5 to 50% w / w of protein of a GH61 polypeptide having cellulolytic enhancing activity for 1 at 7 days at 50 ° C compared to a control hydrolysis with equal total protein loading without cellulolytic enhancing activity (1 to 50 mg cellulolytic protein / g cellulose in PCS). In a preferred aspect, a mixture of CELLUCLAST® 1.5L (Novozymes A / S, Bagsvrd, Denmark) in the presence of 2 to 3% by weight of total protein Aspergillus oryzae betaglicosidase (recombinantly produced in Aspergillus oryzae according to WO 02/095014 ) or 2 to 3% by weight of total protein Aspergillus fumigatus beta-glycosidase (recombinantly produced in Aspergillus oryzae as described in WO 2002/095014) cellulase protein loading is used as the source of cellulolytic activity.
Polypeptides having cellulolytic enhancing activity enhance the hydrolysis of a protein-catalyzed cellulosic material having cellulolytic activity by reducing the amount of cellulosic enzyme required to achieve the same degree of hydrolysis preferably at least 1.01 times, more preferably at least 1.05 times , more preferably at least 1.10 times, more preferably at least 1.25 times, more preferably at least 1.5 times, more preferably at least 2 times, more preferably at least 3 times, more preferably at least 4 times, more preferably at least 5 times, even more preferably at least 10 times and most preferably at least 20 times.
Glycoside hydrolase family 61: The term "Glycoside hydrolase family 61" or "GH61 family" or "GH61" means a polypeptide that is in the glycoside hydrolase Family 61 according to Henrissat B., 1991, A classification of glycosyl hydrolases based on aminoacid sequence similarities, Biochem. J. 280: 309-316, and Henrissat B., and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. J. 316: 695-696.
Cellulosic material: The cellulosic material can be any material containing cellulose. The predominant polysaccharide in the primary cell wall of the biomass is cellulose, the second most abundant is hemicellulose and the third is pectin. The secondary cell wall, produced after the cell has stopped developing, also contains polysaccharides and is strengthened by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is an anhydrocelobiose homopolymer and, therefore, a linear beta (1-4) -D-glycan, while hemicelluloses include a variety of compounds, such as xylans, xyloglycans, arabinoxylans and mannans in complex branched structures with a spectrum substituents. Although, in general, polymorphic cellulose is found in plant tissue, primarily as an insoluble crystalline matrix of parallel glycan chains. Hemicelluloses, usually, hydrogen bond to cellulose, as well as other hemicelluloses, which help to stabilize the cell wall matrix.
Cellulose is generally found, for example, in the branches, leaves, bark and ears of plants or leaves, branches and wood of trees. Cellulosic material can be, but is not limited to, herbaceous material, agricultural waste, forest waste, municipal solid waste, waste paper and pulp and paper shredding waste (see, for example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington DC; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25: 695 -719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocelulosics, in Advances in Biochemical Engineering / Biotechnology, T. Scheper, managing editor, Volume 65, pp.2340, Springer-Verlag, New York). It is understood that cellulose may be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose and hemicellulose and a mixed matrix. In a preferred aspect, the cellulosic material is lignocellulose.
In one aspect, the cellulosic material is herbaceous material. In another aspect, the cellulosic material is agricultural waste. In another aspect, the cellulosic material is forest waste. In another aspect, cellulosic material is municipal solid waste. In another aspect, the cellulosic material is waste paper. In another aspect, the cellulosic material is pulp and paper shredding residue.
In another aspect, the cellulosic material is corn forage. In another aspect, the cellulosic material is corn fiber. In another aspect, the cellulosic material is ear of corn. In another aspect, the cellulosic material is orange peel. In another aspect, the cellulosic material is rice straw. In another aspect, the cellulosic material is wheat straw. In another aspect, the cellulosic material is grassy. In another aspect, the cellulosic material is miscanthus. In another aspect, the cellulosic material is bagasse.
In another aspect, the cellulosic material is microcrystalline cellulose. In another aspect, the cellulosic material is bacterial cellulose. In another aspect, the cellulosic material is algae cellulose. In another aspect, the cellulosic material is cotton lint. In another aspect, the cellulosic material is cellulose treated with amorphous phosphoric acid. In another aspect, the cellulosic material is filter paper.
The cellulosic material can be used as is or can be subjected to pretreatment, using conventional methods known in the art, as described herein. In a preferred aspect, the cellulosic material is pre-treated.
Pre-treated corn forage: The term "PCS" or "Pre-treated corn forage" means a cellulosic material derived from corn forage by treatment with heat and dilute sulfuric acid.
Xylan-containing material: The term "xylan-containing material" is defined here as a sequence, any material comprising plant cell wall polysaccharide containing a main chain of beta- (1-4) linked xylose residues. Terrestrial plant xylans are homopolymers that have a beta- (1-4) -Dxylopyranose backbone, which is branched by short carbohydrate chains. The chains comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose and / or various oligosaccharides, compounds of D-xylose, L-arabinose, D- or Lgalactose and D-glucose. Xylan-like polysaccharides can be divided into homoxylans or heteroxylans, which include glucuronoxylans, (arabino) glucuronoxylans, (glucurono) arabinoxylans, arabinoxylans and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Know. 186: 1—67.
In the methods of the present invention, any material containing xylan can be used. In a preferred aspect, the material containing xylan is lignocellulose.
Isolated polypeptide: The term "isolated polypeptide" as used here refers to a polypeptide that is isolated from a source. In a preferred aspect, the polypeptide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60 % pure, even more preferably at least 80% pure and more preferably at least 90% pure, as determined by SDS-PAGE.
Substantially pure polypeptide: The term "substantially pure polypeptide" here indicates a polypeptide preparation that contains, at most 10%, preferably, at most 8%, more preferably, at most 6%, more preferably, at most 5%, most preferably , most 4%, most preferably, most 3%, even more preferably, most 2%, most preferably, most 1% and even more preferably, most 0.5% by weight of other polypeptide material with the which is naturally or recombinantly associated. Therefore, it is preferred that the substantially pure polypeptide is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, most preferably at less 98% pure, even more preferably at least 99% pure, more preferably at least 99.5% pure and even more preferably 100% pure by weight of the total polypeptide material present in the preparation. The polypeptides of the present invention are preferably in a substantially pure form, that is, that the polypeptide preparation is essentially free of other polypeptide material with which it is naturally or recombinantly associated. This can be accomplished, for example, by preparing the polypeptide by well-known recombinant methods or by classical purification methods.
Mature polypeptide: The term "mature polypeptide" is defined here as a sequence a polypeptide in its final form following translation and any post-translation modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 20 to 407 of SEQ ID NO: 2 based on the SignalP program (Nielsen et al., 1997, Protein Engineering 10: 1-6) program that predicts amino acids 1 to 19 of SEQ ID NO: 2 is a signal peptide.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" is defined here as a sequence a nucleotide sequence that encodes a mature polypeptide having xylanase activity. In one aspect, the mature polypeptide sequence are nucleotides 58 to 1439 of SEQ ID NO: 1 based on the SignalP program (Nielsen et al., 1997, which predicts nucleotides 1 to 1 of SEQ ID NO: 1 encode a peptide of signal.
Identity: The relationship between the two amino acid sequences or between the two sequences is described by the parameter "identity".
For the purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443453) as implemented in the Needle program. EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics 16: 276-277), preferably version 3.0.0 or later. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5 and the Replacement Matrix EBLOSUM62 (EMBOSS version of BLOSUM62). The output of the needle-labeled “longest identity” (obtained using the -nobrief option) is used as the percentage identity and is calculated as follows:
(Identical residues x 100) / (Alignment length Total number of gaps in the alignment)
For the purposes of the present invention, the degree of identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 3.0.0 or later. The optional parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5 and the EDNAFULL replacement matrix (EMBOSS version of NCBI NUC4.4). The output of the needle-labeled “longest identity” (obtained using the -nobrief option) is used as the percentage identity and is calculated as follows:
(Identical deoxyribonucleotides x 100) / (Alignment length - Total number of gaps in the alignment)
Homologous sequence: The term "homologous sequence" is defined here as a predicted protein having an E value (or expectation record) less than 0.001 in a tfasty survey (Pearson, WR, 1999, in Bioinformatics Methods and Protocols, S. Misener and SA Krawetz, ed., pp. 185-219) with the Penicillium pinophilum xylanase of SEQ ID NO: 2 or its mature polypeptide.
Polypeptide fragment: The term "polypeptide fragment" is defined here as a sequence a polypeptide having one or more (several) amino acids deleted from the amino and / or carboxyl terminus of the mature polypeptide of SEQ ID NO: 2 or a homologous sequence thereof; where the fragment has xylanase activity. In a preferred aspect, a fragment contains at least 320 amino acid residues, more preferably at least 340 amino acid residues and more preferably at least 360 amino acid residues of the mature polypeptide of SEQ ID NO: 2 or the homologous sequence thereof.
Subsequence: The term "subsequence" is defined here as a sequence a nucleotide sequence having one or more (several) deleted nucleotides from the 5 'and / or 3' end of a mature polypeptide coding sequence of SEQ ID NO: 1 or a homologous sequence of these; wherein the subsequence encodes a polypeptide fragment having xylanase activity. In a preferred aspect, the subsequence contains at least 960 nucleotides, more preferably at least 1020 nucleotides and more preferably at least 1080 nucleotides from a mature polypeptide coding sequence of SEQ ID NO: 1 or the homologous sequence thereof.
Allelic variant: The term "allelic variant" here indicates any of two or more alternative forms of a gene that occupies the same chromosomal site. Allelic variation naturally increases through mutation and can result in polymorphism within populations. Genetic mutations can be silent (no change in the encoded polypeptide) or can encode polypeptides having altered amino acid sequences. An allele variant of a polypeptide is a polypeptide encoded by an allele variant of a gene.
Isolated polynucleotide: The term "isolated polynucleotide" as used here refers to a polynucleotide that is isolated from a source. In a preferred aspect, the polynucleotide is at least 1% pure, preferably at least 5% pure, more preferably at least 10% pure, more preferably at least 20% pure, more preferably at least 40% pure, more preferably at least 60 % pure, even more preferably at least 80% pure and more preferably at least 90% pure, as determined by agarose electrophoresis.
Substantially pure polynucleotide: The term "substantially pure polynucleotide" as used here refers to a polynucleotide preparation free of other foreign or unwanted nucleotides and in a form suitable for use within the designed protein production systems. In this way, a substantially pure polynucleotide contains, at most 10%, preferably, at most 8%, more preferably, at most 6%, more preferably, at most 5%, more preferably, at most 4%, most preferably, at most 3%, even more preferably, most 2%, most preferably, most 1% and even more preferably, most 0.5% by weight of another polynucleotide material with which it is naturally or recombinantly associated, a substantially polynucleotide Pure can, however, include naturally occurring 5 'and 3' untranslated regions, such as promoters and terminators. It is preferred that the substantially pure polynucleotide is at least 90% pure, preferably at least 92% pure, more preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97 % pure, even more preferably at least 98% pure, more preferably at least 99% pure and even more preferably at least 99.5% pure by weight. The polynucleotides of the present invention are preferably in a substantially pure form, that is, that the polynucleotide preparation is essentially free of other polynucleotide material with which it is naturally or recombinantly associated. Polynucleotides can be of genomic origin, cDNA, RNA, semisynthetic, synthetic or any combination of these.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are, in general, determined by an open reading frame, which usually begins with an ATG start codon or alternative start codons such as GTG and TTG and ends with an interrupt codon such as TAA, TAG and TGA. The coding sequence can be a DNA, cDNA, synthetic or recombinant polynucleotide.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription of a mature joined mRNA molecule obtained from a eukaryotic cell. The cDNA loses intron sequences that may be present in the corresponding genomic DNA. Primary RNA transcription is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA. These steps include the removal of intron strings by a process called joining. The mRNA-derived cDNA therefore loses any intron sequences.
Nucleic acid construction: The term "nucleic acid construction" means a single or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a way that , otherwise, it must not exist in a natural state or that it is synthetic. The term nucleic acid construct is synonymous with the term "expression cassette" when the amino acid construct contains the control sequences required for the expression of the coding sequence of the present invention.
Control sequences: The term "control sequences" means all components necessary for the expression of a polynucleotide that encodes a polypeptide of the present invention. Each control sequence can be natural or foreign to the polynucleotide encoding the polypeptide or natural or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence and transcription terminator. At a minimum, control sequences include a promoter and transcription and translation interruption signals. Control sequences can be provided with linkers for the purpose of introducing specific restriction sites that facilitate the binding of control sequences to the polynucleotide coding region that encodes a polypeptide.
Operationally linked: The term "operationally linked" means a configuration in which a control sequence is placed in an appropriate position with respect to the coding sequence of a polynucleotide, such as the control sequence directed to the expression of the coding sequence.
Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.
Expression vector: The term "expression vector" is defined here as a linear or circular DNA molecule that comprises a polynucleotide that encodes a polypeptide of the present invention and is operably linked to additional nucleotides that provide its expression.
Host cell: The term "host cell", as used herein, includes any type of cell that is susceptible to transformation, transfection, transduction and the like with a nucleic acid construct or expression vector that comprises a polynucleotide of the present invention.
Modification: The term "modification" here means any chemical modification of the polypeptide that comprises or consists of the mature polypeptide of SEQ ID NO: 2 or a homologous sequence thereof; as well as genetic manipulation of the DNA encoding such a polypeptide. The modification can be a substitution, a deletion and / or an insertion of one or more (several) amino acids as well as substitutions of one or more (several) secondary amino acid chains.
Artificial variant: When used here, the term "artificial variant" means a polypeptide having xylanase activity produced by an organism that expresses a modified polynucleotide sequence from a mature polypeptide coding sequence of SEQ ID NO: 1 or a homologous sequence thereof. The modified nucleotide sequence is obtained through human intervention by modifying a polynucleotide sequence disclosed in SEQ ID NO: 1 or a homologous sequence thereof.
Detailed description of the invention
Polypeptides having xylanase activity
In a first aspect, the present invention relates to isolated polypeptide comprising amino acid sequences having a degree of identity to the mature polypeptide of SEQ ID NO: 2, preferably at least 90%, more preferably at least 95% and most preferably at least 96%, at least 97%, at least 98% or at least 99%, which have xylanase activity (hereinafter homologous polypeptides). In a preferred aspect, homologous polypeptides comprise amino acid sequences that differ by ten amino acids, preferably by five amino acids, more preferably by four amino acids, even more preferably by three amino acids, more preferably by two amino acids and even more preferably by one amino acid of the polypeptide mature from SEQ ID NO: 2.
A polypeptide of the present invention preferably comprises the amino acid sequence of SEQ ID NO: 2 or an allelic variant thereof or a fragment thereof having xylanase activity. In a preferred aspect, the polypeptide comprises an amino acid sequence of SEQ ID NO: 2. In another preferred aspect, the polypeptide comprising mature polypeptide of SEQ ID NO: 2. In another preferred aspect, the polypeptide comprises amino acids 20 to 407 of SEQ ID NO: 2 or an allelic variant thereof or a fragment thereof having xylanase activity. In another preferred aspect, the polypeptide comprises amino acids 20 to 407 of SEQ ID NO: 2. In another preferred aspect, the polypeptide consists of an amino acid sequence of SEQ ID NO: 2 or an allelic variant thereof or a fragment thereof xylanase activity. In another preferred aspect, the polypeptide consists of an amino acid sequence of SEQ ID NO: 2. In another preferred aspect, the polypeptide consists of the mature polypeptide of SEQ ID NO: 2. In another preferred aspect, the polypeptide consists of amino acids 20 to 407 of SEQ ID NO: 2 or an allelic variant thereof or a fragment thereof having xylanase activity. In another preferred aspect, the polypeptide consists of amino acids 20 to 407 of SEQ ID NO: 2.
In a second aspect, the present invention relates to isolated polypeptide having xylanase activity that are encoded by polynucleotides that hybridize under preferably very low stringency conditions, more preferably low stringency conditions, more preferably medium stringency conditions, more preferably high medium stringency conditions, even more preferably high stringency conditions and, more preferably, very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1 or (iii) a complementary strand of full length of (i) or (ii) (J. Sambrook, EF Fritsch, and T. Maniatis, 1989, Molecular Çloning, A Laboratory Manual , 2nd edition, Cold Spring Harbor, New York). In a preferred aspect, stringency conditions are high stringency conditions. In another preferred aspect, stringency conditions are very high stringency conditions.
The nucleotide sequence of SEQ ID NO: 1 or a subsequence thereof; as well as an amino acid sequence of SEQ ID NO: 2 or a fragment thereof; can be used to design nucleic acid probes to identify and clone DNA encoding polypeptides having xylanase activity from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southem blotting procedures, in order to identify and isolate the corresponding gene in it. Such probes can be considerably shorter than the entire sequence, but must be at least 14, preferably at least 25, more preferably at least 35 and most preferably at least 70 nucleotides in length. However, it is preferred that the nucleic acid probe is at least 100 nucleotides in length. For example, the nucleic acid probe can be at least 200 nucleotides, preferably at least 300 nucleotides, more preferably at least 400 nucleotides or more preferably at least 500 nucleotides in length. Even longer probes can be used, for example, nucleic acid probes that are preferably at least 600 nucleotides, more preferably at least 700 nucleotides, even more preferably at least 800 nucleotides or more preferably at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for the detection of the corresponding gene (for example, with ³² P, ³ H, ³⁵ S, biotin or avidin). Such probes are covered by the present invention.
A DNA or genomic cDNA library prepared from such other strains can therefore be assessed for DNA that hybridizes to the probes described above and encodes a polypeptide having xylanase activity. Genomic or other DNA from such other strains can be separated by agarose or polyacrylamide gel electrophoresis or other separation techniques. The DNA from the libraries or the separated DNA can be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that is homologous with SEQ ID NO: 1 or a subsequence thereof, the carrier material is preferably used in a Southem blot.
For the purposes of the present invention, hybridization indicates that the nucleotide sequence hybridizes to a labeled nucleic acid probe that corresponds to a mature polypeptide coding sequence of SEQ ID NO: 1; the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1; its complementary full-length filament or a subsequence thereof; under very low to very high stringency conditions. Molecules whose nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film.
In a preferred aspect, the nucleic acid probe is a mature polypeptide coding sequence of SEQ ID NO: 1. In another preferred aspect, the nucleic acid probe is nucleotides 58 to 1439 of SEQ ID NO: 1. In another preferred aspect, the nucleic acid probe is a polynucleotide sequence that encodes the polypeptide of SEQ ID NO: 2 or a subsequence thereof. In another preferred aspect, the nucleic acid probe is SEQ ID NO: 1. In another preferred aspect, the nucleic acid probe is the polynucleotide sequence contained in the plasmid pGEM-T-Ppin3 that is contained in the E. coli DSM 22922, wherein the polynucleotide sequence thereof encodes a polypeptide having xylanase activity. In another preferred aspect, the nucleic acid probe is the mature polypeptide coding region contained in plasmid pGEM-T-Ppin3 which is contained in E. coli DSM 22922.
For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42 ° C in 5X SSPE, 0.3% SDS, 200 μg / ml sperm DNA divided and denatured salmon and 25% formamide for very low and low stringencies, 35% formamide for medium and medium-high stringencies or 50% formamide for high and very high stringencies, following standard Southem blotting procedures for 12 to 24 hours optimally.
For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS preferably at 45 ° C (very low stringency), more preferably at 50 ° C (low stringency), more preferably at 55 ° C (medium stringency), more preferably at 60 ° C (medium-high stringency), even more preferably at 65 ° C (high stringency) and most preferably at 70 ° C ( very high stringency).
For short probes of about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization, hybridization and posthybridization washing of about
5 ^o C at about 10 ° C below the Tm calculated using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48: 1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, IX Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM monobasic sodium phosphate, 0.1 mM ATP and 0.2 mg of yeast RNA per ml following standard Southem blotting procedures for 12 to 24 hours optimally.
For short probes of about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5 ^o C at 10 ° C below the calculated T _m .
In a third aspect, the present invention relates to isolated polypeptide having nucleotide-encoded xylanase activity that comprises or consists of nucleotide sequences that have a degree of identity to a mature polypeptide coding sequence of SEQ ID NO: 1, preferably at least 90%, more preferably at least 95% and more preferably at least 96%, at least 97%, at least 98% or at least 99%, which encodes a polypeptide having xylanase activity. See the polynucleotide section here.
In a fourth aspect, the present invention relates to artificial variants which comprise a substitution, deletion and / or insertion of one or more (or more) amino acids of the mature polypeptide of SEQ ID NO: 2 or a homologous sequence thereof. Preferably, the amino acid changes are of a minor nature, which are conservative amino acid substitutions or insertions that do not significantly affect protein fold and / or activity; small deletions, typically from one to about 30 amino acids; small amino or carboxyl terminal extensions, such as an amino terminal methionine residue; a binding peptide of up to about 20 to 25 residues or a small extent that facilitates purification by changing the net charge or another function, such as a polyhistidine tract, an antigenic epitope or a binding domain.
Examples of conservative substitutions are within the group of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine) and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that generally do not alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most common occurrence changes are Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro , Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu and Asp / Gly.
In addition to the standard 20 amino acids, non-standard amino acids (such as, 4-hydroxyproline, 6-2V-methyl lysine, 2-aminoisobutyric acid, isovaline and alpha-methyl serine) can be substituted in place of amino acid residues of a polypeptide-type wild. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code and unnatural amino acids can be substituted in place of amino acid residues. “Unnatural amino acids” have been modified after protein synthesis and / or have a chemical structure in their secondary chains that differs from that of standard amino acids. The unnatural amino acids can be chemically synthesized and are preferably commercially available and include pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline and 3,3-dimethylproline.
Alternatively, the amino acid changes are of such a nature that the physicochemical properties of the polypeptides are altered. For example, changes in amino acids can improve the thermal stability of the polypeptide, change the specificity of the substrate, change the optimal pH and others.
The essential amino acids in the precursor polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scan mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the later technique, simple alanine mutations are introduced into each residue in the molecule and the resulting mutant molecules are tested for biological activity (i.e., xylanase activity) to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of the structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photo-affinity labeling, in conjunction with the contact site amino acid mutation putative. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBS Lett. 309: 59-64. The identities of essential amino acids can also be inferred from the analysis of identities with polypeptides that are related to a polypeptide according to the invention.
Single or multiple amino acid substitutions, deletions and / or insertions can be made and tested using known methods of mutagenesis, recombination and / or mixing, followed by a relevant evaluation procedure, such as those disclosed by Reidhaar-Olson and Sauer , 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Know. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (for example, Lowman et al., 1991, Biochem. 30: 10832-10837; US Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).
Mutagenesis / mixing methods can be combined with automated high-throughput evaluation methods to detect the activity of cloned mutated polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and quickly sequenced using standard methods in the art. These methods allow rapid determination of the importance of individual amino acid residues in a polypeptide of interest and can be applied to polypeptides of unknown structure.
The total number of amino acid substitutions, deletions and / or insertions of the mature polypeptide of SEQ ID NO: 2 is 10, preferably 9, more preferably 8, more preferably 7, more preferably, most 6, most preferably 5, most preferably 4 , even more preferably 3, more preferably 2 and even more preferably 1.
Polypeptide sources having xylanase activity
A polypeptide having xylanase activity of the present invention can be obtained from microorganisms of any gender. For the purposes of the present invention, the term "obtained from" as used here in connection with a given source must mean that the polypeptide encoded by a nucleotide sequence is produced by the source or by a strain in which the nucleotide sequence of the source was inserted. In a preferred aspect, the polypeptide obtained from a given source is secreted in an extracellular manner.
A polypeptide having xylanase activity of the present invention can be a bacterial polypeptide. For example, the polypeptide may be a gram-positive bacterial polypeptide such as a Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus or Oceanobacillus polypeptide having a gram-negative bacterial or polypeptide a polypeptide from E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fusobacterium, Ilyobacter, Neisseria or Ureaplasma having xylanase activity.
In a preferred aspect, the polypeptide is a polypeptide of Bacillus alkalophilus, Bacillus amiloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformilis, Bacillus licheniformis, Bacillus michillus, Bacillus licheniformis, Bacillus Bacillus subtilis or Bacillus thuringiensis having xylanase activity.
In another preferred aspect, the polypeptide is a polypeptide from Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis or Streptococcus equi subsp. Zooepidemicus having xylanase activity.
In another preferred aspect, the polypeptide is a polypeptide from Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus or Streptomyces lividans having xylanase activity.
A polypeptide having xylanase activity of the present invention can also be a fungal polypeptide and more preferably a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia polypeptide having xylanase activity or more preferably a fungal polypeptide. as an Acremonium polypeptide, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Cryphocididia, Cryptococia,
Fusarium, Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Poitrasia, Poitrasania
Pseudotrichonympha, Rhizomucor, Sehizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella or Xylaria having xylanase activity.
In a preferred aspect, the polypeptide is a polypeptide of Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis having xylanase activity.
In another preferred aspect, the polypeptide is a polypeptide from Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus nigery, Porch, niger, Porpor , Chrysosporium inops, Chrysosporium pannicola,
Chrysosporium queenslandicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium rose, Fusarium, fusarium, fusarium, fusarium, sarium , Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium funiculosum, Thicylavia alias, Thiagnostichysilia, Pichlorhilma, Christina, australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia spededonium, Thielavia setosa, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma esei or Trichoderma viride having xylanase activity.
In a more preferred aspect, the polypeptide is a Penicillium pinophilum polypeptide having xylanase activity. In a more preferred aspect, the polypeptide is a polypeptide Penicillium pinophilum NN046877 having xylanase activity, for example, the polypeptide comprising mature polypeptide of SEQ ID NO: 2.
It will be understood that for the species already mentioned the invention encompasses both perfect and imperfect states and other taxonomic equivalents, for example, anamorphs, with respect to the species name for which they are known. Those skilled in the art will easily recognize the identity of appropriate equivalents.
Strains of these species are easily accessible to the public in several culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS) and Agricultural Research Service Patent Culture Collection , Northem Regional Research Center (NRRL).
In addition, such polypeptides can be identified and obtained from other sources including microorganisms isolated from nature (eg, soil, compounds, water, etc.) using the probes mentioned above. Techniques for the isolation of microorganisms from natural habitats are well known in the art. The polynucleotide can then be obtained by an evaluation similar to a genomic or cDNA library of such a microorganism. Once a polynucleotide encoding a polypeptide has been detected with the probes, the polynucleotide can be isolated or cloned using techniques that are well known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989 , supra).
The polypeptides of the present invention also include fused polypeptides or cleavable fusion polypeptides in which another polypeptide is fused at the N or C terminal of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleotide sequence (or a portion thereof) that encodes another polypeptide to a nucleotide sequence (or a portion thereof) of the present invention. Techniques for producing fusion polypeptides are known in the art and include linking the coding sequences that encode the polypeptides so that they are in the structure and that the expression of the fused polypeptide is under the control of the same promoters and terminator.
A fusion polypeptide can still comprise a cleavage site. In the secretion of the fusion protein, the site is cleaved releasing the polypeptide having xylanase activity from the fusion protein. Examples of cleavage sites include, but are not limited to, a Kex2 site encoding the Lys-Arg dipeptide (Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al. , 2000, J. Biotechnol. 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991, Biotechnology 9: 378381), an Ile- (Glu or Asp) -Gly-Arg site, which is cleaved by a Factor Xa protease after the arginine residue (Eaton et al., 1986, Biochem. 25: 505512); an Asp-Asp-Asp-Asp-Lys site, which is cleaved by an enterokinase after lysine (Collins-Racie et al., 1995, Biotechnology 13: 982-987); a His-Tyr-Glu site or His-Tyr-Asp site, which is cleaved by Genenase I (Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248); a Leu-Val-Pro-Arg-Gly-Ser site, which is cleaved by thrombin after Arg (Stevens, 2003, Drug Discovery World 4: 35-48); a Glu-Asn-Leu-TyrPhe-Gln-Gly site, which is cleaved by TEV protease after Gin (Stevens, 2003, supra) and a Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro site, which it is cleaved by a genetically engineered form of human rhinovirus 3C protease after Gin (Stevens, 2003, supra).
Polynucleotides
The present invention also relates to isolated polynucleotides that comprise or consist of nucleotide sequences encoding polypeptides having the xylanase activity of the present invention.
In a preferred aspect, the nucleotide sequence comprises or consists of SEQ ID NO: 1. In another more preferred aspect, the nucleotide sequence comprises or consists of the sequence contained in plasmid pGEM-T-Ppin3 which is contained in E. coli DSM 22922. In another preferred aspect, the nucleotide sequence comprises or consists of a mature polypeptide coding sequence of SEQ ID NO: 1. In another preferred aspect, the nucleotide sequence comprises or consists of nucleotides 58 to 1439 of SEQ ID NO: 1. In another more preferred aspect, the nucleotide sequence comprises or consists of the mature polypeptide encoding the sequence contained in plasmid pGEM-T-Ppin3 which is contained in E. coli DSM 22922. The present invention also encompasses sequences nucleotide encoding polypeptides comprising or consisting of the amino acid sequence of SEQ ID NO: 2 or the mature polypeptide thereof, which differs from SEQ ID NO: 1 or the mature polypeptide which encodes its sequence due to the degeneration of the genetic code. The present invention also relates to subsequences of SEQ ID NO: 1 which encode fragments of SEQ ID NO: 2 having xylanase activity.
The present invention also relates to mutant polynucleotides that comprise or consist of at least one mutation in a mature polypeptide coding sequence of SEQ ID NO: 1, wherein the mutant nucleotide sequence encodes the mature polypeptide of SEQ ID NO: 2.
Techniques used to isolate or clone a polynucleotide that encodes a polypeptide are known in the art and include isolation of genomic DNA, cDNA preparation or a combination thereof. The cloning of the polynucleotides of the present invention of such genomic DNA can be performed, for example, using the known polymerase chain reaction (PCR) or antibody evaluation of expression libraries to detect cloned DNA fragments with divided structural characteristics . See, for example, Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), activated activated transcription (LAT) and nucleotide sequence-based amplification (NASBA) can be used, polynucleotides can be cloned from a strain of Penicillium or another related organism and thus, for example, can be an allelic species or variant of the polypeptide that encodes the region of the nucleotide sequence.
The present invention also relates to isolated polynucleotides that comprise or consist of nucleotide sequences that have a degree of identity to a mature polypeptide coding sequence of SEQ ID NO: 1, preferably at least 90%, more preferably at least 95% and more preferably at least 96%, at least 97%, at least 98% or at least 99%, which encodes a polypeptide having xylanase activity.
Modification of a nucleotide sequence encoding a polypeptide of the present invention may be necessary for the synthesis of polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some way designed from the polypeptide isolated from its natural source, for example, artificial variants that differ from specific activity, thermostability, optimum pH or the like. The variant sequence can be constructed on the basis of a nucleotide sequence presented as a mature polypeptide coding sequence of SEQ ID NO: 1, for example, a subsequence of these and / or by introducing nucleotide substitutions that do not give rise to another amino acid sequence of the polypeptide encoded by the nucleotide sequence, but which corresponds to the use of codon of the intended host organism for the production of the enzyme or by the introduction of nucleotide substitutions which may give rise to a different amino acid sequence. For a general description of nucleotide substitution, see, for example, Ford et al., 1991, Protein Expression and Purification 2: 95-107.
It will be evident to those skilled in the art that substitutions can be made outside regions critical to the function of the molecule and still result in an active polypeptide. The amino acid residues essential for the activity of the polypeptide encoded by a polynucleotide isolated from the invention and, therefore, preferably not subjected to substitution, can be identified according to procedures known in the art, such as site-directed mutagenesis or gene scanning mutagenesis. alanine (see, for example, Cunningham and Wells, 1989, supra). In the subsequent technique, mutations are introduced into each positively charged residue on the molecule and the resulting mutant molecules are tested for xylanase activity to identify amino acid residues that are critical for the molecule's activity. The substrate-enzyme interaction sites can also be determined by analyzing the three-dimensional structure as determined by such techniques as nuclear magnetic resonance analysis, crystallography or photo-affinity labeling (see, for example, by Vos et al., 1992, supra; Smith etal., 1992, supra; Wlodaver et al., 1992, supra).
The present invention also relates to isolated polynucleotides which encode polypeptides of the present invention, which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably high medium stringency conditions, even more preferably high stringency conditions and, more preferably, very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1 or (iii) a complementary full length filament of (i) or (ii) or allelic variants and subsequences thereof (Sambrook et al., 1989, supra), as defined herein. In a preferred aspect, stringency conditions are high stringency conditions. In another preferred aspect, stringency conditions are very high stringency conditions.
The present invention also concerns isolated polynucleotides obtained by (a) hybridizing a population of DNA under very low, low, medium, medium-high, high or very high stringency conditions with (i) the mature polypeptide coding sequence from SEQ ID NO: 1, (ii) the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii) and (b) isolating the hybridization polynucleotide, which encodes a polypeptide having xylanase activity. In a preferred aspect, stringency conditions are high stringency conditions. In another preferred aspect, stringency conditions are very high stringency conditions.
Nucleic acid constructions
The present invention also relates to nucleic acid constructs comprising a polynucleotide isolated from the present invention operably linked to one or more (several) control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the sequences of control.
An isolated polynucleotide encoding a polypeptide of the present invention can be manipulated in a variety of ways to provide expression of the polypeptide. The manipulation of the polynucleotide sequence before insertion into a vector may be desirable or necessary depending on the expression vector. Techniques for modifying polynucleotide sequences using recombinant DNA methods are well known in the art.
The control sequence can be an appropriate promoter sequence, a nucleotide sequence that is recognized by a host cell for the expression of a polynucleotide that encodes a polypeptide of the present invention. The promoter sequence contains transcriptional control sequences that mediate polypeptide expression. The promoter can be any nucleotide sequence that shows transcription activity in the host cell of choice including mutant, truncated and hybrid promoters and can be obtained from genes encoding homologous or heterologous extracellular or intracellular polypeptides to the host cell.
Examples of promoters suitable for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amiloliquefacíens alpha-amylase (amyQ) gene, Bacillus licheniformis x penicillinase gene (penP) prokaryotic beta-lactamase genes and gene (Villa-Kamaroff et al., 1978, Proceedings of the National Academy of Sciences USA 75: 37273731), as well as the tac promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25). Additional promoters are described in Useful proteins from recombinant bacteria in Scientific American, 1980, 242: 74-94; and in Sambrook et al., 1989, supra.
Examples of promoters suitable for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger alpha-amylase neutral, Aspergillus niger alpha- acid-stable amylase, Aspergillus niger or Aspergillus awamori glycoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase 00, Fusarium venen / 56900), Fusarium venenatum Quinn (WO 00/56900), trypsin-like Fusarium oxysporum protease (WO 96/00787), Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobioidrolase I, Trichoderma reesei cellobioidrolase II, Trichoderma reesei endoglucan endoglucanase II, Trichoderma reesei endoglucanase III, Trichoder ma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei betaxilosidase, as well as the NA2-tpi promoter (a modified promoter of the leading alpha-amylase-encoding gene in Asperg untranslated was replaced by an untranslated leader of the gene encoding triose phosphate isomerase in Aspergillus nidulans); and its mutant, truncated and hybrid promoters.
In a yeast host, useful promoters are obtained from genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactocinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2) cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1) and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.
The control sequence can also be a suitable transcription terminator sequence, a system recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3 'end of a nucleotide sequence that encodes the polypeptide. Any terminator that is functional in the host cell of choice can be used in the present invention.
The preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glycoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glycosidase and trypsin-like Fusarium oxysporum protease.
Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1) and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence can also be a suitable leader sequence, an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5 'end of a nucleotide sequence that encodes the polypeptide. Any leader sequence that is functional in the host cell of choice can be used in the present invention.
The preferred leaders for filamentous fungal cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Leaders suitable for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha factor and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3 phosphate dehydrogenase-3-phosphate dehydrogenase-3-phosphate dehydrogenase-3-phosphate dehydrogenase-3-phosphate dehydrogenase-3-phosphate dehydrogenase.
The control sequence can also be a polyadenylation sequence, a sequence operably linked to the 3 'terminal of a nucleotide sequence and when described, is recognized by the host cell as a signal to add polyadenosine residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell of choice can be used in the present invention.
The preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glycoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum protease similar to trypsin and Aspergillus niger alpha-glucosides.
Polyadenylation sequences useful for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.
The control sequence can also be a signal peptide coding sequence that encodes a signal peptide attached to the amino terminus of a polypeptide and directs the encoded polypeptide in the cell secretory path. The 5 'end of the coding sequence of a nucleotide sequence can inherently contain a naturally occurring signal peptide coding sequence in the translation reading frame with the segment of the coding sequence encoding the secreted polypeptide. Alternatively, the 5 'end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. The foreign signal peptide coding sequence may be required when the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, the foreign signal peptide coding sequence can simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any peptide coding sequence that directs the polypeptide expressed in the secretory path of a host cell of choice, that is, secreted in a culture medium, can be used in the present invention.
The signal peptide coding sequences effective for bacterial cells are the signal peptide coding sequences obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alfa-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactaothermse, Bacillus licheniformis beta-lactamamease (nprT, nprS, nprM) and Bacillus subtilis prsA. Additional signal peptides are described by Simonen and Paiva, 1993, Microbiological Reviews 57: 109137.
The effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger amylase, Aspergillus niger glycoamylase, Rhizomucor miehei proteinase insecticide, Humicola insolase, Humicola endoglucanase V and Humicola lanuginosa lipase.
Signal peptides useful for yeast host cells are obtained from the genes for Saccharomyces cerevisiae factor alpha and Saccharomyces cerevisiae invertase. Other sequences encoding useful signal peptides are described by Romanos et al., 1992, supra.
In a preferred aspect, the signal peptide comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2. In another preferred aspect, the sequence encoding the signal peptide comprises or consists of nucleotides 1 to 57 of SEQ ID NO: : 1.
The control sequence can also be a polypeptide coding sequence that encodes a pro-peptide positioned at the amino terminus of a polypeptide. The resulting polypeptide is known as a pro-enzyme or pro-polypeptide (or a zymogen in some cases). In general, a pro-peptide is inactive and can be converted to a mature active polypeptide by catalytic or auto-catalytic dividing of the propeptide from the pro-polypeptide. The propeptide coding sequence can be obtained from the genes for Bacillus subtilis protease alkaline (aprE), Bacillus subtilis protease neutral (nprT), Saccharomyces cerevisiae alpha factor, Rhizomucor miehei aspartic proteinase and Myceliophthora thermophila lacase (WO 95/33836).
When both signal and peptide signal sequences are present at the amino terminus of a polypeptide, the pro-peptide sequence is positioned close to the amino terminus of a polypeptide and the peptide signal sequence is positioned close to the amino terminus of the polypeptide. pro-peptide.
It may also be desirable to add regulatory sequences that allow regulation of polypeptide expression with respect to host cell development. Examples of regulatory systems are those that cause gene expression to turn on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include lac, tac and trp operator systems. In yeast, the ADH2 system or GAL1 system can be used. In filamentous fungi, the promoter and TAKA alpha-amylase, Aspergillus niger glycoamylase promoter and Aspergillus oryzae glycoamylase promoter can be used as regulatory sequences. Other examples of regulatory sequences are those that allow genetic amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate and the metallothionein genes that are amplified with heavy metals. In these cases, the nucleotide sequence encoding the polypeptide must be operationally linked with the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors that comprise a polynucleotide of the present invention, a promoter and transcription and translation interruption signals. The various nucleotide and control sequences can be joined to produce a recombinant expression vector that can include one or more (several) convenient restriction sites to allow insertion or replacement of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct that comprises the sequence into an appropriate vector for expression. In the creation of the expression vector, the coding sequence is located in the vector so that the coding sequence is operationally linked with the appropriate control sequences for the expression.
The recombinant expression vector can be any vector (for example, a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can perform polynucleotide expression. The choice of the vector will typically depend on the vector's compatibility with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.
The vector can be an autonomously replicating vector, that is, a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, for example, a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means to guarantee self-replication. Alternatively, the vector can be one that, when introduced into the host cell, is integrated into the genome and replicated along with the chromosomes into which it has been integrated. In addition, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the host cell genome or a transposon can be used.
The vectors of the present invention preferably contain one or more (several) selectable markers that allow easy selection of transformed, transfected, transduced or similar cells. A selectable marker is a gene in the product that provides biocidal or viral resistance, resistance to heavy metals, prototrophy to auxotrophs and others.
Examples of selectable bacterial markers are the Bacillus subtilis or Bacillus licheniformis dal genes or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin or tetracycline resistance. Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and URA3. Selectable markers for use in a filamentous fungal cell include, but are not limited to, amdS (acetamidase), argB (omitin carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (adenyltransferase sulfate) and trpC (anthranilate synthase), as well as their equivalents. The amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus are preferred for use in an Aspergillus cell.
The vectors of the present invention preferably contain an element that allows integration of the vector into the host cell's genome or autonomous replication of the vector in the genome-independent cell.
For integration into the host cell genome, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides to direct integration by homologous recombination into the host cell genome at a similar location on the chromosomes. To increase the likelihood of integration in a precise location, the integrational elements must contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding allo sequence to enhance the likelihood of homologous recombination. The integrational elements can be any sequence that is homologous to the target sequence in the host cell genome. In addition, the integrational elements can be non-coding or coding nucleotides. On the other hand, the vector can be integrated into the host cell genome by non-homologous recombination.
For autonomous replication, the vector can still comprise a source of replication that allows the vector to replicate autonomously in the host cell in question. The origin of replication can be any replicator plasmid that mediates autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that allows the plasmid or vector to replicate in vivo.
Examples of bacterial origins of replication are in the origins of replication of plasmids pBR322, pUC19, pACYC177 and pACYC184 that allow replication in E. coli and pUBllO, pE194, ρΤΑ1060 and pAMRl that allow replication in Bacillus.
Examples of origins of replication for use in a yeast host cell are the origin of 2 microns of replication, ARS1, ARS4, the combination of ARS1 and CEN3 and the combination of ARS4 and CEN6.
Examples of useful origins of replication in a filamentous fungal cell are AMAI and ANSI (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00 / 24883). Isolation of the AMAI gene and construction of plasmids or vectors comprising the gene can be performed according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention can be inserted into a host cell to increase production of a polypeptide. An increase in the number of copies of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including a selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene and thereby additional copies of the polynucleotide, can be selected by culturing the cells in the presence of the appropriate selectable agent.
The procedures used for ligating the elements described above for the construction of the recombinant expression vectors of the present invention are well known to a person skilled in the art (see, for example, Sambrook et al., 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, which comprise a polynucleotide isolated from the present invention, which are advantageously used in the recombinant production of the polypeptides having xylanase activity. A vector comprising a polynucleotide of the present invention is introduced into a host cell so that the vector is maintained as a chromosomal integral or as a self-replicating extra-chromosomal vector as described above. The term "host cell" encompasses any progeny of a precursor cell that is not identical to the precursor cell due to mutations that occur during replication. The choice of a host cell, to some extent, will depend on the gene that encodes the polypeptide and its source.
The host cell can be any cell useful in the recombinant production of a polypeptide of the present invention, for example, a prokaryote or a eukaryote.
The eukaryotic host cell can be any Gram positive bacterium or a Gram negative bacterium. Gram negative bacteria include, but are not limited to, Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus and Oceanobacillus. Gram negative bacteria include, but are not limited to, E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fusobacterium, Ilyobacter, Neisseria and Ureaplasma.
The bacterial host cell can be any Bacillus cell. Bacillus cells useful in the practice of the present invention include, but are not limited to, Bacillus alkalophilus cells, Bacillus amiloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus lichenormorm Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis and Bacillus thuringiensis.
In a preferred aspect, the bacterial host cell is a cell of Bacillus amiloliquefaciens, Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtilis. In a more preferred aspect, the bacterial host cell is a Bacillus amiloliquefaciens cell. In another more preferred aspect, the bacterial host cell is a Bacillus clausii cell. In another more preferred aspect, the bacterial host cell is a cell of Bacillus licheniformis. In another more preferred aspect, the bacterial host cell is a Bacillus subtilis cell.
The bacterial host cell can also be any Streptococcus cell. Streptococcus cells useful in the practice of the present invention include, but are not limited to, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis and Streptococcus equi subsp cells. Zooepidemicus.
In a preferred aspect, the bacterial host cell is a cell of Streptococcus equisimilis. In another preferred aspect, the bacterial host cell is a cell of Streptococcus pyogenes. In another preferred aspect, the bacterial host cell is a cell of Streptococcus uberis. In another preferred aspect, the bacterial host cell is a cell of Streptococcus equi subsp. Zooepidemicus.
The bacterial host cell can also be any Streptomyces cell. Streptomyces cells useful in the practice of the present invention include, but are not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus and Streptomyces lividans cells.
In a preferred aspect, the bacterial host cell is a cell of Streptomyces achromogenes. In another preferred aspect, the bacterial host cell is a Streptomyces avermitilis cell. In another preferred aspect, the bacterial host cell is a cell of Streptomyces coelicolor. In another preferred aspect, the bacterial host cell is a cell of Streptomyces griseus. In another preferred aspect, the bacterial host cell is a cell of Streptomyces lividans.
The introduction of DNA into a Bacillus cell can, for example, be accomplished by the transformation of protoplasts (see, for example, Chang and Cohen, 1979, Molecular General Genetics 168: 111-115), using the competent cells (see, for example, example, Young and Spizizen, 1961, Journal of Bacteriology 81: 823-829 or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209-221), by electroporation (see, for example, Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, for example, Koehler and Thome, 1987, Journal of Bacteriology 169: 5271-5278). The introduction of DNA into an E coli cell can, for example, be carried out by the transformation of protoplasts (see, for example, Hanahan, 1983, J. Mol. Biol. 166: 557-580) or electroporation (see, for example , Dower et al., 1988, Nucleic Acids Res. 16: 6127-6145). The introduction of DNA into a Streptomyces cell can, for example, be accomplished by the transformation of protoplasts and electroporation (see, for example, Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), by conjugation (see, for example, Mazodier et al., 1989, J. Bacteriol. 171: 35833585), or by transduction (see, for example, Burke et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289 -6294). The introduction of DNA into a Pseudomonas cell can, for example, be carried out by electroporation (see, for example, Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or by conjugation (see, for example , Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71: 51-57). The introduction of DNA into a Streptococcus cell can, for example, be accomplished by natural competence (see, for example, Perry and Kuramitsu, 1981, Infect. Immun. 32: 1295-1297), by the transformation of protoplasts (see, for example, example, Catt and Jollick, 1991, Microbios. 68: 189-207, by electroporation (see, for example, Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804) or by conjugation (see, for example, Clewell, 1981, Microbiol Rev. 45: 409-436) However, any method known in the art for introducing DNA into a host cell can be used.
The host cell can also be a eukaryote, such as a mammalian, insect, plant or fungal cell.
The host cell can be a fungal cell. The "fungi" as used in this include the phyla Ascomycota, Basidiomycota, Chytridiomycota and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB Intemational, University Press, Cambridge, UK ) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra).
The fungal host cell can be a yeast cell. The "yeast" as used in this includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast and yeast that belongs to the Imperfecti fungi (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast should be defined as described in Biology and Activities of Yeast (Skinner, FA, Passmore, SM and Davenport, RR eds, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
Still, in a more preferred aspect, the yeast host cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces or Yarrowia cell.
In a more preferred aspect, the yeast host cell is a cell of Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis. In another more preferred aspect, the yeast host cell is a Kluyveromyces lactis cell. In another more preferred aspect, the yeast host cell is a Yarrowia lipolytica cell.
In another more preferred aspect, the fungal host cell is a filamentous fungal cell. "Filamentous fungi" include all filamentous forms in the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). Filamentous fungi are, in general, characterized by a mycelial wall composed of chitin, cellulose, glycan, chitosan, mannan and other complex polysaccharides. The vegetative development occurs by the hyphal elongation and carbon catabolism is mandatory aerobic. In contrast, vegetative development by yeasts, such as Saccharomyces cerevisiae, occurs by the budding of a single-celled stalk and carbon catabolism can be fermenter.
Still, in a more preferred aspect, the filamentous fungal host cell is an Acremonium cell, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Neucore, Neucor, Mycora , Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes or Trichoderma.
In a more preferred aspect, the filamentous fungal host cell is a cell of Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae. In another more preferred aspect, the filamentous fungal host cell is a cell of Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusarium venenatum. In another more preferred aspect, the filamentous fungal host cell is a Bjerkandera adusta cell,
Ceriporiopsis aneirina, aneirina Ceriporiopsis, Ceriporiopsis caregiea, gilvescens Ceriporiopsis, Ceriporiopsis pannocinta, Ceriporiopsis rivulose, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium tropicum, Chrysosporium merdarium, Chrysosporium inops, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium zonatum, Coprinus cinereus , Coriolus hirsutus, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielaviaoderma, Trichetes, Trichetes, Trichetes, Trichetes, Trichetes reesei or Trichoderma viride.
Fungal cells can be transformed by a process that involves the formation of protoplasts, transformation of protoplasts and regeneration of the cell wall in a manner known per se. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238 023 and Yelton et al., 1984, Proceedings of the National Academy of Sciences USA 81: 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156 and WO 96/00787. yeast can be transformed using the procedures described by Becker and Guarente, In Abelson, JN and Simon, MI, editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920.
Production methods
The present invention also relates to the methods of producing a polypeptide of the present invention, which comprises: (a) growing a cell, which in its wild type produces the polypeptide, under the conductive conditions for the production of the polypeptide; and (b) recovering the polypeptide. In a preferred aspect, the cell is of the genus Penicillium. In a more preferred aspect, the cell is Penicillium pinophilum. In a more preferred aspect, the cell is Penicillium pinophilum NN046877.
The present invention also relates to the methods of producing a polypeptide of the present invention, which comprises: (a) culturing a recombinant host cell, as described herein, under the conductive conditions for the production of the polypeptide; and (b) recovering the polypeptide.
The present invention also relates to methods of producing a polypeptide of the present invention, which comprises: (a) culturing a recombinant host cell under conductive conditions for the production of polypeptide, wherein the host cell comprises a mutant nucleotide sequence having at least one mutation in a mature polypeptide coding sequence of SEQ ID NO: 1, wherein the mutant nucleotide sequence encodes a polypeptide that comprises or consists of the mature polypeptide of SEQ ID NO: 2; and (b) recovering the polypeptide.
In the production methods of the present invention, cells are grown in a nutrient medium suitable for the production of polypeptide using methods well known in the art. For example, the cell can be grown by cultivating a large-scale or smaller-scale shake and fermentation flask (including continuous, batch, batch-fed or solid fermentations) in industrial and laboratory fermenters carried out in a suitable medium and under conditions that allow the polypeptide to be expressed and / or isolated. Cultivation takes place in a suitable nutrient medium comprising sources of carbon and nitrogen and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or can be prepared according to published compositions (for example, in American Type Culture Collection catalogs). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted into the medium, it can be recovered from cell lysates.
Polypeptides can be detected using methods known in the art that are specific for polypeptides. These detection methods can include the use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of the polypeptide as described therein.
The resulting polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray drying, evaporation or precipitation.
The polypeptides of the present invention can be purified by a variety of procedures known in the art including, but not limited to, chromatography (for example, ion exchange, affinity, hydrophobic, chromato-focusing and size exclusion), electrophoretic procedures (for example, focusing preparative isoelectric), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, for example, Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure polypeptides.
Plants
The present invention also relates to plants, for example, a transgenic plant, plant part, or plant cell, which comprises an isolated polynucleotide encoding a polypeptide having xylanase activity of the present invention in order to express and produce the polypeptide in the quantities recoverable. The polypeptide can be recovered from the plant or part of a plant. Alternatively, the plant or plant part containing the recombinant polypeptide can be used as such to improve the quality of a food or feed, for example, to improve nutritional value, palatability and rheological properties, or to destroy an anti-nutritive factor.
The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a monocot). Examples of monocot plants are grasses, such as meadow grass (blue grass, Poa), forage grass such as Fescue, Lolium, temperate grass, such as Agrostis and cereals, for example, wheat, oats, rye, barley, rice , sorghum and corn.
Examples of dicot plants are tobacco, vegetables such as section, potato, beet, peas, beans and soybeans and cruciferous plants (Brassicaceae family), such as sunflower, rapeseed and model organism strictly reported Arabidopsis thaliana.
Examples of plant parts are stem, callus, leaves, root, fruits, seeds and tubers as well as the individual tissues that comprise these parts, for example, epidermis, mesophilic, parenchyma, vascular tissues, meristems. The compartments of the specific plant cell, such as chloroplasts, apoplasts, mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a plant part. In addition, any plant cell, whatever the origin of the tissue, is considered to be a plant part. Also, plant parts such as specific tissues and isolated cells to facilitate the use of the invention are also considered plant parts, for example, embryos, endosperm, aleurone and seed coatings.
Also included within the scope of the present invention is the progeny of such plants, plant parts and plant cells.
The transgenic plant or plant cell that expresses a polypeptide of the present invention can be constructed according to methods known in the art. In summary, the plant or plant cell is constructed by one or more (diverse) expression constructs encoding a polypeptide of the present invention in the plant host genome or chloroplast genome and propagation of the resulting modified plant or plant cell in a plant cell or transgenic plant.
The expression construct is conveniently a nucleic acid construct that comprises a polynucleotide encoding a polypeptide of the present invention operably linked with appropriate regulatory sequences required for the expression of the nucleotide sequence in the plant or plant part of choice. In addition, the expression construct may comprise a selectable marker useful for identifying host cells into which an expression construct has been integrated and the DNA sequences necessary for the introduction of the construct to the plant in question (the latter depends on the method of introduction of DNA to be used).
The choice of regulatory sequences, such as promoter and terminator sequences and optionally traffic or signal sequences, is determined, for example, on the basis of when, where and how the polypeptide is desired to be expressed. For example, the expression of the gene encoding a polypeptide of the present invention can be constitutive or inducible, or it can be related to specific development, stage or tissue and the gene product can be targeted to a specific tissue or plant part such as seeds or sheets. Regulatory sequences are, for example, described by Tague et al., 1988, Plant Physiology 86: 506.
For constitutive expression, 35S-CaMV, corn ubiquitin 1 and rice actin promoter 1 can be used (Franck et al., 1980, Cell 21: 285-294; Christensen et al., 1992, Plant Mol 18: 67558
689; Zhang et al., 1991, Plant Cell 3: 1155-1165). Organ-specific promoters can be, for example, a promoter from immersed storage tissues such as seeds, potato tubers and fruits (Edwards and Coruzzi, 1990, Ann. Rev. Genet. 24: 275-303), or from immersed metabolic tissues such as meristems (Ito et al., 1994, Plant Mol. Biol. 24: 863-878), a seed-specific promoter such as glutelin, prolamine, globulin, or albumin promoter from rice (Wu et al., 1998, Plant and Cell Physiology 39: 885-889), a Vicia fabum promoter from legumin B4 and the unknown seed protein gene from Vicia faba (Conrad et al., 1998 , Journal of Plant Physiology 152: 708711), a promoter from seed oil body protein (Chen et al., 1998, Plant and Cell Physiology 39: 935-941), the storage protein napA promoter from Brassica napus, or any other specific seed promoter known in the art, for example, as described in WO 91 / 14772. In addition, the promoter may be a leaf-specific promoter such as the rbcs promoter from rice or tomatoes (Kyozuka et al., 1993, Plant Physiology 102: 991-1000, the promoter of the chlorella virus adenine methyltransferase gene (Mitra and Higgins, 1994, Plant Molecular Biology 26: 85-93), or the aldP gene promoter from rice (Kagaya et al., 1995, Molecular and General Genetics 248: 668-674), or an inducible promoter by injury such as the pin2 potato promoter (Xu et al., 1993, Plant Molecular Biology 22: 573-588). Likewise, the promoter may induce abiotic treatments such as temperature, dryness, or changes in salinity or substance-induced exogenously applied that activates the promoter, for example, ethanol, estrogen, plant hormones such as ethylene, abscisic acid and gibberellic acid and heavy metals.
A promoter enhancing element can also be used to achieve greater expression of a polypeptide of the present invention in the plant. For example, the promoter enhancing element can be an intron that is placed between the promoter and the nucleotide sequence encoding a polypeptide of the present invention. For example, Xu et al., 1993, supra, discloses the use of the first intron of the rice actiba 1 gene to enhance expression.
The selectable marker gene and any other parts of the expression construct can be chosen from the one available in the art.
The nucleic acid construct is incorporated into the plant's genome according to conventional techniques known in the art, including Agrobacterium-mediated transformation, virus-mediated transformation, microinjection, particle bombardment, biological transformation and electroporation (Gasser et al., 1990, Science 244: 1293; Potrykus, 1990, Bio / Technology 8: 535; Shimamoto et al., 1989, Nature 338: 274).
At present, Agrobacterium tumefaciens-mediated gene transfer is the method of choice for the generation of transgenic dicots (for a review, see Hooykas and Schilperoort, 1992, Plant Molecular Biology 19: 15-38) and can also be used for transformation of monocots, although transformation methods are often used for these plants. Currently, the method of choice for the generation of transgenic monocots is the particle bombardment (tungsten particles and gold microscope coated with DNA transformation) from embryonic callus or embryo development (Christou, 1992, Plant Journal 2: 275-281 ; Shimamoto, 1994, Current Opinion Biotechnology 5: 158-162; Vasil et al., 1992, Bio / Technology 10: 667-674). An alternative method for the transformation of monocots is based on the transformation of protoplasts as described by Omirulleh et al., 1993, Plant Molecular Biology 21: 415-428.
Following the transformation, the transformants having incorporated the expression construct are selected and regenerated in total plants according to methods well known in the art. Often the transformation procedure is indicated for the selective elimination of gene selection during regeneration or in subsequent generations for use, for example, co-transformation with two separate T-DNA constructs or specific excision at the site of gene selection by a specific recombinase.
The present invention also relates to the methods of producing a polypeptide of the present invention comprising: (a) cultivating a transgenic plant or a cell comprising a polynucleotide encoding the polypeptide having xylanase activity of the present invention under the conditions conducive to production polypeptide; and (b) recovering the polypeptide.
In the embodiments, in addition to the direct transformation of a particular plant genotype with a construction prepared in accordance with the present invention, transgenic plants can be made by crossing a plant having a construction of the present invention to a second plant that needs construction. For example, a construct encodes a polypeptide having xylanase activity or a portion of it can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the present invention not only encompasses a plant directly regenerated from the cells that have been transformed in accordance with the present invention, but also the progeny of such plants. As used herein, progeny refers to the offspring of any generation of a precursor plant prepared in accordance with the present invention. Such a progeny can include a DNA construct prepared in accordance with the present invention, or a portion of a DNA construct prepared in accordance with the present invention. In embodiments, the results of crossing a transgene of the present invention being introduced into a plant line by crossing pollination from a starting line with a donor plant line that includes a transgene of the present invention. Non-limiting examples of such steps are still articulated in U.S. Patent NO: 7,151,204.
Plants including a polypeptide having xylanase activity of the present invention are expected to include plants generated through a cross-conversion process. For example, plants of the present invention include plants referred to as a cross-converted, line, innate or hybrid genotype.
In embodiments, genetic markers can be used to assist the introgression of one or more transgenes of the invention from one genetic foundation to another. Marker-assisted selection offers the advantages of conventional breeding in that it can be used to avoid errors caused by phenotypic variations. In addition, genetic markers may provide data regarding the relative degree of elite germplasm in the individual progeny of a particular cross. For example, when a plant with a desired trait that would otherwise have an undesirable genetic foundation is agrochemically crossed into an elite precursor, genetic markers can be used to select the progeny that not only have the trait of interest, but also have a relatively large proportion of the desired germplasm. In this way, the number of generations required to introgress one or more traits in a genetic basis is minimized.
Removal or reduction of xylanase activity
The present invention also relates to methods of producing a precursor cell mutant, which comprises the disruption or deletion of a polynucleotide, or a portion thereof, encoding a polypeptide of the present invention, which results in the mutant cell that produces less of the polypeptide. than the precursor cell when grown under the same conditions.
The mutant cell can be constructed by reducing or eliminating the expression of a nucleotide sequence encoding a polypeptide of the present invention using methods well known in the art, for example, insertions, disruptions, substitutions or deletions. In a preferred aspect, the nucleotide sequence is inactivated. The nucleotide sequence to be modified or inactivated can be, for example, the coding region or part of it essential for the activity, or a regulatory element required for the expression of the coding region. An example of such a control or regulatory sequence may be a promoter sequence or a functional part thereof, that is, a part that is sufficient to affect the expression of a nucleotide sequence. Other control sequences for possible modification include, but are not limited to, a leader, a polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator and transcriptional activator.
Modification or inactivation of the nucleotide sequence can be accomplished by subjecting the precursor cell to mutagenesis and selection of the mutant cells in which the expression of the nucleotide sequence has been reduced or eliminated. Mutagenesis, which can be specific or random, can be performed, for example, by using a suitable chemical or physical mutagenesis agent, by using a suitable oligonucleotide, or by subjecting the DNA sequence to PCR-generated mutagenesis. In addition, mutagenesis can be performed using any combination of these 25 mutagenesis agents.
Examples of a physical or chemical mutagenic agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, sulfonate ethyl methane (EMS), sodium disulfide, formic acid and nucleotide analogs.
When such agents are used, mutagenesis is typically performed by incubating the precursor cell to be mutagenized in the presence of the mutagenesis agent of choice under the appropriate conditions and evaluating and / or selecting the mutant cells exhibiting reduced or no expression of the gene.
The modification or inactivation of the nucleotide sequence can be accompanied by the introduction, replacement or removal of one or more (several) nucleotides in the gene or a regulatory element required by its transcription or translation. For example, nucleotides can be inserted or removed so as to result in the introduction of an interrupt codon, the removal of the start codon, or a change in the reading opening structure. Such modification or inactivation may be accompanied by site-directed mutagenesis or PCR-directed mutagenesis according to methods known in the art. Although, in principle, the modification can be carried out in vivo, that is, directly in the cell expressing the nucleotide sequence to be modified, it is preferred that the modification is carried out in vitro as exemplified below.
An example of a convenient way to eliminate or reduce the expression of a nucleotide sequence by a cell is based on techniques for gene replacement, gene deletion or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous nucleotide sequence is mutagenized in vitro to produce a defective nucleic acid sequence which is then transformed by the precursor cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous nucleotide sequence. It may be desirable that the defective nucleotide sequence also encodes a marker that can be used for the selection of transformants in which the nucleotide sequence has been modified or destroyed. In a particularly preferred aspect, the nucleotide sequence is interrupted with a selectable marker such as that described herein.
Alternatively, the modification or inactivation of the nucleotide sequence can be carried out by the RNAi or antisense techniques established using a sequence complementary to a nucleotide sequence. More specifically, expression of the nucleotide sequence by a cell can be reduced or eliminated by introducing a sequence complementary to a nucleotide sequence of the gene that can be transcribed in the cell and is able to hybridize to the mRNA produced in the cell. Under conditions that allow the complementary antisense nucleotide sequence to hybridize to the mRNA, the amount of the translated protein is thereby reduced or eliminated.
The present invention further relates to a precursor cell mutant cell comprising an interruption or deletion of a nucleotide sequence encoding the polypeptide or a control sequence thereof, which results in the mutant cell that produces less of the polypeptide or no polypeptide compared to the cell precursor.
Modally created mutant polypeptide cells are particularly useful as host cells for the expression of heterologous and / or natural polypeptides. Therefore, the present invention further concerns methods of producing a heterologous or natural polypeptide, which comprises: (a) cultivating a mutant cell under the conductive conditions for the production of the polypeptide; and (b) recovering the polypeptide. The term heterologous polypeptides is defined here as polypeptides that are not natural host cells, a natural protein in which modifications were made to alter the natural sequence, or a natural protein whose expression is quantitatively altered as a result of manipulation of the host cell by recombinant DNA techniques.
Still in one aspect, the present invention relates to the method of producing a protein product essentially free of xylanase activity by fermenting a cell that produces both of a polypeptide of the present invention as well as the protein product of interest by adding an effective amount. of an agent capable of inhibiting the xylanase activity in the fermentation broth before, during or after the fermentation is complete, recovering the product of interest from the fermentation broth and optionally subjecting the recovered product to further purification.
Still in one aspect, the present invention concerns the method of producing a protein product essentially free of xylanase activity by culturing the cell under conditions allowing the expression of the product, subjecting the resulting culture broth to a combined pH and temperature treatment in this way to reduce the xylanase activity substantially and recovering the product from the culture broth. Alternatively, the combined pH and temperature treatment can be performed on an enzyme preparation recovered from the culture broth. The combined pH and temperature treatment can optionally be used in combination with a treatment with a xylanase inhibitor.
In accordance with this aspect of the invention, it is possible to remove at least 60%, preferably at least 75%, more preferably at least 85%, even more preferably at least 95% and most preferably at least 99% of the xylanase activity. Complete removal of xylanase activity can be achieved by using this method.
The combined pH and temperature treatment is preferably carried out at a pH in the range of 2 to 4 or 9 to 11 and a temperature in the range of at least 60 to 70 ° C for a sufficient period of time to achieve the desired effect, where typically , 30 to 60 minutes is sufficient.
The methods used for the cultivation and purification of the product of interest can be carried out by methods known in the art.
The methods of the present invention for producing an essentially xylanase free product are of particular interest in the production of eukaryotic polypeptides, in particular fungal proteins such as enzymes.
The enzyme can be selected from, for example, an amylolytic enzyme, lipolytic enzyme, proteolytic enzyme, cellulolytic enzyme, oxireductase or plant cell wall degradation enzyme. Examples of such enzymes include an aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, 10 cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, glucoside, glucase, galactosidase, galactosidase, galactosidase, galactosidase, glucase, galactosidase, glucase haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinolytic enzyme, peroxidase, phytase, phenoloxidase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transferase, transglutaminase, 15 or x Xylanase-deficient cells can also be used to express heterologous proteins of pharmaceutical interest such as hormone, development factors, receptors and the like.
It will be understood that the term eukaryotic polypeptides include not only natural polypeptides, but also those 20 polypeptides, for example, enzymes that have not been identified by substitutions, deletions or additions, or such other modifications to enhance activity, thermostability, pH tolerance and others .
In yet another aspect, the present invention relates to a protein product essentially free from the xylanase activity which is produced by a method of the present invention.
Methods of inhibiting expression of a polypeptide having xylanase activity
The present invention also relates to methods of inhibiting the expression of a polypeptide having xylanase activity in a cell, which comprises administering the cell or expressing a double-stranded RNA (dsRNA) molecule in the cell, wherein a dsRNA comprises a subsequence of a polynucleotide of the present invention. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.
The dsRNA is preferably a minor interference RNA (siRNA) or a micro RNA (miRNA). In a preferred aspect, dsRNA is minor interference RNA (siRNAs) for inhibiting transcription. In another preferred aspect, dsRNA is micro RNA (miRNAs) for inhibiting translation.
The present invention also concerns such double stranded RNA (dsRNA) molecules, which comprise a portion of a mature polypeptide coding sequence of SEQ ID NO: 1 for inhibiting the expression of a polypeptide in a cell. While the present invention is not limited by any particular mechanism of action, dsRNA can enter the cell and cause degradation of a single stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi).
The dsRNAs of the present invention can be used to silence the gene. In one aspect, the invention provides methods for selectively degrading RNA using the dsRNAis of the present invention. The process can be practiced in vitro, ex vivo or in vivo. In one aspect, dsRNA molecules can be used to generate a loss of the mutation's function in the cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art, see, for example, U.S. Patent No. 6,506,559; U.S. Patent No. 6,511,824; U.S. Patent No. 6,515,109; and U.S. Patent No. 6,489,127.
Compositions
The present invention also concerns compositions comprising a polypeptide of the present invention. Preferably, the compositions are enriched in such a polypeptide. The term enriched indicates that the composition's xylanase activity was increased, for example, with an enrichment factor of at least 1.1.
The composition can comprise a polypeptide of the present invention as a major enzyme component, for example, a mono-component composition. Alternatively, the composition may comprise multiple enzymatic activities, such as an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alfagalactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidases, beta-galactosidases, haloperoxidase, invertase, laccase, lipase, mannosidase, oxidase, pectinolytic enzyme, peptidoglutaminase, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase. Additional enzymes can be produced, for example, by a microorganism belonging to the Aspergillus genus, preferably Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus', Fuserillillus niger, or bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium torphumum, Fusarium torhemum, Fusarium torisum ', Humicola, preferably Humicola insolens or Humicola lanuginosa', or Trichoderma, preferably Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride.
Polypeptide compositions can be prepared according to methods known in the art and can be in the form of a liquid or dry composition. For example, the polypeptide composition can be in the form of a granulate or a microgranulate. The polypeptide to be included in the composition can be stabilized according to methods known in the art.
The examples are given below by the preferred uses of the polypeptide compositions of the invention. The dosage of the polypeptide composition of the invention and other conditions under which the composition is used can be determined based on methods known in the art.
Uses
The present invention is also directed to methods of using polypeptides having xylanase activity, or compositions thereof. The polypeptides of the present invention can be used to degrade or convert plant cell walls or any material containing xylan, for example, lignocellulose, which originates from plant cell walls (see, for example, WO 2002/18561). Examples of various uses are described below. The dosage of the polypeptides of the present invention and other conditions under which the polypeptides are used can be determined based on methods known in the art.
The enzymatic degradation of a material containing xylan is facilitated by the partial or total removal of secondary branches. The polypeptides of the present invention are preferably used in conjunction with other xylan degrading enzymes such as xylanases, acetylxylan esterases, arabinofuranosidases, xylosidases, feruloyl esterases, glucuronidases and a combination thereof, in the processes in which the material containing xylan is to be degraded. For example, acetyl groups can be removed by acetylxylan esterases; arabinose groups by alpha-arabinosidases; groups of feruloyl by feruloyl esterases and groups of glucuronic acid by alfaglucuronidases. Oligomers released by xylanases, or by the combination of xylanases and secondary branching hydrolyzing enzymes, can further be degraded to free xylose by beta-xylidasidases.
The present invention also relates to methods for degrading or converting a material containing xylan or cellulosic, which comprises: treating the material containing xylan or cellulosic with an enzyme composition in the presence of a polypeptide having xylanase activity of the present invention. In a preferred aspect, the method further comprises recovering the converted or degraded xylan or cellulosic material.
The present invention also concerns methods for producing a fermentation product, which comprises: (a) saccharifying a material containing xylan or cellulosic with an enzyme composition in the presence of a polypeptide having xylanase activity of the present invention; (b) fermenting the material containing xylan or cellulosic saccharified with one or more fermentation microorganisms to produce the fermentation product; and (c) recovering the fermentation product from fermentation.
The present invention also concerns methods of fermenting a material containing xylan or cellulosic, which comprises: fermenting material containing xylan or cellulosic with one or more fermentation microorganisms, wherein material containing xylan or cellulosic is saccharified with a composition of enzyme in the presence of a polypeptide having xylanase activity of the present invention. In a preferred aspect, fermentation of the material containing xylan or cellulosic produces a fermentation product. In another preferred aspect, the method further comprises recovering the fermentation product from the fermentation.
The methods of the present invention can be used to saccharify a material containing xylan or cellulosic to fermentable sugars and convert fermentable sugars into many useful substances, for example, fuel, potable ethanol and / or fermentation product (for example, acids, alcohols, ketones, gases and others). The production of a desired fermentation product from material containing xylan or cellulosic typically involves pretreatment, enzymatic hydrolysis (saccharification) and fermentation.
The processing of the xylan-containing or cellulosic material according to the present invention can be followed using procedures conventional in the art. In addition, the methods of the present invention can be implemented using any conventional biomass processing mechanisms configured to operate according to the invention.
Hydrolysis (saccharification) and fermentation, separate or simultaneous, includes, but is not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and fermentation (HHCF); and direct microbial conversion (DMC). SHF uses the process steps separate from the first material containing xylan or cellulosic enzymatically hydrolyzes to fermentable sugars, for example, glucose, cellobiose, cellotriose and pentose sugars and then ferment the fermentable sugars to ethanol. In SSF, the enzymatic hydrolysis of the material containing xylan or cellulosic and the fermentation of sugars to ethanol are combined in one step (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed. , Taylor & Francis, Washington, DC, 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan, J. and Himmel, M., 1999, Enzymes, energy and the environment: A strategic perspective on the US Department of Energy's research and development activities for bioethanol, Biotechnol. Prog. 15: 817 -827). HHF involves a separate hydrolysis step and in addition a simultaneous saccharification and hydrolysis step, which can be carried out in the same reactor. The steps in an HHF process can be performed at different temperatures, that is, high temperature enzymatic saccharification followed by SSF at a lower temperature than the fermentation strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis and fermentation) in one or more steps where the same organism is used to produce the enzymes by converting material containing xylan or cellulosic to fermentable sugars and to convert fermentable sugars into one final product (Lynd, LR, Weimer, PJ, van Zyl, WH and Pretorius, IS, 2002, Microbial cellulose utilization: Fundamentals and biotechnology, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood herein that any methods known in the art comprise pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof can be used in the practice of the methods of the present invention.
A conventional mechanism may include a stirred batch reactor, a batch stirred reactor, a continuous flow agitated reactor with ultrafiltration and / or a continuous buffer flow column reactor (Fernanda de Castilhos Corazza, Flávio Faria de Moraes , Gisella Maria Zanin and Ivo Neitzel, 2003, Optimal control in fedbatch reactor for the cellobiose hydrolysis, Acta Scientiarum. Technology 25: 33-38; Gusakov, AV and Sinitsyn, AP, 1985, Kinetics of the enzimatic hydrolysis of cellulose: 1. A mathematical model for a batch reactor process, 25 Enz. Microb. Technol. Ί: 346-352), an attrition reactor (Ryu, SK and Lee, JM, 1983, Bioconversion of waste cellulose by using a attrition bioreactor, Biotechnol. Bioeng 25: 53-65), or a reactor with intensive agitation induced by an electromagnetic field (Gusakov, AV, Sinitsyn, AP, Davydkin, IY, Davydkin, VY, Protas, Ο. V., 1996, Enhancement of enzimatic cellulose hydrolysis using a novel type of biorr eator with intensive agitation deduced for electromagnetic field, Appl. Biochem. Biotechnol. 56: 141-153). Additional reactor types include: fluidized milk upflow blanket, immobilized type reactors and extruder for hydrolysis and / or fermentation.
Pre-treatment. In the practice of the methods of the present invention, any pretreatment process known in the art can be used to disrupt the plant cell wall components of material containing xylan and / or cellulosic (Chandra et al., 2007, Substrate pretreatment: The key to effective enzimatic hydrolysis of lignocellulosics Adv. Biochem. Engin./Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Pretreatment of cellulosic lignomaterial for efficient bioethanol production, Adv. Biochem. Engin. / Biotechnol. 108: 41-65 ; Hendriks and Zeeman, 2009, Pretreatments to enhance the digestibility of lignocellulosic biomass, Bioresource Technol. 100: 10-18; Mosier et al., 2005, Features of promising technologies for pretreatment of lignocellulosic biomass, Bioresource Technol. 96: 673-686 ; Taherzadeh and Karimi, 2008, Pretreatment of lignocellulosic wastes to improve ethanol and biogas production: A review, Int. J. of Mol. Sci. 9: 16211651; Yang and Wyman, 2008, Pretreatment: the key to unlocki ng low-cost cellulosic ethanol, Biofuels Bioproducts and Biorefining-Biofpr. 2: 26-40).
Xylan-containing or cellulosic material can also be subjected to particle size reduction, pre-saturation, wetting, washing, or conditioning before pretreatment using methods known in the art.
Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), diluted acid pretreatment, hot water pretreatment, alkaline pretreatment, lime pretreatment, wet oxidation, ammonia fiber explosion, wet explosion, organosolv pretreatment and biological pretreatment. Additional pretreatments include percolation of ammonia, ultrasound, electroporation, microwaves, supercritical CO _2, supercritical H ₂ O, ozone, gamma irradiation pretreatments.
Xylan-containing or cellulosic material can be pre-treated prior to hydrolysis and / or fermentation. Pre-treatment is preferably carried out before hydrolysis. Alternatively, pretreatment can be carried out simultaneously with enzyme hydrolysis to release fermentable sugars, such as glucose, xylose and / or cellobiosis. In many cases, the pre-treatment step alone results in some conversion of biomass to fermentable sugars (even in the absence of enzymes).
Pre-treatment. In the steam pretreatment, material containing xylan or cellulosic is heated to break up the components of the plant cell wall, including lignin, hemicellulose and cellulose to manufacture cellulose and other fractions, for example, hemicellulose, accessible to enzymes. The material containing xylan or cellulosic is passed to or through a reaction vessel where the steam is injected to increase the temperature to the required temperature and pressure and is retained therein for the desired reaction time. The steam pretreatment is preferably done at 140 to 230 ° C, more preferably 160 to 200 ° C and more preferably 170 to 190 ° C, where the optimal temperature range depends on any addition of a chemical catalyst. The residence period for the steam pretreatment is preferably 1 to 15 minutes, more preferably 3 to 12 minutes and more preferably 4 to 10 minutes, where the optimal residence period depends on the temperature range and any addition of a chemical catalyst . Steam pretreatment allows for relatively high solids loads, so that the material containing xylan or cellulosic material is only generally wet during the pretreatment. Steam pretreatment is often combined with an explosive discharge of the material after pretreatment, which is known as a steam explosion, that is, rapid flicker at atmospheric pressure and turbulent flow of the material to increase the accessible surface area. by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; US Patent Application No. 20020164730). During the steam pretreatment, groups of acetyl hemicellulose are cleaved and the resulting acid autocatalyzes the partial hydrolysis of hemicellulose to monosaccharides and oligosaccharides. Lignin is removed only to a limited extent.
A catalyst such as H ₂ SO ₄ or SO ₂ (typically 0.3 to 3% w / w) is often added before the steam pretreatment, which decreases time and temperature, increases recovery and improves enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509-523; Sassner et al., 2006, Enzyme Microb Technol 39: 756-762).
Chemical pre-treatment: The term "chemical treatment" refers to any chemical pre-treatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin. Examples of suitable chemical pretreatment processes include, for example, pretreatment of diluted acid, pretreatment with lime, wet oxidation, freeze explosion / ammonia fiber (AFEX), percolation of ammonia (APR) and pretreatments of organosolvent.
In the pre-treatment of the diluted acid, material containing xylan or cellulosic is mixed with diluted acid, typically H ₂ SO ₄ and water to form a paste, heated by steam at room temperature and after a period of residence flickered at atmospheric pressure. Pretreatment of diluted acid can be carried out with various reactor designs, for example, buffer flow reactors, countercurrent reactors, or countercurrent contraction bed reactors (Duff and Murray, 1996, supra; Schell et al., 2004, Bioresource Technol. 91: 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).
Various pretreatment methods under alkaline conditions can also be used. Alkaline pretreatments include, but are not limited to, pretreatment with lime, wet oxidation, ammonia percolation (APR) and ammonia freeze / fiber burst (AFEX).
The pre-treatment of lime is carried out with calcium carbonate, sodium hydroxide or ammonia at a low temperature of 85 to 150 ° C and residence time of 1 hour in several days (Wyman et al., 2005, Bioresource Technol. 96: 1959-1966; Mosier et al., 2005, Bioresource Technol. 96: 673686). WO 2006/110891, WO 2006/11899, WO 2006/11900 and WO 2006/110901 discloses pretreatment methods using ammonia.
Wet oxidation is a pretreatment typically performed at 180 to 200 ° C for 5 to 15 minutes with the addition of an oxidizing agent such as hydrogen peroxide or oxygen super pressure (Schmidt and Thomsen, 1998, Bioresource Technol. 64: 139 -151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117: 1-17; Varga et al., 2004, Biotechnol. Bioeng. 88: 567-574; Martin et al., 2006, J. Chem. Technol, Biotechnol, 81: 1669-1677). Pretreatment is carried out to preferably 1 to 40% dry substance, more preferably 2 to 30% dry substance and most preferably 5 to 20% dry substance and often the initial pH is increased by the addition of alkali such as sodium carbonate.
A modification of the wet oxidation pretreatment method, known as a wet burst (combination of wet oxidation and steam burst), can handle dry matter up to 30%. In the wet explosion, the oxidizing agent is introduced during the pre-treatment after a certain period of residence. The pretreatment is then completed by atmospheric pressure scintillation (WO 2006/032282).
The ammonia fiber explosion (AFEX) involves treating the material containing xylan or cellulosic with gaseous or liquid ammonia at moderate temperatures such as 90 to 100 ° C and high pressure such as 17 to 20 bar for 5 to 10 minutes, where the content of dry substance can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231; Alizadeh et al ., 2005, Appl. Biochem. Biotechnol. 121: 1133-1141; Teymouri et al., 2005, Bioresource Technol. 96: 2014-2018). The AFEX pretreatment results in depolymerization of cellulose and partial hydrolysis of hemicellulose. The carbohydrate-lignin complexes are cleaved.
The organosolvent pretreatment delignifies material containing xylan or cellulosic by extraction using aqueous ethanol (40 to 60% ethanol) at 160 to 200 ° C for 30-60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90: 473-481; Pan et al., 2006, Biotechnol. Bioeng. 94: 851-861; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121: 219-230). Sulfuric acid is usually added as a catalyst. In organosolvent pretreatment, most hemicellulose is removed.
Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. and Biotechnol. 105108, p. 69-85 and Mosier et al., 2005, Bioresource Technology 96: 673-686 and U.S. Published Application 2002/0164730.
In one aspect, the chemical pretreatment is preferably carried out as an acidic treatment and more preferably as a continuous mild and / or diluted acid treatment. The acid is typically sulfuric acid, but other acids can also be used, such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof. The mild acid treatment is carried out in the pH range of preferably 1 to 5, more preferably 1 to 4 and more preferably 1 to 3. In one aspect, the acid concentration is in the range of preferably 0.01 to 20% by weight of the acid, more preferably 0.05 to 10% by weight of the acid, even more preferably 0.1 to 5% by weight of the acid and more preferably 0.2 to 2.0% by weight of the acid. The acid is contacted with the material containing xylan or cellulosic and maintained at a temperature in the range of preferably 160 to 220 ° C and more preferably 165 to 195 ° C, for periods ranging from seconds to minutes to, for example, 1 second to 60 minutes.
In another aspect, pretreatment is performed as an ammonia fiber blast stage (AFEX pretreatment stage).
In another aspect, pretreatment takes place in an aqueous paste. In preferred aspects, material containing xylan or cellulosic is present during the pretreatment in amounts preferably between 10 to 80% by weight, more preferably between 20 to 70% by weight and more preferably between 30 to 60% by weight, as in I take 50% by weight. The pre-treated xylan or cellulosic material may be washed or unwashed using any method known in the art, for example, washed with water.
Mechanical pretreatment: The term "mechanical pretreatment" refers to various types of crushing or grinding (for example, dry grinding, wet grinding, or vibrating ball grinding). In a preferred aspect, mechanical pretreatment is carried out in a batting process, steam gun hydrolyzer system that uses high pressure and high temperature as defined above, for example, a Sunds hydrolyzer available from Sunds Defibrator AB, Sweden.
Physical pretreatment: The term "physical pretreatment" refers to any pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin from material containing xylan or cellulosic. For example, physical pretreatment may involve irradiation (eg microwave irradiation), vapor / vapor explosion, hydrothermolysis and combinations of these.
Physical pretreatment may involve high pressure and / or high temperature (vapor explosion). In one aspect, high pressure means pressure in the range of preferably about 300 to about 600 psi, more preferably about 350 to about 550 psi and more preferably about 400 to about 500 psi, such as around 450 psi . In another aspect, high temperature means temperatures in the range of about 100 to about 300 ° C, preferably about 140 to about 235 ° C.
Combined chemical and physical pretreatment: Material containing xylan or cellulosic can be pretreated both physically and chemically. For example, the pre-treatment step may involve the treatment of mild or diluted acid and high temperature and / or pressure treatment. Chemical and physical pretreatments can be carried out sequentially or simultaneously, as desired. A mechanical pretreatment can also be included.
Consequently, in a preferred aspect, material containing xylan or cellulosic is subjected to physical, chemical or mechanical pretreatment, or any combination thereof, to promote the separation and / or release of cellulose, hemicellulose and / or lignin.
Biological pretreatment: The term "biological pretreatment" refers to any biological pretreatment that promotes the separation and / or release of cellulose, hemicellulose and / or lignin from material containing xylan or cellulosic. Biological pretreatment techniques may involve the application of lignin solubilizing microorganisms (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212; Ghosh and Singh, 1993, Physicochemical and biological treatments for enzymatic / microbial conversion of cellulosic biomass, Adv. Appl. Microbiol. 39: 295-333; McMillan, JD, 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, Μ. E., Baker, JO and Overend, RP, eds., ACS Symposium Series 566, American Chemical Society, Washington,
DC, chapter 15; Gong, CS, Cao, NJ, Du, J. and Tsao, GT, 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65 : 207-241; Olsson and Hahn-Hagerdal, 1996, Fermentation of lignocellulosic hydrolysates for ethanol production, Enz. Microb. Tech. 18: 312-331 and Vallander and Eriksson, 1990, Production of ethanol from cellulosic lignomaterial: State of the art, Adv. Biochem. Eng./Biotechnol. 42: 63-95).
Saccharification. In the hydrolysis step, also known as saccharification, the material containing xylan or cellulosic, for example, pretreated, is hydrolyzed to break down cellulose and hemicellulose to fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose and / or soluble oligosaccharides. Hydrolysis is carried out enzymatically by an enzyme composition in the presence of a polypeptide having xylanase activity of the present invention. The enzymes in the compositions can also be added sequentially.
Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions that can be readily determined by a person skilled in the art. In a preferred aspect, hydrolysis is carried out under conditions suitable for enzyme activity, that is, optimal for enzymes. Hydrolysis can be carried out as a continuous or batch process by feeding where the pre-treated xylan or cellulosic material (substrate) is gradually fed to, for example, an enzyme containing the hydrolysis solution.
Saccharification is generally performed in agitated tank reactors or fermenters under controlled pH, temperature and mixing conditions. The appropriate process time, temperature and pH conditions can be readily determined by a person skilled in the art. For example, saccharification can continue for up to 200 hours, but is typically performed for preferably about 12 to about 96 hours, more preferably about 16 to about 72 hours, and more preferably about 24 to about 48 hours. The temperature is in the range of preferably about 25 ° C to about 70 ° C, more preferably about 30 ° C to about 65 ° C and more preferably about 40 ° C to 60 ° C, in particular about 50 ° C. The pH is in the range of preferably about 3 to about 8, more preferably about 3.5 to about 7 and more preferably about 4 to about 6, in particular about pH 5. The content of dry solid is in the range of preferably about 5 to about 50% by weight, more preferably about 10 to about 40% by weight and more preferably about 20 to about 30% by weight.
The enzyme composition preferably comprises enzymes having cellulolytic activity and / or xylan degradation activity. In one aspect, the enzyme composition comprises one or more xylan degrading enzymes. In another aspect, the enzyme composition comprises one or more cellulolytic enzymes. In another aspect, the enzyme composition comprises one or more xylan degrading enzymes and one or more cellulolytic enzymes.
One or more xylan degrading enzymes are preferably selected from the group consisting of a xylanase, an acetixylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase and glucuronidase. One or more of the cellulolytic enzymes is preferably selected from the group consisting of an endoglucanase, a cellobiohydrolase and a beta-glucosidase.
In another preferred aspect, the enzyme composition further or further comprises an additional polypeptide having cellulolytic enhancing activity (see, for example, WO 2005/074647, WO 2005/074656 and WO 2007/089290). In another aspect, the enzyme composition may or may further comprise one or more additional enzyme activities to improve the degradation of the cellulose-containing material or xylan-containing material. Preferred additional enzymes are hemicellulases (for example, alpha-Dglucuronidases, alpha-L-arabinofuranosidases, endo-mannanases, betamanosidases, alpha-galactosidases, endo-alpha-L-arabinanases, betagalactosidases), carbohydrate-esterases (for example, acetyl -xylan esterases, acetyl-manan esterases, ferulic acid esterases, coumaric acid esterases, glucuronoyl esterases), pectinases, proteases, ligninolytic enzymes (for example, laccases, manganese peroxidases, lignin peroxidases, H2O2 production enzymes, oxide reductases), expansins, swolenins, or mixtures thereof. In the methods of the present invention, additional enzymes can be added before or during fermentation, for example, during saccharification or during or after the propagation of the fermentation microorganisms.
One or more components of the enzyme composition can be wild type proteins, recombinant proteins, or a combination of wild type proteins and recombinant proteins. For example, one or more components can be a cell's natural proteins, which is used as the host cells to recombinantly express one or more (several) other components of the enzyme composition. One or more components of the enzyme composition can be produced as monocomponents, which are then combined to form an enzyme composition. The enzyme composition can be a combination of single-component and multi-component protein preparations.
The enzymes used in the methods of the present invention can be in any form suitable for use in the processes described herein, such as, for example, crude fermentation broth with or without removed cells, the purified or semi-purified enzyme preparation, or a host cell as a source of enzymes. The enzyme composition can be a dry or granulated powder, a non-dusting granulate, a liquid, a stabilized liquid, or a protected stabilized enzyme. The liquid enzyme preparations can, for example, be stabilized by the addition of the stabilizers such as a sugar, a sugar alcohol or other polyol and / or lactic acid or other organic acid according to the established process.
The optimal amounts of enzymes and polypeptides having xylanase activity depending on several factors including, but not limited to, the mixture of component enzymes, the material containing xylan or cellulosic, the concentration of the material containing xylan or cellulosic, the pretreatments of the material containing xylan or cellulosic, temperature, time, pH and inclusion of the fermentation organism (for example, yeast for simultaneous saccharification and fermentation).
In a preferred aspect, an effective amount of the cellulolytic enzymes and / or xylan degrading enzymes to the material containing xylan or cellulosic is about 0.5 to about 50 mg, preferably about 0.5 to about 40 mg , more preferably at about 0.5 to about 25 mg, more preferably at about 0.75 to about 20 mg, most preferably at about 0.75 to about 15 mg, even more preferably at about 0 , 5 to about 10 mg and more preferably to about 2.5 to about 10 mg per g of the material containing xylan or cellulosic.
In another preferred aspect, an effective amount of the polypeptides having xylanase activity to the material containing xylan or cellulosic is about 0.01 to about 50.0 mg, preferably about 0.01 to about 40 mg, more preferably about 0.01 to about 30 mg, more preferably about 0.01 to about 20 mg, more preferably about 0.01 to about 10 mg, more preferably about 0.01 to about 5 mg, most preferably to about 0.025 to about 1.5 mg, more preferably to about 0.05 to about 1.25 mg, more preferably to about 0.075 to about 1.25 mg, more preferably to about 0.1 to about 1.25 mg, even more preferably to about 0.15 to about 1.25 mg and most preferably to about 0.25 to about 1.0 mg per g of the material containing xylan or cellulosic.
In another preferred aspect, an effective amount of the polypeptides having xylanase activity, cellulolytic enzymes and / or xylan degrading enzymes is from about 0.005 to about 1.0 g, preferably at about 0.01 to about 1.0 g, more preferably at about 0.15 to about 0.75 g, more preferably at about 0.15 to about 0.5 g, more preferably at about 0.1 to about 0.5 g, even more preferably at about 0.1 to about 0.5 g and more preferably at about 0.05 to about 0.2 g per g of cellulolytic enzymes.
Enzymes can be derived or obtained from any suitable source, including mammalian, bacterial, fungal, yeast or vegetable origin. The term "obtained" here means that an enzyme has been isolated from an organism that naturally produces the enzyme as a natural enzyme. The term "obtained" also means in this that an enzyme was recombinantly produced in a host organism using methods described herein, in which a recombinantly produced enzyme is natural or foreign to the host organism or has a modified amino acid sequence, for example, having one or more amino acids that are deleted, inserted and / or substituted, i.e., a recombinantly produced enzyme that is a mutant and / or a fragment of a natural amino acid sequence or an enzyme produced by the nucleic acid mixing processes known in the art. Covered within the meaning of a natural enzyme are the natural variants and within the meaning of a foreign enzyme are the variants recombinantly obtained, such as by site-directed mutagenesis or mixture.
A polypeptide having cellulolytic enzyme activity or xylan degrading activity can be a bacterial polypeptide. For example, the polypeptide can be a gram-positive bacterial polypeptide such as a Bacillus, Streptococcus, Streptomyces, Staphylococcus, Enterococcus, Lactobacillus, Lactococcus, Clostridium, Geobacillus, or Oceanobacillus polypeptide having an enzyme or cellulolytic activity, or an enzyme-degrading activity or cellulolytic activity. gram negative bacterial polypeptide such as an E. coli, Pseudomonas, Salmonella, Campylobacter, Helicobacter, Flavobacterium, Fusobacterium, Ilyobacter, Neisseria, or Ureaplasma polypeptide having enzyme cellulolytic activity or xylan degradation activity.
In a preferred aspect, the polypeptide is a Bacillus alkalophilus polypeptide, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megillus, Bacillus megillus, Bacillus michillus subtilis, or Bacillus thuringiensis having cellulolytic enzyme activity or xylan degradation activity.
In another preferred aspect, the polypeptide is a polypeptide Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, or Streptococcus equi subsp. Zooepidemicus having cellulolytic enzyme activity or xylan degradation activity.
In another preferred aspect, the polypeptide is a polypeptide Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, or Streptomyces lividans having cellulolytic enzyme activity or xylan degradation activity.
The polypeptide having cellulolytic enzyme activity or xylan degrading activity can also be a fungal polypeptide and more preferably a yeast polypeptide such as a Candida, Kluyveromyces, Pichia, Saccharomyces polypeptide,
Schizosaccharomyces, or Yarrowia having cellulolytic enzyme activity or xylan degradation activity; or more preferably a filamentous fungal polypeptide such as an Acremonium, Agaricus, Alternaria, Aspergillus, Aureobasidium, Botryospaeria, Ceriporiopsis, Chaetomidium, Chrysosporium, Claviceps, Cochliobolus, Coprinopsis, Crypticia, Cryptography, Cryptocidia, Cryptocidia , Gibberella, Holomastigotoides, Humicola, Irpex, Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Piromyces, Poitrasia, Poitrasia,
Pseudotrichonympha, Rhizomucor, Schizophyllum, Scytalidium, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trichoderma, Trichophaea, Verticillium, Volvariella, or Xylarixwa. having cellulolytic enzyme activity or xylan degradation activity.
In a preferred aspect, the polypeptide is a Saccharomyces carlsbergensis polypeptide, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, or Saccharomyces oviformis having cellulolytic activity of enzyme or cellulolytic activity.
In another preferred aspect, the polypeptide is an Acremonium cellulolyticus, Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus,
Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium tropicum, Chrysosporium merdarium, Chrysosporium inops, Chrysosporium pannicola,
Chrysosporium queenslandicum, Chrysosporium zonatum, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium rose, Fusarium, fusarium, fusarium, fusarium, sarium , Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola grisea, Humicola insolens, Humicola lanuginosa, Irpex lacteus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium funiculosia, Thicilliaavia, Thiaromaliaiel, chiapielielumony, Pichylia australeinsis, Thielavia fimeti, Thielavia microspora, Thielavia ovispora, Thielavia peruviana, Thielavia spededonium, Thielavia setosa, Thielavia subthermophila, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma esei, Trichoderma viride, or Trichophaea saccata having cellulolytic enzyme activity or xylan degradation activity.
Protein-designed or chemically modified mutants of polypeptides having cellulolytic enzyme activity or xylan degradation activity can also be used.
One or more components of the enzyme composition can be a recombinant component, that is, produced by cloning a DNA sequence encoding the single component and the subsequent cell transformed with the DNA sequence and expressed in a host (see, for example , WO 91/17243 and WO 91/17244). The host is preferably a heterologous host (enzyme is foreign to the host), but the host may under certain conditions also be a homologous host (enzyme is natural to the host). Monocomponent cellulolytic proteins can also be prepared by purifying such a protein from a fermentation broth.
Examples of commercial cellulolytic protein preparations suitable for use in the present invention include, for example, CELLIC ™ Ctec (Novozymes A / S), CELLUCLAST ™ (Novozymes A / S) and
NOVOZYM ™ 188 (Novozymes A / S). Other commercially available preparations comprising cellulase that can be used include CELLUZYME ™, CEREFLO ™ and ULTRAFLO ™ (Novozymes A / S), LAMINEX ™ and SPEZYME ™ CP (Genencor Int.), ROHAMENT ™ 7069 W (Rõhm GmbH) and FIBREZYME® LDI, FIBREZYME® LBR, or VISCOSTAR® 150L (Dyadic Intemational, Inc.). Cellulase enzymes are added in effective amounts of about 0.001 to about 5.0% by weight of solids, more preferably from about 0.025 to about 4.0% by weight of solids and more preferably from about 0.005 to about 2.0% by weight of solids.
Examples of bacterial endoglucanases that can be used in the methods of the present invention include, but are not limited to, Acidothermus cellulolyticus endoglucanase (WO 91/05039; WO 93/15186; US Patent No. 5,275,944; WO 96/02551 US Patent No. 5,536,655, WO 00/70031, WO 05/093050); Thermobifida fusca endoglucanase III (WO 05/093050); and Thermobifida fusca endoglucanase V (WO 05/093050).
Examples of fungal endoglucanases that can be used in the methods of the present invention include, but are not limited to, Trichoderma reesei endoglucanase I (Penttila et al., 1986, Gene 45: 253-263; GENBANK ™ accession No. M15665) ; Trichoderma reesei endoglucanase II (Saloheimo, et al., 1988, Gene 63: 11-22; GENBANK ™ accession No. M19373); Trichoderma reesei endoglucanase III (Okada et al., 1988, Appl. Environ. Microbiol. 64: 555-563; GENBANK ™ accession No. AB003694); Trichoderma reesei endoglucanase IV (Saloheimo et al., 1997, Eur. J. Biochem. 249: 584-591; GENBANK ™ accession No. Y11II3); and Trichoderma reesei endoglucanase V (Saloheimo et al., 1994, Molecular Microbiology 13: 219-228; GENBANK ™ accession No. Z33381); Aspergillus aculeatus endoglucanase (Ooi et al., 1990, Nucleic Acids Research 18: 5884); Aspergillus kawachii endoglucanase (Sakamoto et al., 1995, Current Genetics
27: 435-439); Erwinia carotovara endoglucanase (Saarilahti et al., 1990, Gene 90: 9-14); Fusarium oxysporum endoglucanase (GENBANK ™ accession No. L29381); Humicola grisea var. thermoidea endoglucanase (GENBANK ™ accession No. AB003107); Melanocarpus albomyces endoglucanase (GENBANK ™ accession No. MAL515703); Neurospora crassa endoglucanase (GENBANK ™ accession No. XM 324477); Humicola insolens endoglucanase V; Myceliophthora thermophila CBS 117.65 endoglucanase; basidiomycete CBS 495.95 endoglucanase; basidiomycete CBS 494.95 endoglucanase; Thielavia terrestris NRRL 8126 CEL6B endoglucanase; Thielavia terrestris NRRL 8126 CEL6C endoglucanase); Thielavia terrestris NRRL 8126 CEL7C endoglucanase; Thielavia terrestris NRRL 8126 CEL7E endoglucanase; Thielavia terrestris NRRL 8126 CEL7F endoglucanase; Cladorrhinum foecundissimum ATCC 62373 CEL7A endoglucanase; and Trichoderma reesei N °. VTT-D-80133 endoglucanase (GENBANK ™ accession No. M15665).
Examples of cellulobiohydrolases useful in the methods of the present invention include, but are not limited to, Trichoderma reesei cellobiohydrolase I; Trichoderma reesei cellobiohydrolase II; Humicola insolens cellobiohydrolase I, Myceliophthora thermophila cellobiohydrolase II, Thielavia terrestris cellobiohydrolase II (CEL6A), Chaetomium thermophilum cellobioidrolase I and Chaetomium thermophilum celobioidrolase II.
Examples of beta-glucosidases useful in the methods of the present invention include, but are not limited to, Aspergillus oryzae betaglucosidase; Aspergillus fumigatus beta-glucosidase; Penicillium brasilianum IBT 20888 beta-glucosidase; Aspergillus niger beta-glucosidase; and Aspergillus aculeatus beta-glucosidase.
The Aspergillus oryzae polypeptide having beta-glucosidase activity can be obtained according to WO 2002/095014. The Aspergillus fumigatus polypeptide having beta-glucosidase activity can be obtained according to WO 2005/047499. The Penicillium brasilianum polypeptide having beta-glucosidase activity can be obtained according to WO 2007/019442. The Aspergillus niger polypeptide having beta-glucosidase activity can be obtained according to Dan et al., 2000, J. Biol. Chem. 275: 4973-4980. The Aspergillus aculeatus polypeptide having beta-glucosidase activity can be obtained according to Kawaguchi et al., 1996, Gene 173: 287-288.
Beta-glucosidase can be a fusion protein. In one aspect, beta-glucosidase is the BG fusion protein of the beta-glucosidase variant Aspergillus oryzae or the beta-glucosidase fusion protein Aspergillus oryzae obtained according to WO 2008/057637.
Other endoglucanases, cellobiohydrolases and beta-glucosidases are disclosed in the numerous families of glycosyl hydrolase using the classification according to Henrissat B., 1991, A classification of glycosyl hydrolases based on amino-acid sequence similarities, Biochem. J. 280: 309316 and Henrissat B. and Bairoch A., 1996, Updating the sequence-based classification of glycosyl hydrolases, Biochem. 7 316: 695-696.
Other cellulolytic enzymes that can be used in the present invention are described in EP 495,257, EP 531,315, EP 531,372, WO 89/09259, WO 94/07998, WO 95/24471, WO 96/11262, WO 96/29397, WO 96 / 034108, WO 97/14804, WO 98/08940, WO 98/012307, WO 98/13465, WO 98/015619, WO 98/015633, WO 98/028411, WO 99/06574, WO 99/10481, WO 99 / 025846, WO 99/025847, WO 99/031255, WO 2000/009707, WO 2002/050245, WO 2002/0076792, WO 2002/101078, WO 2003/027306, WO 2003/052054, WO 2003/052055, WO 2003 / 052056, WO 2003/052057, WO 2003/052118, WO 2004/016760, WO 2004/043980, WO 2004/048592, WO 2005/001065, WO 2005/028636, WO 2005/093050, WO 2005/093073, WO 2006 / 074005, WO 2006/117432, WO 2007/071818, WO 2007/071820, WO 2008/008070, WO 2008/008793, US Patent No. 4,435,307, U.S. Patent No. 5,457,046, U.S. Patent No. 5,648,263, Patent
U.S. No. 5,686,593, U.S. Patent No. 5,691,178, U.S. Patent No. 5,763,254 and U.S. Patent No. 5,776,757.
In the methods of the present invention, any polypeptide having cellulolytic enhancing activity can be used.
In the first aspect, the polypeptide having cellulolytic enhancing activity comprises the following reasons: [ILMV] -PX (4,5) -GXY- [ILMV] -XRX- [EQ] -X (4) - [HNQ] and [FW] - [TF] -K [AIV], where X is any amino acid, X (4,5) is any amino acid in 4 or 5 continuous positions and X (4) is any amino acid in 4 continuous positions.
The polypeptide comprising the reasons noted above may still comprise:
HX (1,2) -GPX (3) - [YW] - [AILMV], [EQ] -XYX (2) -CX- [EHQN] - [FILV] -X- [ILV], or HX (1, 2) -GPX (3) - [YW] - [AILMV] and [EQ] -XYX (2) -CX- [EHQN] [FILV] -X- [ILV], where X is any amino acid, X (l , 2) is any amino acid in 1 position or 2 continuous positions, X (3) is any amino acid in 3 continuous positions and X (2) is any amino acid in 2 continuous positions. In the above reasons, the abbreviation for the single letter acceptable IUPAC amino acid is used.
In a preferred aspect, the polypeptide having cellulolytic enhancing activity still comprises HX (1,2) -GPX (3) - [YW] [AILMV], In another preferred aspect, the isolated polypeptide having cellulolytic enhancing activity still comprises [EQ] - XYX (2) -CX- [EHQN] [FILV] -X- [ILV]. In another preferred aspect, the polypeptide having cellulolytic enhancing activity still comprises HX (1,2) -GPX (3) - [YW] [AILMV] and [EQ] -XYX (2) -CX- [EHQN] - [FILV] -X- [ILV].
In a second aspect, the polypeptide having cellulolytic intensifying activity comprises the following reason:
[ILMV] -Px (4,5) -GxY- [ILMV] -xRx- [EQ] -x (3) -A- [HNQ], where x is any amino acid, x (4,5) is any amino acid in 4 or 5 continuous positions ex (3) is any amino acid in 3 continuous positions. In the above reason, the abbreviation for the single letter acceptable IUPAC amino acid is used.
Examples of polypeptides having cellulolytic enhancing activity useful in the methods of the present invention include, but are not limited to, polypeptides having cellulolytic enhancing activity from Thielavia terrestris (WO 2005/074647); polypeptides having cellulolytic enhancing activity from Thermoascus aurantiacus (WO 2005/074656); and polypeptides having cellulolytic intensifying activity from Trichoderma reesei (WO 2007/089290).
Examples of commercial xylan degradation enzyme preparation suitable for use in the present invention include, for example, SHEARZYME ™ (Novozymes A / S), CELLIC ™ Htec (Novozymes A / S), VISCOZYME® (Novozymes A / S) , ULTRAFLO® (Novozymes A / S), PULPZYME® HC (Novozymes A / S), MULTIFECT® Xylanase (Genencor), ECOPULP® TX-200A (AB Enzymes), HSP 6000 Xylanase (DSM), DEPOL ™ 333P (Biocatalysts Limit , Wales, UK), DEPOL ™ 740L. (Biocatalysts Limit, Wales, UK) and DEPOL ™ 762P (Biocatalysts Limit, Wales, UK).
Examples of xylanases useful in the methods of the present invention include, but are not limited to, Aspergillus aculeatus xylanase (GeneSeqP: AAR63790; WO 94/21785), Aspergillus fumigatus xylanases (WO 2006/078256) and Thielavia terrestris NRRL 8126 xylanases (WO / 079210).
Examples of beta-xylosidases useful in the methods of the present invention include, but are not limited to, Trichoderma reesei betaxilosidase (UniProtKB / TrEMBL accession number Q92458), Talaromyces emersonii (SwissProt accession number Q8X212) and gross Neurospora (SwissProt accession number Q7SOW4).
Examples of acetylxylan esterases useful in the methods of the present invention include, but are not limited to, Hypocrea jecorin acetylxylan esterase (WO 2005/001036), Neurospora crassa acetylxylan esterase (UniProt accession number q7s259), Thielavia terrestris NRRL 8126 acetylxilan esterase 2009/042846), Chaetomium globosum acetylxylan esterase (Uniprot accession number Q2GWX4), Chaetomium gracile acetylxilan esterase (GeneSeqP accession number AAB82124), Phaeosphaeria nodorum acetylxylan esterase (Uniprot accession number DS0HHilH1n1nHxHil1n / 073709).
Examples of ferulic acid esterases useful in the methods of the present invention include, but are not limited to, Humicola insolens DSM 1800 feruloyl esterase (WO 2009/076122), Neurospora crassa feruloyl esterase (UniProt accession number Q9HGR3) and Neosartorya fischeri feruloil esterase (UniProt Accession number A1D9T4).
Examples of arabinofuranosidases useful in the methods of the present invention include, but are not limited to, Humicola insolens DSM 1800 arabinofuranosidase (WO 2009/073383) and Aspergillus niger arabinofuranosidase (GeneSeqP accession number AAR94170).
Examples of alpha-glucuronidases useful in the methods of the present invention include, but are not limited to, Aspergillus clavatus alfaglucuronidase (UniProt accession number alccl 2), Trichoderma reesei alfaglucuronidase (Uniprot accession number Q99024), Talaromyces emersonii (alpha-glucuronidase accession number Q8X211), Aspergillus niger alfa-glucuronidase (Uniprot accession number Q96WX9), Aspergillus terreus alfa-glucuronidase (SwissProt accession number Q0CJP9) and Aspergillus fumigatus alfa-glucuronidase (Q4PrWW accession number).
The enzymes and proteins used in the methods of the present invention can be produced by fermenting the microbial strains noted above in a nutrient medium containing suitable carbon sources and nitrogen and inorganic salts, using procedures known in the art (see, for example, Bennett, JW and LaSure, L. (eds.), More Gene Manipulations in Fungi, Academic Press, CA, 1991). Suitable media are available from commercial suppliers or can be prepared according to published compositions (for example, in American Type Culture Collection catalogs). Temperature ranges and other conditions suitable for enzyme development and production are known in the art (see, for example, Bailey, J.E. and Ollis, D.F., Fundamental Biochemical Engineering, McGraw-Hill Book Company, NY, 1986).
Fermentation can be any method of culturing a cell resulting in the expression or isolation of an enzyme. Fermentation can, therefore, be understood as comprising shaking flask cultivation, or large or smaller scale fermentation (including continuous, batch, batch-fed or solid fermentations) in industrial and laboratory fermenters carried out in a suitable medium and under conditions allowing the enzyme to be expressed or isolated. The resulting enzymes produced by the methods described above can be recovered from the fermentation medium and purified by conventional procedures.
Fermentation. Fermentable sugars obtained from material containing hydrolyzed and pretreated xylan or cellulosic material can be fermented by one or more fermentation microorganisms capable of fermenting the sugars directly or indirectly in a desired fermentation product, the "fermentation" or "fermentation process" refers to any fermentation process or any process that comprises a fermentation step. The fermentation process also includes the fermentation processes used in the consumed alcohol industry (for example, beer and wine), the dairy industry (for example, fermented dairy products), the leather industry and the tobacco industry. The fermentation conditions depend on the desired fermentation product and fermentation organism and can be easily determined by a person skilled in the art.
In the fermentation step, sugars, released from the material containing xylan or cellulosic as a result of the pretreatment and enzymatic hydrolysis steps, are fermented to the product, for example, ethanol, by a fermentation organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separated or simultaneous, as described in this.
Any suitable material containing xylan or hydrolyzed cellulosic can be used in the fermentation step in the practice of the present invention. The material is generally selected on the basis of the desired fermentation product, that is, the substance to be obtained from the fermentation and the process used, as is well known in the art.
The term "fermentation medium" is understood in this to refer to a medium before the fermentation microorganisms are added, such as a medium resulting from the saccharification process, as well as a medium used in the simultaneous saccharification and fermentation process ( SSF).
The "fermentation micro-organism" refers to any micro-organism, including fungal and bacterial organisms, suitable for use in the desired fermentation process to produce a fermentation product. The fermentation organism can be C6 and / or C5 fermentation organisms, or a combination thereof. Both C6 and C5 fermentation organisms are well known in the art. Suitable fermentation microorganisms are capable of fermenting, i.e. converting, sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, or oligosaccharides, directly or indirectly into the desired fermentation product.
Examples of fungal and bacterial fermentation organisms that produce ethanol are described by Lin et al., 2006, Appl. Microbiol. Biotechnol. 69: 627-642.
Examples of fermentation microorganisms that can ferment C6 sugars include fungal and bacterial organisms, such as yeast. The preferred yeast includes strains of Saccharomyces spp., Preferably Saccharomyces cerevisiae.
Examples of fermentation organisms that can ferment C5 sugars include fungal and bacterial organisms, such as yeast. Preferred C5 fermentation yeast includes strains of Pichia, preferably Pichia stipitis, such as Pichia stipitis CBS 5773; strains of Candida, preferably Candida boidinii, Candida brassicae, Candida sheatae, Candida diddensii, Candida pseudotropicalis, or Candida utilis.
Other fermentation organisms include strains of Zymomonas, such as Zymomonas mobilis ', Hansenula, such as Hansenula anomalous', Kluyveromyces, such as K. fragilis ·, Schizosaccharomyces, such as S. pombe-, and E. coli, especially E strains coli that have been genetically modified to improve ethanol production.
In a preferred aspect, the yeast is Saccharomyces spp. In a more preferred aspect, the yeast is Saccharomyces cerevisiae. In another more preferred aspect, the yeast is Saccharomyces distaticus. In another more preferred aspect, the yeast is Saccharomyces uvarum. In another preferred aspect, the yeast is Kluyveromyces. In another more preferred aspect, the yeast is Kluyveromyces marxianus. In another more preferred aspect, the yeast is Kluyveromyces fragilis. In another preferred aspect, the yeast is Candida. In another more preferred aspect, the yeast is Candida boidinii. In another more preferred aspect, the yeast is Candida brassicae. In another more preferred aspect, the yeast is Candida diddensii. In another more preferred aspect, the yeast is Candida pseudotropicalis. In another more preferred aspect, the yeast is Candida utilis. In another preferred aspect, the yeast is Clavispora. In another more preferred aspect, the yeast is Clavispora lusitaniae. In another more preferred aspect, the yeast is Clavispora opuntiae. In another preferred aspect, the yeast is Pachysolen. In another more preferred aspect, the yeast is Pachysolen tannophilus. In another preferred aspect, the yeast is a Pichia. In another more preferred aspect, the yeast is a Pichia stipitis. In another preferred aspect, the yeast is a Bretannomyces. In another more preferred aspect, the yeast is Bretannomyces clausenii (Philippidis, GP, 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, CE, ed., Taylor & Francis, Washington, DC, 179-212) .
Bacteria that can efficiently ferment hexose and pentose to ethanol include, for example, Zymomonas mobilis and Clostridium thermocellum (Philippidis, 1996, supra).
In a preferred aspect, the bacterium is a Zymomonas. In a more preferred aspect, the bacterium is Zymomonas mobilis. In another preferred aspect, the bacterium is a Clostridium. In another more preferred aspect, the bacterium is Clostridium thermocellum.
Commercially available yeast suitable for ethanol production includes, for example, ETHANOL RED ™ yeast (available from Fermentis / Lesaffre, USA), FALI ™ (available from Fleischmann's Yeast, USA), SUPERSTART ™ and fresh THERMOSACC yeast ™ (available from Ethanol Technology, WI, USA), BIOFERM ™ AFT and XR (available from NABC - North American
Bioproducts Corporation, GA, USA), GERT STRAND ™ (available from Gert Strand AB, Sweden) and FERMIOL ™ (available from DSM Specialties).
In a preferred aspect, the fermentation microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as use of xylose, use of arabinose and xylose and micro-organisms from co-use of arabinose.
The cloning of heterologous genes in various fermentation microorganisms has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (co-fermentation) (Chen and Ho, 1993, Cloning and improving the expression of Pichia stipitis xylose reductase gene in Saccharomyces cerevisiae , Appl. Biochem. Biotechnol. 39-40: 135-147; Ho et al., 1998, Genetically engineered Saccharomyces yeast capable of effectively cofermenting glucose and xylose, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy, 1993, Xylose fermentation by Saccharomyces cerevisiae, Appl. Microbiol. Biotechnol. 38: 776-783; Walfridsson et al., 1995, Xylose-metabolizing Saccharomyces cerevisiae strains overexpressing the TKL1 and TAL1 genes that encode the pentose phosphate pathway enzymes transketolase and transketolase and Appl. Environ. Microbiol. 61: 41844190; Kuyper et al., 2004, Minimal metabolic engineering of Saccharomyces cerevisiae for efficient anaerobic xylose fermentation: a proof of principal, FEMS Yeast Research 4: 655-664; Beall et al., 1991, Parametric studies of ethanol production from xylose and other sugars by recombinant Escherichia coli, Biotech. Bioeng. 38: 296-303; Ingram et al., 1998, Metabolic engineering of bacteria to production of ethanol, Biotechnol. Bioeng. 58: 204214; Zhang et al., 1995, Metabolic engineering of a pentose metabolism pathway in ethanologenic Zymomonas mobilis, Science 267: 240-243; Deanda et al., 1996, Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering, Appl. Environ. Microbiol. 62: 446599
4470; WO 2003/062430, xylose isomerase).
In a preferred aspect, the genetically modified fermentation microorganism is Saccharomyces cerevisiae. In another preferred aspect, the genetically modified fermentation microorganism is Zymomonas mobilis. In another preferred aspect, the genetically modified fermentation microorganism is Escherichia coli. In another preferred aspect, the genetically modified fermentation microorganism is Klebsiella oxytoca. In another preferred aspect, the genetically modified fermentation microorganism is Kluyveromyces sp.
It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.
The fermentation microorganism is typically added to a hydrolyzate and fermentation is carried out for about 8 to about 96 hours, such as about 24 to about 60 hours. The temperature is typically between about 26 ° C to about 60 ° C, in particular about 32 ° C or 50 ° C and about pH 3 to about pH 8, such as around pH 4-5, 6, or 7.
In a preferred aspect, yeast and / or another microorganism is applied to the material containing degraded xylan or cellulosic and fermentation is carried out for about 12 to about 96 hours, such as typically 24 to 60 hours. In a preferred aspect, the temperature is preferably between about 20 ° C to about 60 ° C, more preferably about 25 ° C to about 50 ° C and more preferably about 32 ° C to about 50 ° C, in particular about 32 ° C or 50 ° C and the pH is generally about pH 3 to about pH 7, preferably around pH 4 to 7. However, some fermentation organisms, for example, bacteria, having an excellent temperature of greater fermentation. Yeast or other microorganisms are preferably applied in amounts of approximately 10 ⁵ to 10 ¹² , preferably approximately 10 ⁷ to 10 ¹⁰ , especially
100 approximately 2 x 10 ⁸ viable cell count per ml of fermentation broth. The guidance regarding the use of yeast for fermentation can also be observed in, for example, “The Alcohol Textbook” (Editors K. Jacques, TP Lyons and DR Kelsall, Nottingham University Press, United Kingdom 1999), which is therefore incorporated by reference.
A fermentation stimulator can be used in combination with any of the processes described therein to improve the fermentation process and in particular, the performance of the fermentation microorganism, such as rate intensification and ethanol production. A "fermentation stimulator" refers to stimulators for the development of fermentation microorganisms, in particular, yeast. The preferred fermentation stimulators for development include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin and vitamins A, B, C, D and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is therefore incorporated by reference. Examples of minerals include minerals and minerals that can provide nutrients comprising P, K, Mg, S, Ca, Fe, Zn, Mn and Cu.
Fermentation products: A fermentation product can be any substance derived from fermentation. The fermentation product can be, without limitation, an alcohol (for example, arabinitol, butanol, ethanol, glycerol, methanol, 1,3-propanediol, sorbitol and xylitol); an organic acid (for example, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diceto-D-gluconic acid, formic acid, fumaric acid, gluconic acid, gluconic acid, glucuronic acid, glutaric acid , 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, propionic acid, succinic acid and
101 xylonic acid); a ketone (for example, acetone); an amino acid (for example, aspartic acid, glutamic acid, glycine, lysine, serine and threonine); a gas (for example, methane, hydrogen (H ₂ ), carbon dioxide (CO2) and carbon monoxide (CO)). The fermentation product can also be protein as a high value product.
In a preferred aspect, the fermentation product is an alcohol. It will be understood that the term "alcohol" includes a substance that contains one or more hydroxyl moieties. In a more preferred aspect, the alcohol is arabinitol. In another more preferred aspect, the alcohol is butanol. In another more preferred aspect, the alcohol is ethanol. In another more preferred aspect, the alcohol is glycerol. In another more preferred aspect, the alcohol is methanol. In another more preferred aspect, the alcohol is 1,3-propanediol. In another more preferred aspect, the alcohol is sorbitol. In another more preferred aspect, the alcohol is xylitol. See, for example, Gong, CS, Cao, NJ, Du, J. and Tsao, GT, 1999, Ethanol production ffom renewable resources, in Advances in Biochemical Engineering / Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Silveira, Μ. M. and Jonas, R., 2002, The biotechnological production of sorbitol, Appl. Microbiol. Biotechnol. 59: 400-408; Nigam, P. and Singh, D., 1995, Processes for fermentative production of xylitol - a sugar substitute, Process Biochemistry 30 (2): 117-124; Ezeji, T. C., Qureshi, N. and Blaschek, Η. P., 2003, Production of acetone, butanol and ethanol by Clostridium beijerinckii BA101 and in situ recovery by gas stripping, World Journal of Microbiology and Biotechnology 19 (6): 595-603.
In another preferred aspect, the fermentation product is an organic acid. In another more preferred aspect, the organic acid is acetic acid. In another more preferred aspect, the organic acid is acetonic acid. In another more preferred aspect, the organic acid is adipic acid. In another more preferred aspect, the organic acid is ascorbic acid. In another aspect
More preferred, the organic acid is citric acid. In another more preferred aspect, the organic acid is 2,5-diceto-D-gluconic acid. In another more preferred aspect, the organic acid is formic acid. In another more preferred aspect, the organic acid is fumaric acid. In another more preferred aspect, the organic acid is glucaric acid. In another more preferred aspect, the organic acid is gluconic acid. In another more preferred aspect, the organic acid is glucuronic acid. In another more preferred aspect, the organic acid is glutaric acid. In another preferred aspect, the organic acid is 3-hydroxypropionic acid. In another more preferred aspect, the organic acid is itaconic acid. In another more preferred aspect, the organic acid is lactic acid. In another more preferred aspect, the organic acid is malic acid. In another more preferred aspect, the organic acid is malonic acid. In another more preferred aspect, the organic acid is oxalic acid. In another more preferred aspect, the organic acid is propionic acid. In another more preferred aspect, the organic acid is succinic acid. In another more preferred aspect, the organic acid is xylonic acid. See, for example, Chen, R. and Lee, Y. Y., 1997, Membrane-mediated extractive fermentation for lactic acid production from cellulosic biomass, Appl. Biochem. Biotechnol. 63-65: 435-448.
In another preferred aspect, the fermentation product is a ketone. It will be understood that the term "ketone" includes a substance that contains one or more portions of ketone. In another more preferred aspect, the ketone is acetone. See, for example, Qureshi and Blaschek, 2003, supra.
In another preferred aspect, the fermentation product is an amino acid. In another more preferred aspect, the organic acid is aspartic acid. In another more preferred aspect, the amino acid is glutamic acid. In another more preferred aspect, the amino acid is glycine. In another more preferred aspect, the amino acid is lysine. In another more preferred aspect, the amino acid is serine. In another more preferred aspect, the amino acid is
103 threonine. See, for example, Richard, A. and Margaritis, A., 2004, Empirical modeling of batch fermentation kinetics for poli (glutamic acid) production and other microbial biopolymers, Biotechnology and Bioengineering 87 (4): 501-515.
In another preferred aspect, the fermentation product is a gas. In another more preferred aspect, the gas is methane. In another more preferred aspect, the gas is H ₂ . In another more preferred aspect, the gas is CO ₂ . In another more preferred aspect, the gas is CO. See, for example, Kataoka, N., A. Miya and K. Kiriyama, 1997, Studies on hydrogen production by continuous culture system of hydrogen-producing anaerobic bacteria, Water Science and Technology 36 (6-7): 41-47; and Gunaseelan VN in Biomass and Bioenergy, Vol. 13 (1-2), pp. 83-114, 1997, Anaerobic digestion of biomass for methane production: A review.
Recovery. Fermentation products can optionally be recovered from the fermentation medium using any method known in the art including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation or extraction. For example, alcohol is separated from material containing xylan or fermented cellulosic material and purified by conventional distillation methods. Ethanol with a value of up to about 96% by volume can be obtained, which can be used as, for example, ethanol fuel, potable ethanol, that is, neutral potable spirits, or industrial ethanol.
Other uses
The polypeptides of the present invention can also be used with limited activity from other xylanolitic enzymes to degrade xylans for the production of oligosaccharides. Oligosaccharides can be used as a bulking agent, similar to arabinoxylan oligosaccharides released from cereal cell wall material, or more or less arabinoxylans purified from cereals.
104
The polypeptides of the present invention can also be used in combination with other xylanolitic enzymes to degrade xylans to xylose and other monosaccharides (U.S. Patent No. 5,658,765). The released xylose can be converted to other compounds.
The polypeptides of the present invention can be used together with other glucanase-like enzymes to improve oil extraction from oil-rich plant material, similar to corn oil from corn embryos.
The polypeptides of the present invention can also be used in cooking to improve the development, elasticity and / or stability of dryness and / or the volume, fractional structure and / or anti-aging properties of the baked product (see US Patent No. 5,693. 518). Polypeptides can also be used for the preparation of dryness or cooked products prepared from any type of flour or cereal (for example, based on wheat, rye, barley, oats or corn). Baked products produced with a polypeptide of the present invention include breads, French bread, baguettes and the like. For cooking purposes a polypeptide of the present invention can be used as only or greater enzyme activity, or can be used in combination with other enzymes such as a xylanase, a lipase, an amylase, an oxidase (eg, glucose oxidase, peroxidase ), a laccase and / or a protease.
The polypeptides of the present invention can also be used to modify animal feed and can exert their effect in vitro (by modifying food components) or in vivo to improve food digestibility and increase the efficiency of this use (US Patent No. 6,245,546). Polypeptides can be added to food compositions containing high amounts of arabinoxylans and glucuronoxylans, for example, food containing cereals such as barley, wheat, rye, oats or corn. When added to the food the polypeptide
105 will improve in vivo breakdown of plant cell wall material partially due to reduced intestinal viscosity (Bedford et al., 1993, Proceedings of the lst Symposium on Enzymes in Animal Nutrition, pp. 73-77), where improved utilization of plant nutrients by the animal is reached. Therefore, the development rate and / or feed conversion ratio (ie, the weight of the food eaten relative to weight gain) is improved.
The polypeptides of the present invention can also be used in the pulp and paper industry, inter alia, in bleaching processes to enhance the brightness of bleached pulps where the amount of chlorine used in bleaching stages is reduced and to increase the freeness of pulps in the recycled paper process (Eriksson, 1990, Wood Science and Technology 24: 79-101; Paice et al., 1988, Biotechnol. and Bioeng. 32: 235239 and Pommier et al., 1989, Tappi Journal 187-191). The treatment of the lignocellulosic pulp can be carried out, for example, as described in U.S. Patent No. 5,658,765, WO 93/08275, WO 91/02839 and WO 92/03608.
The polypeptides of the present invention can also be used in the preparation of beer, in particular to improve the filterability of must containing, for example, barley and / or sorghum malt (WO 2002/24926). Polypeptides can be used in the same way as pentosanases conventionally used for preparation, for example, as described by Viêtor et al., 1993, J. Inst. Brew. 99: 243-248; and EP 227159. In addition, polypeptides can be used for the treatment of spent brewer grains, that is, residues from the production of beer wort containing malted barley or barley or other cereals, in order to improve the use of residuals for example, animal feed.
The polypeptides of the present invention can be used for the separation of components from plant cell materials, in particular from cereal components such as wheat components. Of particular interest is the separation of wheat and gluten and starch, that is, components of
106 considerable commercial interest. The separation process can be carried out using methods known in the art, such as the so-called dough process (or wet grinding process) carried out as a decanter or hydroclone process. In the doughing process, the starting material is a diluted pumpable dispersion of the plant material such as wheat to be subjected to separation. In a wheat separation process the dispersion is usually made from wheat flour and water
The polypeptides of the invention can also be used in the preparation of fruit and vegetable juice in order to increase production (see, for example, U.S. Patent No. 6,228,630).
The polypeptides of the present invention can also be used as a component of an enzymatic textile counting system (see, for example, U.S. Patent No. 6,258,590).
The polypeptides of the present invention can also be used in laundry detergent applications in combination with other enzyme functionalities (see, for example, U.S. Patent No. 5,696,068).
Flag peptide
The present invention also relates to an isolated polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2. The present invention also relates to the construction of nucleic acids that comprises a gene that encodes a protein, in which a gene is operably linked to the polynucleotide encoding the signal peptide comprising or consisting of amino acids 1 to 19 of SEQ ID NO: 2, in which a gene is foreign to the polynucleotide encoding the signal peptide.
In a preferred aspect, the nucleotide sequence of the polynucleotide comprises or consists of nucleotides 1 to 57 of SEQ ID NO: 1.
The present invention also relates to recombinant expression vectors and recombinant host cells that
107 comprise such nucleic acid constructs.
The present invention also relates to methods of producing a protein which comprises (a) culturing such a recombinant host cell under conditions suitable for the production of the protein; and (b) recovering the protein.
The protein can be natural or heterologous to host cells. The term "protein" is not meant in this to refer to the specific length of the encoded product and therefore includes peptides, oligopeptides and proteins. The term "protein" also encompasses two or more polypeptides combined to form the encoded product. Proteins also include hybrid polypeptides that comprise a combination of partial or complete polypeptide sequences obtained from at least two different proteins in which one or more (diverse) can be heterologous or natural to host cells. Additional proteins include naturally occurring allele and projected variations of the proteins mentioned above and hybrid proteins.
Preferably, the protein is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter. In a more preferred aspect, the protein is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In a still more preferred aspect, the protein is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, beta-galactosidase, beta-galactosidase, alpha-glucosamine glucosidase, invertase, laccase, another lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase or xylanase.
The gene can be obtained from any prokaryotic, eukaryotic or other source.
108
The present invention is further described by the following examples which are not to be construed as limiting the scope of the invention.
Examples
Materials
The chemicals used as buffers and substrates were commercial products of at least reagent grade.
Strain
Penicillium pinophilum NN046877 was used as a source of the family 10 polypeptide having xylanase activity. The Aspergillus oryzae HowBlOl strain (WO 95/35385) was used as a host to recombinantly express the polypeptide of the Penicillium pinophilum family NN046877 10 having xylanase activity.
Middle
The PDA plates were composed of 39 grams of potato dextrose agar and deionized water per liter.
The NNCYP-PCS medium was composed of 5.0 g of NaNO3, 3.0 g of NH4CI, 2.0 g of MES, 2.5 g of citric acid, 0.2 g of CaCl ₂ 2H ₂ O, 1.0 g of Bacto Peptona, 5.0 g of yeast extract, 0.2 g of MgSO ₄ 7H ₂ O, 4.0 g of K ₂ HPO ₄ , 1.0 ml of solution of trace elements CO VE, 2.5 g of glucose, 25.0 g of pre-treated corn forage (PCS) and deionized water per liter.
The COVE trace element solution was composed of 0.04 g of Na ₂ B ₄ O ₇ -10H ₂ O, 0.4 g of CuSO ₄ -5H ₂ O, 1.2 g of FeSO ₄ -7H ₂ O, 0 , 7 g of MnSO ₄ -H ₂ O, 0.8 g of Na ₂ MoO ₂ -2H ₂ O, 10 g of ZnSO ₄ -7H ₂ O and deionized water per liter.
The LB plates were composed of 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, 15 g of agar and deionized water per liter.
SOC medium was composed of 2% tryptone, 0.5% extract
109 yeast, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ and 10 mM MgSO ₄ ; sterilized by autoclave and then filter sterilized glucose was added to 20 mM.
The YPM medium was composed of 1% yeast extract, 2% Bacto peptone and 2% maltose.
The minimum medium plates were composed of 6 g of NaNO ₃ , 0.52 of KC1, 1.52 g of KH2PO4, 1 ml of COVE trace metal solution, 20 g of Noble agar, 20 ml of 50% glucose, 2, 5 ml of 20% MgSO4'7H ₂ O, 20 ml of the stock solution of biotin and deionized water per liter.
The biotin stock solution was comprised of a 0.2 g liter of biotin.
The COVE trace metallic solution was composed of 0.04 g of Na ₂ B4O ₇ -10H ₂ O, 0.4 g of CuSO ₄ -5H ₂ O, 1.2 g of FeSO ₄ -7H ₂ O, 0.7 g of MnSO ₄ -H ₂ O, 0.8 g of Na ₂ MoO ₂ H ₂ O, 10 g of ZnSO ₄ -7H ₂ O and deionized water per liter.
Example 1: Preparation of the mycelium of the Penicillium pinophilum strain
Compound samples were collected from Yunnan, China on December 12, 2000. Penicillium pinophilum NN046877 was isolated using simple spore isolation techniques on PD As plates at 45 ° C. The strain Penicillium pinophilum NN046877 was inoculated on a plate PDA and incubated for 4 days at 37 ° C in the dark. PDA buffers from several mycelia were inoculated into 500 ml of shake flasks containing 100 ml of the NNCYP-PCS medium. The flasks were incubated for 5 days at 37 ° C with shaking at 160 rpm. Mycelia were collected on day 4 and day 5. Mycelia each day were frozen in liquid nitrogen and stored in a -80 ° C freezer until use.
Example 2: Isolation of RNA from the strain Penicillium pinophilum
110
The frozen mycelia were transferred in a pestle cooled by liquid nitrogen and crushed into a fine powder. Total RNA was prepared from the mycelium in powder form each day by extraction with the TRIZOL ™ reagent (Invitrogen Corporation, Carlsbad, CA, USA). The polyA-enriched RNA was isolated using a total mTRAP kit (Active Motif, Carlsbad, CA, USA).
Example 3: Construction of a Penicillium pinophilum strain cDNA library
The double stranded cDNA for each day was synthesized with a SMART ™ cDNA library construction kit (Clontech Laboratories, Inc., Mountain View, CA, USA). The cDNA was cleaved with Sfi I and the cDNA was fractionated by size in 0.8% agarose gel electrophoresis using 44 mM Tris base, 44 mM boric acid, 0.5 mM EDTA buffer (TBE). The 500 bp and greater cDNA fraction was taxed from the gel and purified using a gel group purification kit and GFX® PCR DNA (GE Healthcare, United Kingdom) according to the manufacturer's instructions. Then equal amounts of cDNA from day 4 and day 5 were joined for the construction of the library.
The joined cDNA was then directionally cloned by the Sfi I ligation cleaved by pMHas7 (WO 2009/037253) using T4 ligase (New England Biolabs, Inc., Beverly, MA, USA) according to the manufacturer's instructions. The ligation mixture was electroporated into the E. coli ELECTROMAX ™ DH10B ™ cell (Invitrogen Corp., Carlsbad, CA, USA) using a GENE PULSER® and pulse controller (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 25 pF, 25 mAmp, 1.8 kV with a 1 mm slotted crucible according to the manufacturers' procedure.
The electroporated cells were placed on LB plates supplemented with 50 mg kanamycin per liter. A cDNA tool was prepared from 60,000 total pMHas7 vector ligation transformants
111 original. Plasmid DNA was prepared directly from the colony group using a QIAGEN® plasmid kit (QIAGEN Inc., Valencia, CA, USA).
Example 4: Construction of a SigA4 transposon containing the β-lactamase reporter gene
A transposon-containing plasmid designed by pSigA4 was constructed from the pSigA2 transposon containing the plasmid described in WO 2001/77315 in order to create an enhanced version of the pSigA2 signal trapping transposon with the diminished selection rationale. The pSigA2 transposon contains a minor signal beta-lactamase construct encoded in the transposon itself. PCR was used to create a deletion of the intact beta lactamase gene observed in the plasmid structure using a PROOFSTART ™ louse-proof Pfu Turbo polymerase (QIAGEN GmbH Corporation, Hilden, Germany) and the following 5 'phosphorylated primers (TAG Copenhagen, Denmark) :
SigA2NotU-P: 5’-TCGCGATCCGTTTTCGCATTTATCGTGAAACGCT-3 ’(SEQID NO: 3)
SigA2NotD-P: 5’-CCGCAAACGCTGGTGAAAGTAAAAGATGCTGAA-3 ’(SEQ ID NO: 4)
The amplification reaction was composed of 1 μΐ of pSigA2 (10 ng / μΐ), 5 μΐ of 10X PROOFSTART ™ buffer (QIAGEN GmbH Corporation, Hilden, Germany), 2.5 μΐ of dNTP mixture (20 mM), 0.5 μΐ of SigA2NotU-P (10 mM), 0.5 μΐ of SigA2NotD-P (10 mM), 10 μΐ of Q solution (QIAGEN GmbH Corporation, Hilden, Germany) and 31.25 μΐ of deionized water. A DNA ENGINE ™ thermal cycler (MJ Research Inc., Waltham, MA, USA) was used for programmed amplification per cycle at 95 ° C for 5 minutes; and 20 cycles each at 94 ° C for 30 seconds, 62 ° C for 30 seconds and 72 ° C for 4 minutes.
A reaction product at 3.9 kb PCR was isolated by 0.8%
112 agarose gel electrophoresis using 40 mM Tris base-20 mM sodium acetate -1 mM sodium EDTA buffer (TAE) and 0.1 pg ethidium bromide per ml. The DNA group was visualized with the help of an EAGLE EYE® imaging system (Stratagene, La Jolla, CA, USA) at 360 nm. The 3.9 kb DNA group was taxed from the gel and purified using a GFX® PCR DNA and gel group purification kit according to the manufacturer's instructions.
The 3.9 kb fragment was self-ligated at 16 ° C overnight with 10 units of T4 DNA ligase (New England Biolabs, Inc., Beverly, MA, USA), 9 μΐ of the 3.9 kb PCR fragment and 1 μΐ of 10 X binding buffer (New England Biolabs, Inc., Beverly, MA, USA). The bond was heat inactivated for 10 minutes at 65 ° C and then digested with Dpn I at 37 ° C for 2 hours. After incubation, digestion was purified using a GFX® PCR DNA and gel group purification kit.
The purified material was then transformed into competent E. coli TOP 10 cells (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instructions. The transformation mixture was placed on LB plates supplemented with 25 pg of chloramphenicol per ml. The minipreps plasmids were prepared from various transformants and digested with Bgl II. A plasmid with the correct construction was chosen. The plasmid was indicated by pSigA4. Plasmid pSigA4 contains the transposon flanked by Bgl II SigA2 identical to that disclosed in WO 2001/77315.
A 60 μΐ sample of plasmid pSigA4 DNA (0.3 pg / μΐ) was digested with Bgl II and separated by 0.8% agarose gel electrophoresis using TBE buffer. A 2 kb SigA2 transposon DNA group was eluted with 200 μΐ of EB buffer (QIAGEN GmbH Corporation, Hilden, Germany) and purified using a GFX® PCR DNA and Gel Group Purification Kit according to the instructions in the manufacturer and eluted in 200 μΐ of EB buffer. SigA2 was used for signal trapping assisted by transposon.
113
Example 5: Transposon-assisted signal trapping of the Penicillium pinophilum strain
A complete description of transposon-assisted signal trapping is described in WO 2001/77315. The plasmid group was treated with the transposon SigA2 and HYPERMU ™ transposase (EPICENTRE Biotechnologies, Madison, WI, USA) according to the manufacturer's instructions.
For the in vitro transposon trapping of the Penicillium pinophilum cDNA library, 2 μΐ of SigA2 transposon containing approximately 100 ng of DNA was mixed with 1 μΐ of DNA from the plasmid group of the Penicillium pinophilum cDNA library containing 1 pg of DNA, 1 μΐ of DNA HYPERMU ™ transposase and 2 μΐ of 10X buffer (EPICENTRE Biotechnologies, Madison, WI, USA) in a total volume of 20 μΐ and incubated at 30 ° C for 3 hours followed by the addition of 2 μΐ of interruption buffer (EPICENTRE Biotechnologies, Madison, WI, USA) and heat inactivated at 75 ° C for 10 minutes. The DNA was precipitated by the addition of 2 μΐ of 3 M sodium acetate pH 5 and 55 μΐ of 96% ethanol and centrifuged for 30 minutes at 10,000 xg, 4 ^o C. The granule was washed in 70% ethanol, dried in air at room temperature and resuspended in 10 μΐ deionized water.
A 2 μΐ volume of the transposon-labeled plasmid group was electroporated into 50 μΐ of the E. coli ELECTROMAX ™ DH10B ™ cells (Invitrogen Corp., Carlsbad, CA, USA) according to the manufacturer's instructions using a GENE PULSER® and pulse controller at 25 pF, 25 mAmp, 1.8 kV with a 1 mm slotted crucible according to the manufacturer's procedures.
The cells submitted to electroporation were incubated in SOC medium with agitation at 225 rpm for 1 hour at 37 ° C before being placed in the following selective medium: the LB medium supplemented with 50 pg of kanamycin.
114 per ml; LB medium supplemented with 50 pg of kanamycin per ml and 15 pg of chloramphenicol per ml; and LB medium supplemented with 50 pg of kanamycin per ml, 15 pg of chloramphenicol per ml and 30 pg of ampicillin per ml.
After placing the electroporation in the LB medium supplemented with kanamycin, chloramphenicol and ampicillin, approximately 200 colonies per 50 pl were observed after 3 days at 30 ° C. All colonies were replicated placed in the LB medium with kanamycin, chloramphenicol and ampicillin described above . Five hundred colonies were recovered under this selection condition. The DNA from each colony was sequenced with the advanced transposon and the reverse primers (primers A and B), shown below, according to the procedure disclosed in WO 2001/77315 (page 28).
Initiator A:
5’-agcgtttgcggccgcgatcc-3 ’(SEQ ID NO: 5)
Initiator B:
5’-ttattcggtcgaaaaggatcc-3 ’(SEQ ID NO: 6)
Example 6: Assembly of sequence annotation
DNA sequences were obtained from SinoGenoMax Co., Ltd (Beijing, China). Primer A and primer B read for each plasmid were presented to remove the vector and transposon sequence. The assembled sequences were grouped into contigs using the PhredPhrap program (Ewing et al., 1998, Genome Research 8: 175-185; Ewing and Green, 1998, Genome Research 8: 186-194). All contigs were subsequently compared to the sequences available in the standard public DNA and protein sequence database (TrEMBL, SWALL, PDB, EnsemblPep, GeneSeqP) using the BLASTX 2, 0al9MP-WashU program [14-Jul-1998] [Build linux-x86 18:51:44 30-Jul-1998] (Gish et al., 1993, Nat. Genet. 3: 266-72). The xylanase candidate from the GH10 family was identified directly by analyzing the BlastX results.
115
Example 7: Preparation of genomic DNA from Penicillium pinophilum NN046877
Penicillium pinophilum NN046877 was developed on a PDA agar plate at 37 ° C for 4 to 5 days. The mycelia were collected directly from the agar plate in a sterile pestle and frozen by liquid nitrogen. The frozen mycelia were crushed into a fine powder by the pestle and genomic DNA was isolated using a DNEASY® Plant Mini kit (QIAGEN Inc., Valencia, CA, USA).
Example 8: Cloning of the Penicillium 10 pinophilum xylanase gene from genomic DNA
Based on information from the Penicillium pinophilum GH10 xylanase gene obtained as described in Example 6, oligonucleotide primers, shown below, were designed to amplify the GH10 xylanase gene from the genomic DNA of Penicillium pinophilum 15 NN046877. An IN-FUSION® CF Dry-down cloning kit (Clontech
Laboratories, Inc., Mountain View, CA, USA) was used to directly clone the fragment into the pPFJO355 expression vector, without the need for restriction digestion and ligation.
Sense initiator:
5'ACACAACTGGGGATCCACCATGACTCTAGTAAAGGCTATTCTTTTA GC-3 '(SEQ ID NO: 7)
Anti-sense initiator:
5’25 GTCACCCTCTAGATCTTCAC AAACATTGGGAGTAGTATGG-3 ’(SEQ
IDNO.-8)
The bold letters represent the coding sequence and the remaining sequence was homologous to the pPFJO355 insertion sites.
The pPFJO355 expression vector contains the amylase promoter
116
Aspergillus oryzae TAKA-, Aspergillus niger glycoamylase terminator elements, sequences derived from pUC19 for the selection and propagation in E. coli and a pyrG gene, which encodes an Aspergillus nidulans orotidine decarboxylase for the selection of a pyr mutant Aspergillus strain transformant.
Twenty picomols from each of the above primers were used in a PCR reaction composed of Penicillium pinophilum genomic DNA NN046877, 10 μΐ of 5X GC buffer (Finnzymes Oy, Espoo, Finland), 1.5 μΐ of DMSO, 2.5 mM each of dATP, dTTP, dGTP and dCTP and 0.6 unit of PHUSION ™ High-Fidelity DNA Polymerase (Finnzymes Oy, Espoo, Finland), in a final volume of 50 μΐ. Amplification was performed using a Peltier thermal cycler (MJ Research Inc., South San Francisco, CA, USA) programmed by denaturation at 98 ° C for 1 minutes; 5 cycles of denaturation at 98 ° C for 15 seconds, subjected to annealing at 56 ° C for 30 seconds, with an increase of I ^o C per cycle and elongation at 72 ° C for 75 seconds; 25 cycles each at 98 ° C for 15 seconds, 65 C for 30 seconds and 72 ° C for 75 seconds; and a final extension at 72 ° C for 10 minutes. The heat block was then in a soaked cycle at 4 ^o C.
The reaction products were isolated by 1.0% agarose gel electrophoresis using TBE buffer where a product group of approximately 1.4 kb was taxed from the gel and purified using an ILLUSTRA® GFX® PCR DNA and kit group purification gel (GE Healthcare, Buckinghamshire, UK) according to the manufacturer's instructions.
Plasmid pPFJO355 was digested with Bam I and Bgl II, isolated by 1.0% agarose gel electrophoresis using TBE buffer and purified using an ILLUSTRA® GFX® PCR DNA and gel group purification kit according to manufacturer's instructions.
The gene fragment and the digested vector were linked together
117 using a PCRIN-FUSION® CF Dry-down cloning kit resulting in pPpin3 (Figure 1) where the transcription of the Penicillium pinophilum GH10 xylanase gene is under the control of the Aspergillus oryzae TAKA alpha-amylase promoter. Soon, 30 ng of pPFJO355 digested with Bam I and Bgl II and 60 ng of the xylanase gene Penicillium pinophilum GH10 purified by the PCR product were added by a reaction flask and resuspended in a final volume of 10 μΐ with the addition of water deionized. The reaction was incubated at 37 ° C for 15 minutes and then 50 ° C for 15 minutes. Three μΐ of the reaction was used to transform competent E. coli ΤΘΡ10 cells (TIANGEN Biotech Co. Ltd., Beijing, China). An E. coli transformants containing pPpin3 was detected by the PCR colony and plasmid DNA was prepared using a QIAprep Spin Miniprep kit (QIAGEN Inc., Valencia, CA, USA). The insertion of the Penicillium pinophilum GH10 xylanase gene into pPpin3 was confirmed by DNA sequencing using a 3730XL DNA analyzer (Applied Biosystems Inc, Foster City, CA, USA).
The same PCR fragment was cloned into the pGEM-T vector (Promega Corporation, Madison, WI, USA) using a pGEM-T vector system (Promega Corporation, Madison, WI, USA) to generate pGEM-TPpin3. The Penicillium pinophilum GH10 xylanase gene contained in pGEMT-Ppin3 was confirmed by DNA sequencing using a 3730XL DNA analyzer. The E. coli strain 059157T-Ppin3 (NN059157), containing pGEM-T-Ppin3, was deposited with the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSM), D-38124 Braunschweig, Germany on September 7, 2009 and indicates the number of accession DSM 22922.
Example 9: Characterization of the genomic sequence Penicillium pinophilum that encodes a GH10 polypeptide having xylanase activity
DNA sequencing of the genomic clone Penicillium pinophilum encoding a GH10 polypeptide having xylanase activity was
118 performed with an automatic DNA sequencer model Biosystems Model 3700 applied using terminator chemistry version 3.1 BIG-DYE ™ (Applied Biosystems, Inc., Foster City, CA, USA) and dGTP chemistry (Applied Biosystems, Inc., Foster City, CA , USA) and initiator walking strategy. The nucleotide sequence data was examined for quality and all sequences were compared in each other with assistance from PHRED / PHRAP software (University of Washington, Seattle, WA, USA).
The nucleotide sequence (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO: 2) of the Penicillium pinophilum ghlO gene are shown in Figures 2A and 2B. The coding sequence is 1442 bp including the interruption codon and is interrupted by three introns of 51 bp (nucleotides 199-249), 73 bp (nucleotides 383-455) and 94 bp (nucleotides 570-663). The predicted encoded protein is 407 amino acids. The% G + C of the gene coding sequence (including introns) is 47.99% G + C and the mature polypeptide coding sequence is 49.22%. Using the SignalP program (Nielsen et al., 1997, Protein Engineering 10: 1-6), a 19-residue signal peptide was predicted. The predicted mature protein contains 388 amino acids with a predicted molecular mass of 41.5 kDa and an isoelectric point of 5.03.
A global alignment of formation in comparative pairs of amino acid sequences was determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443453) as implemented in the EMBOSS Needle program with gap-opening penalty of 10, crack extension penalty of 0.5 and the EBLOSUM62 matrix. The alignment showed that the deduced amino acid sequence of the Penicillium pinophilum gene encoding the GH10 polypeptide having xylanase activity forming 76% and 87% identity (excluding slits) the deduced amino acid sequence of the GH10 family protein predicted from Talaromyces emersonii ( AAU99346) and Penicillium
119 marneffei (B6QN64), respectively.
Example 10: Expression of the Penicillium pinophilum GH10 xylanase gene in Aspergillus oryzae
The Aspergillus oryzae HowBlOl protoplasts (WO 95/35385 Example 1) were prepared according to the method of Christensen et al., 1988, Bio / Technology 6: 1419-1422 and transformed with 3 pg of pPpin3. the transformation produced about 50 transformants. Twelve transformants were isolated on the individual minimal medium plates.
Four transformants were separately inoculated in 3 ml of the YPM medium in a 24 well plate and incubated at 30 ° C with shaking at 150 rpm. After 3 days of incubation, 20 μΐ of supernatant from each culture was analyzed by SDS-PAGE using a NUPAGE® NOVEX® 4-12% Bis-Tris gel with 2- (N-morpholino) ethanesulfonic acid (MES) (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's instructions. The resulting gel was stained with INSTANT® Blue (Expedeon Ltd., Babraham Cambridge, UK). The SDS-PAGE profiles of the cultures showed that most transformants have a larger group of approximately 55 kDa. The expression strain was indicated Aspergillus oryzae EXP02765.
The slope of Aspergillus oryzae EXP02765 was washed with 10 ml of YPM and inoculated in a 2 liter flask containing 400 ml of the YPM medium to generate the broth for the characterization of the enzyme. The culture was collected on day 3 and filtered using a 0.45 pm DURAPORE® membrane (Millipore, Bedford, MA, USA).
Example 11: Purification of recombinant Penicillium pinophilum GH10 xylanase from Aspergillus oryzae
A 1 liter volume of filtered broth from the Aspergillus oryzae EXP02765 strain was precipitated with ammonium sulfate (80% saturation) and dissolved again in 50 ml of 25 mM sodium acetate pH 4.3 and then
120 dialyzed against the same buffer and filtered through a 0.45 mm filter. The solution was applied to a 40 ml Q SEPHAROSE ™ rapid flow column (GE Healthcare, Buckinghamshire, UK) equilibrated in 25 mM sodium acetate pH 4.3. The recombinant GH10 protein does not bind to the column. Fractions with xylanase activity were collected and evaluated by SDS-PAGE as described in Example 10. Fractions containing a group of approximately 55 kDa were joined. The combined solution was concentrated by ultrafiltration.
Example 12: Evaluation of Penicillium pinophilum GH10 xylanase in PCS hydrolysis
Corn forage was pretreated at the U.S. Department of Energy National Renewable Energy Laboratory (NREL) using diluted sulfuric acid. The following conditions were used for the pretreatment: 0.048 g sulfuric acid / g dry biomass at 190 ° C and 25% dry solids w / w in about 1 minute. The water-insoluble solids in pre-treated corn forage (PCS) contain 52% cellulose, 3.6% hemicellulose and 29.8% lignin. Cellulose and hemicellulose were determined by a two-stage sulfuric acid hydrolysis with subsequent analysis of sugars by high performance liquid chromatography using standard analytical procedure NREL # 002. Lignin was determined gravimetrically after hydrolyzing the cellulose and hemicellulose fractions with sulfuric acid using standard analytical procedure NREL # 003. Before enzymatic hydrolysis, the PCS was ground (Multi Utility Grinder, Inno Concepts Inc., GA, USA) and sieved through a 450 µm evaluation (Retsch AS200).
Penicillium pinophilum GH10 xylanase was expressed and purified as described in Examples 10 and 11. Protein concentration was determined by SDS-PAGE using an 8 to 16% CRITERION® SDS-PAGE gel (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and a system
121 CRITERION® pigment-free image (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
The synergistic effects between xylanase Penicillium pinophilum GH10 and a cellulolytic enzyme preparation Trichoderma reesei SaMeMF268 (WO 2008/151079) were determined using 1 gram crushed, non-washed PCS hydrolysis assay (GS-PCS) at 50 ° C, pH 5. Penicillium pinophilum GH10 xylanase (0.6 mg / g cellulose) was added to the cellulolytic enzyme preparation Trichoderma reesei SaMe-MF268 (3 mg / g cellulose), giving a total load of 3.6 mg protein / g cellulose. The total insoluble solids loads of GS-PCS were 50 g / L (in 50 mM sodium acetate buffer pH 5.0 containing 1 mM manganese sulfate). The total reaction volume was 1.0 ml in 96 well plates. The tests were performed in duplicates. After 72 hours of incubation at 50 ° C, the supernatants were removed and filtered through a 0.45 pm 96 well filter plate (Millipore, Bedford, MA, USA), diluted 2 times in 5 mM H ₂ SO ₄ and analyzed by AMINEX® HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using an AGILENT® 1100 HPLC (Agilent Technologies, Santa Clara, CA, USA) and refractive index detection. The hydrolysis data are presented as% of the total cellulose converted to glucose. The degree of conversion of cellulose to reduce sugar was calculated using the following equation: Conversion ₍ o _{/ o)} = RS _(mg / _m i) * 100 * 162 / (Cellulose (mg / mi) * 180) = RS _{(mg / ml)} * 100 / (Cellulose (^ ΐ) * 1,111)
In this equation, RS is a concentration of sugar reduction in the solution measured in the glucose equivalents (mg / ml) and the factor 1,111 reflects the weight gain in the conversion of cellulose to glucose.
PCS hydrolysis by Penicillium pinophilum GH10 xylanase (0.6 mg / g cellulose) and the cellulolytic enzyme preparation Trichoderma reesei SaMe-MF268 (3 mg / g cellulose) produced a conversion of
122 cellulose of 65.8% after 72 hours, while the hydrolysis PCS by the preparation of cellulolytic enzyme Trichoderma reesei SaMe-MF268 to 3.6 mg / g of cellulose produced a cellulose conversion of 61.7%, indicating that Penicillium xylanase pinophilum GH10 supplemented has a synergistic effect with the preparation of cellulolytic enzyme Trichoderma reesei SaMe-MF268 in PCS hydrolysis at 50 ° C, pH 5.0.
Example 13: Characterization of Penicillium pinophilum GH10 xylanase
Specific activity. The specific activity of Penicillium pinophilum GH10 xylanase was subjected to testing on birch wood xylan (Sigma Chemical Co., St. Louis, MO, USA). A birch wood xylan solution (2 g / L) was prepared in 50 mM sodium acetate pH 5.0 containing 0.01% TWEEN® 20. Ten microliters of Penicillium pinophilum GH10 xylanase (in different loads) were added to 190 μΐ of the birch wood xylan solution. Substrate control and enzyme control were included. The reaction was incubated at 50 ° C for 30 minutes followed by 50 μΐ of 0.5 M NaOH to stop the reaction.
The reducing sugars produced were determined using a parahydroxybenzoic acid hydrazide assay (PHBAH, Sigma, St. Louis, MO, USA) adapted to a 96 well microplate format as described below. Briefly, a 100 μΐ aliquot of an appropriately diluted sample was placed in a 96 well conical deep-bottom microplate. The reactions were initiated by adding 50 μΐ of 1.5% (w / v) PHBAH in 2% NaOH to each reservoir. The plates were heated uncoated to 95 ° C for 10 minutes. The plates were allowed at room temperature (RT) and 50 μΐ of distilled water added to each reservoir. A 100 μΐ aliquot from each reservoir was transferred to a 96-well flat-bottom plate and the
123 absorbance at 410 nm measured using a SPECTRAMAX® microplate reader (Molecular Devices, Sunnyvale, CA, USA). Glucose standards (0.1 to 0.0125 mg / ml diluted with 0.4% sodium hydroxide) were used to prepare a standard curve to translate the A ₄ i _0nm values obtained into glucose equivalents. The enzyme loading versus the reducing sugars produced was plotted and the linear range was used to calculate the specific xylanase activity Penicillium pinophilum GH10, as expressed as pmole of glucose equivalent produced per minute per mg of enzyme, or IU / mg. The specific activity of Penicillium pinophilum GH10 xylanase in birch wood xylan was measured as an enzyme 113.5 IU / mg.
Thermostability. Penicillium pinophilum GH10 xylanase was diluted in 50 mM sodium acetate pH 5 containing 0.01% TWEEN® 20 at 1 g per liter and then incubated at 60 ° C for 3 hours or 24 hours. The same sample was also stored at 4 ^o C to serve as a control. After incubation, the activity of the samples in birch wood xylan was measured using the same assay protocol described above for the specific activity, except an enzyme loading was used which gives <5% conversion. The activity of the sample at 4 ^o C was normalized to 100% and the activities of the samples in other incubation conditions were compared to activity 4 ^o C. The thermostability of xylanase Penicillium pinophilum GH10 is shown below indicating that the enzyme retained 100% of this activity after incubation at 60 ° C for 3 hours and 83% of its activity after incubation at 60 ° C for 24 hours.
Incubation condition Residual activity in birch wood xylan 4 ^o C 100% 60 ° C, 3 hours 100% 60 ° C, 24 hours 83%
PH profile. The pH activity of Penicillium pinophilum GH10 xylanase was determined using the same assay protocol
124 described above for the specific activity, except the enzyme was incubated at five different pHs of 4, 5, 6, 7 and 8 and an enzyme load was used which gives less than 5% conversion. Britton Robinson buffer was used as the buffer system. To prepare the Britton Robinson buffer, a 100 mM stock solution was prepared containing 0.1 mol of boric acid, 0.1 mol of acetic acid and 0.1 mol of phosphoric acid per liter of deionized water. The 100 mM stock solution was then titrated to a pH of 4, 5, 6, 7, or 8 using 5 M NaOH and then diluted to 40 mM. Birch wood xylan was added to each buffer at a concentration of 2 g per liter and the activity was measured at 50 ° C. The greater activity was normalized to 100% and activities at other pH values were compared to greater activity and expressed in% of activity. The pH activity profile of Penicillium pinophilum GH10 xylanase is shown below.
PH value Activity 4.0 100% 5.0 78% 6.0 62% 7.0 19% 8.0 0%
Deposit of biological material
The following biological material was deposited under the terms of
Budapest Treaty with the Deutsche Sammlung von Mikroorganismen and
Zellkulturen GmbH (DSM), Mascheroder Weg 1 B, D-38124 Braunschweig,
Germany and given the following accession number:
Deposit Accession number Deposit date E. coli (NN059157) DSM 22922 September 7, 2009
The strain was deposited under conditions that guarantee that access to the crop will be available during the pending of the Patent Application to one determined by the foreign Patent laws to be titled therein. The deposit represents a substantially pure culture of the deposited strain. The deposit is available as required by foreign patent laws in countries where the individual application counterparties, or their progenies
125 are deposited. However, it must be understood that the availability of a deposit does not constitute a license to practice individual invention to the detriment of Patent rights guaranteed by government action.
The present invention is described by the following numbered paragraphs:
[1] An isolated polypeptide having xylanase activity, selected from the group consisting of: (a) a polypeptide comprising an amino acid sequence having at least 90% identity to the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide that hybridizes under very high stringency conditions to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a polypeptide coding sequence mature from SEQ ID NO: 1 or (iii) a complementary filament of full length of (i) or (ii); (c) a polypeptide encoded by a polynucleotide comprising a nucleotide sequence having at least 90% identity to a mature polypeptide coding sequence of SEQ ID NO: 1 and (d) a variant comprising a substitution, deletion and / or insertion of one or more (several) amino acids of the mature polypeptide of SEQ ID NO: 2.
[2] The polypeptide of paragraph 1, which comprises an amino acid sequence having at least 90% identity to the mature polypeptide of SEQ ID NO: 2.
[3] The polypeptide of paragraph 2, which comprises an amino acid sequence having at least 95% identity to the mature polypeptide of SEQ ID NO: 2.
[4] The polypeptide of paragraph 3, which comprises an amino acid sequence having at least 97% identity to the mature polypeptide of SEQ ID NO: 2.
[5] The polypeptide of paragraph 1, which comprises or consists of
126 of the amino acid sequence of SEQ ID NO: 2 or a fragment thereof having xylanase activity.
[6] The polypeptide of paragraph 5, which comprises or consists of the amino acid sequence of SEQ ID NO: 2.
[7] The polypeptide of paragraph 5, which comprises or consists of the mature polypeptide of SEQ ID NO: 2.
[8] The polypeptide of paragraph 1, which is encoded by a polynucleotide that hybridizes under very high stringency conditions to (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) the cDNA sequence contained in a mature polypeptide coding sequence of SEQ ID NO: 1 or (iii) a complementary strand of full length of (i) or (ii).
[9] The polypeptide of paragraph 1, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 90% identity to a mature polypeptide coding sequence of SEQ ID NO: 1.
[10] The polypeptide of paragraph 9, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 95% identity to a mature polypeptide coding sequence of SEQ ID NO: 1.
[11] The polypeptide of paragraph 10, which is encoded by a polynucleotide comprising a nucleotide sequence having at least 97% identity to a mature polypeptide coding sequence of SEQ ID NO: 1.
[12] The polypeptide of paragraph 1, which is encoded by a polynucleotide that comprises or consists of a nucleotide sequence of SEQ ID NO: 1 or a subsequence thereof that encodes a fragment having xylanase activity.
[13] The polypeptide in paragraph 12, which is encoded by a
127 polynucleotide that comprises or consists of a nucleotide sequence from SEQIDNOil.
[14] The polypeptide of paragraph 12, which is encoded by a polynucleotide that comprises or consists of a mature polypeptide coding sequence of SEQ ID NO: 1.
[15] The polypeptide of paragraph 1, wherein the polypeptide is a variant that comprises a substitution, deletion and / or insertion of one or more (several) amino acids from the mature polypeptide of SEQ ID NO: 2.
[16] The polypeptide of paragraph f which is encoded by the polynucleotide contained in plasmid pGEM-T-Ppin3 which is contained in E. coli DSM 22922.
[17] The polypeptide according to any of paragraphs 1 to 16, wherein the mature polypeptide is amino acids 20 to 407 of SEQ ID NO: 2.
[18] The polypeptide according to any of paragraphs 1 to 17, wherein the mature polypeptide sequence is nucleotides 58 to 1439 of SEQ ID NO: 1.
[19] An isolated polynucleotide that comprises a nucleotide sequence that encodes the polypeptide according to any of paragraphs 1 through 18.
[20] The polynucleotide isolated from paragraph 19, which comprises at least one mutation in a mature polypeptide coding sequence of SEQ ID NO: 1, wherein the mutant nucleotide sequence encodes the mature polypeptide of SEQ ID NO: 2.
[21] A nucleic acid construct comprising polynucleotides of paragraph 19 or 20 operably linked to one or more (several) control sequences that direct the production of the polypeptide in an expression host.
[22] A recombinant expression vector that comprises the
128 nucleic acid construction of paragraph 21.
[23] A recombinant host cell comprising the nucleic acid construct of paragraph 21.
[24] A method for producing the polypeptide according to any of paragraphs 1 through 18, which comprises: (a) cultivating a cell, which in its wild type produces the polypeptide, under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide.
[25] A method for producing the polypeptide according to any of paragraphs 1 through 18, which comprises: (a) cultivating a host cell comprising a nucleic acid construct comprising a nucleotide sequence encoding the polypeptide under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide.
[26] A method of producing a precursor cell mutant, which comprises interrupting or canceling a polynucleotide encoding the polypeptide or a portion thereof, according to any of paragraphs 1 through 18, which results in the production of a mutant less than polypeptide other than the precursor cell.
[27] A mutant cell produced by the method of paragraph 26.
[28] The mutant cell in paragraph 27, which still comprises a gene that encodes a natural or homologous protein.
[29] A method of producing a protein, which comprises: (a) growing a paragraph 28 mutant cell under conditions conducive to the production of the protein and (b) recovering the protein.
[30] The polynucleotide isolated from paragraph 19 or 20, obtained by (a) hybridizing a population of DNA under very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1, (ii) a cDNA sequence contained in a coding sequence for
129 mature polypeptide of SEQ ID NO: 1 or (iii) a full length complementary strand of (i) or (ii) and (b) isolating the hybridizing polynucleotide, which encodes a polypeptide having xylanase activity.
[31] The polynucleotide isolated from paragraph 30, where the mature polypeptide sequence is nucleotides 58 to 1439 of SEQ ID NO: 1.
[32] A method of producing a polynucleotide that comprises a mutant nucleotide sequence that encodes a polypeptide having xylanase activity, which comprises: (a) introducing at least one mutation into a mature polypeptide coding sequence of SEQ ID NO: 1, wherein the mutant nucleotide sequence encodes a polypeptide comprising or consisting of the mature polypeptide of SEQ ID NO: 2 and (b) recovering the polynucleotide comprising the mutant nucleotide sequence.
[33] A mutant polynucleotide produced by the method of paragraph 32.
[34] A method of producing a polypeptide, which comprises: (a) culturing a cell comprising a mutant polynucleotide of paragraph 33 that encodes the polypeptide under conditions conducive to the production of the polypeptide and (b) recovering the polypeptide.
[35] A method for producing the polypeptide according to any of paragraphs 1 through 18, comprising: (a) cultivating a transgenic plant or a plant cell comprising a polynucleotide that encodes the polypeptide under conditions conducive to production polypeptide and (b) recovering the polypeptide.
[36] A transgenic plant, plant part or plant cell transformed with a polynucleotide that encodes the polypeptide according to any of paragraphs 1 through 18.
[37] A double-stranded inhibitor molecule (dsRNA) comprising a subsequence of the polynucleotide of paragraph 19 or 20, in
130 that optionally the dsRNA is a siRNA molecule or a miRNA molecule.
[38] The double-stranded inhibitor RNA (dsRNA) molecule of paragraph 37, which is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length .
[39] A method of inhibiting the expression of a polypeptide having xylanase activity in a cell, which comprises administering to the cell or expressing in the cell, a double-stranded RNA (dsRNA) molecule, in which the dsRNA comprises a subsequence of the polynucleotide paragraph 19 or 20.
[40] The method of paragraph 39, wherein the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.
[41] An isolated polynucleotide that encodes a signal peptide that comprises or consists of amino acids 1 to 19 of SEQ ID NO: 2.
[42] A nucleic acid construct comprising a gene that encodes a protein operably linked to the polynucleotide of paragraph 41, wherein the gene is foreign to the polynucleotide that encodes the signal peptide.
[43] A recombinant expression vector that comprises the nucleic acid construct of paragraph 42.
[44] A recombinant host cell comprising the nucleic acid construct of paragraph 42.
[45] A method of producing a protein, comprising: (a) culturing the recombinant host cell of paragraph 44 under conditions conducive to the production of the protein and (b) recovering the protein.
[46] A composition that comprises polypeptide according to any of paragraphs 1 through 18.
[47] A method for degrading or converting a material
131 cellulosic, which comprises: treating the cellulosic material with an enzyme composition in the presence of the polypeptide having xylanase activity according to any of paragraphs 1 through 18.
[48] The method of paragraph 47, in which the cellulosic material is pre-treated.
[49] The method of paragraph 47 or 48, wherein the enzyme composition comprises one or more cellulolytic enzymes selected from the group consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[50] The method according to any of paragraphs 47 to 49, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a hemicellulase, esterase, protease, laccase or peroxidase.
[51] The method according to any of paragraphs 47 to 50, which further comprises recovering degraded cellulosic material.
[52] The method of paragraph 51, in which the degraded cellulosic material is sugar.
[53] The method of paragraph 52, in which sugar is selected from the group consisting of glucose, xylose, mannose, galactose and arabinose.
[54] A method for producing a fermentation product, which comprises: (a) saccharifying a cellulosic material with an enzyme composition in the presence of the polypeptide having xylanase activity according to any of paragraphs 1 through 18; (b) fermenting the saccharified cellulosic material with one or more fermentation microorganisms for the production of the fermentation product and (c) recovering the fermentation fermentation product.
[55] The method of paragraph 54, in which the cellulosic material is pre-treated.
[56] The method of paragraph 54 or 55, wherein the enzyme composition comprises one or more cellulolytic enzymes selected from the group
132 consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[57] The method according to any of paragraphs 54 to 56, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of a hemicellulase, esterase, protease, laccase or peroxidase.
[58] The method according to any of paragraphs 54 to 57, in which steps (a) and (b) are carried out simultaneously in simultaneous saccharification and fermentation.
[59] The method according to any of paragraphs 54 to 58, wherein the fermentation product is an alcohol, organic acid, ketone, amino acid or gas.
[60] A method of fermenting a cellulosic material, which comprises: fermenting the cellulosic material with one or more fermentation microorganisms, in which the cellulosic material is saccharified with an enzyme composition in the presence of the polypeptide having xylanase activity according to any one of paragraphs 1 through 18.
[61] The method of paragraph 60, in which the fermentation of the cellulosic material produces a fermentation product.
[62] The method of paragraph 61, which further comprises recovering the fermentation product from fermentation.
[63] The method according to any of paragraphs 60 to 62, in which cellulosic material is pre-treated before saccharification.
[64] The method according to any of paragraphs 60 to 63, wherein the enzyme composition comprises one or more cellulolytic enzymes selected from the group consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[65] The method according to any of paragraphs 60 to 64, wherein the enzyme composition still comprises one or more enzymes selected from the group consisting of a hemicellulase, esterase,
133 protease, laccase or peroxidase.
[66] The method according to any of paragraphs 60 to 65, wherein the fermentation product is an alcohol, organic acid, ketone, amino acid or gas.
[67] A method for degrading or converting a material containing xylan, which comprises: treating the hemicellulosic material with an enzyme composition in the presence of the polypeptide having xylanase activity according to any of paragraphs 1 through 18.
[68] The method of paragraph 67, in which the material containing xylan is pre-treated.
[69] The method of paragraph 67 or 68, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a xylanase, an acetixyl esterase, a feruloyl esterase, an arabinofuranosidase, an xylosidase, a glucuronidase and a combination of these.
[70] The method according to any of paragraphs 67 to 69, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[71] The method according to any of paragraphs 67 to 70, which further comprises recovering degraded cellulosic material.
[72] A method of producing the fermentation product, which comprises: (a) saccharifying a material containing xylan with an enzyme composition in the presence of the polypeptide having xylanase activity according to any of paragraphs 1 through 18; (b) fermenting the material containing saccharified xylan with one or more fermentation microorganisms for the production of the fermentation product and (c) recovering the fermentation fermentation product.
[73] The method of paragraph 72, in which the material containing
134 xylan is pre-treated.
[74] The method of paragraph 72 or 73, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a xylanase, an acetixyl esterase, a feruloyl esterase, an arabinofuranosidase, an xylosidase, a glucuronidase and a combination of these.
[75] The method according to any of paragraphs 72 to 74, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[76] The method according to any of paragraphs 72 to 75, in which steps (a) and (b) are carried out simultaneously in simultaneous saccharification and fermentation.
[77] The method according to any of paragraphs 72 to 76, wherein the fermentation product is an alcohol, organic acid, ketone, amino acid or gas.
[78] A method of fermenting a material containing xylan, comprising: fermenting the material containing xylan with one or more fermentation microorganisms, in which the cellulosic material is saccharified with an enzyme composition in the presence of the polypeptide having xylanase activity accordingly. with any of paragraphs 1 through 18.
[79] The method of paragraph 78, in which the fermentation of the material containing xylan produces a fermentation product.
[80] The method of paragraph 79, which further comprises recovering the fermentation product from fermentation.
[81] The method according to any of paragraphs 78 to 80, in which the material containing xylan is pre-treated before saccharification.
[82] The method according to any of the paragraphs of
135 to 81, wherein the enzyme composition comprises one or more enzymes selected from the group consisting of a xylanase, an acetixyl esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, a glucuronidase and a combination thereof.
[83] The method according to any of paragraphs 78 to 82, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase, cellobiohydrolase and beta-glucosidase.
[84] The method according to any of paragraphs 78 to 83, wherein the fermentation product is an alcohol, organic acid, ketone, amino acid or gas.
The invention described and claimed here should not be limited in scope by the specific aspects disclosed here, since these aspects are intended as illustrations of various aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. In fact, several modifications of the invention in addition to those shown and described here will become evident to those skilled in the technique of the preceding description. Such modifications are also intended to be within the scope of the appended claims. In the event of a conflict, this disclosure including definitions will control.

权利要求:
Claims (11)
[1]
1. Transgenic microbial host cell, characterized by the fact that it comprises a nucleic acid construct comprising a polynucleotide that encodes a polypeptide having
5 xylanase activity, in which the polynucleotide consists of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQ ID NO: 1.
[2]
2. Transgenic microbial host cell according to claim 1, characterized by the fact that the polypeptide having xylanase activity consists of SEQ ID NO: 2 or amino acids 20 to 407 of SEQ ID
10 NO: 2.
[3]
3. Method for producing a polypeptide having xylanase activity, characterized by the fact that it comprises:
(a) cultivating a transgenic microbial host cell as defined in any one of claims 1-2, or a transgenic plant or a transgenic plant cell comprising a nucleic acid construct comprising a polynucleotide encoding a polypeptide having xylanase activity, in that the polynucleotide consists of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQ ID NO: 1, under conditions suitable for the production of the polypeptide; and
(B) recovering the polypeptide.
[4]
4. Method for degrading or converting a cellulosic material or a material containing xylan, characterized by the fact that it comprises: treating the cellulosic material or the material containing xylan with an enzyme composition in the presence of a polypeptide having activity of
25 xylanase encoded by a polynucleotide consisting of SEQ ID NO: 1, or nucleotides 58 to 1439 of SEQ ID NO: 1.
[5]
Method according to claim 4, characterized in that it additionally comprises recovering the cellulosic material or the material containing degraded xylan.
Petition 870180061048, of 07/16/2018, p. 19/24
[6]
6. Method for producing a fermentation product, characterized by the fact that it comprises:
(a) saccharifying a cellulosic material or a material containing xylan with an enzyme composition in the presence of a polypeptide having xylanase activity encoded by a polynucleotide consisting of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQ ID NO: 1;
(b) fermenting cellulosic material or material containing xylan saccharified with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from fermentation.
[7]
7. Method for fermenting a cellulosic material or material containing xylan, characterized by the fact that it comprises: fermenting the cellulosic material or the material containing xylan with one or more fermenting microorganisms, in which the cellulosic material or the material containing xylan is saccharified with a enzyme composition in the presence of a polypeptide having xylanase activity encoded by a polynucleotide consisting of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQIDNO: 1.
[8]
8. Method according to claim 7, characterized in that the fermentation of the cellulosic material or the material containing xylan produces a fermentation product.
[9]
Method according to claim 8, characterized in that it comprises additionally recovering the fermentation product from the fermentation.
[10]
10. Nucleic acid construction, characterized by the fact that it comprises a polynucleotide having xylanase activity consisting of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQ ID NO: 1
Petition 870180061048, of 07/16/2018, p. 20/24 operationally linked to one or more control sequences that direct the production of the polypeptide in an expression host.
[11]
11. Expression vector, characterized by the fact that it comprises a polynucleotide that encodes a polypeptide having xylanase activity 5 consisting of SEQ ID NO: 1 or nucleotides 58 to 1439 of SEQ
ID NO: 1 operationally linked to one or more control sequences that direct the production of the polypeptide in a transgenic microbial host cell.
Petition 870180061048, of 07/16/2018, p. 21/24
1/3

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20170145395A1|2017-05-25|Polypeptides having Xylanase Activity and Polynucleotides Encoding Same

---

US8431362B2|2013-04-30|Polypeptides having xylanase activity and polynucleotides encoding same

---

US8604277B2|2013-12-10|Polypeptides having beta-glucosidase activity and polynucleotides encoding same

---

US8609933B2|2013-12-17|Polypeptides having feruloyl esterase activity and polynucleotides encoding same

---

US8058513B2|2011-11-15|Polypeptides having feruloyl esterase activity and polynucleotides encoding same

---

US8129591B2|2012-03-06|Polypeptides having xylanase activity and polynucleotides encoding same

---

US8735128B2|2014-05-27|Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same

---

US8071335B2|2011-12-06|Polypeptides having acetylxylan esterase activity and polynucleotides encoding same

---

BR112012000260B1|2020-11-17|transgenic microbial host cell, methods to produce a polypeptide, to produce a mutant of a precursor cell, to inhibit expression of a polypeptide, to produce a protein, to degrade or convert a cellulosic material, to produce a fermentation product, to ferment a cellulosic material, nucleic acid constructs, expression vector, isolated polypeptide having cellulolytic intensification activity, and isolated polynucleotide that encodes the same

---

BRPI1012923B1|2018-10-16|transgenic microbial host cell, methods for producing a polypeptide, for producing a mother cell mutant, for degrading or converting a cellulosic material, for producing a fermentation product, for fermenting a cellulosic material, nucleic acid construct, and, vector of expression

---

US10190103B2|2019-01-29|Polypeptides having glucuronyl esterase activity and polynucleotides encoding same

---

BR112012006982B1|2021-12-21|TRANSGENIC MICROBIAL HOST CELL, METHODS FOR PRODUCING A POLYPEPTIDE, FOR PRODUCING A MUTANT OF A PRECURSOR CELL, FOR INHIBITING THE EXPRESSION OF A POLYPEPTIDE, FOR PRODUCING A PROTEIN, FOR DEGRADING OR CONVERTING A CELLULOSIC MATERIAL, FOR PRODUCING A FERMENTATION PRODUCT, FOR FERMENTING A CELLULOSIC MATERIAL, NUCLEIC ACID CONSTRUCTIONS, EXPRESSION VECTOR, ISOLATED POLYPEPTIDE HAVING CELLULOLYTIC ENHANCEMENT ACTIVITY, ISOLATED POLYNUCLEOTIDE ENCODING THE SAME, AND, DETERGENT COMPOSITION

同族专利:

---

公开号 | 公开日

---

US20120240293A1|2012-09-20|

---

US8299322B2|2012-10-30|

---

US20110078830A1|2011-03-31|

---

EP2483403B1|2017-11-15|

---

CN107338233A|2017-11-10|

---

BR112012006978A2|2015-09-08|

---

US8431362B2|2013-04-30|

---

US8211665B2|2012-07-03|

---

CA2775347A1|2011-04-07|

---

DK2483403T3|2018-02-12|

---

EP2483403A1|2012-08-08|

---

WO2011041405A1|2011-04-07|

---

CN102648276A|2012-08-22|

---

US20130078672A1|2013-03-28|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DK187280A|1980-04-30|1981-10-31|Novo Industri As|RUIT REDUCING AGENT FOR A COMPLETE LAUNDRY|

---

FI87577C|1985-12-03|1993-01-25|Gist Brocades Nv|FOERFARANDE FOER FRAMSTAELLNING AV VOERT OCH OEL MED FOERBAETTRAD FILTRERBARHET OCH / ELLER LAEGRE Viscosite|

---

DK122686D0|1986-03-17|1986-03-17|Novo Industri As|PREPARATION OF PROTEINS|

---

US5776757A|1988-03-24|1998-07-07|Novo Nordisk A/S|Fungal cellulase composition containing alkaline CMC-endoglucanase and essentially no cellobiohydrolase and method of making thereof|

---

JP2728531B2|1988-03-24|1998-03-18|ノボノルディスクアクティーゼルスカブ|Cellulase preparation|

---

US5223409A|1988-09-02|1993-06-29|Protein Engineering Corp.|Directed evolution of novel binding proteins|

---

DK420289D0|1989-08-25|1989-08-25|Novo Nordisk As|METHOD OF TREATING LIGNOCELLULOSE PULP|

---

US5275944A|1989-09-26|1994-01-04|Midwest Research Institute|Thermostable purified endoglucanas from acidothermus cellulolyticus ATCC 43068|

---

US5110735A|1989-09-26|1992-05-05|Midwest Research Institute|Thermostable purified endoglucanase from thermophilic bacterium acidothermus cellulolyticus|

---

US5536655A|1989-09-26|1996-07-16|Midwest Research Institute|Gene coding for the E1 endoglucanase|

---

PT97110B|1990-03-23|1998-11-30|Gist Brocades Nv|PROCESS FOR CATALYSING ACCELERABLE REACTIONS BY ENZYMES, BY ADDING TO THE REACTIONAL MEDIUM OF TRANSGENIC PLANTS SEEDS AND FOR OBTAINING THE REFERED SEEDS|

---

JP3110452B2|1990-05-09|2000-11-20|ノボノルディスクアクティーゼルスカブ|Cellulase preparation comprising endoglucanase enzyme|

---

DK115890D0|1990-05-09|1990-05-09|Novo Nordisk As|ENZYME|

---

DK203490D0|1990-08-24|1990-08-24|Novo Nordisk As|PROCEDURE FOR TREATING LIGNOCELLULOS PULP AND APPARATUS FOR PERFORMING THE PROCESS|

---

IL99552D0|1990-09-28|1992-08-18|Ixsys Inc|Compositions containing procaryotic cells,a kit for the preparation of vectors useful for the coexpression of two or more dna sequences and methods for the use thereof|

---

DE69133035T2|1991-01-16|2003-02-13|Procter & Gamble|Compact detergent compositions with highly active cellulases|

---

DK175391D0|1991-10-18|1991-10-18|Novo Nordisk As|NEW ENZYMER|

---

EP0825254B1|1992-07-02|2001-10-04|Novozymes A/S|Alkalophilic Bacillus sp. AC13 and xylanase obtainable therefrom|

---

EP1431389A3|1992-10-06|2004-06-30|Novozymes A/S|Cellulase variants|

---

AU679211B2|1993-03-10|1997-06-26|Novozymes A/S|Enzymes with xylanase activity from aspergillus aculeatus|

---

JP2807612B2|1993-03-12|1998-10-08|ノボノルディスクアクティーゼルスカブ|Novel xylanase, method for producing the same, pulp treatment method using the xylanase, and method for producing xylo-oligosaccharide|

---

DE4343591A1|1993-12-21|1995-06-22|Evotec Biosystems Gmbh|Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes|

---

US5605793A|1994-02-17|1997-02-25|Affymax Technologies N.V.|Methods for in vitro recombination|

---

EP1632557B1|1994-03-08|2011-02-23|Novozymes A/S|Novel alkaline cellulases|

---

DE69523052T2|1994-06-03|2002-06-20|Novo Nordisk Biotech Inc|PURIFIED MYCELIOPHTHORA LACCASES AND NUCLEIC ACIDS CODING THEM|

---

AT256191T|1994-06-17|2003-12-15|Novozymes As|A MUSHROOM IN WHICH THE AREA GENE IS CHANGED AND AN AREA GENE FROM ASPERGILLUS ORYZAE|

---

EP0777737B1|1994-06-30|2005-05-04|Novozymes Biotech, Inc.|Non-toxic, non-toxigenic, non-pathogenic fusarium expression system and promoters and terminators for use therein|

---

AU3604595A|1994-10-06|1996-05-02|Novo Nordisk A/S|An enzyme and enzyme preparation with endoglucanase activity|

---

CN1165614C|1995-01-26|2004-09-08|诺沃奇梅兹有限公司|Animal feed additives comprising xylanase|

---

CN102080070B|1995-03-17|2016-01-20|诺沃奇梅兹有限公司|new endoglucanase|

---

US6313081B1|1995-04-28|2001-11-06|Henkel Kommanditgesellschaft Auf Aktien |Detergents comprising cellulases|

---

US20030044956A1|1995-08-23|2003-03-06|Short Jay M.|Enzymes having carboxymethyl cellulase activity and methods of use thereof|

---

AU7299796A|1995-10-17|1997-05-07|Rohn Enzyme Finland Oy|Cellulases, the genes encoding them and uses thereof|

---

AU3938997A|1996-08-26|1998-03-19|Novo Nordisk A/S|A novel endoglucanase|

---

CN100362100C|1996-09-17|2008-01-16|诺沃奇梅兹有限公司|Cellulase variants|

---

US6451063B1|1996-09-25|2002-09-17|Genencor International, Inc.|Cellulase for use in industrial processes|

---

US6017870A|1996-10-09|2000-01-25|Genencor International, Inc.|Purified cellulase and method of producing|

---

US7883872B2|1996-10-10|2011-02-08|Dyadic International , Inc.|Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose|

---

US5811381A|1996-10-10|1998-09-22|Mark A. Emalfarb|Cellulase compositions and methods of use|

---

US5989899A|1996-12-23|1999-11-23|Genencor International, Inc.|Oversized cellulase compositions for use in detergent compositions and in the treatment of textiles|

---

EP1002102A1|1997-07-31|2000-05-24|Dsm N.V.|Cellulose degrading enzymes of aspergillus|

---

US5871550A|1997-08-26|1999-02-16|Genencor International, Inc.|Mutant Thermonospora spp. cellulase|

---

WO1999025846A2|1997-11-19|1999-05-27|Genencor International, Inc.|Cellulase produced by actinomycetes and method for producing same|

---

ES2267200T3|1997-11-19|2007-03-01|Genencor International, Inc.|CELLULOSE PRODUCED BY ACTINOMYCETES AND METHOD TO PRODUCE IT.|

---

CA2330245C|1998-06-24|2011-12-20|Genencor International, Inc.|Cellulase producing actinomycetes, cellulase produced therefrom and method of producing same|

---

US6562612B2|1997-11-19|2003-05-13|Genencor International, Inc.|Cellulase producing actinomycetes, cellulase produced therefrom and method of producing same|

---

DE69836227T2|1997-12-16|2007-08-23|Genencor International, Inc., Palo Alto|PROCESS FOR THE PREPARATION OF EGIII-SIMILAR ENZYMES|

---

US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|

---

DK1124949T3|1998-10-26|2006-11-06|Novozymes As|Construction and screening of a DNA library of interest in filamentous fungal cells|

---

US6258590B1|1998-11-02|2001-07-10|Novozymes A/S|Biopreparation of textiles at high temperatures|

---

US6511824B1|1999-03-17|2003-01-28|Exelixis, Inc.|Nucleic acids and polypeptides of invertebrate TWIK channels and methods of use|

---

JP4620253B2|1999-03-22|2011-01-26|ノボザイムス，インコーポレイティド|Promoter for gene expression in fungal cells|

---

AU5279100A|1999-05-19|2000-12-05|Midwest Research Institute|E1 endoglucanase variants y245g, y82r and w42r|

---

US6531644B1|2000-01-14|2003-03-11|Exelixis, Inc.|Methods for identifying anti-cancer drug targets|

---

ES2166316B1|2000-02-24|2003-02-16|Ct Investig Energeticas Ciemat|PROCEDURE FOR THE PRODUCTION OF ETHANOL FROM LIGNOCELLULOSIC BIOMASS USING A NEW THERMOTOLERING YEAST.|

---

EP1276857B1|2000-04-07|2008-06-11|Novozymes A/S|Signal sequence trapping|

---

CA2416801C|2000-07-21|2012-01-03|The Government Of The United States Of America, Represented By The Secre Tary, Department Of Health And Human Services|Adult human dental pulp stem cells in vitro and in vivo|

---

EP1184460A1|2000-08-29|2002-03-06|Dsm N.V.|Modified fungal xylanases|

---

JP4878428B2|2000-09-21|2012-02-15|ベーアーエスエフ・アクチエンゲゼルシャフト|Talalomyces xylanase|

---

JP2004518413A|2000-10-12|2004-06-24|エクセリクシス・インコーポレイテッド|Human ECT2 and usage|

---

US7151204B2|2001-01-09|2006-12-19|Monsanto Technology Llc|Maize chloroplast aldolase promoter compositions and methods for use thereof|

---

JP2004527261A|2001-05-18|2004-09-09|ノボザイムスアクティーゼルスカブ|Polypeptide having cellobiase activity and polynucleotide encoding the same|

---

US6982159B2|2001-09-21|2006-01-03|Genencor International, Inc.|Trichoderma β-glucosidase|

---

US7005289B2|2001-12-18|2006-02-28|Genencor International, Inc.|BGL5 β-glucosidase and nucleic acids encoding the same|

---

US7056721B2|2001-12-18|2006-06-06|Genencor International, Inc.|EGVI endoglucanase and nucleic acids encoding the same|

---

US7045332B2|2001-12-18|2006-05-16|Genencor International, Inc.|BGL4 β-glucosidase and nucleic acids encoding the same|

---

US7045331B2|2001-12-18|2006-05-16|Genencor International, Inc.|EGVII endoglucanase and nucleic acids encoding the same|

---

US7049125B2|2001-12-18|2006-05-23|Genencor International, Inc.|EGVIII endoglucanase and nucleic acids encoding the same|

---

CA2474033C|2002-01-23|2013-06-04|Royal Nedalco B.V.|Fermentation of pentose sugars|

---

EP2305801B1|2002-08-16|2017-07-05|Danisco US Inc.|Novel variant hyprocrea jecorina CBH1 cellulases|

---

ES2601145T3|2002-11-07|2017-02-14|Danisco Us Inc.|Beta-glucosidase BGL6 and nucleic acids encoding it|

---

US7407788B2|2002-11-21|2008-08-05|Danisco A/S, Genencor Division|BGL7 beta-glucosidase and nucleic acids encoding the same|

---

EP2298876A1|2003-03-21|2011-03-23|Genencor International, Inc.|Novel cbh1 homologs and variant cbh1 cellulases|

---

CA2771875A1|2003-04-01|2005-01-06|Danisco Us Inc.|Variant hypocrea jecorina cbh1|

---

CA2525333C|2003-05-29|2016-03-01|Genencor International, Inc.|Trichoderma genes|

---

US7244605B2|2003-10-28|2007-07-17|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

WO2006011899A1|2003-11-25|2006-02-02|L-3 Communications Security and Detection Systems Corporation|Security system for detecting nuclear masses|

---

DK2314605T3|2004-01-30|2014-06-16|Novozymes Inc|Polypeptides with cellulolytic enhancing activity and polynucleotides encoding them|

---

WO2005074656A2|2004-02-06|2005-08-18|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US7960160B2|2004-02-12|2011-06-14|Novozymes, Inc.|Polypeptides having xylanase activity from Aspergillus fumigatus|

---

US8097445B2|2004-03-25|2012-01-17|Danisco Us Inc.|Exo-endo cellulase fusion protein|

---

EP2354222A1|2004-03-25|2011-08-10|Genencor International, Inc.|Cellulase fusion protein and heterologous cellulase fusion construct encoding the same|

---

US20060004699A1|2004-06-30|2006-01-05|Nokia Corporation|Method and system for managing metadata|

---

DK176540B1|2004-09-24|2008-07-21|Cambi Bioethanol Aps|Process for the treatment of biomass and organic waste in order to extract desired biologically based products|

---

EP2292747B1|2004-12-30|2017-01-25|Danisco US Inc.|Variant hypocrea jecorina cbh2 cellulases|

---

EP1869197A2|2005-04-12|2007-12-26|E.I. Dupont De Nemours And Company|Treatment of biomass to obtain ethanol|

---

MX2007013474A|2005-04-29|2008-04-02|Ab Enzymes Oy|Improved cellulases.|

---

CA2625933C|2005-08-04|2015-11-24|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

US7608689B2|2005-09-30|2009-10-27|Novozymes, Inc.|Methods for enhancing the degradation or conversion of cellulosic material|

---

FI120045B|2005-12-22|2009-06-15|Roal Oy|Treatment of cellulose materials and enzymes useful therein|

---

DK1969123T3|2005-12-22|2017-08-28|Ab Enzymes Oy|Hitherto UNKNOWN ENZYMS|

---

US8304212B2|2006-07-10|2012-11-06|Dyadic International, Inc.|Methods and compositions for degradation of lignocellulosic material|

---

CA2658610A1|2006-07-21|2008-05-15|Novozymes, Inc.|Methods of increasing secretion of polypeptides having biological activity|

---

WO2008049837A2|2006-10-24|2008-05-02|Novozymes A/S|Improved alpha factor signal peptide for producing a polypeptide|

---

CN100575483C|2007-01-29|2009-12-30|中国农业大学|The method for preparing heat resistant xylanase, heat-resisting xylobiase or heat-resisting beta-glucosidase|

---

CN103436509A|2007-05-31|2013-12-11|诺维信股份有限公司|Methods of increasing the cellulolytic enhancing activity of a polypeptide|

---

US8609386B2|2007-09-18|2013-12-17|Novozymes A/S|Polypeptides having tyrosinase activity and polynucleotides encoding same|

---

WO2009042846A1|2007-09-28|2009-04-02|Novozymes A/S|Polypeptides having acetylxylan esterase activity and polynucleotides encoding same|

---

US8034599B2|2007-11-30|2011-10-11|Novozymes A/S|Polypeptides having arabinofuranosidase activity and polynucleotides encoding same|

---

CN101932704A|2007-12-05|2010-12-29|诺维信公司|Polypeptides having xylanase activity and polynucleotides encoding same|

---

EP2224822B1|2007-12-06|2014-05-21|Novozymes A/S|Polypeptides having acetylxylan esterase activity and polynucleotides encoding same|

---

US8034995B2|2007-12-07|2011-10-11|Novozymes A/S|Polypeptides having feruloyl esterase activity and polynucleotides encoding same|

---

DK3222716T3|2009-11-06|2020-11-16|Novozymes Inc|COMPOSITIONS FOR SACCHARIFICATION OF CELLULOSIS MATERIAL|DK3222716T3|2009-11-06|2020-11-16|Novozymes Inc|COMPOSITIONS FOR SACCHARIFICATION OF CELLULOSIS MATERIAL|

---

EP2588604B1|2010-06-30|2016-06-29|Novozymes, Inc.|Polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

US9187742B2|2010-08-30|2015-11-17|Novozymes, Inc.|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2012030845A2|2010-08-30|2012-03-08|Novozymes A/S|Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same|

---

US20130212746A1|2010-08-30|2013-08-15|Novoyzmes A/S|Polypeptides Having Hemicellulolytic Activity And Polynucleotides Encoding Same|

---

EP3470514A1|2010-08-30|2019-04-17|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US9267126B2|2010-08-30|2016-02-23|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

US8624082B2|2010-08-30|2014-01-07|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

ES2594528T3|2010-09-30|2016-12-20|Novozymes, Inc.|Variants of polypeptides with cellulolytic enhancement activity and polynucleotides that encode them|

---

DK2622070T3|2010-09-30|2016-11-21|Novozymes Inc|Variants of polypeptides having cellulolytic enhancing ACTIVITY AND POLYNUCLEOTIDES ENCODING THEM|

---

WO2012044915A2|2010-10-01|2012-04-05|Novozymes, Inc.|Beta-glucosidase variants and polynucleotides encoding same|

---

US20130260423A1|2010-10-26|2013-10-03|Novozymes North America, Inc.|Methods of Saccharifying Sugar Cane Trash|

---

ES2541492T3|2010-11-02|2015-07-21|Novozymes, Inc.|Methods for pretreating cellulosic material with GH61 polypeptide|

---

WO2012059053A1|2010-11-04|2012-05-10|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2012062220A1|2010-11-12|2012-05-18|Novozymes A/S|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

DK2668265T3|2011-01-26|2017-10-16|Novozymes As|Hitherto unknown glycoside hydrolases from thermophilic fungi|

---

MX2013007720A|2011-01-26|2013-08-09|Novozymes As|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.|

---

US9080161B2|2011-01-26|2015-07-14|Novozymes, Inc.|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

CN103517985B|2011-01-26|2016-12-07|诺维信公司|There is the polypeptide of cellobiohydrolase activity and encode the polynucleotide of this polypeptide|

---

DK2678352T3|2011-02-23|2018-03-05|Novozymes Inc|Polypeptides with cellulolysis enhancing activity and polynucleotides encoding them|

---

CN103608461B|2011-03-09|2016-08-03|诺维信公司|The method increasing the cellulolytic enhancing activity of polypeptide|

---

US9409958B2|2011-03-10|2016-08-09|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP3333258A3|2011-03-25|2018-07-25|Novozymes A/S|Method for degrading or converting cellulosic material|

---

EP2691519A1|2011-03-31|2014-02-05|Novozymes, Inc.|Cellulose binding domain variants and polynucleotides encoding same|

---

WO2012135659A2|2011-03-31|2012-10-04|Novozymes A/S|Methods for enhancing the degradation or conversion of cellulosic material|

---

DK2702153T3|2011-04-28|2019-03-18|Novozymes Inc|Polypeptides with endoglucanase activity and polynucleotides encoding them|

---

CN103797126A|2011-04-29|2014-05-14|诺维信股份有限公司|Methods for enhancing the degradation or conversion of cellulosic material|

---

EP2734633B1|2011-07-22|2019-05-01|Novozymes North America, Inc.|Processes for pretreating cellulosic material and improving hydrolysis thereof|

---

ES2672048T3|2011-08-04|2018-06-12|Novozymes Inc.|Polypeptides with xylanase activity and polynucleotides that encode them|

---

CN103703125B|2011-08-04|2016-09-07|诺维信公司|There is polypeptide and the coded polynucleotide thereof of endoglucanase activity|

---

BR112014004190A2|2011-08-24|2017-03-01|Novozymes Inc|method for constructing a filamentous fungal strain, filamentous fungal strain, method for producing multiple recombinant polypeptides, and tandem construct|

---

BR112014004188A2|2011-08-24|2017-03-21|Novozymes Inc|method for obtaining positive transformants from a filamentous fungal host cell, filamentous fungal host cell, method for producing multiple recombinant polypeptides, and tandem construct|

---

WO2013043910A1|2011-09-20|2013-03-28|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP2760885B1|2011-09-30|2017-07-26|Novozymes, Inc.|Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same|

---

CN103998680B|2011-10-27|2017-04-26|巴克曼实验室国际公司|Method and composition for enzymatic treatment of fiber for papermaking, and paper products made therewith|

---

BR112014008056A2|2011-10-28|2017-04-11|Novozymes Inc|isolated polypeptide, isolated polynucleotide, recombinant host cell, methods for producing a polypeptide, a precursor cell mutant, and a protein, transgenic plant, plant part or plant cell, double stranded inhibitory rna molecule, processes for synthesizing a product fermentation, and to ferment a cellulosic or xylan-containing material, and, broth formulation or cell culture composition|

---

CN104039817A|2011-10-28|2014-09-10|诺维信股份有限公司|Polypeptides having xylanase activity and polynucleotides encoding same|

---

US10704034B2|2011-10-28|2020-07-07|Novozymes Inc.|Polypeptides having xylanase activity and polynucleotides encoding same|

---

WO2013064075A1|2011-10-31|2013-05-10|Novozymes, Inc.|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

EP3382017A1|2011-11-18|2018-10-03|Novozymes A/S|Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same|

---

EP3597736A1|2011-11-21|2020-01-22|Novozymes A/S|Gh61 polypeptide variantsand polynucleotides encoding same|

---

EP3342860A1|2011-11-22|2018-07-04|Novozymes, Inc.|Polypeptides having beta-xylosidase activity and polynucleotides encoding same|

---

DK2784161T3|2011-11-25|2018-09-24|Mitsui Chemicals Inc|Xylanase Mutant, Method of Preparation and Use thereof, and Method of Preparation of Sucessed Lignocellulose|

---

WO2013079015A1|2011-12-01|2013-06-06|Novozymes, Inc.|Polypeptides having beta-xylosidase activity and polynucleotides encoding same|

---

EP2791330B1|2011-12-16|2017-07-26|Novozymes, Inc.|Polypeptides having laccase activity and polynucleotides encoding same|

---

WO2013091547A1|2011-12-19|2013-06-27|Novozymes, Inc.|Polypeptides having catalase activity and polynucleotides encoding same|

---

MX2014007255A|2011-12-19|2014-08-08|Novozymes As|Processes and compositions for increasing the digestibility of cellulosic materials.|

---

CA2878019A1|2011-12-20|2013-06-27|Novozymes, Inc.|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2013096652A1|2011-12-21|2013-06-27|Novozymes, Inc.|Methods for determining the degradation of a biomass material|

---

WO2013163590A2|2012-04-27|2013-10-31|Novozymes, Inc.|Gh61 polypeptide variants and polynucleotides encoding same|

---

WO2014092832A2|2012-09-19|2014-06-19|Novozymes, Inc.|Methods for enhancing the degradation or conversion of cellulosic material|

---

CN104755617B|2012-10-08|2019-01-01|诺维信公司|Polypeptide with cellulolytic enhancing activity and the polynucleotides for encoding them|

---

WO2014066141A2|2012-10-24|2014-05-01|Novozymes A/S|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

CA2892031A1|2012-11-27|2014-06-05|Novozymes A/S|Milling process|

---

EP2925790B1|2012-11-27|2021-07-07|Novozymes A/S|Milling process|

---

CN104870639A|2012-12-14|2015-08-26|诺维信公司|Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same|

---

US20150337280A1|2012-12-19|2015-11-26|Novozymes A/S|Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same|

---

CN103131684B|2013-01-09|2015-09-30|中国农业科学院饲料研究所|A kind of C of having holds the method for the zytase XynA of unnecessary sequence and gene thereof and purposes, raising zytase catalytic rate|

---

US8759041B1|2013-02-12|2014-06-24|Novozymes Inc.|Polypeptides having xylanase activity and polynucleotides encoding same|

---

DK2964760T3|2013-03-08|2021-07-26|Novozymes Inc|Cellobiohydrolase variants and polynucleotides encoding them|

---

WO2014182990A1|2013-05-10|2014-11-13|Novozymes A/S|Polypeptides having xylanase activity and polynucleotides encoding same|

---

CA2919157A1|2013-09-04|2015-03-12|Novozymes A/S|Processes for increasing enzymatic hydrolysis of cellulosic material|

---

EP3511418B1|2014-01-07|2020-07-15|Novozymes A/S|Corollospora maritima mannanase and its use|

---

GB201401680D0|2014-01-31|2014-03-19|Dupont Nutrition Biosci Aps|Compositions and methods comprising a xylanase enzyme variant|

---

BR112017003847A2|2014-08-28|2018-02-27|Renescience As|process for solubilizing waste such as municipal solid waste , and process for producing a fermentation product|

---

WO2016037096A1|2014-09-05|2016-03-10|Novozymes A/S|Carbohydrate binding module variants and polynucleotides encoding same|

---

BR112017005914A2|2014-09-23|2017-12-12|Novozymes As|process for ethanol production, and recombinant fermenting organism.|

---

CN107406862A|2015-01-28|2017-11-28|帝斯曼知识产权资产管理有限公司|The method of enzymatic hydrolysis ligno-cellulosic materials and sugar fermentation|

---

WO2016120298A1|2015-01-28|2016-08-04|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

SI3250697T1|2015-01-28|2020-02-28|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

US10557127B2|2015-02-24|2020-02-11|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

US20180051306A1|2015-03-12|2018-02-22|Novozymes A/S|Enzymatic Hydrolysis with Hemicellulolytic Enzymes|

---

EP3067428A1|2015-03-12|2016-09-14|BETA RENEWABLES S.p.A.|A process for producing a hydrolyzed mixture from a pre-treated ligno-cellulosic slurry comprising a slurry liquid and slurry solids|

---

BR112017019332A2|2015-03-12|2018-07-24|Beta Renewables Spa|processes for improving a saccharification glucose or xylose yield of a lignocellulosic material and for producing a fermentation product from a lignocellulosic material|

---

EP3268486A1|2015-03-12|2018-01-17|Novozymes A/S|Multi-stage enzymatic hydrolysis of lignocellulosic biomass employing an oxidoreductase with an aa9 polypeptide|

---

JP6508852B2|2015-04-14|2019-05-08|国立研究開発法人産業技術総合研究所|Modified xylanase|

---

WO2016169893A1|2015-04-20|2016-10-27|Dsm Ip Assets B.V.|Whole fermentation broth|

---

WO2016169892A1|2015-04-20|2016-10-27|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2016188459A1|2015-05-27|2016-12-01|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2016207144A1|2015-06-22|2016-12-29|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

US20180216089A1|2015-07-24|2018-08-02|Novozymes, Inc.|Polypeptides Having Beta-Xylosidase Activity And Polynucleotides Encoding Same|

---

EP3325616A1|2015-07-24|2018-05-30|Novozymes, Inc.|Polypeptides having arabinofuranosidase activity and polynucleotides encoding same|

---

WO2017040907A1|2015-09-04|2017-03-09|Novozymes A/S|Methods of inhibiting aa9 lytic polysaccharide monooxygenase catalyzed inactivation of enzyme compositions|

---

US10479984B2|2015-09-22|2019-11-19|Novozymes A/S|Polypeptides having cellobiohydrolase activity and polynucleotides encoding same|

---

WO2017070219A1|2015-10-20|2017-04-27|Novozymes A/S|Lytic polysaccharide monooxygenasevariants and polynucleotides encoding same|

---

CN114054481A|2015-11-02|2022-02-18|雷内科学有限公司|Dissolving municipal solid waste with mixed enzymes|

---

BR112018067371A2|2016-03-02|2019-01-15|Novozymes As|cellobiohydrolase variant, enzyme composition, whole broth formulation or cell culture composition, polynucleotide, recombinant host cell, plant, plant part or transgenic plant cell, methods for producing and obtaining a cellobio variant. hydrolase, transgenic plant, and processes for degradation of a cellulosic material, for production of a fermentation product and for fermentation of a cellulosic material|

---

EP3433358A1|2016-03-24|2019-01-30|Novozymes A/S|Cellobiohydrolase variants and polynucleotides encoding same|

---

WO2017205535A1|2016-05-27|2017-11-30|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

EP3469090A1|2016-06-09|2019-04-17|DSM IP Assets B.V.|Seed train for large scale enzyme production|

---

WO2018019948A1|2016-07-29|2018-02-01|Dsm Ip Assets B.V.|Polypeptides having cellulolytic enhancing activity and uses thereof|

---

WO2018026868A1|2016-08-01|2018-02-08|Novozymes, Inc.|Polypeptides having endoglucanase activity and polynucleotides encoding same|

---

WO2018085370A1|2016-11-02|2018-05-11|Novozymes A/S|Processes for reducing production of primeverose during enzymatic saccharification of lignocellulosic material|

---

US20190276809A1|2016-11-24|2019-09-12|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2018096019A1|2016-11-24|2018-05-31|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2018185071A1|2017-04-03|2018-10-11|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2019072732A1|2017-10-09|2019-04-18|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

EP3704259A1|2017-10-30|2020-09-09|DSM IP Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

WO2019086370A1|2017-10-30|2019-05-09|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of lignocellulosic material and fermentation of sugars|

---

RU2020124098A|2017-12-22|2022-01-24|Новозимс А/С|METHOD FOR GRINDING WHEAT AND XYLANASE GH8|

---

WO2019185681A1|2018-03-28|2019-10-03|Dsm Ip Assets B.V.|Enzyme composition|

---

BR112020018791A2|2018-03-28|2020-10-13|Dsm Ip Assets B.V.|enzyme composition|

---

BR112020023198A2|2018-05-17|2021-02-09|Dsm Ip Assets B.V.|process for producing a polypeptide|

---

WO2019229108A1|2018-05-30|2019-12-05|Dsm Ip Assets B.V.|Process for producing sugars from carbohydrate materials|

---

WO2020058249A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

WO2020058253A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

WO2020058248A1|2018-09-18|2020-03-26|Dsm Ip Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

EP3870715A1|2018-10-24|2021-09-01|DSM IP Assets B.V.|Process for enzymatic hydrolysis of carbohydrate material and fermentation of sugars|

---

US20220025348A1|2018-12-12|2022-01-27|Novozymes A/S|Polypeptides Having Xylanase Activity And Polynucleotides Encoding Same|

---

CN113544280A|2019-03-12|2021-10-22|帝斯曼知识产权资产管理有限公司|Method for producing a fermentation broth|

---

WO2021026201A1|2019-08-05|2021-02-11|Novozymes A/S|Enzyme blends and processes for producing a high protein feed ingredient from a whole stillage byproduct|

---

WO2021048164A1|2019-09-10|2021-03-18|Dsm Ip Assets B.V.|Enzyme composition|

---

WO2022013148A1|2020-07-13|2022-01-20|Dsm Ip Assets B.V.|Process for the production of biogas|

法律状态:
2018-04-24| B07A| Technical examination (opinion): publication of technical examination (opinion) [chapter 7.1 patent gazette]|

---

2018-10-02| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2018-11-06| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 29/09/2010, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US24688709P| true| 2009-09-29|2009-09-29|

---

US61/246887|2009-09-29|

---

PCT/US2010/050709|WO2011041405A1|2009-09-29|2010-09-29|Polypeptides having xylanase activity and polynucleotides encoding same|

---