![]() Framework-shuffling of antibodies
专利摘要:
The present invention relates to methods of reengineering or reshaping antibodies to reduce the immunogenicity of the antibodies, while maintaining the immunospecificity of the antibodies for an antigen. In particular, the present invention provides methods of producing antibodies inmmunospecific for an antigen by synthesizing a combinatorial library comprising complementarity determining regions (CDRs) from a donor antibody fused in frame to framework regions from a sub-bank of framework regions. The invention also provides method of producing improved humanized antibodies. The present invention also provides antibodies produced by the methods of the invention. 公开号:AU2013204018A1 申请号:U2013204018 申请日:2013-04-11 公开日:2013-05-02 发明作者:William Dall'acqua;Melissa Damschroder;Herren Wu 申请人:MedImmune LLC; IPC主号:C12N15-87
专利说明:
FRAMEWORK-SHUFFLING OF ANTIBODIES The present application is a divisional application from Australian patent application number 2006227377, the entire disclosure of which is incorporated herein by reference. 1. FIELD OF THE INVENTION [0001] The present invention relates to methods of reengineering or reshaping antibodies to reduce the immunogenicity of the antibodies, while maintaining the immunospecificity of the antibodies for an antigen. In particular, the present invention provides methods of producing antibodies immunospecific for an antigen by synthesizing a combinatorial library comprising complementarity determining regions (CDRs) from a donor antibody fused in frame to framework regions from a sub-bank of framework regions. The present invention also provides antibodies produced by the methods of the invention. 2. BACKGROUND OF THE INVENTION [0002] Antibodies play a vital role in our immune responses. They can inactivate viruses and bacterial toxins, and are essential in recruiting the complement system and various types of white blood cells to kill invading microorganisms and large parasites. Antibodies are synthesized exclusively by B lymphocytes, and are produced in millions of forms, each with a different amino acid sequence and a different binding site for an antigen. Antibodies, collectively called immunoglobulins (Ig), are among the most abundant protein components in the blood. Alberts et ah, Molecular Biology of the Cell, 2nd ed., 1989, Garland Publishing, Inc. [0003] A typical antibody is a Y-shaped molecule with two identical heavy (H) chains (each containing about 440 amino acids) and two identical light (L) chains (each containing about 220 amino acids). The four chains are held together by a combination of noncovalent and covalent (disulfide) bonds. The proteolytic enzymes, such as papain and pepsin, can split an antibody molecule into different characteristic fragments. Papain produces two separate and identical Fab fragments, each with one antigen-binding site, and one Fc fragment. Pepsin produces one F (ab') 2 fragment. Alberts et al, Molecular Biology of the Cell, 2nd ed., 1989, Garland Publishing, Inc. [0004] Both L and H chains have a variable sequence at their amino-terminal ends but a constant sequence at their carboxyl-terminal ends. The L chains have a constant region about 110 amino acids long and a variable region of the same size. The H chains also have a variable region about 110 amino acids long, but the constant region of the H chains is about 1 WO 2006/102095 PCT/US2006/009745 330 or 440 amino acid long, depending on the class of the H chain. Alberts et ah, Molecular Biology of the Cell, 2nd ed., 1989, Garland Publishing, Inc. atpplOl9. [0005] Only part of the variable region participates directly in the binding of antigen. Studies have shown that the variability in the variable regions of both L and H chains is for 5 the most part restricted to three small hypervariable regions (also called complementarity determining regions, or CDRs) in each chain. The remaining parts of the variable region, known as framework regions (FR), are relatively constant. Alberts et ah, Molecular Biology of the Cell, 2nd ed., 1989, Garland Publishing, Inc. atpp 1019 - 1020. [0006] Natural immunoglobulins have been used in assays, diagnosis and, to a more 0 limited extent, therapy. However, such uses, especially in therapy, have been hindered by the polyclonal nature of natural immunoglobulins. The advent of monoclonal antibodies of defined specificity increased the opportunities for therapeutic use. However, most monoclonal antibodies are produced following immunization of a rodent host animal with the target protein, and subsequent fusion of a rodent spleen cell producing the antibody of 5 interest with a rodent myeloma cell. They are, therefore, essentially rodent proteins and as such are naturally immunogenic in humans, frequently giving rise to an undesirable immune response termed the HAMA (Human Anti-Mouse Antibody) response. [0007] Many groups have devised techniques to decrease the immunogenicity of therapeutic antibodies. Traditionally, a human template is selected by the degree of 0 homology to the donor antibody, i.e., the most homologous human antibody to the non human antibody in the variable region is used as the template for humanization. The rationale is that the framework sequences serve to hold the CDRs in their correct spatial orientation for interaction with an antigen, and that framework residues can sometimes even participate in antigen binding. Thus, if the selected human framework sequences are most .5 similar to the sequences of the donor frameworks, it will maximize the likelihood that affinity will be retained in the humanized antibody. Winter (EP No. 0239400), for instance, proposed generating a humanized antibody by site-directed mutagenesis using long oligonucleotides in order to graft three complementarity determining regions (CDRl, CDR2 and CDR3) from each of the heavy and light chain variable regions. Although this approach has been shown 0 to work, it limits the possibility of selecting the best human template supporting the donor CDRs. WO 2006/102095 PCT/US2006/009745 [0008] Although a humanized antibody is less immunogenic than its natural or chimeric counterpart in a human, many groups find that a CDR grafted humanized antibody may demonstrate a significantly decreased binding affinity (e.g., Riechmann et ah, 1988, Nature 3 32:323-327). For instance, Reichmann and colleagues found that transfer of the 5 CDR regions alone was not sufficient to provide satisfactory antigen binding activity in the CDR-grafted product, and that it was also necessary to convert a serine residue at position 27 of the human sequence to the corresponding rat phenylalanine residue. These results indicated that changes to residues of the human sequence outside the CDR regions may be necessary to obtain effective antigen binding activity. Even so, the binding affinity was still [0 significantly less than that of the original monoclonal antibody. [0009] For example, Queen et al (U.S. Patent No. 5,530,101) described the preparation of a humanized antibody that binds to the interleukin-2 receptor, by combining the CDRs of a murine monoclonal (anti-Tac MAb) with human immunoglobulin framework and constant regions. The human framework regions were chosen to maximize homology 5 with the anti-Tac MAb sequence. In addition, computer modeling was used to identify framework amino acid residues which were likely to interact with the CDRs or antigen, and mouse amino acids were used at these positions in the humanized antibody. The humanized anti-Tac antibody obtained was reported to have an affinity for the interleukin-2 receptor (p55) of 3 X 109 M-, which was still only about one-third of that of the murine MAb. 0 [0010] Other groups identified further positions within the framework of the variable regions (i.e., outside the CDRs and structural loops of the variable regions) at which the amino acid identities of the residues may contribute to obtaining CDR-grafted products with satisfactory binding affinity. See, e.g., U.S. Patent Nos. 6,054,297 and 5,929,212. Still, it is impossible to know beforehand how effective a particular CDR grafting arrangement will be 25 for any given antibody of interest. [0011] Leung (U.S. Patent Application Publication No. US 2003/0040606) describes a framework patching approach, in which the variable region of the immunoglobulin is compartmentalized into FRI, CDRI, FR2, CDR2, FR3, CDR3 and FR4, and the individual FR sequence is selected by the best homology between the non-human antibody and the 30 human antibody template. This approach, however, is labor intensive, and the optimal framework regions may not be easily identified. WO 2006/102095 PCT/US2006/009745 [0012] As more therapeutic antibodies are being developed and are holding more promising results, it is important to be able to reduce or eliminate the body's immune response elicited by the administered antibody. Thus, new approaches allowing efficient and rapid engineering of antibodies to be human-like, and/or allowing a reduction in labor to 5 humanize an antibody provide great benefits and medical value. [0013] Citation or discussion of a reference herein shall not be construed as an admission that such is prior art to the present invention. 3. SUMMARY OF THE INVENTION ) [0014] The invention is based, in part, on the synthesis of framework region sub banks for the variable heavy chain framework regions and the variable light chain framework regions of antibodies and on the synthesis of combinatorial libraries of antibodies comprising a variable heavy chain region and/or a variable light chain region with the variable chain region(s) produced by fusing together in frame complementarity determining regions (CDRs) 5 derived from a donor antibody and framework regions derived from framework region sub banks. The synthesis of framework region sub-banks allows for the fast, less labor intensive production of combinatorial libraries of antibodies (with or without constant regions) which can be readily screened for their immunospecificity for an antigen of interest, as well as their immunogenicity in an organism of interest. The library approach described in the invention allows for efficient selection and identification of acceptor frameworks (e.g., human frameworks). In addition to the synthesis of framework region sub-banks, sub-banks of CDRs can be generated and randomly fused in frame with framework regions from framework region sub-banks to produce combinatorial libraries of antibodies (with or without constant regions) that can be screened for their immunospecificity for an antigen of interest, 5 as well as their immunogenicity in an organism of interest. The combinatorial library methodology of the invention is exemplified herein for the production of humanized antibodies for use in human beings. However, the combinatorial library methodology of the invention can readily b e applied to the production of antibodies for use in any organism of interest. 0 [0015] The present invention provides methods of re-engineering or re-shaping an antibody (i.e.., a donor antibody) by fusing together nucleic acid sequences encoding CDRs in frame with nucleic acid sequences encoding framework regions, wherein at least one CDR WO 2006/102095 PCT/US2006/009745 is from the donor antibody and at least one framework region is from a sub-bank of framework regions (e.g., a sub-bank sequences encoding some or all known human germline light chain FRI frameworks). One method for generating re-engineered or re-shaped antibodies is detailed in Figure 13. Accordingly, the present invention also provides re 5 engineered or re-shaped antibodies produced by the methods of the present invention. The re-engineered or re-shaped antibodies of the current invention are also referred to herein as "modified antibodies," "humanized antibodies," "framework shuffled antibodies" and more simply as "antibodies of the invention." As used herein, the antibody from which one or more CDRs are derived is a donor antibody. In some embodiments, a re-engineered or re ) shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or six CDRs from a donor antibody. In some embodiments, a re engineered or re-shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or eight frameworks from a sub-bank of framework regions. 5 [0016] In addition, the present invention also provides methods of generating novel antibodies by fusing together nucleic acid sequences encoding CDRs in frame with nucleic acid sequences encoding framework regions, wherein the sequences encoding the CDRs are derived from multiple donor antibodies, or are random sequences and at least one framework region is from a sub-bank of framework regions (e.g., a sub-bank of sequences encoding ) some or all known human light chain FRI frameworks). [0017] The methods of the present invention may be utilized for the production of a re-engineered or re-shaped antibody from a first species, wherein the re-engineered or re, shaped antibody does not elicit undesired immune response in a second species, and the re engineered or re-shaped antibody retains substantially the same or better antigen binding 5 ability of the antibody from the first species. Accordingly, the present invention provides re engineered or re-shaped antibodies comprising one or more CDRs from a first species and at least one framework from a second species. In some embodiments, a re-engineered or re, shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or six CDRs from a first species. In some embodiments, a re 0 engineered or re-shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or eight frameworks from a second species. In a specific embodiment, re-engineered or re-shaped antibodies of the present invention comprise at least one framework from a second species WO 2006/102095 PCT/US2006/009745 having less than 60%, or less than 70%,. or less than 80%, or less than 90% homology to the corresponding framework of the antibody from the first species (e.g. light chain FWl of the re-engineered or re-shaped antibody is derived from a second species and is less than 60% homologous to light chain FWl of the antibody from the first species). 5 [0018] The methods of the present invention may be utilized for the production of a re-engineered or re-shaped antibody from a first species, wherein the re-engineered or re shaped antibody has improved and/or altered characteristics, relative to the antibody from a first species. The methods of the present invention may also be utilized to re-engineer or re shape a donor antibody, wherein the re-engineered or re-shaped antibody has improved 0 and/or altered characteristics, relative to the donor antibody. Antibody characteristics which may be improved by the methods described herein include, but are not limited to, binding properties (e.g., antibody-antigen binding constants such as, Ka, Kd, Ko, Kof), antibody stability in vivo (e.g., serum half-lives) and/or in vitro (e.g., shelf-life), melting temperture (Tm) of the antibody (e.g., as determined by Differential scanning calorimetry (DSC) or other 5 method known in the art), the pi of the antibody (e.g., as determined Isoelectric focusing (IEF) or other methods known in the art), antibody solubility (e.g., solubility in a pharmaceutically acceptable carrier, diluent or excipient), effector function (e.g., antibody dependent cell-mediated cytotoxicity (ADCC)) and production levels (e.g., the yield of an antibody from a cell). In accordance with the present invention, a combinatorial library 0 comprising the CDRs of the antibody from the first species fused in frame with framework regions from one or more sub-banks of framework regions derived from a second species can be constructed and screened for the desired modified and/or improved antibody. [0019] The present invention also provides cells comprising, containing or engineered to express the nucleic acid sequences described herein. The present invention provides a 5 method of producing a heavy chain variable region (e.g., a humanized heavy chain variable region), said method comprising expressing the nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region) in a cell described herein. The present invention provides a method of producing an light chain variable region (e.g., a humanized light chain variable region), said method comprising expressing the nucleotide 0 sequence encoding a light chain variable region (e.g., a humanized light chain variable region) in a cell described herein. The present invention also provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said WO 2006/102095 PCT/US2006/009745 method comprising expressing the nucleic acid sequence(s).encoding the humanized antibody contained in the cell described herein. [0020] The present invention provides re-engineered or re-shaped antibodies produced by the methods described herein. In a specific embodiment, the invention provides 5 humanized antibodies produced by the methods described herein. In another embodiment, the invention provides re-engineered or re-shaped (e.g., humanized) antibodies produced by the methods described herein have one or more of the following properties improved and/or altered: binding properties, stability in vivo and/or in vitro, thermal melting temperture (Tm), pi, solubility, effector function and production levels. The present invention also provides a D composition comprising an antibody produced by the methods described herein and a carrier, diluent or excipient. In a specific embodiment, the invention provides a composition comprising a humanized antibody produced by the methods described herein and a carrier, diluent or excipient. Preferably, the compositions of the invention are pharmaceutical compositions in a form for its intended use. 5 [0021] The present invention provides for a framework region sub-bank for each framework region of the variable light chain and variable heavy chain. Accordingly, the invention provides a framework region sub-bank for variable light chain framework region 1, variable light chain framework region 2, variable light chain framework region 3, and variable light chain framework region 4 for each species of interest and for each definition of ) a CDR (e.g., Kabat and Chothia). The invention also provides a framework region sub-bank for variable heavy chain framework region 1, variable heavy chain framework region 2, variable heavy chain framework region 3, and variable heavy chain framework region 4 for each species of interest and for each definition of a CDR (e.g., Kabat and Chothia). The framework region sub-banks may comprise framework regions from germline framework 5 sequences and/or framework regions from functional antibody sequences. The framework region sub-banks may comprise framework regions from germline framework sequences and/or framework regions from functional antibody sequences into which one or more mutations have been introduced. The framework region sub-banks can be readily used to synthesize a combinatorial library of antibodies which can be screened for their 0 immunospecificity for an antigen of interest, as well as their immunogencity in an organism of interest. [0022] The present invention provides for a CDR sub-bank for each CDR of the variable light chain and variable heavy chain. Accordingly, the invention provides a CDR WO 2006/102095 PCT/US2006/009745 region sub-bank for variable light chain .CDR1, variable light chain CDR2, and variable light CDR3 for each species of interest and for each definition of a CDR (e.g., Kabat and Chothia). The invention also provides a CDR sub-bank for variable heavy chain CDR1, variable heavy CDR2, and variable heavy chain CDR3 for each species of interest and for each definition of 5 a CDR (e.g., Kabat and Chothia). The CDR sub-banks may comprise CDRs that have been identified as part of an antibody that immunospecifically to an antigen of interest. The CDR sub-banks can be readily used to synthesize a combinatorial library of antibodies which can be screened for their immunospecificity for an antigen of interest, as well as their immunogencity in an organism of interest. 0 [0023] The present invention provides a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region and/or a nucleotide sequence encoding a light chain variable region with the variable region(s) produced by fusing together CDRs 1-3 derived from a donor antibody in frame with framework regions 1-4 from framework region sub-banks. In some embodiments, one or more of the CDRs derived from 5 the donor antibody heavy and/or light chain variable region(s) contain(s) one or more mutations relative to the nucleic acid sequence encoding the corresponding CDR in the donor antibody. The present invention also provides a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region and/or a nucleotide sequence encoding a light chain variable region with the variable region(s) produced by fusing together 3 CDRs 1-3 derived from CDR sub-banks (preferably, sub-banks of CDRs that immunospecifically bind to an antigen of interest) in frame with framework regions 1-4 from framework region sub-banks. [0024] In one embodiment, the present invention provides a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a 5 humanized heavy chain variable region), said first nucleotide sequence encoding the heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence 0 encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable WO 2006/102095 PCT/US2006/009745 region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). In accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence encoding a donor light chain variable region (e.g., a non-human donor 5 light chain variable region). Alternatively, in accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said second nucleotide sequence encoding the light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light 3 chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable 5 region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., sub-bank of human light chain framework regions). [0025] In another embodiment, the present invention provides a nucleic acid sequence comprising a first nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said first nucleotide sequence encoding the light ) chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a 5 light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). In accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence 0 encoding a donor heavy chain variable region (e.g., a non-human donor heavy chain variable region). [0026] In another embodiment, the present invention provides a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a WO 2006/102095 PCT/US2006/009745 humanized heavy chain variable region)., said first nucleotide acid sequence encoding the heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). In accordance with this embodiment, the nucleic acid may further comprise a second nucleotide sequence encoding a donor light chain variable region (e.g., a non-human donor light chain variable region). Alternatively, in accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said second nucleotide sequence encoding the light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) or at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human antibodies) and at least one light chain framework region is from a sub-bank of 5 human light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0027] In another embodiment, the present invention provides a nucleic acid sequence comprising a first nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said first nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain WO 2006/102095 PCT/US2006/009745 framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework 5 regions (e.g., a sub-bank of human light chain framework regions). In accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence encoding a donor heavy chain variable region (e.g., a non-human heavy chain variable region). Alternatively, in accordance with this embodiment, the nucleic acid sequence may further comprise a second nucleotide sequence encoding a heavy chain variable region (e.g., a 0 humanized heavy chain variable region), said second nucleotide sequence encoding the heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a 5 nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). ) [0028] The present invention also provides cells comprising, containing or engineered to express the nucleic acid sequences described herein. In one embodiment, the present invention provides a cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said cell produced by the process comprising introducing into a cell a 5 nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region) synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence 0 encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is WO 2006/102095 PCT/US2006/009745 from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). In accordance with this embodiment, the cell may further comprise a second nucleic acid sequence comprising a second nucleotide sequence encoding a light chain variable region (e.g., a humanized or human light chain variable region). 5 [0029] In another embodiment, the present invention provides a cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region) 0 synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain 5 framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). In accordance with this embodiment, the cell may further comprise a second nucleic acid sequence comprising a second nucleotide 'sequence encoding a heavy chain variable region (e.g., a human or humanized heavy chain variable region). [0030] In another embodiment, the present invention provides a cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region) and a second nucleotide sequence 5 encoding a light chain variable region (e.g., a humanized light chain variable region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence 0 encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a light chain variable WO 2006/102095 PCT/US2006/009745 region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic 5 acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs of the heavy chain variable region are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), the CDRs of the light chain variable region are derived from a donor light chain variable region (e.g., a non-human donor light chain variable region), at least one .0 heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions), and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0031] In another embodiment, the present invention provides a cell comprising a first 5 nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a ,0 heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non 25 human donor antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). In accordance with this embodiment, the cell may further comprise a second nucleic acid sequence comprising a second nucleotide sequence encoding a light chain variable region (e.g., a humanized or human light chain variable region). 30 [0032] In another embodiment, the present invention provides a cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence WO 2006/102095 PCTIUS2006/009745 encoding a light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain 5 framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). In accordance with this [0 embodiment, the cell may further comprise a second nucleic acid sequence comprising a second nucleotide sequence encoding a heavy chain variable region (e.g., a humanized or human heavy chain variable region). [0033] In another embodiment, the present invention provides a cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable .5 region (e.g., a humanized heavy chain variable region) and a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework 0 region 1, a nucleic acid sequence encoding a heavy chain CDR, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a light chain variable 25 region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light 30 chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy I A WO 2006/102095 PCT/US2006/009745 chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub bank of human heavy chain framework regions), and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). 5 [0034] In another embodiment, the present invention provides a cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region) and a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said cell produced by the process comprising introducing into a cell a nucleic acid sequence 0 comprising: (i) a first nucleotide sequence encoding a heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1 , a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid 5 sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light 0 chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), at least one light chain variable region CDR is from a sub-bank of light 25 chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions), and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). 30 [0035] In another embodiment, the present invention provides a cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region) and a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said WO 2006/102095 PCT/US2006/009745 cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRl, a nucleic acid sequence 5 encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain .0 framework region 1, a nucleic acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a .5 sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions), and at least one light chain .0 framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0036] The present invention provides a cell containing nucleic acid sequences encoding an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic 25 acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said first nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI 5 a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a 30 nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least WO 2006/102095 PCT/US2006/009745 one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence synthesized 5 by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence ) encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework region (e.g., a sub-bank of human light chain framework region). [0037] The present invention provides a cell containing nucleic acid sequences encoding an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a heavy chain variable region), said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., 5 non-human donor antibodies) and at least one heavy chain framework region is from a sub bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence synthesized by fusing together a nucleic acid sequence 0 encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI 5 a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid WO 2006/102095 PCT/US2006/009745 sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework region (e.g., a sub-bank of human light chain framework region). 5 [0038] The present invention provides a cell containing nucleic acid sequences encoding an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide acid sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said nucleotide sequence synthesized by 10 fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence 5 encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a light chain !0 variable region (e.g., a humanized light chain variable region), said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid 25 sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). 30 [0039] The present invention provides a cell containing nucleic acid sequences encoding an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., 1 0 WO 2006/102095 PCT/US2006/009745 a humanized heavy chain variable region), said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding 5 a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework ) regions (e.g., a sub-bank of human heavy chain framework regions); and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI, a nucleic acid sequence 5 encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0040] The present invention provides a method of producing a heavy chain variable region (e.g., a humanized heavy chain variable region), said method comprising expressing the nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy 5 chain variable region) in a cell described herein. The present invention provides a method of producing an light chain variable region (e.g., a humanized light chain variable region), said method comprising expressing the nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region) in a cell described herein. The present invention also provides a method of producing an antibody (e.g., a humanized antibody) that 0 immunospecifically binds to an antigen, said method comprising expressing the nucleic acid sequence(s) encoding the humanized antibody contained in the cell described herein. [0041] In one embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said WO 2006/102095 PCT/US2006/009745 method comprising: (a) generating sub-banks of heavy chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid 5 sequence encoding a heavy chain CDRl , a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a [0 non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a variable light chain variable region (e.g., a humanized or human variable light chain variable region); 5 and (d) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized or human light chain variable region). In accordance with this embodiment, the method may further comprise a step (e) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. 0 [0042] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of heavy chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said nucleotide 25 sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a 30 heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); (c) introducing the nucleic acid WO 2006/102095 PCT/US2006/009745 sequence into a cell containing a nucleio acid sequence comprising a nucleotide sequence encoding a variable light chain variable region (e.g., a humanized or human variable light chain variable region); and (d) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable 5 region (e.g., the humanized or human light chain variable region). In accordance with this embodiment, the method may further comprise a step (e) comprising screening for an antibody (e.g., a humanized antibody) that immuno specifically binds to the antigen. [0043] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said 0 method comprising: (a) generating sub-banks of light chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a 5 light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain 0 framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions); (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a variable heavy chain variable region (e.g., a humanized or human variable heavy chain variable region); and (d) expressing the nucleotide sequences encoding the heavy chain variable :5 region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized or human light chain variable region). In accordance with this embodiment, the method may further comprise a step (e) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. [0044] In another embodiment, the present invention provides a method of producing 0 an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence WO 2006/102095 PCT/US2006/009745 produced by fusing together a nucleis acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions); (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a variable heavy chain variable region (e.g., a humanized or human variable heavy chain variable region); and (d) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized or human light chain variable region). In accordance with this embodiment, the method may further comprise a step (e) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. [0045] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain 5 framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain ) framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence produced by fusing together a nucleic acid WO 2006/102095 PCT/US2006/009745 sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid 5 sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions); (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences 0 encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the humanized light chain variable region (e.g., the humanized light chain variable region). In accordance with this embodiment, the method may further comprise a step (g) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. 5 [0046] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a 3 humanized heavy chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a 5 heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); (d) synthesizing a nucleic acid sequence comprising a nucleotide 0 sequence encoding a light chain variable region (e.g. a humanized light chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid WO 2006/102095 PCT/US2006/009745 sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is 5 from a sub-bank of human light chain framework regions; (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized light chain variable region). In accordance with this embodiment, the method may further comprise a step (g) comprising screening for an antibody (e.g., a [0 humanized antibody) that immunospecifically binds to the antigen. [0047] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid 5 sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain ,0 framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); 25 (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a 30 nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework WO 2006/102095 PCT/US2006/009745 region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions); (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the 5 humanized light chain variable region). In accordance with this embodiment, the method may further comprise a step (g) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. [0048] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said ) method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid 5 sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions); (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said nucleotide sequence produced by fusing together a nucleic acid sequence 5 encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub 0 bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions); (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the WO 2006/102095 PCT/US2006/009745 heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized light chain variable region). In accordance with this embodiment, the method may further comprise a step (g) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. 5 [0049] In another embodiment, the present invention provides a method of producing an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a heavy chain variable region .0 (e.g., a humanized heavy chain variable region), said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence 5 encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a 0 light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), 25 the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain 30 framework regions); (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the light chain variable region (e.g., the humanized light chain variable region). In accordance with this embodiment, the method may further WO 2006/102095 PCT/US2006/009745 comprise a step (f) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. [0050] The present invention provides a method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub 5 banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a 0 heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid 5 sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain ) variable region CDR is from a sub-bank ofheavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, the light chain variable region CDRs are derived from a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions; (d) 5 introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. In accordance with this embodiment, the method may further comprise a step (f) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. 0 [0051] The present invention provides a method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence WO 2006/102095 PCT/US2006/009745 encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a 5 nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light ) chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region, at least one light chain S variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions; (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. In accordance with this embodiment, the method may further comprise a step (f) comprising screening for an antibody (e.g., a humanized antibody) that immunospecifically binds to the antigen. [0052] In another embodiment, the present invention provides a method of producing 5 an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a heavy chain variable region (e.g., a humanized heavy chain variable region), said first nucleotide sequence produced by 0 fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence WO 2006/102095 PCT/US2006/009745 encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region), said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 5 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy 0 chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light 5 chain framework regions (e.g., a sub-bank of human light chain framework regions); (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the heavy chain variable region (e.g., the humanized heavy chain variable region) and the humanized light chain variable region (e.g., the humanized light chain variable region). In accordance with this embodiment, the method may further comprise a step (f) 0 comprising screening for an antibody (e.g., ahumanized antibody) that immunospecifically binds to the antigen. [0053] The present invention further encompasses the use of the methods described herein to produce an antibody with improved and/or altered characteristics, relative to the donor antibody. Antibody characteristics which may be improved by the methods described 5 herein include, but are not limited to, binding properties (e.g., antibody-antigen binding constants such as, Ka, Kd, KOn' Kff), antibody stability in vivo (e.g., serum half-lives) and/or in vitro (e.g., shelf-life), melting temperature (Tm) of the antibody (e.g., as determined by Differential scanning calorimetry (DSC) or other method known in the art), the pi of the antibody (e.g., as determined Isoelectric focusing (IEF) or other methods known in the art), 0 antibody solubility (e.g., solubility in a pharmaceutically acceptable carrier, diluent or excipient), effector function (e.g., antibody dependent cell-mediated cytotoxicity (ADCC)) and antibody production levels (e.g., the yield of an antibody from a cell). In one embodiment, one or more of the above antibody characteristics are improved and/or altered WO 2006/102095 PCT/US2006/009745 by at least 1%, or at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 150%, or at least 200%, or at least 500%, relative to the donor .antibody. In another embodiment, one or more of the above antibody characteristics are 5 improved and/or altered by at least 2 fold, or by at least 3 fold, or by at least 5 fold, or by at least 10 fold, or by at least 20 fold, or by at least 50 fold, or by at least 100 fold, or by at least 200 fold, or by at least 500 fold, or by at least 1000 fold, relative to the donor antibody. In accordance with these embodiments, the methods described herein may further comprise a step comprising screening for an antibody (e.g., a humanized antibody) that has the desired 0 improved characteristics. [0054] The present invention provides antibodies produced by the methods described herein. In one embodiment, the invention provides humanized antibodies produced by the methods described herein. The present invention also provides a composition comprising an antibody produced by the methods described herein and a carrier, diluent or excipient. In 5 another embodiment, the invention provides a composition comprising a humanized antibody produced by the methods described herein and a carrier, diluent or excipient. Preferably, the compositions of the invention are pharmaceutical compositions in a form for its intended use. [0055] The present invention provides a plurality of nucleic acid sequences comprising nucleotide sequences encoding heavy chain variable regions (e.g., humanized ) heavy chain variable regions), said nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a !5 nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-humanized donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). The present invention 0 also provides a plurality of nucleic acid sequences comprising nucleotide sequences encoding heavy chain variable regions (e.g., humanized heavy chain variable regions), said nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence WO 2006/102095 PCT/US2006/009745 encoding a heavy chain CDRl, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at 5 least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one heavy chain framework region is from a sub bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). [0056] The present invention provides a plurality of nucleic acid sequences 0 comprising nucleotide sequences encoding light chain variable regions (e.g., humanized light chain variable regions), said nucleotide sequences encoding the light chain variable regions each produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain 5 CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a 0 sub-bank of human light chain framework regions). The present invention also provides a plurality of nucleic acid sequences comprising nucleotide sequences encoding light chain variable regions (e.g., humanized light chain variable regions), said nucleotide sequences encoding the light chain variable regions each produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light 25 chain CDRl , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) 30 and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0057] The present invention provides a plurality of nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions (e.g., WO 2006/102095 PCT/US2006/009745 humanized heavy chain variable regions), said first set of nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid 5 sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide encoding light chain variable regions (e.g., humanized light chain variable regions), said second set of nucleotide sequences encoding the light chain variable regions each produced 10 by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, 15 wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub O bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0058] The present invention provides a plurality of nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions (e.g., 25 humanized heavy chain variable regions), said first set of nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain 30 framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide encoding light chain variable regions (e.g., humanized light chain variable regions), said second set of nucleotide sequences encoding the light chain variable regions each produced WO 2006/102095 PCT/US2006/009745 by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a 5 light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region), at least one heavy chain framework .0 region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain framework region is from a sub bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0059] The present invention provides a plurality of nucleic acid sequences 5 comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions (e.g., humanized heavy chain variable regions), said first set of nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid 0 sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding light chain variable regions (e.g., humanized light chain variable regions), said second set of nucleotide sequences encoding the light chain variable regions 25 each produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain 30 framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy chain WO 2006/102095 PCT/US2006/009745 framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., human light chain framework regions). [0060] The present invention provides a plurality of nucleic acid sequences 5 comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions (e.g., humanized heavy chain variable regions), said first set of nucleotide sequences encoding the heavy chain variable regions each produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid 0 sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide encoding light chain variable regions (e.g., humanized light chain variable regions), said second set of nucleotide sequences encoding the light chain variable regions each produced 5 by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, ,0 wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human antibodies), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human antibodies), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions 25 )and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0061] The present invention provides a population of cells comprising the nucleic acid sequences described herein. In one embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide sequences 30 encoding a plurality of heavy chain variable regions (e.g., humanized heavy chain variable regions), said cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework I2A WO 2006/102095 PCT/US2006/009745 region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain 5 framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions). In accordance with this embodiment, the cells may further comprise a nucleic acid sequence comprising a nucleotide 0 sequence encoding a light chain variable region (e.g., a humanized or human light chain variable region). [0062] In another embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide acid sequences encoding a plurality of heavy chain variable regions (e.g., humanized heavy chain variable regions), said cells 5 produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid D sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain 5 framework regions). In accordance with this embodiment, the cells may further comprise a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized or human light chain variable region). [0063] In another embodiment, the present invention provides a population of cells comprising nucleic sequences comprising nucleotide sequences encoding a plurality of light 0 chain variable regions (e.g., humanized light chain variable regions), said cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a WO 2006/102095 PCT/US2006/009745 light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are 5 derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). In accordance with this embodiment, the cells may further comprise a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized or 0 human light chain variable region). [0064] In another embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of light chain variable regions (e.g., humanized light chain variable regions), said cells produced by the process comprising introducing into cells nucleic acid sequences comprising 5 nucleotide sequences encoding light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light 0 chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies) and at least one light chain framework region is from a sub bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). In accordance with this embodiment, the cells may further comprise a nucleic acid 25 sequence comprising a nucleotide sequence encoding a light chain variable region (e.g., a humanized or human light chain variable region). [0065] In another embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of heavy chain variable regions (e.g., humanized heavy chain variable regions) and a plurality of 30 light chain variable regions (e.g., humanized light chain variable regions), said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a WO 2006/102095 PCT/US2006/009745 nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain 5 framework region 4, and (ii) a second set of nucleotide sequences encoding light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a .0 nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy chain variable region), the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable 5 region), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0066] In another embodiment, the present invention provides a population of cells .0 comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of heavy chain variable regions (e.g., humanized heavy chain variable regions) and a plurality of light chain variable regions (e.g., humanized light chain variable regions), said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions each synthesized 25 by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain 30 framework region 4, and (ii) a second set of nucleotide sequences encoding light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a WO 2006/102095 PCT/US2006/009745 light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), the light chain variable region CDRs are derived from a donor antibody light chain variable region (e.g., a non-human donor antibody light chain variable region), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0067] In another embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of heavy chain variable regions (e.g., humanized heavy chain variable regions) and a plurality of light chain variable regions (e.g., humanized light chain variable regions), said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRl, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic 5 acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region (e.g., a non-human donor antibody heavy ) chain variable region), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub-bank of human heavy chain framework regions) and at least one light chain 38 WO 2006/102095 PCT/US2006/009745 framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0068] In another embodiment, the present invention provides a population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of 5 heavy chain variable regions (e.g., humanized heavy chain variable regions) and a plurality of light chain variable regions (e.g., humanized light chain variable regions), said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a D nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding light chain 5 variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a ) light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies (e.g., non-human donor antibodies), at least one heavy chain framework region is from a sub-bank of heavy chain framework regions (e.g., a sub 5 bank of human heavy chain framework regions) and at least one light chain framework region is from a sub-bank of light chain framework regions (e.g., a sub-bank of human light chain framework regions). [0069] The present invention provides a method of identifying an antibody that immunospecifically binds to an antigen, said method comprising expressing the nucleic acid 0 sequences in the cells as described herein and screening for an antibody that has an affinity of at least l x 106 M~1, at least l x 107 M-, at least l x 108 M~1, at least l x 109 M1, at least I x 1010 M~or above for said antigen. In a specific embodiment, the invention provides a method of identifying a humanized antibody that immunospecifically to an antigen, said method WO 2006/102095 PCT/US2006/009745 comprising expressing the nucleic acid sequences in the cells as described herein and screening for a humanized antibody that has an affinity of at least 1 x 106 M1, at least 1 x 107 M', at least 1 x 10s M 1 , at least 1 x 10 9 M 1 , at least 1 x 1010 M-or above for said antigen. The present invention provides an antibody identified by the methods described herein. In a 5 preferred embodiment, the invention provides a humanized antibody identified by the methods described herein. [0070] In accordance with the present invention, the antibodies generated as described herein (e.g., a humanized antibody) comprise a light chain variable region and/or a heavy chain variable region. In some embodiments, the antibodies generated as described 0 herein further comprise a constant region(s). [0071] The present invention provides antibodies (e.g., humanized antibodies) generated in accordance with the invention conjugated or fused to amoiety (e.g., a therapeutic agent or drug). The present invention also provides compositions, preferably pharmaceutical compositions, comprising an antibody generated and/or identified in 5 accordance with the present invention and a carrier, diluent or excipient. In certain embodiments, the present invention provides compositions, preferably pharmaceutical compositions, comprising a humanized antibody as described herein and a carrier, diluent or excipient. The present invention also provides compositions, preferably pharmaceutical compositions, comprising an antibody generated and/or identified in accordance with the 3 present invention conjugated or fused to a moiety (e.g., a therapeutic agent or drug), and a carrier, diluent or excipient. In certain other embodiments, the present invention provides compositions comprising a humanized antibody (or fragment thereof) conjugated or fused to a moiety (e.g., a therapeutic agent or drug), and a carrier, diluent or excipient. The present invention further provides uses of an antibody generated and/or identified in accordance with 5 the present invention (e.g., a humanized antibody) alone or in combination with other therapies to prevent, treat, manage or ameliorate a disorder or a symptom thereof. [0072] The pharmaceutical compositions of the invention may be used for the prevention, management, treatment or amelioration of a disease or one or more symptoms thereof. In one embodiment, the pharmaceutical compositions of the invention are sterile and 0 in suitable form for a particular method of administration to a subject with a disease. In another embodiment, the pharmaceutical compositions of the invention are substantially endotoxin free. WO 2006/102095 PCT/US2006/009745 [0073] The invention further provides methods of detecting, diagnosing and/or monitoring the progression of a disorder utilizing one or more antibodies (e.g., one or more humanized antibodies) generated and/or identified in accordance with the methods of the invention. 5 [0074] The invention provides kits comprising sub-banks of antibody framework regions of a species of interest. The invention also provides kits comprising sub-banks of CDRs of a species of interest. The invention also provides kits comprising combinatorial sub-libraries of nucleic acids, wherein the nucleic acids comprise nucleotide sequences that contain one framework region (e.g., FRI) fused in frame to one corresponding CDR (e.g., [0 CDR1). The invention further provides kits comprising combinatorial libraries of nucleic acids, wherein the nucleic acids comprise nucleotide sequences that contain the framework regions and CDRs of the variable heavy chain region or variable light chain region fused in frame (e.g., FRI +CDR1+FR2+CDR2+FR3+CDR3+FR4). [0075] In some embodiments, the invention provides kits comprising sub-banks of [5 human immunoglobulin framework regions, sub-banks of CDRs, combinatorial sub-libraries, and/or combinatorial libraries. In one embodiment, the invention provides a kit comprising a framework region sub-bank for variable light chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Kabat system. In another embodiment, the invention provides a kit comprising a framework region sub-bank for lO variable light chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Chothia system. In another embodiment, the invention provides a kit comprising a framework region sub-bank for variable heavy chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Kabat system. In another embodiment, the invention provides a kit comprising a framework region sub-bank 25 for variable heavy chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Chothia system. In yet another embodiment, the invention provides a kit comprising sub-banks of both the variable light chain and the variable heavy chain framework regions. [0076] The invention also provides a pharmaceutical pack or kit comprising one or 30 more containers filled with a humanized antibody of the invention. The pharmaceutical pack or kit may further comprises one or more other prophylactic or therapeutic agents useful for the prevention, treatment, management or amelioration of a particular disease or a symptom thereof The invention also provides a pharmaceutical pack or kit comprising one or more WO 2006/102095 PCT/US2006/009745 containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of 5 manufacture, use or sale for human administration. [0077] The present invention also provides articles of manufacture. 3.1 Terminology [0078] As used herein, the terms "acceptor" and "acceptor antibody" refer to the antibody or nucleic acid sequence providing or encoding at least 80%, at least 85%, at least 0 90%, or at least 95% amino acid sequences of one or more of the framework regions. In some embodiments, the term "acceptor" refers to the antibody or nucleic acid sequence providing or encoding the constant region(s). In a specific embodiment, the term "acceptor" refers to a human antibody or nucleic acid sequence that provides or encodes at least 80%, or at least 85%, or at least 90%, or at least 95% amino acid sequences of one or more of the 5 framework regions. An acceptor framework region and/or acceptor constant region(s) may be, e.g., derived or obtained from a germline antibody gene, a mature antibody gene, a functional antibody (e.g., antibodies well-known in the art, antibodies in development, or antibodies commercially available). [0079] As used herein, the terms "antibody" and "antibodies" refer to monoclonal 0 antibodies, multispecific antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), single chain antibodies, single domain antibodies, Fab fragments, F(ab) fragments, disulfide-linked Fvs (sdFv), anti idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above. In particular, antibodies include immunoglobulin molecules and immunologically active Z5 fragments of immunoglobulin molecules, i.e., molecules that contain an antigen binding site. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGi, IgG 2 , IgG 3 , IgG 4 , IgA] and IgA 2 ) or subclass. [0080] A typical antibody contains two heavy chains paired with two light chains. A full-length heavy chain is about 50 IcD in size (approximately 446 amino acids in length), and 0 is encoded by a heavy chain variable region gene (about 116 amino acids) and a constant region gene. There are different constant region genes encoding heavy chain constant region of different isotypes such as alpha, gamma (IgGl, IgG2, IgG3, IgG4), delta, epsilon, and mu WO 2006/102095 PCT/US2006/009745 sequences. A full-length light chain is about 25 Kd in size (approximately 214 amino acids in length), and is encoded by a light chain variable region gene (about 110 amino acids) and.a kappa or lambda constant region gene. The variable regions of the light and/or heavy chain are responsible for binding to an antigen, and the constant regions are responsible for the 5 effector functions typical of an antibody. [0081] As used herein, the term "CDR" refers to the complement detem0ning region within antibody variable sequences. There are three CDRs in each of the variable regions of the heavy chain and the light chain, which are designated CDRI, CDR2 and CDR3, for each of the variable regions. The exact boundaries of these CDRs have been defined differently [0 according to different systems. The system described by Kabat (Kabat et ah, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD (1987) and (1991)) not only provides an unambiguous residue numbering system applicable to any variable region of an antibody, but also provides precise residue boundaries defining the three CDRs. These CDRs may be referred to as Kabat CDRs. Chothia and coworkers (Chothia & 5 Lesk, J. Mol. Biol. 196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)) found that certain sub-portions within Kabat CDRs adopt nearly identical peptide backbone conformations, despite having great diversity at the level of amino acid sequence. These sub portions were designated as Ll, L2 and L3 or Hl, H2 and H3 where the "L" and the "H" designates the light chain and the heavy chains regions, respectively. These regions may be ,0 referred to as Chothia CDRs, which have boundaries that overlap with Kabat CDRs. Other boundaries defining CDRs overlapping with the Kabat CDRs have been described by Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)). Still other CDR boundary definitions may not strictly follow one of the above systems, but will nonetheless overlap with the Kabat CDRs, although they may be shortened or lengthened in 25 light of prediction or experimental findings that particular residues or groups of residues or even entire CDRs do not significantly impact antigen binding. The methods used herein may utilize CDRs defined according to any of these systems, although specific embodiments use Kabat or Chothia defined CDRs. [0082] As used herein, the term "derivative" in the context of proteinaceous agent 30 (e.g., proteins, polypeptides, and peptides, such as antibodies) refers to a proteinaceous agent that comprises an amino acid sequence which has been altered by the introduction of amino acid residue substitutions, deletions, and/or additions. The term "derivative" as used herein also refers to a proteinaceous agent which has been modified, i.e., by the covalent attachment WO 2006/102095 PCT/US2006/009745 of any type of molecule to the proteinaceous agent. For example, but not by way of limitation, an antibody maybe modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. A derivative of a proteinaceous 5 agent may be produced by chemical modifications using techniques known to those of skill in the art, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Further, a derivative of a proteinaceous agent may contain one or more non-classical amino acids. A derivative of a proteinaceous agent possesses a similar or identical function as the proteinaceous agent from which it was 0 derived. [0083] As used herein, the terms "disorder" and "disease" are used interchangeably for a condition in a subject. [0084] As used herein, the term "donor antibody" refers to an antibody providing one or more CDRs. In a specific embodiment, the donor antibody is an antibody from a species 5 different from the antibody from which the framework regions are derived. In the context of a humanized antibody, the term "donor antibody" refers to a non-human antibody providing one or more CDRs. In other embodiments, the "donor antibody" may be derived from the same species from which the framework regions are derived. [0085] As used herein, the term "effective amount" refers to the amount of a therapy 0 which is sufficient to reduce or ameliorate the severity and/or duration of a disorder or one or more symptoms thereof, prevent the advancement of a disorder, cause regression of a disorder, prevent the recurrence, development, onset or progression of one or more symptoms associated with a disorder, detect a disorder, or enhance or improve the prophylactic or therapeutic effect(s) of another therapy (e.g., prophylactic or therapeutic agent). 25 [0086] As used herein, the term "epitopes" refers to fragments of a polypeptide or protein having antigenic or immunogenic activity in an animal, preferably in a mammal, and most preferably in a human. An epitope having immunogenic activity is a fragment of a polypeptide or protein that elicits an antibody response in an animal. An epitope having antigenic activity is a fragment of a polypeptide or protein to which an antibody 30 immunospecifically binds as determined by any method well-known to one of skill in the art, for example by immunoassays. Antigenic epitopes need not necessarily be immunogenic. WO 2006/102095 PCT/US2006/009745 [0087] As used herein, the term "fusion protein" refers to a polypeptide or protein (including, but not limited to an antibody) that comprises an amino acid sequence of a first protein or polypeptide or functional fragment, analog or derivative thereof, and an amino acid sequence of a heterologous protein, polypeptide, or peptide (i.e., a second protein or 5 polypeptide or fragment, analog or derivative thereof different than the first protein or fragment, analog or derivative thereof). In one embodiment, a fusion protein comprises a prophylactic or therapeutic agent fused to a heterologous protein, polypeptide or peptide. In accordance with this embodiment, the heterologous protein, polypeptide or peptide may or may not be a different type of prophylactic or therapeutic agent. For example, two different 10 proteins, polypeptides or peptides with immunomodulatory activity may be fused together to form a fusion protein. In one embodiment, fusion proteins retain or have improved activity relative to the activity of the original protein, polypeptide or peptide prior to being fused to a heterologous protein, polypeptide, or peptide. [0088] As used herein, the term "fragment" refers to a peptide or polypeptide 5 (including, but not limited to an antibody) comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous 0 amino acid residues, at least contiguous 80 amino acid residues, at least contiguous 90 amino acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of another polypeptide or protein. In a specific 25 embodiment, a fragment of a protein or polypeptide retains at least one function of the protein or polypeptide. [0089] As used herein, the term "functional fragment" refers to a peptide or polypeptide (including, but not limited to an antibody) comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 30 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least contiguous 80 amino acid residues, at least contiguous 90 amino A e WO 2006/102095 PCT/US2006/009745 acid residues, at least contiguous 100 amino acid residues, at least contiguous 125 amino acid residues, at least 150 contiguous amino acid residues, at least contiguous 175 amino acid residues, at least contiguous 200 amino acid residues, or at least contiguous 250 amino acid residues of the amino acid sequence of second, different polypeptide or protein, wherein said 5 polypeptide or protein retains at least one function of the second, different polypeptide or protein. In a specific embodiment, a fragment of a polypeptide or protein retains at least two, three, four, or five functions of the protein or polypeptide. Preferably, a fragment of an antibody that immunospecifically binds to a particular antigen retains the ability to immunospecifically bind to the antigen. 0 [0090] As used herein, the term "framework" or "framework sequence" refers to the remaining sequences of a variable region minus the CDRs. Because the exact definition of a CDR sequence can be determined by different systems, the meaning of a framework sequence is subject to correspondingly different interpretations. The six CDRs (CDRI, 2, and 3 of light chain and CDR1, 2, and 3 of heavy chain) also divide the framework regions on 5 the light chain and the heavy chain into four sub-regions (FRI, FR2, FR3 and FR4) on each chain, in which CDR1 is positioned between FRI and FR2, CDR2 between FR2 and FR3, and CDR3 between FR3 and FR4. Without specifying the particular sub-regions as FRI, FR2, FR3 or FR4, a framework region, as referred by others, represents the combined FR's within the variable region of a single, naturally occurring immunoglobulin chain. As used ,0 herein, a FR represents one of the four sub-regions, and FRs represents two or more of the four sub-regions constituting a framework region. As an example, Table 1-4 list the germline sequences of FRI, 2, 3, and 4 of kappa light chain, respectively. Table 5-7 list the germline sequences of FRI, 2, and 3 of heavy chain according to the Kabat definition, respectively. Table 8-10 list the germline sequences of FR 1, 2 and 3 of heavy chain according to the 25 Chothia definition, respectively. Table 11 lists the germline sequence of FR4 of the heavy chain. [0091] Tables 1-65 [0092] The SEQ ID Number for each sequence described in tables 1-65 is indicated in the first column of each table. 30 Table 1. FRI of Light Chains 1 GATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGC 2 GATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGC 3 GATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGC 4 GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGC 46 WO 2006/102095 PCT/US2006/009745 5 GATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCCCTGGACAGCCGGCCTCCATCTCCTGC 6 GATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTGC 7 GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGC 8 GAGATTGTGATGACCCAGACTCCACTCTCCTTGTCTATCACCCCTGGAGAGCAGGCCTCCATCTCCTGC 5 9 GATATTGTGATGACCCAGACTCCACTCTCCTCGCCTGTCACCCTTGGACAGCCGGCCTCCATCTCCTTC 10 GAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGC 11 GATGTTGTGATGACACAGTCTCCAGCTTTCCTCTCTGTGACTCCAGGGGAGAAAGTCACCATCACCTGC 12 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 13 GAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTCCAAAGGAGAAAGTCACCATCACCTGC 0 14 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 15 GAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTCCAGGAGACAAAGTCAACATCTCCTGC 16 GACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGT 17 GCCATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 18 GACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 5 19 AACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGT 20 GACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGT 2 1 GAAATAGTGATGATGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 22 GCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 23 GACATCCAGATGACCCAGTCTCCATCTTCTGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGT 0 24 GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 25 GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 26 GACATCCAGATGATCCAGTCTCCATCTTTCCTGTCTGCATCTGTAGGAGACAGAGTCAGTATCATTTGC 27 GCCATCCGGATGACCCAGTCTCCATTCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 28 GTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTACAGGAGACAGAGTCACCATCAGTTGT 5 29 GCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 30 GACATCCAGATGACCCAGTCTCCATCTTCCGTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGT 31 GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 32 GACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 33 GCCATCCGGATGACCCAGTCTCCATCCTCATTCTCTGCATCTACAGGAGACAGAGTCACCATCACTTGT 0 34 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 35 GACATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 36 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 37 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 38 GACATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 5 39 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGC 40 GAAATTGTAATGACACAGTCTCCACCCACCCTGTCTTTGTCTCCAGGGGAAAGAGTCACCCTCTCCTGC 41 GAAATTGTAATGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 42 GAAATTGTGTTGACGCAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 43 GAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGC 0 44 GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCAACTGC 45 GATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGC 46 GATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGC Table 2. FR2 of Light Chains 5 47 TGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTAT 48 TGGTTTCAGCAGAGGCCAGGCCAATCTCCAAGGCGCCTAATTTAT 49 TGGTACCTGCAGAAGCCAGGCCAGTCTCCACAGCTCCTGATCTAT 50TGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTAT 51 TGGTACCTGCAGAAGCCAGGCCAGCCTCCACAGCTCCTGATCTAT 50 52 TGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTAT 53 TGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTAT 54 TGGTTTCTGCAGAAAGCCAGGCCAGTCTCCACACTCCTGATCTAT 55 TGGCTTCAGCAGAGGCCAGGCCAGCCTCCAAGACTCCTAATTTAT 56 TGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAG 5 57 TGGTACCAGCAGAAACCAGATCAAGCCCCAAAGCTCCTCATCAAG 58 TGGTATCAGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTAT 59 TGGTACCAGCAGAAACCAGATCAGTCTCCAAAGCTCCTCATCAAG 60TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCGCCTGATCTAT 61 TGGTACCAACAGAAACCAGGAGAAGCTGCTATTTTCATTATTCAA iO 62 TGGTTTCAGCAGAAACCAGGGAAAGCCCCTAAGTCCCTGATCTAT 63 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 64 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 65 TGGTTTCAGCAGAAACCAGGGAAAGTCCCTAAGCACCTGATCTAT 66 TGGTATCAGCAGAAACCAGAGAAAGCCCCTAAGTCCCTGATCTAT WO 2006/102095 PCT/US2006/009745 67 TGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT 68 TGGTATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTAT 69 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 7 0 TGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT 5 71 TGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT 72 TGGTATCTGCAGAAACCAGGGAAATCCCCTAAGCTCTTCCTCTAT 73 TGGTATCAGCAAAAACCAGCAAAAGCCCCTAAGCTCTTCATCTAT 74 TGGTATCAGCAAAAACCAGGGAAAGCCCCTGAGCTCCTGATCTAT 75 TGGTATCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTAT D 76 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 77 TGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT 78 TGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 79 TGGTATCAGCAAAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 8o TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 5 81 TGGTATCGGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTAT 82 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAC 83 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAT 84 TGGTATCGGCAGAAACCAGGGAAAGTTCCTAAGCTCCTGATCTAT 85 TGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTAC D 86 TGGTATCAGCAGAAACCTGGCCAGGCGCCCAGGCTCCTCATCTAT 87 TGGTACCAGCAGAAACCTGGGCAGGCTCCCAGGCTCCTCATCTAT 88 TGGTACCAGCAGAAACCTGGCCTGGCGCCCAGGCTCCTCATCTAT 89 TGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTAT 90 TGGTACCAGCAGAAACCAGGACAGCCTCCTAAGCTGCTCATTTAC 5 91 TGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTAT 92 TGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTAT Table 3. FR3 of Light Chains 93 GGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCT ) GAGGATGTTGGGGTTTATTACTGC 94 GGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCT GAGGATGTTGGGGTTTATTACTGC 95 5 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCT GAGGATGTTGGGGTTTATTACTGA 96 GGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCT GAGGATGTTGGGGTTTATTACTGC ) 97 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCT GAGGATGTTGGGGTTTATTACTGC 98 GGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCT 5 GAGGATGTCGGGGTTTATTACTGC 99 GGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCT GAGGATGTTGGGGTTTATTACTGC 100 0 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAGCCGGGTGGAGGCT GAGGATTTTGGAGTTTATTACTGC 101 GGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAGCAGGGTGGAAGCT GAGGATGTCGGGGTTTATTACTGC 5 102 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAATAGCCTGGAAGCTG AAGATGCTGCAACGTATTACTGT 103 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCTTTACCATCAGTAGCCTGGAAGCTG 0 AAGATGCTGCAACATATTACTGT 104 GGGGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATGTTGCAACTTATTACTGT WO 2006/102095 PCT/US2006/009745 105 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCATAGCCTGGAAGCTG AAGATGCTGCAACGTATTACTGT 106 5 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTATTACTGT 107 GGAATCCCACCTCGATTCAGTGGCAGCGGGTATGGAACAGATTTTACCCTCACAATTAATAACATAGAATCTG AGGATGCTGCATATTACTTCTGT o 108 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTATTACTGt 109 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGCACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG 5 AAGATTTTGCAACTTATTACTGT 110 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAGCAGCCTGCAGCCTG ATGATTTTGCAACTTATTACTGC 111 0 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTATTACTGT 112 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACfCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTATTACTGC 5 113 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTG AAGATTTTGCAGTTTATTACTGT 114 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG 0 AAGATTTTGCAACTTATTACTGT 115 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTACTATTGT 116 5 GGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAGCAGCCTGCAGTCTG AAGATTTTGCAGTTTATTACTGT 117 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGCCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTG AAGATTTTGCAGTTTATTACTGT o 118 GGGGTCTCATCGAGGTTCAGTGGCAGGGGATCTGGGACGGATTTCACTCTCACCATCATCAGCCTGAAGCCTG AAGATTTTGCAGCTTATTACTGT l19 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACGGATTACACTCTCACCATCAGCAGCCTGCAGCCTG t5 AAGATTTTGCAACTTATTACTGT 120 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGTTGCCTGCAGTCTG AAGATTTTGCAACTTATTACTGT 121 0 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTATTACTGT 122 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAACTTACTATTGT 5 123 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTG AAGATTTTGCAGTTTATTACTGT 124 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAGCAGCCTGCAGCCTG 0 AAGATTTTGCAACTTATTACTGT 125 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCTGCCTGCAGTCTG AAGATTTTGCAACTTATTACTGT 126 5 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTG AAGATTTTGCAACTTACTACTGT WO 2006/102095 PCT/US2006/009745 127 GGAGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAGCAGCCTGCAGCCTG AAGATGTTGCAACTTATTACGGT 128 5 GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTG AAGATATTGCAACATATTACTGT 129 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTG AAGATTTTGCAACTTACTACTGT 0 130 GGAGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAGCAGCCTGCAGCCTG AAGATGTTGCAACTTATTACGGT 131 GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAGCAGCCTGCAGCCTG 5 AAGATATTGCAACATATTACTGT 132 AGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAGTTTATTACTGT 133 ,0 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTGCAGCCTG AAGATTTTGCAGTTTATTACTGT 134 GGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTG AAGATTTTGCAGTGTATTACTGT ,5 135 GGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTG AAGATTTTGCAGTGTATTACTGT 136 GGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTG 0 AAGATGTGGCAGTTTATTACTGT 137 GGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCT GAGGATGTTGGAGTTTATTACTGC 138 5 GGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAGCAGGGTGGAGGCT GAGGATGTTGGAGTTTATTACTGC Table.4. FR4 of Light Chains 139 TTCGGCCAAGGGACCAAGGTGGAAATCAAA 140 TTTGGCCAGGGGACCAAGCTGGAGATCAAA 0 141 TTCGGCCCTGGGACCAAAGTGGATATCAAA 142 TTCGGCGGAGGGACCAAGGTGGAGATCAAA 143 TTCGGCCAAGGGACACGACTGGAGATTAAA Table 5. FRI of Heavy Chains (Rabat definition) 144 45 CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTT CTGGTTACACCTTTACC 145 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCT TCTGGATACACCTTCACC 50 146 CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGTTT CCGGATACACCCTCACT 147 CAGGTTCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTT 55 CTGGATACACCTTCACT 148 CAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTT CCGGATACACCTTCACC 149 50 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCA TCTGGATACACCTTCACC WO 2006/102095 PCT/US2006/009745 150 CAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTT CTGGATTCACCTTTACT 5 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTT CTGGAGGCACCTTCAGC 152 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCT TCTGGATACACCTTCACC o 153 CAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCT CTGGGTTCTCACTCAGC 154 CAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCT 5 CTGGGTTCTCACTCAGC 155 CAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCT CTGGGTTCTCACTCAGC 156 0O CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 157 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 5 158 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCT CTGGATTCACTTTCAGT 159 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT 0 CTGGATTCACCTTCAGT 160 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTTGAT I1 5 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 162 GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTTAGC 0 163 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 164 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGT 45 CTGGATTCACCTTCAGT 165 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 166 50 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCGTCAGT 167 GAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTTGAT 55 168 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 169 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTT >0 CTGGATTCACCTTTGGT 170 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGGTTCACCGTCAGT 171 5 GAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT <1i WO 2006/102095 PCT/US2006/009745 172 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGGTTCACCGTCAGT 173 5 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTTAGT 174 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTCAGT 0 175 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCT CTGGGTTCACCTTCAGT 176 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT 5 CTGGATTCACCTTCAGT 177 ' GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATTCACCTTTGAT 178 ,0 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCT CTGGTTACTCCATCAGC 179 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGTACTGTCT CTGGTGGCTCCATCAGC 5 180 CAGGTGCAGCTACAGCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCT ATGGTGGGTCCTTCAGT 181 CACCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT 0 CTGGTGGCTCCATCAGC 182 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CTGGTGGCTCCATCAGT 183 5 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CTGGTGGCTCCATCAGT 184 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CTGGTGGCTCCGTCAGC 0 185 GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGT TCTGGATACAGCTTTACC 186 CAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCT 45 CCGGGGACAGTGTCTCT 187 CAGGTGCAGCTGGTGCAGTCTGGCCATGAGGTGAAGCAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTT CTGGTTACAGTTTCACC Table 6. FR2 of Heavy Chains (Kabat definition) 50 188TGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGA 189TGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGA 190 TGGGTGCGACAGGCTCCTGGAAAAGGGCTTGAGTGGATGGGA 191TGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGA 192TGGGTGCGACAGGCCCCCGGACAAGCGCTTGAGTGGATGGGA 55 193 TGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGA 194 TGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGA 195 TGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGA 196 TGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGA 197 TGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCA 50 198 TGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCA 199 TGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCA 200 TGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCA 201 TGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCA 202 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGC 55 203 TGGGCCCGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCG WO 2006/102095 PCT/JS2006/009745 204 TGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCT 205 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCA 206 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCA 207 TGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCA 5 208 TGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCA 209 TGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCG 210 TGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCA 211TGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCT 212 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCA .0 213 TGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGT 214 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCA 215 TGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCA 216 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCA 217 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCC 5 218 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGC 219 TGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGC 220 TGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCA 22 1TGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCA 222 TGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGG 0 223 TGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGG 224 TGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGG 22s TGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGG 226 TGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGG 227 TGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGG 5 228 TGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGG 229 TGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGG 230 TGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGA 231 TGGGTGCCACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGA Table 7. FR3 of Heavy Chains (Kabat definition) 0 232 AGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGAC ACGGCCGTGTATTACTGTGCGAGA 233 AGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTGACGAC 5 ACGGCCGTGTATTACTGTGCGAGA 234 AGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ACGGCCGTGTATTACTGTGCAACA 235 0 AGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ATGGCTGTGTATTACTGTGCGAGA 236 AGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ACAGCCATGTATTACTGTGCAAGA 45 237 AGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ACGGCCGTGTATTACTGTGCGAGA 238 AGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCGAGGAC 50 ACGGCCGTGTATTACTGTGCGGCA 239 AGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ACGGCCGTGTATTACTGTGCGAGA 240 55 AGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGAC ACGGCCGTGTATTACTGTGCGAGA 241 AGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAACATGGACCCTGTGGACA CAGCCACATATTACTGTGCACGG 50 242 AGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGAC ACAGCCACATATTACTGTGCACAC 243 AGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTGTGGACA >5 CAGCCACGTATTATTGTGCACGG WO 2006/102095 PCT/US2006/009745 244 CGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGAC ACGGCCGTGTATTACTGTGCGAGA 245 5 CGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCGGGGACA CGGCTGTGTATTACTGTGCAAGA 246 AGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCGAGGAC ACAGCCGTGTATTACTGTACCACA 0 247 CGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCGAGGAC ATGGCTGTGTATTACTGTGTGAGA 248 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGAC 5 ACGGCCTTGTATCACTGTGCGAGA 249 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGAC ACGGCTGTGTATTACTGTGCGAGA 250 '0 CGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGAC ACGGCCGTATATTACTGTGCGAAA 251 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGAC ACGGCTGTGTATTACTGTGCGAGA 252 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGAC ACGGCTGTGTATTACTGTGCGAGA 253 CGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCGAGGACA 0 CGGCTGTGTATTACTGTGTGAGA 254 AGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTGAGGGCA CGGCCGTGTATTACTGTGCCAGA 255 5 CGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTGAGGAC ACCGCCTTGTATTACTGTGCAAAA 256 CGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGACGAGGAC ACGGCTGTGTATTACTGTGCGAGA .0 257 AG/TTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCGAGGAC ACAGCCGTGTATTACTGTACTAGA 258 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCGAGGACA 45 CGGCCGTGTATTACTGTGCGAGA 259 AGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTGAGGACA TGGCTGTGTATTACTGTGCGAGA 260 50 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTGAGGACA CGGCTGTGTATTACTGTGCGAGA 261 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGAC ACGGCTGTGTATTACTGTGCGAGA 55 262 AGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGCAAATGAACAGCCTGAAAACCGAGGAC ACGGCCGTGTATTACTGTGCTAGA 263 AGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCGAGGAC 50 ACGGCCGTGTATTACTGTACTAGA 264 CGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCGAGGAC ACGGCTGTGTATTACTGTGCAAGA 265 55 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTGAGGACA CGGCCTTGTATTACTGTGCAAAA WO 2006/102095 PCT/US2006/009745 266 CGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGTGGACA CGGCCGTGTATTACTGTGCGAGA 267 5 CGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCGCGGACA CGGCCGTGTATTACTGTGCGAGA 268 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACA CGGCTGTGTATTACTGTGCGAGA 0 269 CGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCAGACA CGGCTGTGTATTACTGTGCGAGA 270 CGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCGCGGACA 5 CGGCCGTGTATTACTGTGCGAGA 271 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACA CGGCCGTGTATTACTGTGCGAGA 272 ,0 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTGCGGACA CGGCCGTGTATTACTGTGCGAGA 273 CAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACA CCGCCATGTATTACTGTGCGAGA .5 274 CGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCGAGGACA CGGCTGTGTATTACTGTGCAAGA 275 CGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGCAGATCAGCAGCCTAAAGGCTGAGGACA 0 TGGCCATGTATTACTGTGCGAGA Table 8. FRI of Heavy Chains (Chothia definition) 276 CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTT CT 5 277 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCT TCT 278 CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGTTT 279 CAGGTTCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCTT CT 280 45 CAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCAGTGAAGGTTTCCTGCAAGGCTT CC 281 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGCA TCT 50 282 CAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCAGTGAAGGTCTCCTGCAAGGCTT CT 283 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGTCTCCTGCAAGGCTT >5 CT 284 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCT TCT 285 50 CAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCTGACCTGCACCGTCT CT 286 CAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCTGACCTGCACCTTCT CT WO 2006/102095 PCT/US2006/009745 287 CAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACTGACCTGCACCTTCT CT 288 5 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 289 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 0 290 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGACTCTCCTGTGCAGCCT CT 291 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT .5 CT 292 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 293 "0 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 294 GA (3GTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT .5 295 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCT CT 296 CA (3GTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGT 0 CT 297 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCCCTGAGACTCTCCTGTGCAGCCT CT 298 5 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 299 GAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT -0 300 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 301 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCCCTGAGACTCTCCTGTACAGCTT 45 CT 302 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 303 50 GAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 304 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 55 305 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT 306 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGAGGGTCCCTGAGACTCTCCTGTGCAGCCT 50 CT 307 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAAACTCTCCTGTGCAGCCT CT 308 55 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CT WO 2006/102095 PCT/US2006/009745 309 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTCTCCTGTGCAGCCT CT 310 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCTCACCTGCGCTGTCT CT 311 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCTCACCTGTACTGTCT CT 312 CAGGTGCAGCTACAGCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCGCTGTCT AT 313 CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CT 314 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CT 315 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CT 316 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CT 3 17 GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGT TCT 318 CAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCACTCACCTGTGCCATCT cc 319 CAGGTGCAGCTGGTGCAGTCTGGCCATGAGGTGAAGCAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTT CT Table 9. FR2 of Heavy Chains (Chothia definition) 320 TATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATC 321 TACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATC 322 TTATCCATGCACTGGGTGCGACAGGCTCCTGGAAAAGGGCTTGAGTGGATGGGAGGTTTT 323 TATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTTGAGTGGATGGGATGGAGC 324 CGCTACCTGCACTGGGTGCGACAGGCCCCCGGACAAGCGCTTGAGTGGATGGGATGGATC 325 TACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAATAATC 326 TCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTTGAGTGGATAGGATGGATC 327 TATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGAGGGATC 328 TATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTTGAGTGGATGGGATGGATG 329 ATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACACATT 330 GTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTGGAGTGGCTTGCACTCATT 331 ATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTGGAGTGGCTTGCACTCATT 332 TACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATT 333 TACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTGGAGTGGGTCTCAGCTATT 334 GCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTATT 335 AGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTT 336 TATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGAGTGGGTCTCTGGTATT 337 TATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATT 338 TATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGCTATT 339 TATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATA 340 TATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATA 341 AGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTGGAGTGGGTATCGGGTGTT 342 AATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCATCCATT 343 TATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTGGAGTGGGTCTCTCTTATT 344 TATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTTCATACATT 345 TATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTAGGTTTCATT 346 AACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATT 347 TATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGCTATT 348 AACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGTTATT 349 TATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTGGCCAACATA 350 CACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTACT 57 WO 2006/102095 PCT/US2006/009745 3 51 TCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTGGAGTGGGTTGGCCGTATT 352 TACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTGGTGTGGGTCTCACGTATT 353 TATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTGGAGTGGGTCTCAGGTATT 354 AACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTACATC 5 355 TACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTGGAGTGGATTGGGTACATC 356 TACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGGAAATC 357 TACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATC 358 TACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTGGAGTGGATTGGGCGTATC 359 TACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATC O 360 TACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGGTATATC 361 TACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATC 362 GCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTTGAGTGGCTGGGAAGGACA 363 TATGGTATGAATTGGGTGCCACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGTTC Table 10. FR3 of Heavy Chains (Chothia definition) .5 364 ACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATG GAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGA 365 ACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATG 0 GAGCTGAGCAGGCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGA 366 ACAATCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCAACA 367 .5 ACAAAATATTCACAGGAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACATGGCTGTGTATTACTGTGCGAGA 368 ACCAACTACGCACAGAAATTCCAGGACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACACAGCCATGTATTACTGTGCAAGA o 369 ACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGA 370 ACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATG 5 GAGCTGAGCAGCCTGAGATCCGAGGACACGGCCGTGTATTACTGTGCGGCA 371 GCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGA 372 0 ACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATG GAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTGTATTACTGTGCGAGA 373 AAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTA CCATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACGG 45 374 AAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTA CAATGACCAACATGGACCCTGTGGACACAGCCACATATTACTGTGCACAC 375 AAATACTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTA 50 CAATGACCAACATGGACCCTGTGGACACAGCCACGTATTATTGTGCACGG 376 ATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGC AAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGA 377 55 ACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTC AAATGAACAGCCTGAGAGCCGGGGACACGGCTGTGTATTACTGTGCAAGA 378 ACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGC AAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACCACA 50 379 ACGCACTATGTGGACTCCGTGAAGCGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGC AAAAGAACAGACGGAGAGCCGAGGACATGGCTGTGTATTACTGTGTGAGA 380 ACAGGTTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGC >5 AAATGAACAGTCTGAGAGCCGAGGACACGGCCTTGTATCACTGTGCGAGA WO 2006/102095 PCT/US2006/009745 381 ATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGC AAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGA 382 ACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC AAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAA 383 AAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC AAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGA 384 AAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC AAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGA 385 ACGCACTATGCAGACTCTGTGAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGC AAACGAATAGCCTGAGGGCCGAGGACACGGCTGTGTATTACTGTGTGAGA 386 ACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC AAATGAACAACCTGAGAGCTGAGGGCACGGCCGTGTATTACTGTGCCAGA 387 ACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGC AAATGAACAGTCTGAGAACTGAGGACACCGCCTTGTATTACTGTGCAAAA 388 ATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGC AAATGAACAGCCTGAGAGACGAGGACACGGCTGTGTATTACTGTGCGAGA 389 ACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGC AAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTACTAGA 390 ACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC AAATGAACAGCCTGAGAGCCGAGGACACGGCCGTGTATTACTGTGCGAGA 391 ACATATTATGCAGACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC AAATGGGCAGCCTGAGAGCTGAGGACATGGCTGTGTATTACTGTGCGAGA 392 ACATACTACGCAGACTCCGTGAAGGGCCGATrCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC AAATGAACAGCCTGAGAGCTGAGGACACGGCTGTGTATTACTGTGCGAGA 393 AAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGC AAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGA 394 ACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGC AAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTGCTAGA 395 ACAGCATATGCTGCGTCGGTGAAAGGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGC 5 AAATGAACAGCCTGAAAACCGAGGACACGGCCGTGTATTACTGTACTAGA 396 ACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTG CAAATGAACAGTCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCAAGA 397 ) ATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGC AAATGAACAGTCTGAGAGCTGAGGACACGGCCTTGTATTACTGTGCAAAA 398 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACCGCCGTGGACACGGCCGTGTATTACTGTGCGAGA 5399 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACTGCCGCGGACACGGCCGTGTATTACTGTGCGAGA 400 ACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA ) AGCTGAGCTCTGTGACCGCCGCGGACACGGCTGTGTATTACTGTGCGAGA 401 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACCGCCGCAGACACGGCTGTGTATTACTGTGCGAGA 402 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACCGCCGCGGACACGGCCGTGTATTACTGTGCGAGA 50 WO 2006/102095 PCT/US2006/009745 403 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGA 404 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA AGCTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTATTACTGTGCGAGA 405 ACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGC AGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGA 406 AATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGC AGCTGAACTCTGTGACTCCCGAGGACACGGCTGTGTATTACTGTGCAAGA 407 CCAACATATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGC AGATCAGCAGCCTAAAGGCTGAGGACATGGCCATGTATTACTGTGCGAGA Table 11. FR4 of Heavy Chain 408 TGGGGCCAGGGCACCCTGGTCACCGTCTCCTCA 409 TGGGGCCGTGGCACCCTGGTCACTGTCTCCTCA 410 TGGGGCCAAGGGACAATGGTCACCGTCTCTTCA 411 TGGGGCCAAGGAACCCTGGTCACCGTCTCCTCA 412 TGGGGCCAAGGAACCCTGGTCACCGTCTCCTCA 4]3 TGGGGGCAAGGGACCACGGTCACCGTCTCCTCA [0093] As used herein, the term "germline antibody gene" or "gene fragment" refers to an immunoglobulin sequence encoded by non-lymphoid cells that have not undergone the maturation process that leads to genetic rearrangement and mutation for expression of a particular immunoglobulin. (See, e.g., Shapiro et ai, Crit. Rev. Immunol. 22(3): 183-200 (2002); Marchalonis et al, Adv Exp Med Biol. 484:13-30 (2001)). One of the advantages provided by various embodiments of the present invention stems from the recognition that germline antibody genes are more likely than mature antibody genes to conserve essential amino acid sequence structures characteristic of individuals in the species, hence less likely to be recognized as from a foreign source when used therapeutically in that species. [00941 As used herein, the term "humanized antibody" is an antibody or a variant, derivative, analog or fragment thereof which immunospecifically binds to an antigen of interest and which comprises a framework (FR) region having substantially the amino acid sequence of a human antibody and a complementarity determining region (CDR) having substantially the amino acid sequence of a non-human antibody. As used herein, the term "substantially" in the context of a CDR refers to a CDR having an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of a non-human antibody CDR. A humanized antibody comprises substantially all of at least one, and typically two, variable domains (Fab, Fab', F(ab') 2 , FabC, Fv) in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin (i.e., donor antibody) and all or substantially all of the framework regions WO 2006/102095 PCT/US2006/009745 are those of a human immunoglobulin sequence. In certain embodiments, a humanized antibody also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. In some embodiments, a humanized antibody contains both the light chain as well as at least the variable domain of a heavy chain. The 5 antibody also may include the CHl , hinge, CH2, CH3, and CH4 regions of the heavy chain. In some embodiments, a humanized antibody only contains a humanized light chain. In some embodiments, a humanized antibody only contains a humanized heavy chain. hi specific embodiments, a humanized antibody only contains a humanized variable domain of a light chain and/or humanized heavy chain. .0 [0095] The humanized antibody can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including without limitation IgG 1 , IgG 2 , IgG 3 and IgG 4 . The humanized antibody may comprise sequences from more than one class or isotype, and particular constant domains may be selected to optimize desired effector functions using techniques well-known in the art. .5 [0096] The framework and CDR regions of a humanized antibody need not correspond precisely to the parental sequences, e.g., the donor antibody CDR or the acceptor framework may be mutagenized by substitution, insertion and/or deletion of at least one amino acid residue so that the CDR or framework residue at that site does not correspond to either the donor antibody or the acceptor framework. Such mutations, however, will not be ,0 extensive. Usually, at least 80%, or at least 85%, or at least 90%, or at least 95% of the humanized antibody residues will correspond to those of the parental FR and CDR sequences. [0097] As used herein, the term "host cell" includes a to the particular subject cell transfected or transformed with a nucleic acid molecule and the progeny or potential progeny of such a cell. Progeny of such a cell may not be identical to the parent cell transfected with 25 the nucleic acid molecule due to mutations or environmental influences that may occur in succeeding generations or integration of the nucleic acid molecule into the host cell genome. [0098] As used herein, the term "immunospecifically binds to an antigen" and analogous terms refer to peptides, polypeptides, proteins (including, but not limited to fusion proteins and antibodies) or fragments thereof that specifically bind to an antigen or a 30 fragment and do not specifically bind to other antigens. A peptide, polypeptide, or protein that immunospecifically binds to an antigen may bind to other antigens with lower affinity as determined by, e.g., immunoassays, BlAcore, or other assays known in the art. Antibodies or WO 2006/102095 PCT/US2006/009745 fragments that immunospecifically bind to an antigen may be cross-reactive with related antigens. Preferably, antibodies or fragments that immunospecifically bind to an antigen do not cross-react with other antigens. [0099] As used herein, the term "isolated" in the context of a proteinaceous agent 5 (e.g., a peptide, polypeptide or protein (such as fusion protein or antibody)) refers to a proteinaceous agent which is substantially free of cellular material or contaminating proteins, polypeptides, peptides and antibodies from the cell or tissue source from which it is derived, or substantially free of chemical precursors or other chemicals when chemically synthesized. The language "substantially free of cellular material" includes preparations of a proteinaceous 10 agent in which the proteinaceous agent is separated from cellular components of the cells from which it is isolated or recombinantly produced. Thus, a proteinaceous agent that is substantially free of cellular material includes preparations of a proteinaceous agent having less than about 30%, 20%, 10%, or 5% (by dry weight) of heterologous protein, polypeptide or peptide (also referred to as a "contaminating protein"). When the proteinaceous agent is 15 recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, 10%, or 5% of the volume of the proteinaceous agent preparation. When the proteinaceous agent is produced by chemical synthesis, it is preferably substantially free of chemical precursors or other chemicals, i.e., it is separated from chemical precursors or other chemicals which are involved in the synthesis 20 of the proteinaceous agent. Accordingly, such preparations of a proteinaceous agent have less than about 30%, 20%, 10%, 5% (by dry weight) of chemical precursors or compounds other than the proteinaceous agent of interest. In a specific embodiment, proteinaceous agents disclosed herein are isolated. In another specific embodiment, an antibody of the invention is isolated. 25 [0100] As used herein, the term "isolated" in the context of nucleic acid molecules refers to a nucleic acid molecule which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, is preferably substantially free of other cellular material, or culture medium when produced by recombinant techniques, or 30 substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, nucleic acid molecules are isolated. In one embodiment, a nucleic acid molecule encoding an antibody of the invention is isolated. As used herein, the term "substantially free" refers to the preparation of the "isolated" nucleic acid having less than WO 2006/102095 PCT/US2006/009745 about 30%, 20%, 10%, or 5% (by dry weight) of heterologous nucleic acids, and preferably other cellular material, culture medium, chemical precursors, or other chemicals. [0101] As used herein, the term "in combination" refers to the use of more than one therapies (e.g., more than one prophylactic agent and/or therapeutic agent). The use of the 5 term "in combination" does not restrict the order in which therapies (e.g., prophylactic and/or therapeutic agents) are administered to a subject. A first therapy (e.g., a first prophylactic or therapeutic agent) can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), .0 concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapy (e.g., a second prophylactic or therapeutic agent) to a subject. [0102] As used herein, the terms "manage," "managing," and "management" refer to 5 the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent), which does not result in a cure of the disease. In certain embodiments, a subject is administered one or more therapies (e.g., one or more prophylactic or therapeutic agents) to "manage" a disease so as to prevent the progression or worsening of the disease. [0103] As used herein, the term "mature antibody gene" refers to a genetic sequence ,0 encoding an immunoglobulin that is expressed, for example, in a lymphocyte such as a B cell, in a hybridoma or in any antibody producing cell that has undergone a maturation process so that the particular immunoglobulin is expressed. The term includes mature genomic DNA, cDNA and other nucleic acid sequences that encode such mature genes, which have been isolated and/or recombinantly engineered for expression in other cell types. Mature antibody 25 genes have undergone various mutations and rearrangements that structurally distinguish them from antibody genes encoded in all cells other than lymphocytes. Mature antibody genes in humans, rodents, and many other mammals are formed by fusion of V and J gene segments in the case of antibody light chains and fusion of V, D, and J gene segments in the case of antibody heavy chains. Many mature antibody genes acquire point mutations 30 subsequent to fusion, some of which increase the affinity of the antibody protein for a specific antigen. WO 2006/102095 PCT/US2006/009745 [0104] As used herein, the term "pharmaceutically acceptable" refers approved by a regulatory agency of the federal or a state government, or listed in the U.S. Pharmacopeia, European Pharmacopeia, or other generally recognized pharmacopeia for use in animals, and more particularly, in humans. 5 [0105] As used herein, the terms "prevent," "preventing," and "prevention" refer to the inhibition of the development or onset of a disorder or the prevention of the recurrence, onset, or development of one or more symptoms of a disorder in a subject resulting from the administration of a therapy (e.g., a prophylactic or therapeutic agent), or the administration of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents). 0 [0106] As used herein, the terms "prophylactic agent" and "prophylactic agents" refer to any agent(s) which can be used in the prevention of a disorder or one or more of the symptoms thereof. In certain embodiments, the term "prophylactic agent" refers to an antibody of the invention. In certain other embodiments, the term "prophylactic agent" refers to an agent other than an antibody of the invention. Preferably, a prophylactic agent is an 5 agent which is known to be useful to or has been or is currently being used to the prevent or impede the onset, development, progression and/or severity of a disorder or one or more symptoms thereof. [0107] As used herein, the term "prophylactically effective amount" refers to the amount of a therapy (e.g. , prophylactic agent) which is sufficient to result in the prevention of D the development, recurrence, or onset of a disorder or one or more symptoms thereof, or to enhance or improve the prophylactic effect(s) of another therapy (e.g., a prophylactic agent). [0108] As used herein, the phrase "protocol" refers to a regimen for dosing and timing the administration of one or more therapies (e.g., therapeutic agents) that has a therapeutic effective. 5 [0109] As used herein, the phrase "side effects" encompasses unwanted and adverse effects of a prophylactic or therapeutic agent. Side effects are always unwanted, but unwanted effects are not necessarily adverse. An adverse effect from a therapy (e.g., a prophylactic or therapeutic agent) might be harmful, uncomfortable, or risky. [0110] As used herein, the term "small molecules" and analogous terms include, but 0 are not limited to, peptides, peptidomimetics, amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a WO 2006/102095 PCT/US2006/009745 molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and 5 salts, esters, and other pharmaceutically acceptable forms of such agents. [0111] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the terms "subject" and "subjects" refer to an animal, preferably a mammal including a non-primate (e.g., a cow, pig, horse, cat, dog, rat, and mouse) and a primate (e.g., a monkey, such as a cynomolgous monkey, a chimpanzee, and a human), and most preferably 0 a human. In one embodiment, the subject is a non-human animal such as a bird (e.g., a quail, chicken, or turkey), a farm animal (e.g., a cow, horse, pig, or sheep), a pet (e.g., a cat, dog, or guinea pig), or laboratory animal (e.g., an animal model for a disorder). In a specific embodiment, the subject is a human (e.g., an infant, child, adult, or senior citizen). [0112] As used herein, the term "synergistic" refers to a combination of therapies 5 (e.g., prophylactic or therapeutic agents) which is more effective than the additive effects of any two or more single therapies (e.g., one or more prophylactic or therapeutic agents). A synergistic effect of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents) permits the use of lower dosages of one or more of therapies (e.g., one or more prophylactic or therapeutic agents) and/or less frequent administration of said therapies 0 to a subject with a disorder. The ability to utilize lower dosages of therapies (e.g., prophylactic or therapeutic agents) and/or to administer said therapies less frequently reduces the toxicity associated with the administration of said therapies to a subject without reducing the efficacy of said therapies in the prevention or treatment of a disorder. In addition, a synergistic effect can result in improved efficacy of therapies (e.g., prophylactic or 5 therapeutic agents) in the prevention or treatment of a disorder. Finally, synergistic effect of a combination of therapies (e.g., prophylactic or therapeutic agents) may avoid or reduce adverse or unwanted side effects associated with the use of any single therapy. [0113] As used herein, the terms "therapeutic agent" and "therapeutic agents" refer to any agent(s) which can be used in the prevention, treatment, management, or amelioration of 0 a disorder or one or more symptoms thereof. In certain embodiments, the term "therapeutic agent" refers to an antibody of the invention. In certain other embodiments, the term "therapeutic agent" refers an agent other than an antibody of the invention. Preferably, a therapeutic agent is an agent which is known to be useful for, or has been or is currently WO 2006/102095 PCT/US2006/009745 being used for the prevention, treatment, management, or amelioration of a disorder or one or more symptoms thereof. 10114] As used herein, the term "therapeutically effective amount" refers to the amount of a therapy (e.g., an antibody of the invention), which is sufficient to reduce the 5 severity of a disorder, reduce the duration of a disorder, ameliorate one or more symptoms of a disorder, prevent the advancement of a disorder, cause regression of a disorder, or enhance or improve the therapeutic effect(s) of another therapy. [0115] As used herein, the temis "therapies" and "therapy" can refer to any protocol(s), method(s), and/or agent(s) that can be used in the prevention, treatment, 0 management, and/or amelioration of a disorder or one or more symptoms thereof. In certain embodiments, the terms "therapy" and "therapy" refer to anti-viral therapy, anti-bacterial therapy, anti-fungal therapy, anti-cancer agent, biological therapy, supportive therapy, and/or other therapies useful in treatment, management, prevention, or amelioration of a disorder or one or more symptoms thereof known to one skilled in the art, for example, a medical 5 professional such as a physician. [01161 As used herein, the terms "treat," "treatment," and "treating" refer to the reduction or amelioration of the progression, severity, and/or duration of a disorder or amelioration of one or more symptoms thereof resulting from the administration of one or more therapies (including, but not limited to, the administration of one or more prophylactic 0O or therapeutic agents). 4. BRIEF DESCRIPTION OF THE FIGURES [01171 Figure 1. Nucleic acid and protein sequences of the heavy and light chains of the mouse anti-human EphA2 monoclonal antibody B233. CDR1, 2 and 3 regions as defined by Kabat are boxed. The full amino acid sequences of the variable heavy (V H) and light (V L) 25 chains are given using the standard one letter code. [0118] Figure 2. Phage vector used for screening of the framework shuffling libraries and expression of the corresponding Fab fragments. Streptavidin purified, single-stranded DNA of each of the VL and VH genes is annealed to the vector by hybridization mutagenesis using homology in the gene 3 leader/CK and gene 3 leader/Cyl regions, respectively. The 30 unique Xbal site in the palindromic loops allows elimination of the parental vector. V H and V L genes are then expressed in frame with the first constant domain of the human K1 heavy chain and the constant domain of the human kappa (K) light chain, respectively. 66 WO 2006/102095 PCT/US2006/009745 [01191 Figure 3. Protein sequences of framework-shuffled, humanized clones of the anti-human EphA2 monoclonal antibody B233 isolated after screening of libraries A and B. CDR, 2 and 3 regions as defined by Kabat are boxed. The full amino acid sequences of the variable heavy (V H) and light (V L) chains are given using the standard one letter code. 5 [0120] Figure 4. ELISA titration using Fab extracts on immobilized human EphA2 Fc. [0121] Figure 5. Sequence analysis of framework shuffled antibodies. aPercent identity at the amino acid level was calculated for each individual antibody framework using mAb B233 for reference. 0 [0122] Figure 6. Nucleic acid and protein sequences of the heavy and light chains of the mouse anti-human EphA2 monoclonal antibody EA2. CDR1, 2 and 3 regions as defined by Kabat are boxed. The full amino acid sequences of the variable heavy (VH) and light (VL) chains are given using the standard one letter code. [0123] Figure 7. Protein sequences of framework-shuffled, humanized clone 4H5 5 isolated after screening of library D. Its CDRL3 -corrected version (named "corrected 4H5") differs by a single amino acid at position L93 (bold) so as to completely match the CDRL3 of parental mAb EA2. CDR1, 2 and 3 regions as defined by Kabat are boxed. The full amino acid sequences of the variable heavy (VH) and light (VL) chains are given using the standard one letter code. 0 [0124] Figure 8. ELISA titration using Fab periplasmic extracts on immobilized human EphA2-Fc. [0125] Figure 9. Sequence analysis of framework shuffled antibodies. "Percent identity at the amino acid level was calculated for each individual antibody framework using mAb EA2 for reference. 25 [0126] Figure 10. DSC Therograms of Chimaeric EA2 and Framework-Shuffled Antibodies. Top left panel is the DSC scan for the isolated Fc domain used to construct all the antibodies. Two discrete peaks are seen for the Fc domain at ~68'C and -83'C. Top right panel is the DSC scan for the intact chimaeric EA2, the Tm of the Fab domain is -80 0 C. Bottom left and right panels are the DSC scans for 4H5 and 4H5 corrected, respectively, 30 both have a Fab Tm of -82 0 C. WO 2006/102095 PCT/US2006/009745 [01271 Figure 11. DSC Therograms of Chimaeric B233 and Framework-Shuffled Antibodies. Top left panel is the DSC scan for the Chimaeric B233, the Tm for the Fab domain is -63'C. The DSC scans for the framework-shuffled 2G6, 6H 1 and 7E8 are shown in the top right, bottom left and bottom right panels, respectively. The Tm for the Fab domains of 2G6, 6H1 1 and 7E8 are each -75 0 C. [0128] Figure 12. Isoelectric focusing (IEF) gel of the Chimaeric and Framework Shuffled Antibodies. The pi of each antibody for the puroposes of this anaylsis is the pi of the major band. EA2 -8.96, 4H5 -8.29, 4H5 corrected -8.09, B233 -8.0, 6Hl 1 - 8.88, 2G6 -8.76 and 7E8-8.75. [01291 Figure 13. Diagram of One Method for Light Chain Combinatorial Construction. Panel A details the use of overlapping PCR to construct a sub-bank of human light chain frameworks using overlapping oligos. A pool of oligos (single or double stranded) representing each framework may be utilized as a sub-bank for some applications. Panel B details the use of overlapping PCR to construct combinatorial sub-libraries of light chain variable region fragments using overlapping primers and the sub-banks generated in panel A. Note that a pool of oligos representing each framework may be utilized as sub banks. Panel C details the use overlapping PCR to construct a combinatorial-library of light chain variable regions using overlapping primers and the sub-libraries generated in panel B. Panel D details the use of overlapping PCR to construct a combinatorial-library of light chain variable regions using overlapping primers and a pool of oligos representing each framework. Note that the sub-banks of frameworks may also be utilized in place of the pool of oligos. These steps may be repeated to generate a heavy chain combinatorial library. The libraries may be expressed together or paired with an appropriate antibody variable region (e.g., a donor antibody variable region, a humanized antibody variable region, etc) for screening and 5 selection. 5. DETAILED DESCRIPTION OF THE INVENTION [01301 The present invention provides methods of re-engineering or re-shaping an antibody (i.e.., a donor antibody) by fusing together nucleic acid sequences encoding CDRs in frame with nucleic acid sequences encoding framework regions, wherein at least one CDR is from the donor antibody and at least one framework region is from a sub-bank of framework regions (e.g., a sub-bank sequences encoding some or all known human germline WO 2006/102095 PCT/US2006/009745 light chain FRI frameworks). One method for generating re-engineered or re-shaped antibodies is detailed in Figure 13. Accordingly, the present invention also provides re engineered or re-shaped antibodies produced by the methods of the present invention. The re-engineered or re-shaped antibodies of the current invention are also referred to herein as 5 "modified antibodies," "humanized antibodies," "framework shuffled antibodies" and more simply as "antibodies of the invention." As used herein, the antibody from which one or more CDRs are derived is a donor antibody. In some embodiments, a re-engineered or re shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or six CDRs from a donor antibody. In some embodiments, a re 0 engineered or re-shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or eight frameworks from a sub-bank of framework regions. [0131] In addition, the present invention also provides methods of generating novel antibodies by fusing together nucleic acid sequences encoding CDRs in frame with nucleic 5 acid sequences encoding framework regions, wherein the sequences encoding the CDRs are derived from multiple donor antibodies, or are random sequences and at least one framework region is from a sub-bank of framework regions (e.g., a sub-bank of sequences encoding some or all known human light chain FRI frameworks). [0132] The methods of the present invention may be utilized for the production of a 0 re-engineered or re-shaped antibody from a first species, wherein the re-engineered or re shaped antibody does not elicit undesired immune response in a second species, and the re engineered or re-shaped antibody retains substantially the same or better antigen binding ability of the antibody from the first species. Accordingly, the present invention provides re engineered or re-shaped antibodies comprising one or more CDRs from a first species and at .5 least one framework from a second species. In some embodiments, a re-engineered or re shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or six CDRs from a first species. In some embodiments, a re engineered or re-shaped antibody of the invention comprises at least one, or at least two, or at least three, or at least four, or at least five, or at least six, or at least seven, or eight 0 frameworks from a second species. In a specific embodiment, re-engineered or re-shaped antibodies of the present invention comprise at least one framework from a second species having less than 60%, or less than 70%, or less than 80%, or less than 90% homology to the corresponding framework of the antibody from the first species (e.g. light chain FWl of the WO 2006/102095 PCT/US2006/009745 re-engineered or re-shaped antibody is derived from a second species and is less than 60% homologous to light chain FWl of the antibody from the first species). [0133] The methods of the present invention may be utilized for the production of a re-engineered or re-shaped antibody from a first species, wherein the re-engineered or re 5 shaped antibody has improved and/or altered characteristics, relative to the antibody from a first species. The methods of the present invention may also be utilized to re-engineer or re, shape a donor antibody, wherein the re-engineered or re-shaped antibody has improved and/or altered characteristics, relative to the donor antibody. Antibody characteristics which may be improved by the methods described herein include, but are not limited to, binding 0 properties (e.g., antibody-antigen binding constants such as, Ka, Kd, KW, Kjf, antibody stability in vivo (e.g., serum half-lives) and/or in vitro (e.g., shelf-life), melting temperture (Tm) of the antibody (e.g., as determined by Differential scanning calorimetry (DSC) or other method known in the art), the pi of the antibody (e.g., as determined Isoelectric focusing (IEF) or other methods known in the art), antibody solubility (e.g., solubility in a 5 pharmaceutically acceptable carrier, diluent or excipient), effector function (e.g., antibody dependent cell-mediated cytotoxicity (ADCC)) and production levels (e.g., the yield of an antibody from a cell). In accordance with the present invention, a combinatorial library comprising the CDRs of the antibody from the first species fused in frame with framework regions from one or more sub-banks of framework regions derived from a second species can 0 be constructed and screened for the desired modified and/or improved antibody. [0134] The present invention also provides cells comprising, containing or engineered to express the nucleic acid sequences described herein. The present invention provides a method of producing a heavy chain variable region (e.g., a humanized heavy chain variable region), said method comprising expressing the nucleotide sequence encoding a heavy chain 25 variable region (e.g., a humanized heavy chain variable region) in a cell described herein. The present invention provides a method of producing an light chain variable region (e.g., a humanized light chain variable region), said method comprising expressing the nucleotide sequence encoding a light chain variable region (e.g., a humanized light chain variable region) in a cell described herein. The present invention also provides a method of producing 30 an antibody (e.g., a humanized antibody) that immunospecifically binds to an antigen, said method comprising expressing the nucleic acid sequence(s) encoding the humanized antibody contained in the cell described herein. WO 2006/102095 PCT/US2006/009745 [0135] The present invention provides re-engineered or re-shaped antibodies produced by the methods described herein. In a specific embodiment, the invention provides humanized antibodies produced by the methods described herein. In another embodiment, the invention provides re-engineered or re-shaped (e.g., humanized) antibodies produced by 5 the methods described herein have one or more of the following properties improved and/or altered: binding properties, stability in vivo and/or in vitro, thermal melting temperture (Tn), pi, solubility, effector function and production levels. The present invention also provides a composition comprising an antibody produced by the methods described herein and a carrier, diluent or excipient. In a specific embodiment, the invention provides a composition 0 comprising a humanized antibody produced by the methods described herein and a carrier, diluent or excipient. Preferably, the compositions of the invention are pharmaceutical compositions in a form for its intended use. [0136] For clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections: 5 (i) construction of a global bank of acceptor framework regions (ii) selection of CDRs (iii) construction of combinatorial sub-libraries (iv) construction of combinatorial libraries (v) expression of the combinatorial libraries 3 (vi) selection of re-engineered or re-shaped antibodies (vii) production and characterization of re-engineered or re-shaped antibodies (viii) antibody conjugates (ix) uses of the compositions of the invention (x) administration and formulations 5 (xi) dosage and frequency of administration (xii) biological assays (xiii) kits (xiv) article of manufacture (xv) exemplary embodiments WO 2006/102095 PCT/US2006/009745 5.1 Construction of a Global Bank of Acceptor Framework Regions [0137] According to the present invention, a variable light chain region and/or variable heavy chain region of a donor antibody (e.g., a non-human antibody) can be modified (e.g., humanized) by fusing together nucleic acid sequences encoding framework 5 regions (FRI, FR2, FR3, FR4 of the light chain, and FRI, FR2, FR3, FR4 of the heavy chain) of an acceptor antibody(ies) (e.g., a human antibody) and nucleic acid sequences encoding complementarity-determining regions (CDRI, CDR2, CDR3 of the light chain, and CDRI, CDR2, CDR3 of the heavy chain) of the donor antibody. Preferably, the modified (e.g., humanized) antibody light chain comprises FRI, CDRI, FR2, CDR2, FR3, CDR3, and FR4. 10 A modified (e.g., humanized) antibody heavy chain comprises FRI, CDR1, FR2, CDR2, FR3, CDR3, and FR4. Each acceptor (e.g., human) framework region (FRI, 2, 3, 4 of light chain, and FRI, 2, 3, 4 of heavy chain) can be generated from FR sub-banks for the light chain and FR sub-banks for the heavy chain, respectively. A global bank of acceptor (e.g., human) framework regions comprises two or more FR sub-banks. One method for [5 generating light chain FR sub-banks is further detailed in Figure 13A. A similar process may be utilized for the generation of heavy chain FR sub-banks. [01381 In one embodiment, a FR sub-bank comprises at least two different nucleic acid sequences, each nucleotide sequence encoding a particular framework (e.g., light chain FRI). In another embodiment, a FR sub-bank comprises at least two different nucleic acid 10 sequences, each nucleotide sequence encoding a particular human framework (e.g., human light chain FRl). It is contemplated that an FR sub-bank may comprise partial frameworks and/or framework fragments. In addition, it is further contemplated that non-naturally occurring frameworks may be present in a FR sub-bank, such as, for example, chimeric frameworks and mutated frameworks. 25 5.1.1 Generation of Sub-banks for the Light Chain Frameworks [0139] Light chain sub-banks 1, 2, 3 and 4 are constructed, wherein sub-bank 1 comprises plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a light chain FRI ; sub-bank 2 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a light 30 chain FR2; sub-bank 3 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a light chain FR3; and sub-bank 4 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a light chain FR4. The FR sequences may be obtained or derived from WO 2006/102095 PCT/US2006/009745 any functional antibody sequences (e.g., an antibody known in the art and/or commercially available). In some embodiments, the FR sequences are obtained or derived from functional human antibody sequences (e.g., an antibody known in the art and/or commercially available). In some embodiments, the FR sequences are derived from human germline light chain sequences. In one embodiment, the sub-bank FR sequences are derived from a human germline kappa chain sequences. In another embodiment, the sub-bank FR sequences are derived from a human germline lambda chain sequences. It is also contemplated that the sub bank FR sequences may be derived from non-human sources (e.g., primate, rodent). [01401 By way of example but not limitation, the following describes a method of generating 4 light chain FR sub-banks using Polymerase Chain Reaction (PCR), wherein human germline kappa chain sequences are used as templates. Light chain FR sub-banks 1, 2 and 3 (encoding FRI, 2, 3 respectively) encompass 46 human germline kappa chain sequences (Al, AlO, All, A14, A17, A18, A19, A2, A20, A23, A26, A27, A3, A30, A5, A7, B2, B3, LI, LlO, LIl, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4/18a, L5, L6, L8, L9, 01, Oil, 012, 014, 018, 02, 0 4 and 08). See Kawasaki etal, 2001, Eur. J. Immunol., 31:1017-1028; Schable and Zachau, 1993, Biol. Chem. Hoppe Seyler 374:1001 1022; and Brensing-Kuppers et al, 1997, Gene 191:173-181. The sequences are summarized at the NCBI website: www.ncbi.nlm.nih.gov/igblast/showGermline.cgi organismF=human&chainType=VK&seqTy pe=nucleotide. Light chain FR sub-bank 4 (encoding FR4) encompasses 5 human germline kappa chain sequences (JKl, J2, Ji3, JK4 and JK5). See Hieter et al., 1982, J. Biol. Chem. 257:1516-1522. The sequences are summarized at the NCBI website: www.ncbi.nlm.nih.gov/igblast/showGermline.cgi organism=human&chainType=JK&seqTy pe=nucleotide. 5 101411 By way of example but not limitation, the construction of light chain FRI sub bank is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 12 and Table 13 (all shown in the 5' to 3' orientation, name followed by sequence): Table 12. Light Chain FRI Forward Primers (for Sub-Bank 1) 41144 Rl1LLll GATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCC 415 FRl L 2 GATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCC 416 FRl L 3 GATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCC 417 FR1 L 4 GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCC 418 FRl L 5 GATATTGTGATGACCCAGACTCCACTCTCTCTGTCCGTCACCC 4199 kR1l1 L66 GATATTGTGATGACCCAGACTCCACTCTCCTCACCTGTCACCC 420 FRl L 7 GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCC 734 WO 2006/102095 PCT/US2006/009745 421 FRI L 8 GAGATTGTGATGACCCAGACTCCACTCTCCTTGTCTATCACCC 422 FRI L 9 GATATTGTGATGACCCAGACTCCACTCTCCTCGCCTGTCACCC 423 FRILl 0 GAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTC 424 FR1LH GATGTTGTGATGACACAGTCTCCAGCTTTCCTCTCTGTGACTC 5 425 FR1L12 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 426 FRIL13 GAAATTGTGCTGACTCAGTCTCCAGACTTTCAGTCTGTGACTC 427 FRiLl4 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 428 FRI L15 GAAACGACACTCACGCAGTCTCCAGCATTCATGTCAGCGACTC 429 FRI L 16 GACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTG [0 43300 FRRii LII 7 GCC ATCCAG ATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 431 FRILl 8 GACATCCAGATGACCCAGTCTCCTTCCACCCTGTCTGCATCTG 432 FRi L19 AACATCCAGATGACCCAGTCTCCATCTGCCATGTCTGCATCTG 433 FRI L20 GACATCCAGATGACCCAGTCTCCATCCTCACTGTCTGCATCTG 434 FRI L21 GAAATAGTGATGATGCAGTCTCCAGCCACCCTGTCTGTGTCTC [5 43355 FRRII [2222 GCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 436 FRI L23 GACATCCAGATGACCCAGTCTCCATCTTCTGTGTCTGCATCTG 437 FRI L24 GAAATAGTGATGACGCAGTCTCCAGCCACCCTGTCTGTGTCTC 438 FRI L25 GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTC 439 FRI L26 GACATCCAGATGATCCAGTCTCCATCTTTCCTGTCTGCATCTG 0 44400 FRRII L2277 GCCATCCGGATGACCCAGTCTCCATTCTCCCTGTCTGCATCTG 441 FRI L28 GTCATCTGGATGACCCAGTCTCCATCCTTACTCTCTGCATCTA 442 FRl L29 GCCATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 443 FRI L30 GACATCCAGATGACCCAGTCTCCATCTTCCGTGTCTGCATCTG 444 FRI L31 GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTC 5 4455 FRRII [3322 GACATCCAGTTGACCCAGTCTCCATCCTTCCTGTCTGCATCTG 446 FRI L33 GCCATCCGGATGACCCAGTCTCCATCCTCATTCTCTGCATCTA 447 FRI L34 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 448 FRI L35 GACATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 449 FRI L36 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 45500 PtRIll [377 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 451 FR1 L38 GACATCCAGTTGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 452 FRI L39 GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTG 453 FRI L40 GAAATTGTAATGACACAGTCTCCACCCACCCTGTCTTTGTCTC 454 FRIL41 GAAATTGTAATGACACAGTCTCCAGCCACCCTGTCTTTGTCTC 5 45555 FRRII L4422 GAAATTGTGTTGACGCAGTCTCCAGCCACCCTGTCTTTGTCTC 456 FRI L43 GAAATTGTGTTGACGCAGTCTCCAGGCACCCTGTCTTTGTCTC 457 FRI L44 GACATCGTGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTC 458 FRI L45 GATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCC 459 4FRI L46 GATATTGTGATGACCCAGACTCCACTCTCCCTGCCCGTCACCC [0 Table 13. Light Chain FRI Reverse Primers (for Sub-Bank 1) 460 FRI LI' GCAGGAGATGGAGGCCGGCTGTCCAAGGGTGACGGGCAGGGAGAGTG 461 FRI L2 GCAGGAGATGGAGGCCGGCTGTCCAAGGGTGACGGGCAGGGAGAGTG 462 FRI L3 GCAGGAGATGGAGGCCGGCTGTCCAGGGGTGACGGACAGAGAGAGTG 463 FR1L4' GCAGGAGATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTG 45 46644 FRR L55" GCAGG A G ATGG AGGCCGGCTGTCCAGGGGTGACGGACAGAGAGAGTG 465 FRI L6' GCAGGAGATGGAGGCCGGCTGTCCAAGGGTGACAGGTGAGGAGAGTG 466 FRI L7' GCAGGAGATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTG 467 FRi L8' GCAGGAGATGGAGGCCTGCTCTCCAGGGGTGATAGACAAGGAGAGTG 468 FRI L9' GAAGGAGATGGAGGCCGGCTGTCCAAGGGTGACAGGCGAGGAGAGTG 50 46699 FkRllLLIIOO" GCAGGTGATGGTGACTTTCTCCTTTGGAGTCACAGACTGAAAGTCTG 470 FRILI l' GCAGGTGATGGTGACTTTCTCCCCTGGAGTCACAGAGAGGAAAGCTG 471 FRILLI 2' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 472 FRI L 13' GCAGGTGATGGTGACTTTCTCCTTTGGAGTCACAGACTGAAAGTCTG 473 FRIL14' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 55 47744 FRRi LLn 55' GCAGGAGATGTTGACTTTGTCTCCTGGAGTCGCTGACATGAATGCTG 475 FRI L 16' ACAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGTGAGGATG 476 FRI L 17' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 477 FRI L 18' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGTGGAAG 478 FRILl 9' ACAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACATGGCAGATG 60 47799 FRRII 2200" ACAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGTGAGGATG 480 FRI L21 GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACACAGACAGGGTGGCTG 481 FRI L22' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 482 FRI L23' ACAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACACAGAAGATG 483 FRI L24' GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACACAGACAGGGTGGCTG 55 48844 FRRII [2255" GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACAAAGACAGGGTGGCTG WO 2006/102095 PCT/US2006/009745 485 FRI L26' GCAAATGATACTGACTCTGTCTCCTACAGATGCAGACAGGAAAGATG 486 FRI L27' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGAATG 487 FR L28' ACAACTGATGGTGACTCTGTCTCCTGTAGATGCAGAGAGTAAGGATG 488 FRI L29' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 5 489 FRI L30' ACAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACACGGAAGATG 490 FRI L31' GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACAAAGACAGGGTGGCTG 491 FR1L32' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGAAGGATG 492 FRI L33' ACAAGTGATGGTGACTCTGTCTCCTGTAGATGCAGAGAATGAGGATG 493 FRI L34' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 0 494 FRlL35" GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 495 FRI L36' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 496 FRI L37' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 497 FRI L38' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 498 FRI L39' GCAAGTGATGGTGACTCTGTCTCCTACAGATGCAGACAGGGAGGATG 5 499 FRlIAY GCAGGAGAGGGTGACTCTTTCCCCTGGAGACAAAGACAGGGTGGGTG 500 FR1L41' GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACAAAGACAGGGTGGCTG 501 FRI L42' GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACAAAGACAGGGTGGCTG 502 FRI L43' GCAGGAGAGGGTGGCTCTTTCCCCTGGAGACAAAGACAGGGTGCCTG 503 FR L44' GCAGTTGATGGTGGCCCTCTCGCCCAGAGACACAGCCAGGGAGTCTG 0 504 FRILIA5" GCAGGAGATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTG 505 FR1L46' GCAGGAGATGGAGGCCGGCTCTCCAGGGGTGACGGGCAGGGAGAGTG [0142] PCR is carried out using the following oligonucleotide combinations (46 in total): FRILl/FR1Ll', FR1L2/FRL2', FR1L3/FR1L3', FR1L4/FRL4', FRIL5/FR1L5', 5 FR1L6/FRL6', FR1L7/FR1L7', FR1L8/FRL8', FR1L9/FRL9', FRL 0/FRLlO', FRILl 1/FRiLll FRL12/FRL12', FR1L13/FRL13', FR1L14/FRL14', FRlL15/FRL15', FRL16/FR1L16', FR1L17/FR1L17', FR1L18/FRL18', FRiL19/FRiL19', FR1L20/FRL20', FR1L21/FR1L21', FR1L22/FRL22', FRiL23/FR1L23', FRiL24/FR1L24', FRiL25/FR1L25', FR1L26/FRL26', o FR1L27/FRL27', FR1L28/FR1L28', FR1L29/FR1L29', FR1L30/FRL30', FR1L31/FRL31', FR1L32/FRL32', FR1L33/FRL33', FR1L34/FRL34', FRL35/FRL35', FR1L36/FRL36', FR1L37/FRL37', FR1L38/FR1L38', FR1L39/FRL39', FR1L40/FRL40', FR1L41/FRL41', FR1L42/FRL42', FRiL43/FR1L43', FRiL44/FR1L44', FRiL45/FR1L45', and FRiL46/FR1L46'. The 5 pooling of the PCR products generates sub-bank 1. [01431 By way of example but not limitation, the construction of light chain FR2 sub bank is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 14 and Table 15 (all shown in the 5' to 3' orientation; name followed by sequence): 0 Table 14. Light Chain FR2 Forward Primers (for Sub-Bank 2) 506 FR2L1 TGGTTTCAGCAGAGGCCAGGCCAATCTCCAA 507 FR2L2 TGGTTTCAGCAGAGGCCAGGCCAATCTCCAA 508 FR2L3 TGGTACCTGCAGAAGCCAGGCCAGTCTCCAC 509 FR2L4 TGGTACCTGCAGAAGCCAGGGCAGTCTCCAC 5 510 FR2L5 TGGTACCTGCAGAAGCCAGGCCAGCCTCCAC 511 FR2L6 TGGCTTCAGCAGAGGCCAGGCCAGCCTCCAA WO 2006/102095 PCT/US2006/009745 512 FR2L7 TGGTACCTGCAGAAGCCAGGGCAGTCTCCAC 5 13 FR2L8 TGGTTTCTGCAGAAAGCCAGGCCAGTCTCCA 514 FR2L9 TGGCTTCAGCAGAGGCCAGGCCAGCCTCCAA 515 FR2L1 0 TGGTACCAGCAGAAACCAGATCAGTCTCCAA 516 FR2L1 1 TGGTACCAGCAGAAACCAGATCAAGCCCCAA 517 FR2L12 TGGTATCAGCAGAAACCAGGGAAAGTTCCTA 5 18 FR2L 13 TGGTACCAGCAGAAACCAGATCAGTCTCCAA 5 19 FR2L14 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 520 FR2L1 5 TGGTACCAACAGAAACCAGGAGAAGCTGCTA 521 FR2L1 6 TGGTTTCAGCAGAAACCAGGGAAAGCCCCTA 522 FR2L1 7 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 523 FR2L1 8 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 524 FR2L1 9 TGGTTTCAGCAGAAACCAGGGAAAGTCCCTA 525 FR2L20 TGGTATCAGCAGAAACCAGAGAAAGCCCCTA 526 FR2L21 TGGTACCAGCAGAAACCTGGCCAGGCTCCCA 527 FR2L22 TGGTATCAGCAGAAACCAGGGAAAGCTCCTA 528 FR2L23 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 529 FR2L24 TGGTACCAGCAGAAACCTGGCCAGGCTCCCA 530 FR2L25 TGGTACCAGCAGAAACCTGGCCAGGCTCCCA 531 FR2L26 TGGTATCTGCAGAAACCAGGGAAATCCCCTA 532 FR2L27 TGGTATCAGCAAAAACCAGCAAAAGCCCCTA 533 FR2L28 TGGTATCAGCAAAAACCAGGGAAAGCCCCTG 534 FR2L29 TGGTATCAGCAGAAACCAGGGAAAGCTCCTA 535 FR2L30 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 536 FR2L31 TGGTACCAACAGAAACCTGGCCAGGCTCCCA 537 FR2L32 TGGTATCAGCAAAAACCAGGGAAAGCCCCTA 538 FR2L33 TGGTATCAGCAAAAACCAGGGAAAGCCCCTA 539 FR2L34 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 540 FR2L35 TGGTATCGGCAGAAACCAGGGAAAGTTCCTA 541 FR2L36 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 542 FR2L37 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 543 FR2L38 TGGTATCGGCAGAAACCAGGGAAAGTTCCTA 544 FR2L39 TGGTATCAGCAGAAACCAGGGAAAGCCCCTA 545 FR2L40 TGGTATCAGCAGAAACCTGGCCAGGCGCCCA 546 FR2L41 TGGTACCAGCAGAAACCTGGGCAGGCTCCCA 547 FR2L42 TGGTACCAGCAGAAACCTGGCCTGGCGCCCA 548 FR2L43 TGGTACCAGCAGAAACCTGGCCAGGCTCCCA 549 FR2L44 TGGTACCAGCAGAAACCAGGACAGCCTCCTA 550 FR2L45 TGGTACCTGCAGAAGCCAGGGCAGTCTCCAC 551 FR2L46 TGGTACCTGCAGAAGCCAGGGCAGTCTCCAC Table 15. Light Chain FR2 Reverse Primers (for Sub-Bank 2) 552 FR2Ll' ATAAATTAGGCGCCTTGGAGATTGGCCTGGCCTCT 553 FR2L2' ATAAATTAGGCGCCTTGGAGATTGGCCTGGCCTCT 554 FR2L3' ATAGATCAGGAGCTGTGGAGACTGGCCTGGCTTCT 5 555 FR2L4' ATAGATCAGGAGCTGTGGAGACTGCCCTGGCTTCT 556 FR2L5' ATAGATCAGGAGCTGTGGAGGCTGGCCTGGCTTCT 557 FR2L6' ATAAATTAGGAGTCTTGGAGGCTGGCCTGGCCTCT 558 FR2L7' ATAGATCAGGAGCTGTGGAGACTGCCCTGGCTTCT 559 FR2L8' ATAGATCAGGAGTGTGGAGACTGGCCTGGCTTTCT 560 FR2L9' ATAAATTAGGAGTCTTGGAGGCTGGCCTGGCCTCT 561 FR2L1 O' CTTGATGAGGAGCTTTGGAGACTGATCTGGTTTCT 562 FR2LI 1' CTTGATGAGGAGCTTTGGGGCTTGATCTGGTTTCT 563 FR2L12' ATAGATCAGGAGCTTAGGAACTTTCCCTGGTTTCT 564 FR2L13' CTTGATGAGGAGCTTTGGAGACTGATCTGGTTTCT 565 FR2L14" ATAGATCAGGCGCTTAGGGGCTTTCCCTGGTTTCT 566 FR2L15 1 TTGAATAATGAAAATAGCAGCTTCTCCTGGTTTCT 567 FR2L1 6' ATAGATCAGGGACTTAGGGGCTTTCCCTGGTTTCT 568 FR2L1 7' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 569 FR2L1 8' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 570 FR2L1 9' ATAGATCAGGTGCTTAGGGACTTTCCCTGGTTTCT 571 FR2L20' ATAGATCAGGGACTTAGGGGCTTTCTCTGGTTTCT 572 FR2L21' ATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCT 573 FR2L22' ATAGATCAGGAGCTTAGGAGCTTTCCCTGGTTTCT 574 FR2L23' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 575 FR2L24' ATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCT WO 2006/102095 PCT/US2006/009745 576 FR2L25' ATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCT 577 FR2L26' ATAGAGGAAGAGCTTAGGGGATTTCCCTGGTTTCT 578 FR2L27' ATAGATGAAGAGCTTAGGGGCTTTTGCTGGTTTTT 579 FR2L28' ATAGATCAGGAGCTCAGGGGCTTTCCCTGGTTTTT 5 580 FR2L29' ATAGATCAGGAGCTTAGGAGCTTTCCCTGGTTTCT 581 FR2L30' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 582 FR2L31' ATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCT 583 FR2L32' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTTT 584 FR2L33' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTTT 0 585 FR2L34' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 586 FR2L35' ATAGATCAGGAGCTTAGGAACTTTCCCTGGTTTCT 587 FR2L36' GTAGATCAGGAGCTTAGGdGCTTTCCCTGGTTTCT 588 FR2L37' ATAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 589 FR2L38' ATAGATCAGGAGCTTAGGAACTTTCCCTGGTTTCT 5 590 FR2L39' GTAGATCAGGAGCTTAGGGGCTTTCCCTGGTTTCT 591 FR2L40' ATAGATGAGGAGCCTGGGCGCCTGGCCAGGTTTCT 592 FR2L41' ATAGATGAGGAGCCTGGGAGCCTGCCCAGGTTTCT 593 FR2L42' ATAGATGAGGAGCCTGGGCGCCAGGCCAGGTTTCT 594 FR2L43' ATAGATGAGGAGCCTGGGAGCCTGGCCAGGTTTCT 0 595 FR2L44' GTAAATGAGCAGCTTAGGAGGCTGTCCTGGTTTCT 596 FR2L45' ATAGATCAGGAGCTGTGGAGACTGCCCTGGCTTCT 597 FR2L46' ATAGATCAGGAGCTGTGGAGACTGCCCTGGCTTCT [01441 PCR is carried out using the following oligonucleotide combinations (46 in 5 total): FR2Ll/FR2Ll ', FR2L2/FR2L2', FR2L3/FR2L3', FR2L4/FR2L4', FR2L5/FR2L5', FR2L6/FR2L6', FR2L7/FR2L7', FR2L8/FR2L8', FR2L9/FR2L9', FR2L1O/FR2L10', FR2Lll/FR2L 1', FR2L12/FR2L12', FR2L13/FR2L13', FR2L14/FR2L14', FR2L15/FR2L15', FR2L16/FR2L16', FR2L17/FR2L17', FR2L18/FR2L18', FR2L19/FR2L19', FR2L20/FR2L20', FR2L21/FR2L21', FR2L22/FR2L22', 0 FR2L23/FR2L23', FR2L24/FR2L24', FR2L25/FR2L25', FR2L26/FR2L26', FR2L27/FR2L27', FR2L28/FR2L28', FR2L29/FR2L29', FR2L30/FR2L30', FR2L31/FR2L31', FR2L32/FR2L32', FR2L33/FR2L33', FR2L34/FR2L34', FR2L35/FR2L35', FR2L36/FR2L36', FR2L37/FR2L37', FR2L38/FR2L38', FR2L39/FR2L39', FR2L40/FR2L40', FR2L41/FR2L41', FR2L42/FR2L42', ,5 FR2L43/FR2L43', FR2L44/FR2L44', FR2L45/FR2L45', and FR2L46/FR2L46'. The pooling of the PCR products generates sub-bank 2. [01451 By way of example but not limitation, the construction of light chain FR3 sub bank is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 16 and Table 17 (all shown in the 5' to 3' orientation, name 0 followed by sequence): Table 16. Light Chain FR3 Forward Primers (for Sub-Bank 3) 598 FR3L1 GGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAG 599 FR3L2 5 GGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAG -77 WO 2006/102095 PCT/US2006/009745 600 FR3L3 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAG 601 FR3L4 GGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAG 5 602 FR3L5 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAG 603 FR3L6 GGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAG 604 FR3L7 .0 GGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAG 605 FR3L8 GGAGTGCCAGATAGGTTCAGTGGCAGCGGGTCAGGGACAGATTTCACACTGAAAATCAG 606 FR3L9 GGGGTCCCAGACAGATTCAGTGGCAGTGGGGCAGGGACAGATTTCACACTGAAAATCAG .5 607 FR3L1 0 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAA 608 FR3L1 1 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCTTTACCATCAG 609 FR3L12 GGGGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 610 FR3LI3 GGGGTCCCCTCGAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACCCTCACCATCAA 611 FR3LI4 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAG 612 FR3LI5 GGAATCCCACCTCGATTCAGTGGCAGCGGGTATGGAACAGATTTTACCCTCACAATTAA 613 FR3LI6 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 614 FR3L17 0 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGCACAGATTTCACTCTCACCATCAG 615 FR3L18 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACCATCAG 616- FR3L19 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAG 5 617 FR3L20 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 618 FR3L21 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAG 619 FR3L22 0 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 620 FR3L23 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAG 621 FR3L24 GGTATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGAGTTCACTCTCACCATCAG 15 622 FR3L25 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGCCTGGGACAGACTTCACTCTCACCATCAG 623 FR3L26 GGGGTCTCATCGAGGTTCAGTGGCAGGGGATCTGGGACGGATTTCACTCTCACCATCAT 624 FR3L27 50 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACGGATTACACTCTCACCATCAG 625 FR3L28 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 626 FR3L29 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG >5 627 FR3L30 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 628 FR3L31 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAG 629 FR3L32 0o GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGAATTCACTCTCACAATCAG 630 FR3L33 GGGGTCCCATCAAGGTTCAGCGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 631 FR3L34 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 5 632 FR3L35 GGAGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAG WO 2006/102095 PCTIUS2006/009745 633 FR3L36 GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAG 634 FR3L37 GGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAG 5 635 FR3L38 GGAGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACTATCAG 636 FR3L39 GGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCACCATCAG 637 FR3L40 0 AGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAG 638 FR3L41 GGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAG 639 FR3L42 GGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAG 5 640 FR3L43 GGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAG 641 FR3L44 GGGGTCCCTGACCGATTCAGTGGCAGCGGGTCTGGGACAGATTTCACTCTCACCATCAG 642 FR3L45 0 GGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAG 643 FR3L46 GGAGTCCCAGACAGGTTCAGTGGCAGTGGGTCAGGCACTGATTTCACACTGAAAATCAG Table 17. Light Chain FR3 Reverse Primers (for Sub-Bank 3) 644 FR3Ll' GCAGTAATAAACCCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAAA 5 645 FR3L2' GCAGTAATAAACCCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAAA 646 FR3L3 TCAGTAATAAACCCCAACATCCTCAGCCTCCACCCGGCTGATTTTCAGTGTGAAA 647 FR3L4' GCAGTAATAAACCCCAACATCCTCAGCCTCCACTCTGCTGATTTTCAGTGTAAAA 648 FR3L5' GCAGTAATAAACCCCAACATCCTCAGCCTCCACCCGGCTGATTTTCAGTGTGAAA 649 FR3L6' GCAGTAATAAACCCCGACATCCTCAGCTTCCACCCTGCTGATTTTCAGTGTGAAA 0 650 FR3L7' GCAGTAATAAACCCCAACATCCTCAGCCTCCACTCTGCTGATTTTCAGTGTAAAA 651 FR3L8' GCAGTAATAAACTCCAAAATCCTCAGCCTCCACCCGGCTGATTTTCAGTGTGAAA 652 FR3L9' GCAGTAATAAACCCCGACATCCTCAGCTTCCACCCTGCTGATTTTCAGTGTGAAA 653 FR3L10' ACAGTAATACGTTGCAGCATCTTCAGCTTCCAGGCTATTGATGGTGAGGGTGAAA 654 FR3L1 1' ACAGTAATATGTTGCAGCATCTTCAGCTTCCAGGCTACTGATGGTAAAGGTGAAA 5 655 FR3L12' ACAGTAATAAGTTGCAACATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 656 FR3L1 3' ACAGTAATACGTTGCAGCATCTTCAGCTTCCAGGCTATTGATGGTGAGGGTGAAA 657 FR3L14' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATTGTGAGAGTGAAT 658 FR3L15' ACAGAAGTAATATGCAGCATCCTCAGATTCTATGTTATTAATTGTGAGGGTAAAA 659 FR3L1 6' GCAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 0 660 FR3L17' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 661 FR3L1 8' GCAGTAATAAGTTGCAAAATCATCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAT 662 FR3L19' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATTGTGAGAGTGAAT 663 FR3L20' GCAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 664 FR3L21' ACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAAC 15 665 FR3L22' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 666 FR3L23' ACAATAGTAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATAGTGAGAGTGAAA 667 FR3L24' ACAGTAATAAACTGCAAAATCTTCAGACTGCAGGCTGCTGATGGTGAGAGTGAAC 668 FR3L25' ACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAG 669 FR3L26' ACAGTAATAAGCTGCAAAATCTTCAGGCTTCAGGCTGATGATGGTGAGAGTGAAA >0 670 FR3L27' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGTAA 671 FR3L28' ACAGTAATAAGTTGCAAAATCTTCAGACTGCAGGCAACTGATGGTGAGAGTGAAA 672 FR3L29' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 673 FR3L30' ACAATAGTAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAA 674 FR3L3 1' ACAGTAATAAACTGCAAAATCTTCAGGCTCTAGGCTGCTGATGGTGAGAGTGAAG >5 675 FR3L32' ACAGTAATAAGTTGCAAAATCTTCAGGCTGCAGGCTGCTGATTGTGAGAGTGAAT 676 FR3L33' ACAGTAATAAGTTGCAAAATCTTCAGACTGCAGGCAGCTGATGGTGAGAGTGAAA 677 FR3L34' ACAGTAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAA 678 FR3L35' ACCGTAATAAGTTGCAACATCTTCAGGCTGCAGGCTGCTGATAGTGAGAGTGAAA 679 FR3L36' ACAGTAATATGTTGCAATATCTTCAGGCTGCAGGCTGCTGATGGTGAAAGTAAAA >0 680 FR3L37' ACAGTAGTAAGTTGCAAAATCTTCAGGTTGCAGACTGCTGATGGTGAGAGTGAAA 681 FR3L38' ACCGTAATAAGTTGCAACATCTTCAGGCTGCAGGCTGCTGATAGTGAGAGTGAAA 682 FR3L39' ACAGTAATATGTTGCAATATCTTCAGGCTGCAGGCTGCTGATGGTGAAAGTAAAA 683 FR3L40' ACAGTAATAAACTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAG 684 FR3L41' ACAGTAATAAACTGCAAAATCTTCAGGCTGCAGGCTGCTGATGGTGAGAGTGAAG 5 685 FR3L42' ACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAG WO 2006/102095 PCT/US2006/009745 686 FR3L43' ACAGTAATACACTGCAAAATCTTCAGGCTCCAGTCTGCTGATGGTGAGAGTGAAG 687 FR3L44' ACAGTAATAAACTGCCACATCTTCAGCCTGCAGGCTGCTGATGGTGAGAGTGAAA 688 FR3L45' GCAGTAATAAACTCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAAA 689 FR3L46' GCAGTAATAAACTCCAACATCCTCAGCCTCCACCCTGCTGATTTTCAGTGTGAA A 5 [01461 PCR is carried out using the following oligonucleotide combinations (46 in total): FR3L1/FR3L1', FR3L2/FR3L2', FR3L3/FR3L3', FR3L4/FR3L4', FR3L5/FR3L5', FR3L6/FR3L6', FR3L7/FR3L7', FR3L8/FR3L8', FR3L9/FR3L9', FR3L10/FR3L10', FR3L11/FR3L11', FR3L2/FR3L12', FR3L13/FR3L13', FR3L14/FR3L14', 0 FR3L15/FR3L15', FR3L16/FR3L16', FR3L17/FR3L7', FR3L18/FR3L18', FR3L19/FR3L19', FR3L20/FR3L20', FR3L21/FR3L21', FR3L22/FR3L22', FR3L23/FR3L23', FR3L24/FR3L24', FR3L25/FR3L25', FR3L26/FR3L26', FR3L27/FR3L27', FR3L28/FR3L28', FR3L29/FR3L29', FR3L30/FR3L30', FR3L31/FR3L31', FR3L32/FR3L32', FR3L33/FR3L33', FR3L34/FR3L34', 5 FR3L35/FR3L35', FR3L36/FR3L36', FR3L37/FR3L37', FR3L38/FR3L38', FR3L39/FR3L39', FR3L40/FR3L40', FR3L41/FR3L41', FR3L42/FR3L42', FR3L43/FR3L43', FR3L44/FR3L44', FR3L45/FR3L45', and FR3L46/FR3L46'. The pooling of the PCR products generates sub-bank 3. 10147] By way of example but not limitation, the construction of light chain FR4 sub ,0 bank is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 18 and Table 19 (all shown in the 5' to 3' orientation, name followed by sequence): Table 18. Light Chain FR4 Forward Primers (for Sub-Bank 4) 690 FR4L1 TTCGGCCAAGGGACCAAGGTGGAAATCAAA 25 691 FR4L2 TTTGGCCAGGGGACCAAGCTGGAGATCAAA 692 FR4L3 TTCGGCCCTGGGACCAAAGTGGATATCAAA 693 FR4L4 TTCGGCGGAGGGACCAAGGTGGAGATCAAA 694 FR4L5 TTCGGCCAAGGGACACGACTGGAGATTAAA Table 19. Light Chain FR4 Reverse Primers (for Sub-Bank 4) 30 695 FR4Ll' TTTGATTTCCACCTTGGTCCCTTGGCCGAA 696 FR4L2' TTTGATCTCCAGCTTGGTCCCCTGGCCAAA 697 FR4L3' TTTGATATCCACTTTGGTCCCAGGGCCGAA 698 FR4L4' TTTGATCTCCACCTTGGTCCCTCCGCCGAA 699 FR4L5' TTTAATCTCCAGTCGTGTCCCTTGGCCGAA 35 [0148] PCR is carried out using the following oligonucleotide combinations (5 in total): FR4L1/FR4Ll', FR4L2/FR4L2', FR4L3/FR4L3', FR4L4/FR4L4', or FR4L5/FR4L5'. The pooling of the PCR products generates sub-bank 4. 80 WO 2006/102095 PCT/US2006/009745 5.1.2 Generation of Sub-banks for the Heavy Chain Frameworks [0149] In some embodiments, heavy chain FR sub-banks 5, 6, 7 and 11 are constructed wherein sub-bank 5 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a heavy chain FRI; sub-bank 6 5 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a heavy chain FR2; sub-bank 7 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a heavy chain FR3; and sub-bank 11 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding a heavy chain FR4, respectively; [0 wherein the heavy chain FRI, FR2, and FR3 are defined according to Kabat definition for CDR HI and H2. In some embodiments, the FR sequences are derived form functional human antibody sequences. In other embodiments, the FR sequences are derived from human germline heavy chain sequences. [0150] By way of example but not limitation, the following describes a method of t5 generating 4 heavy chain FR sub-banks using Polymerase Chain Reaction (PCR), wherein human germline heavy chain sequences are used as templates. Heavy chain FR sub-banks 5, 6 and 7 (encoding FR1, 2, 3 respectively) encompass 44 human germline heavy chain sequences (VH1-18, VHl -2, VH1-24, VH1-3, VHl -45, VH 1-46, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-11, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, 0 VH3-30, VH3-33, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1 and VH7-81). See Matsuda et al, 1998, J. Exp. Med., 188:1973-1975. The sequences are summarized at the NCBI website: www.ncbi.nlm.nih.gov/igblast/showGermline.cgi organism=human&chainType=VH&seqTy 25 pe=nucleotide. Heavy chain FR sub-bank 11 (encoding FR4) encompasses 6 human germline heavy chain sequences (JHl, JH2, JH3, JH4, JH5 and JH6). See Ravetch et al, 1981, Cell 27(3 Pt 2):583-591. The sequences are summarized at the NCBI website: www.ncbi.nlm.nih.gov/igblast/showGe 7t-nline.cgi organism=human&chainType=JH&seqTy pe=nucleotide. 30 101511 By way of example but not limitation, the construction of heavy chain FRI sub-bank (according to Kabat definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 20 and Table 21 (all shown in the 5' to 3' orientation, name followed by sequence): WO 2006/102095 PCT/US2006/009745 Table 20. Heavy Chain FRI (Kabat Definition) Forward Primers (for Sub-Bank 5): 700 FRI HK CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT 701 FRI HK2 5 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT 702 FRl HK3 CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT 703 FR1 HK4 CAGGTTCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT [0 704 FR1HK5 CAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCAGTGAAGGT 705 FRI HK6 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT 706 FRI HK7 [5 CAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCAGTGAAGGT 707 FRI HK8 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCGGTGAAGGT 708 FRI HK9 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGT !0 709 FRI HKl O CAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACCCTCACGCT 710 FRI HKI l CAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACCCTCACGCT 711 FR1HK12 5 CAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACCCTCACACT 712 FR1HK13 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCCCTGAGACT 713 FRlHKl4 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACT .0 714 FR1HK15 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGACT 7 15 FR1HK16 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACT 716 FRIHKI7 5 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCCCTGAGACT 717 FRI HKl 8 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACT 718 FRlHK19 GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACT '0 719 FR1 HK20 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACT 720 FRI HK2 1 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACT 721 FRI HK22 45 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCCCTGAGACT 722 FR1HK23 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCCCTGAGACT 723 FR1HK24 GAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCCCTGAGACT 50 724 FRI HK25 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACT 725 FRI HK26 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCCCTGAGACT 726 FRI HK27 55 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACT 727 FR1HK28 GAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACT 728 FR1HK29 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCCCTGAGACT >0 729 FRI HK30 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACT 730 FRI HK3 1 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGAGGGTCCCTGAGACT 73 1 FRI HK32 5 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAAACT WO 2006/102095 PCT/US2006/009745 732 FR1HK33 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTAGTTCAGCCTGGGGGGTCCCTGAGACT 733 FR1HK34 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCCCTGAGACT 5 734 FR1IHK35 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACCCTGTCCCT 735 FRI HK36 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCACAGACCCTGTCCCT 736 FR1HK37 L0 CAGGTGCAGCTACAGCAGTGGGGCGC AGGACTGTTGAAGCCTTCGGAGACCCTGTCCCT 737 FR1HK38 CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCT 738 FR1HK39 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCT [5 739 FRI HK40 'CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCT 740 FR1HK41 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCT 741 FR1HK42 0o GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGAT 742 FR1HK43 CAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACCCTCTCACT 743 FRI HK44 CAGGTGCAGCTGGTGCAGTCTGGCCATGAGGTGAAGCAGCCTGGGGCCTCAGTGAAGGT 5 Table 21. Heavy Chain FRI (Kabat Definition) Reverse Primers (for Sub-Bank 5): 744 FRI HK' GGTAAAGGTGTAACCAGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGC 745 FRI HK2' GGTGAAGGTGTATCCAGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGC 746 FRI HK3' AGTGAGGGTGTATCCGGAAACCTTGCAGGAGACCTTCACTGAGGCCCCAGGC 747 FRI HK4' AGTGAAGGTGTATCCAGAAGCCTTGCAGGAAACCTTCACTGAGGCCCCAGGC 0 748 FRUMKS" GGTGAAGGTGTATCCGGAAGCCTTGCAGGAAACCTTCACTGAGGACCCAGTC 749 FRI HK6' GGTGAAGGTGTATCCAGATGCCTTGCAGGAAACCTTCACTGAGGCCCCAGGC 750 FRI HK7' AGTAAAGGTGAATCCAGAAGCCTTGCAGGAGACCTTCACTGAGGTCCCAGGC 751 FRI HK8' GCTGAAGGTGCCTCCAGAAGCCTTGCAGGAGACCTTCACCGAGGACCCAGGC 752 FRI HK9' GGTGAAGGTGTATCCAGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGC 5 753 FR1lKHRO' GCTGAGTGAGAACCCAGAGACGGTGCAGGTCAGCGTGAGGGTCTCTGTGGGT 754 FRI HKI P GCTGAGTGAGAACCCAGAGAAGGTGCAGGTCAGCGTGAGGGTCTGTGTGGGT 755 FRI HKl 2' GCTGAGTGAGAACCCAGAGAAGGTGCAGGTCAGTGTGAGGGTCTGTGTGGGT 756 FRI HK 3' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCTCCAGGC 757 FRI HK14' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 0 758 FRnlHKilS" ACTGAAAGTGAATCCAGAGGCTGCACAGGAGAGTCTAAGGGACCCCCCAGGC 759 FRi HK16' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 760 FRI HK 7' ATCAAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 761 FRI HKl 8' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 762 FRI HKl 9' GCTAAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 45 763 FR1HK20" ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCTCCCAGGC 764 FRI HK2P ACTGAAGGTGAATCCAGACGCTGCACAGGAGAGTCTCAGGGACCTCCCAGGC 765 FRI HK22' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGATCCCCCAGGC 766 FRI HK23' ACTGACGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCTAGGC 767 FRI HK24' ATCAAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 50 768 FRIHK2S" ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 769 FR1 HK26' ACCAAAGGTGAATCCAGAAGCTGTACAGGAGAGTCTCAGGGACCGCCCTGGC 770 FRI HK27' ACTGACGGTGAACCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 771 FRIHK28' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 772 FRI HK29' ACTGACGGTGAACCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 55 773 FR 1HK30" ACTAAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 774 FRI HK3 P ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCTCCAGGC 775 FRI HK32' ACTGAAGGTGAACCCAGAGGCTGCACAGGAGAGTTTCAGGGACCCCCCAGGC 776 FRIHK33' ACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGC 777 FRH1HK34' ATCAAAGGTGAATCCAGAGGCTGCACAGGAGAGTCTCAGGGACCTGCCAGGC 50 778 FR 1HK35" GCTG ATGGAGTA ACCAG AGACAGCGCAGGTG AGGG ACAGGGTGTCCGAAGGC 779 FRi HK36' GCTGATGGAGCCACCAGAGACAGTACAGGTGAGGGACAGGGTCTGTGAAGGC 780 FRi HK37' ACTGAAGGACCCACCATAGACAGCGCAGGTGAGGGACAGGGTCTCCGAAGGC 781 FRI HK38' GCTGATGGAGCCACCAGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGC 782 FRIHK39' ACTGATGGAGCCACCAGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGC 55 783 FR1HK40" ACTGATGGAGCCACCAGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGC Q'2 WO 2006/102095 PCT/US2006/009745 784 FRI HK41' GCTGACGGAGCCACCAGAGACAGTGCAGGTG AGGGACAGGGTCTCCGAAGGC 785 FRI HK42" GGTAAAGCTGTATCCAGAACCCTTACAGGAGATCTTCAGAGACTCCCCGGGC 786 FRI HK43' AGAGACACTGTCCCCGGAGATGGCACAGGTGAGTGAGAGGGTCTGCGAGGGC 787 FRI HK44' GGTGAAACTGTAACCAGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGC 5 [01521 PCR is carried out using the following oligonucleotide combinations (44 in total): FR1HK1/FR1HKl', FRlHK2/FR1HK2', FR1HK3/FR1HK3', FR1HK4/FRlHK4', FRIHK5/FRlHK5', FRIHK6/FR1HK6', FR1HK7/FRlHK7', FRiHK8/FRlHK8', FR1HK9/FRlHK9', FRIHKl (YFRlHKlO', FRlHKl 1/FRlHKll', FRlHK12/FRlHK12', 0 FR1HK13/FRlHK13', FRIHKl 4/FR1HK14', FRlHK15/FR1HK15', FRlHK1 6/FRlHK16', FR1HK17/FR1HK17', FRlHKl 8/FR1HK1 8', FR1HK19/FR1HK19', FR1HK20/FR1HK20', FRlHK21/FRHK21', FR1HK22/FRlHK22', FR1HK23/FR1HK23', FR1HK24/FR1HK24', FRiHK25/FRlHK25', FRiHK26/FR1HK26', FRiHK27/FR1HK27', FRIHK28/FR1HK28', FRIHK29/FRlHK29', FRiHK30/FR1HK31', FRiHK32/FRlHK32', FR1HK33/FRlHK33', 5 FRlHK34/FR1HK34', FR1HK35/FR1HK35', FRlHK36/FR1HK36', FRlHK37/FR1HK37', FR1HK38/FR1HK38', FR1HK39/FRlHK39', FR1HK40/FR1HK40', FR1HK41/FR1HK41', FRiHK42/FRlHK42', FRIHK43/FR1HK43', or FRIHK44/FR1HK44'. The pooling of the PCR products generates sub-bank 5. [01531 By way of example but not limitation, the construction of heavy chain FR2 0 sub-bank (according to Kabat definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 22 and Table 23 (all shown in the 5' to 3' orientation, name followed by sequence): Table 22. Heavy Chain FR2 (Kabat Definition) Forward Primers (for Sub-Bank 6): 788 FR2HK1 TGGGTGCGACAGGCCCCTGGACAAGGGCTTG 25 789 FR2HK2 TGGGTGCGACAGGCCCCTGGACAAGGGCTTG 790 FR2HK3 TGGGTGCGACAGGCTCCTGGAAAAGGGCTTG 791 FR2HK4 TGGGTGCGCCAGGCCCCCGGACAAAGGCTTG 792 FR2HK5 TGGGTGCGACAGGCCCCCGGACAAGCGCTTG 793 FR2HK6 TGGGTGCGACAGGCCCCTGGACAAGGGCTTG 30 7 FR2HK7 TGGGTGCGACAGGCTCGTGGACAACGCCTTG 795 FR2HK8 TGGGTGCGACAGGCCCCTGGACAAGGGCTTG 796 FR2HK9 TGGGTGCGACAGGCCACTGGACAAGGGCTTG 797 FR2HK10 TGGATCCGTCAGCCCCCAGGGAAGGCCCTGG 798 FR2HK1 1 TGGATCCGTCAGCCCCCAGGAAAGGCCCTGG 35 79 FR2HK]2 TGGATCCGTCAGCCCCCAGGGAAGGCCCTGG 800 FR2HK1 3 TGGATCCGCCAGGCTCCAGGGAAGGGGCTGG 801 FR2HK14 TGGGTCCGCCAAGCTACAGGAAAAGGTCTGG 802 FR2HKI 5 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 803 FR2HK16 TGGGCCCGCAAGGCTCCAGGAAAGGGGCTGG f0 W4 FR2HK17 TGGGTCCGCCAAGCTCCAGGGAAGGGGCTGG 805 FR2HKI8 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 806 FR2HKI 9 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 807 FR2HK20 TGGGTCCGCCAGGCTCCAGGCAAGGGGCTGG 808 FR2HK21 TGGGTCCGCCAGGCTCCAGGCAAGGGGCTGG t5 W9 FR2HK22 TGGGTCCATCAGGCTCCAGGAAAGGGGCTGG 810 FR2HK23 TGGATCCGCCAGGCTCCAGGGAAGGGGCTGG WO 2006/102095 PCT/US2006/009745 811 FR2HK24 TGGGTCCGTCAAGCTCCGGGGAAGGGTCTGG 812 FR2HK25 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 813 FR2HK26 TGGTTCCGCCAGGCTCCAGGGAAGGGGCTGG 814 FR2HK27 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 815 FR2HK28 TGGGTCCGCCAGGCTCCAGGGAAGGGACTGG 816 FR2HK29 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 817 FR2HK30 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 818 FR2HK31 TGGGTCCGCCAGGCTCCAGGGAAGGGGCTGG 819 FR2HK32 TGGGTCCGCCAGGCTTCCGGGAAAGGGCTGG 820 FR2HK33 TGGGTCCGCCAAGCTCCAGGGAAGGGGCTGG 821 FR2HK34 TGGGTCCGGCAAGCTCCAGGGAAGGGCCTGG 522 FR2HK35 TGGATCCGGCAGCCCCCAGGGAAGGGACTGG 823 FR2HK36 TGGATCCGCCAGCACCCAGGGAAGGGCCTGG 824 FR2HK37 TGGATCCGCCAGCCCCCAGGGAAGGGGCTGG 825 FR2HK38 TGGATCCGCCAGCCCCCAGGGAAGGGGCTGG 826 FR2HK39 TGGATCCGGCAGCCCGCCGGGAAGGGACTGG 827 FR2HK40 TGGATCCGGCAGCCCCCAGGGAAGGGACTGG 828 FR2HK41 TGGATCCGGCAGCCCCCAGGGAAGGGACTGG 829 FR2HK42 TGGGTGCGCCAGATGCCCGGGAAAGGCCTGG 830 FR2HK43 TGGATCAGGCAGTCCCCATCGAGAGGCCTTG 83 1 FR2HK44 TGGGTGCCACAGGCCCCTGGACAAGGGCTTG Table 23. Heavy Chain FR2 (Kabat Definition) Reverse Primers (for Sub-Bank 6): 832 FR2HK' TCCCATCCACTCAAGCCCTTGTCCAGGGGCCT 833 FR2HK2' TCCCATCCACTCAAGCCCTTGTCCAGGGGCCT 8 3344 FRR22HHKK33" TCCCATCCACTCAAGCCCTTTTCCAGGAGCCT 835 FR2HK4' TCCCATCCACTCAAGCCTTTGTCCGGGGGCCT 836 FR2HK5' TCCCATCCACTCAAGCGCTTGTCCGGGGGCCT 837 FR2HK6' TCCCATCCACTCAAGCCCTTGTCCAGGGGCCT 838 FR2HK7 TCCTATCCACTCAAGGCGTTGTCCACGAGCCT 83399 FRR22HHKK88" TCCCATCCACTCAAGCCCTTGTCCAGGGGCCT 840 FR2HK9' TCCCATCCACTCAAGCCCTTGTCCAGTGGCCT 841 FR2HK1 0' TGCAAGCCACTCCAGGGCCTTCCCTGGGGGCT 842 FR2HKI 1 TGCAAGCCACTCCAGGGCCTTTCCTGGGGGCT 843 FR2HK12' TGCAAGCCACTCCAGGGCCTTCCCTGGGGGCT 84444 RR22HHKK 1133" TGAAACCCACTCCAGCCCCTTCCCTGGAGCCT 845 FR2HK14' TGAGACCCACTCCAGACCTTTTCCTGTAGCTT 846 FR2HK15' GCCAACCCACTCCAGCCCCTTCCCTGGAGCCT 847 FR2HK1 6' CGATACCCACTCCAGCCCCTTTCCTGGAGCCT 848 FR2HK1 7' AGAGACCCACTCCAGCCCCTTCCCTGGAGCTT 84499 FRR22HHKK I1 88" T GAG ACCC ACTCC AGCCCCTTCCCTGG AGCCT 850 FR2HK1 9' TGAGACCCACTCCAGCCCCTTCCCTGGAGCCT 85 1 FR2HK20' TGCCACCCACTCCAGCCCCTTGCCTGGAGCCT 852 FR2HK21 TGCCACCCACTCCAGCCCCTTGCCTGGAGCCT 853 FR2HK22' CGATACCCACTCCAGCCCCTTTCCTGGAGCCT 5 5s44 FRR22HIHKK2233 T G AGACCCACTCCAGCCCCTTCCCTGG AGCCT 855 FR2HK24' AGAGACCCACTCCAGACCCTTCCCCGGAGCTT 856 FR2HK25' TGAAACCCACTCCAGCCCCTTCCCTGGAGCCT 857 FR2HK26' ACCTACCCACTCCAGCCCCTTCCCTGGAGCCT 858 FR2HK27' TGAGACCCACTCCAGCCCCTTCCCTGGAGCCT 85599 FRR22HHKK2288" TGAAACATATTCCAGTCCCTTCCCTGGAGCCT 860 FR2HK29' TGAGACCCACTCCAGCCCCTTCCCTGGAGCCT 861 FR2HK30 GGCCACCCACTCCAGCCCCTTCCCTGGAGCCT 862 FR2HK31 GCCAACCCACTCCAGCCCCTTCCCTGGAGCCT 863 FR2HK32' GCCAACCCACTCCAGCCCTTTCCCGGAAGCCT 6644 FRR22HHKK3333" TGAGACCCACACCAGCCCCTTCCCTGGAGCTT 865 FR2HK34' TGAGACCCACTCCAGGCCCTTCCCTGGAGCTT 866 FR2HK35' CCCAATCCACTCCAGTCCCTTCCCTGGGGGCT 867 FR2HK36' CCCAATCCACTCCAGGCCCTTCCCTGGGTGCT 868 FR2HK37' CCCAATCCACTCCAGCCCCTTCCCTGGGGGCT 6699 FRR22HHKK3388" CCCAATCCACTCCAGCCCCTTCCCTGGGGGCT 870 FR2HK39' CCCAATCCACTCCAGTCCCTTCCCGGCGGGCT 871 FR2HK40' CCCAATCCACTCCAGTCCCTTCCCTGGGGGCT 872 FR2HK41 CCCAATCCACTCCAGTCCCTTCCCTGGGGGCT 873 FR2HK42' CCCCATCCACTCCAGGCCTTTCCCGGGCATCT WO 2006/102095 PCT/US2006/009745 874 FR2HK43' TCCCAGCCACTCAAGGCCTCTCGATGGGGACT 875 FR2HK44' TCCCATCCACTCAAGCCCTTGTCCAGGGGCCT [0154] PCR is carried out using the following oligonucleotide combinations (44 in 5 total): FR2HKl/FR2HK1 ', FR2HK2/FR2HK2', FR2HK3/FR2HK3 ', FR2HK4/FR2HK4', FR2HK5/FR2HK5', FR2HK6/FR2HK6', FR2HK7/ER2HK7', FR2HK8/FR2HK8', FR2HK9/FR2HK9', FR2HK10/FR2HK10', FR2HK11/FR2HK11', FR2HK12/FR2HK12', FR2HK13/FR2HK13', FR2HK14/FR2HK14', FR2HK15/FR2HK15', FR2HK16/FR2HK16', FR2HK17/FR2HK17', FR2HK18/FR2HK18', FR2HK19/FR2HK19', FR2HK20/FR2HK20', 10 FR2HK21/FR2HK21', FR2HK22/FR2HK22', FR2HK23/FR2HK23', FR2HK24/FR2HK24', FR2HK25/FR2HK25', FR2HK26/FR2HK26', FR2HK27/FR2HK27', FR2HK28/FR2HK28', FR2HK29/FR2HK29', FR2HK30/FR2HK31', FR2HK32/FR2HK32', FR2HK33/FR2HK33', FR2HK34/FR2HK34', FR2HK35/FR2HK35', FR2HK36/FR2HK36', FR2HK37/FR2HK37', FR2HK38/FR2HK38', FR2HK39/FR2HK39', FR2HK40/FR2HK40', FR2HK41/FR2HK41', 15 FR2HK42/FR2HK42', FR2HK43/FR2HK43', or FR2HK44/FR2HK44'. The pooling of the PCR products generates sub-bank 6. [01551 By way of example but not limitation, the construction of heavy chain FR3 sub-bank (according to Kabat definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 24 and Table 25 (all shown in 20 the 5' to 3' orientation, name followed by sequence): Table 24. Heavy Chain FR3 (Kabat Definition) Forward Primers (for Sub-Bank 7): 876 FR3HK1 AGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTG 877 FR3HK2 AGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGGAGCTGAGCAGGCTGAGATCTG 878 FR3HK3 AGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTG 25 879 FR3HIC4 AGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTG 880 FR3HKS AGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCTG 881 FR3HK6 AGAGTCACCATGACCAGGGACACGTCCACGAGC ACAGTCT ACATGGAGCTGAGCAGCCTGAGATCTG 882 FR3HK7 AGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGGAGCTGAGCAGCCTGAGATCCG 883 FR3HK8 AGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCT ACATGGAGCTGAGCAGCCTGAGATCTG 30 884 FR3HK9 AGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCT ACATGGAGCTGAGCAGCCTGAGATCTG 885 FR3HK 0 AGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTACCATGACCAAC ATGGACCCTG 886 FR3HKI 1 AGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAACATGGACCCTG 887 FR3HK1 2 AGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTACAATGACCAAC ATGGACCCTG 888 FR3HICl 3 CGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCG 35 889 FR3HK14 CGATTC ACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTCAAATGAACAGCCTGAGAGCCG 890 FR3HK1 5 AGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGCAAATGAACAGCCTGAAAACCG 891 FR3HKI 6 CGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGCAAAAGAACAGACGGAGAGCCG 892 FR3HK1 7 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCCG 893 FR3HK1 8 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCG 40 894 FR3HK19 CGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCG 895 FR3HK20 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTG 896 FR3HK2 1 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCG 897 FR3HK22 CGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGCAAACGAATAGCCTGAGGGCCG 898 FR3HK23 AGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAACCTGAGAGCTG 45 899 FR3HK24 CGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGCAAATGAACAGTCTGAGAACTG 900 FR3HK2S CGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGACG 901 FR3HK26 AGATTCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGCAAATGAACAGCCTGAAAACCG 902 FR3HIC27 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCCG 903 FR3HK28 AGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGGGCAGCCTGAGAGCTG 86 WO 2006/102095 PCT/US2006/009745 904 FR3HK29 CGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTCAAATGAACAGCCTGAGAGCTG 905 FR3HK30 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCG 906 FR3HK31 AGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGCAAATGAACAGCCTGAAAACCG 907 FR3HK32 AGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGCAAATGAACAGCCTGAAAACCG 5 908 FR3HK33 CGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGCAAATGAACAGTCTGAGAGCCG 909 FR3HK34 CGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGCAAATGAACAGTCTGAGAGCTG 910 FR3HK35 CGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCG 9 11 FR3HK36 CGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACTGCCG 912 FR3HK37 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCG [0 911 33 FRK33HHKK3388 CGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCG 914 FR3HK39 CGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCCG 915 FR3HK40 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTG 916 FR3HK41 CGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCTGTGACCGCTG 917 FL,3HK42 CAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCT [ 5 91188 FRR33HHKK4433 CGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGCAGCTGAACTCTGTGACTCCCG 919 FR3HK44 CGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGCAGATCAGCAGCCTAAAGGCTG Table 25. Heavy Chain FR3 (Kabat Definition) Reverse Primers (for Sub-Bank 7): 920 FR3HK1' TCTCGCACAGTAATACACGGCCGTGTCGTCAGATCTCAGGCTCCTCAGCT 921 FR3HK2' TCTCGCACAGTAATACACGGCCGTGTCGTCAGATCTCAGCCTGCTCAGCT 92222 FRR33HHKK33" TGTTGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCT 923 FR3HK4' TCTCGCACAGTAATACACAGCCATGTCCTCAGATCTCAGGCTGCTCAGCT 924 FR3HK5' TCTTGCACAGTAATACATGGCTGTGTCCTCAGATCTCAGGCTGCTCAGCT 925 FR3HK6' TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCT 926 FR3HK7' TGCCGCACAGTAATACACGGCCGTGTCCTCGGATCTCAGGCTGCTCAGCT 5 2277 FRR33HHKK88" TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCT 928 FR3HK9' TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCT 929 FR3HK0' CCGTGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATGTTGGTCATGG 930 FR3HKI ' GTGTGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATGTTGGTCATTG 93 1 FR3HK12' CCGTGCACAATAATACGTGGCTGTGTCCACAGGGTCCATGTTGGTCATTG 0 9322 FRR33HHKKI 33" TCTCGCACAGTAATACACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 933 FR3HK14' TCTTGCACAGTAATACACAGCCGTGTCCCCGGCTCTCAGGCTGTTCATTT 934 FR3HK15' TGTGGTACAGTAATACACGGCTGTGTCCTCGGTTTTCAGGCTGTTCATTT 935 FR3HKI 6' TCTCACACAGTAATACACAGCCATGTCCTCGGCTCTCCGTCTGTTCTTTT 936 FR3HK17' TCTCGCACAGTGATACAAGGCCGTGTCCTCGGCTCTCAGACTGTTCATTT 5 9377 FRR33HHKKII88" TCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 938 FR3HK9' TTTCGCACAGTAATATACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 939 FR3HK20' TCTCGCACAGTAATACACAGCCGTGTCCTCAGCTCTCAGGCTGTTCATTT 940 FR3HK21 CTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 941 FR3HK22' TCTCACACAGTAATACACAGCCGTGTCCTCGGCCCTCAGGCTATTCGTTT 0 9422 PkR33HHKK2233" TCTGGCACAGTAATACACGGCCGTGCCCTCAGCTCTCAGGTTGTTCATTT 943 FR3HK24' TTTTGCACAGTAATACAAGGCGGTGTCCTCAGTTCTCAGACTGTTCATTT 944 FR3HK25' TCTCGCACAGTAATACACAGCCGTGTCCTCGTCTCTCAGGCTGTTCATTT 945 FR3HK26' TCTAGTACAGTAATACACGGCTGTGTCCTCGGTTTTCAGGCTGTTCATTT 946 FR3HK27' TCTCGCACAGTAATACACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 45 9477 RR33HHKK2288. TCTCGCACAGTAATACACAGCCATGTCCTCAGCTCTCAGGCTGCCCATTT 948 FR3HK29' TCTCGCACAGTAATACACAGCCGTGTCCTCAGCTCTCAGGCTGTTCATTT 949 FR3HK30' TCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTT 950 FR3HK3 ' TCTAGCACAGTAATACACGGCCGTGTCCTCGGTTTTCAGGCTGTTCATTT 951 FR3HK32' TCTAGTACAGTAATACACGGCCGTGTCCTCGGTTTTCAGGCTGTTCATTT 50 95522 FRR33HHKK3333" TCTTGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGACTGTTCATTT 953 FR3HK34' TTTTGCACAGTAATACAAGGCCGTGTCCTCAGCTCTCAGACTGTTCATTT 954 FR3HK35' TCTCGCACAGTAATACACGGCCGTGTCCACGGCGGTCACAGAGCTCAGCT 955 FR3HK36' TCTCGCACAGTAATACACGGCCGTGTCCGCGGCAGTCACAGAGCTCAGCT 956 FR3HK37' TCTCGCACAGTAATACACAGCCGTGTCCGCGGCGGTCACAGAGCTCAGCT 55 9577 FRR33HHKK3388" TCTCGCACAGTAATACACAGCCGTGTCTGCGGCGGTCACAGAGCTCAGCT 958 FR3HK39' TCTCGCACAGTAATACACGGCCGTGTCCGCGGCGGTCACAGAGCTCAGCT 959 FR3HK40' TCTCGCACAGTAATACACGGCCGTGTCCGCAGCGGTCACAGAGCTCAGCT 960 FR3HK41 ' TCTCGCACAGTAATACACGGCCGTGTCCGCAGCGGTCACAGAGCTCAGCT 961 FR3HK42' TCTCGCACAGTAATACATGGCGGTGTCCGAGGCCTTCAGGCTGCTCCACT 60 9622 FRR33HHKK4433" TCTTGCACAGTAATACACAGCCGTGTCCTCGGGAGTCACAGAGTTCAGCT 963 FR3HK44' TCTCGCACAGTAATACATGGCCATGTCCTCAGCCTTTAGGCTGCTGATCT WO 2006/102095 PCT/US2006/009745 [0156] PCR is carried out using the following oligonucleotide combinations (44 in total): FR3HK1/FR3HK1', FR3HK2/FR3HK2', FR3HK3/FR3HK3', FR3HK4/FR3HK4', FR3HK5/FR3HK5', FR3HK6/FR3HK6', FR3HK7/FR3HK7', FR3HK8/FR3HK8', FR3HK9/FR3HK9', FR3HK1O/FR3HK10', FR3HK11/FR3HK11', FR3HK12/FR3HK12', 5 FR3HK13/FR3HK13', FR3HK14/FR3HK14', FR3HK15/FR3HK15', FR3HK16/FR3HK16', FR3HK17/FR3HK17', FR3HK18/FR3HK18', FR3HK19/FR3HK19', FR3HK20/FR3HK20', FR3HK21/FR3HK21', FR3HK22/FR3HK22', FR3HK23/FR3HK23', FR3HK24/FR3HK24', FR3HK25/FR3HK25', FR3HK26/FR3HK26', FR3HK27/FR3HK27', FR3HK28/FR3HK28', FR3HK29/FR3HK29', FR3HK30/FR3HK31', FR3HK32/FR3HK32', FR3HK33/FR3HK33', 0 FR3HK34/FR3HK34', FR3HK35/FR3HK35', FR3HK36/FR3HK36', FR3HK37/FR3HK37', FR3HK38/FR3HK38', FR3HK39/FR3HK39', FR3HK40/FR3HK40', FR3HK41/FR3HK41', FR3HK42/FR3HK42', FR3HK43/FR3HK43', or FR3HK44/FR3HK44'. The pooling of the PCR products generates sub-bank 7. [0157] By-way of example but not limitation, the construction of heavy chain FR4 5 sub-bank is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 26 and Table 27 (all shown in the 5' to 3' orientation, name followed by sequence): Table 26. Heavy Chain FR4 Forward Primers (for Sub-Bank 11): 964 FR4H1 TGGGGCCAGGGCACCCTGGTCACCGTCTCCTCA 0 965 FR4H2 TGGGGCCGTGGCACCCTGGTCACTGTCTCCTCA 966 FR4H3 TGGGGCCAAGGGACAATGGTCACCGTCTCTTCA 967 FR4H4 TGGGGCCAAGGAACCCTGGTCACCGTCTCCTCA 968 FR4H5 TGGGGCCAAGGAACCCTGGTCACCGTCTCCTCA 969 FR4H6 TGGGGGCAAGGGACCACGGTCACCGTCTCCTCA 25 Table 27. Heavy Chain FR4 Reverse Primers (for Sub-Bank 11): 970 FR4H1' TGAGGAGACGGTGACCAGGGTGCCCTGGCCCCA 971 FR4H2' TGAGGAGACAGTGACCAGGGTGCCACGGCCCCA 972 FR4H3' TGAAGAG ACGGTG ACC ATTGTCCCTTGGCCCCA 973 FR4H4' TGAGGAGACGGTGACCAGGGTTCCTTGGCCCCA 30 974 FR4H5' TGAGGAGACGGTGACCAGGGTTCCTTGGCCCCA 975 FR4H6' TGAGGAGACGGTGACCGTGGTCCCTTGCCCCCA [0158] PCR is carried out using the following oligonucleotide combinations (6 in total): FR4H1/FR4H1', FR4H2/FR4H2', FR4H3/FR4H3', FR4H4/FR4H4', FR4H5/FR4H5', 35 or FR4H6/FR4H6'. The pooling of the PCR products generates sub-bank 11. [0159] In some embodiments, heavy chain FR sub-banks 8, 9, 10 and 11 are constructed wherein sub-bank 8 comprises nucleic acids, each of which encodes a heavy chain FRI ; sub-bank 9 comprises nucleic acids, each of which encodes a heavy chain FR2; 00 WO 2006/102095 PCT/US2006/009745 sub-bank 10 comprises nucleic acids, each of which encodes a heavy chain FR3; and sub bank 11 comprises nucleic acids, each of which encodes a heavy chain FR4, respectively, and wherein the heavy chain FRI, FR2, and FR3 are defined according to Chothia definition for CDR H1 and H2. In some embodiments, the FR sequences are derived form functional 5 human anitbody sequences. hi other embodiments, the FR sequences are derived from human germline heavy chain sequences. [0160] By way of example but not limitation, the following describes a method of generating 4 heavy chain FR sub-banks using Polymerase Chain Reaction (PCR), wherein human gemiline heavy chain sequences are used as templates. Heavy chain FR sub-banks 7, 0 8 and 9 (encoding FRI, 2, 3 respectively) encompass 44 human germline heavy chain sequences (VH1-18, VHl -2, VHI -24, VH1-3, VH1-45, VH1-46, VH1-58, VH -69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-1 1, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, 5 VH4-59, VH4-61, VH5-51, VH6-1 and VH7-8 1). See Matsuda et al, 1998, J. Exp. Med., 188:1973-1975. The sequences are summarized at the NCBI website: www.ncbi.nlm.nih.gov/igblast/showGei-mline.cgi organism=human&chainType=VH&seqTy pe=nucleotide. Sub-bank 11 (encodes FR4) is the same sub-bank 11 as described above. [0161] By way of example but not limitation, the construction of heavy chain FRI 0 sub-bank (according to Chothia definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 28 and Table 29 (all shown in the 5' to 3' orientation, name followed by sequence): Table 28. Heavy Chain FRI (Chothia Definition) Forward Primers (for Sub-Bank 8): 976 FRI HCI CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCA 25 977 FRlHC2 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCA 978 FRI HC3 CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCA 979 FRI HC4 CAGGTTCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCA 980 FRI HC5 CAGATGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGACTGGGTCCTCA 981 FRI HC6 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCA 30 9s2 FRDHC7 CAAATGCAGCTGGTGCAGTCTGGGCCTGAGGTGAAGAAGCCTGGGACCTCA 983 FRI HC8 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGTCCTCG 984 FRI HC9 CAGGTGCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCA 985 FRI HClO CAGGTCACCTTGAAGGAGTCTGGTCCTGTGCTGGTGAAACCCACAGAGACC 986 FRI HCI I CAGATCACCTTGAAGGAGTCTGGTCCTACGCTGGTGAAACCCACACAGACC 35 987 FR IHC 12 CAGGTCACCTTGAGGGAGTCTGGTCCTGCGCTGGTGAAACCCACACAGACC 988 FRI HC13 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCAAGCCTGGAGGGTCC 989 FRI HC 14 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCC 990 FRI1HC15 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCC 991 FRI HC16 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCC 10 992 FRflHC17 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGTGTGGTACGGCCTGGGGGGTCC 993 FRI HC1 8 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCC 994 FRI HC1 9 GAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCC WO 2006/102095 PCT/US2006/009745 995 FR1HC20 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCC 996 FR1HC21 CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCC 997 FR1HC22 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGATCC 998 FR1HC23 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTAGGGGGTCC 5 999 FR1HC24 GAAGTGCAGCTGGTGGAGTCTGGGGGAGTCGTGGTACAGCCTGGGGGGTCC 1000 FR1 HC25 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCC 1001 FR1HC26 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCAGGGCGGTCC 1002 FR1HC27 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCC 1003 FR1 HC28 GAGGTGCAGCTGGTGGAGTCTGGGGAAGGCTTGGTCCAGCCTGGGGGGTCC D 1004 FR1HC29 GAGGTGCAGCTGGTGGAGTCTGGAGGAGGCTTGATCCAGCCTGGGGGGTCC 1005 FR1HC30 GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCC 1006 FR1 HC3 1 GAGGTGC AGCTGGTGGAGTCTGGGGG AGGCTTGGTCCAGCCTGGAGGGTCC 1007 FRl1HC32 GAGGTGCAGCTGGTGGAGTCCGGGGGAGGCTTGGTCCAGCCTGGGGGGTCC 1008 FRlHC33 GAGGTGCAGCTGGTGGAGTCCGGGGG AGGCTTAGTTCAGCCTGGGGGGTCC 5 1009 FR1HC34 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGCAGGTCC 1010 FR1HC35 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGACACC 1011 FR1HC36 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTG AAGCCTTC ACAGACC 1012 FR1HC37 CAGGTGCAGCTACAGCAGTGGGGCGCAGGACTGTTGAAGCCTTCGGAGACC 1013 FR1HC38 CAGCTGC AGCTGC AGGAGTCGGGCCCAGGACTGGTG AAGCCTTCGGAG ACC 3 1014 FRI HC39 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC 1015 FR1HC40 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC 1016 FR1HC41 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC 1017 FRl HC42 GAGGTGCAGCTGGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCT 1018 FRl HC43 CAGGTACAGCTGCAGCAGTCAGGTCCAGGACTGGTGAAGCCCTCGCAGACC 5 1019 FR1HC44 CAGGTGCAGCTGGTGCAGTCTGGCCATGAGGTGAAGCAGCCTGGGGCCTCA Table 29. Heavy Chain FRI (Chothia Definition) Reverse Primers (for Sub-Bank 8): 1020 FRI HC I' AGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGCTTCTTCAC 1021 FRI HC2' AGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGCTTCTTCAC 1022 FRI HC3' GGAAACCTTGC AGGAGACCTTCACTGAGGCCCCAGGCTTCTTCAC ) 1023 FRI HC4' AGAAGCCTTGCAGGAAACCTTCACTGAGGCCCCAGGCTTCTTCAC 1024 FRI HC5' GGAAGCCTTGCAGGAAACCTTC ACTGAGGACCC AGTCTTCTTCAC 1025 FRI HC6' AGATGCCTTGCAGGAAACCTTCACTGAGGCCCCAGGCTTCTTCAC 1026 FRI HC7' AGAAGCCTTGCAGGAGACCTTCACTGAGGTCCCAGGCTTCTTCAC 1027 FRI HC8' AGAAGCCTTGCAGGAGACCTTCACCGAGGACCCAGGCTTCTTCAC ) 1028 FRI HC9' AGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGCTTCTTCAC 1029 FRIHClO' AGAGACGGTGCAGGTCAGCGTGAGGGTCTCTGTGGGTTTCACCAG 1030 FRI HC 11' AGAGAAGGTGCAGGTC AGCGTGAGGGTCTGTGTGGGTTTCACC AG 1031 FRI HC12' AGAGAAGGTGCAGGTCAGTGTGAGGGTCTGTGTGGGTTTCACCAG 1032 FRI HC13' AGAGGCTGCACAGGAGAGTCTCAGGGACCCTCCAGGCTTGACCAA ) 1033 FRI HC14' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGTACCAA 1034 FR1HC1 5' AGAGGCTGCACAGGAGAGTCTAAGGGACCCCCCAGGCTTTACCAA 1035 FRI HCI 6' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGTACCAA 1036 FRI HC 17' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCCGT ACCAC 1037 FRI HCI 8' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTTGACCAG 5 1038 FRI HCi 9' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGT ACCAA 1039 FRI HC20' AGAGGCTGCACAGGAGAGTCTCAGGGACCTCCCAGGCTGGACCAC 1040 FRI HC21' AGACGCTGCACAGGAGAGTCTCAGGGACCTCCCAGGCTGGACCAC 1041 FRI HC22' AGAGGCTGCACAGGAGAGTCTCAGGGATCCCCCAGGCTGTACCAA 1042 FRI HC23' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCT AGGCTGT ACCAA 0 1043 FRI HC24' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGTACCAC 1044 FRIHC25' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGTACCAA 1045 FRI HC26' AGAAGCTGTACAGGAGAGTCTCAGGGACCGCCCTGGCTGTACCAA 1046 FR1HC27' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGGATCAA 1047 FRI HC28' AGAGGCTGC ACAGGAGAGTCTCAGGGACCCCCCAGGCTGGACCAA 5 1048 FRI HC29' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGGATCAA 1049 FRI HC30' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGGACCAA 1050 FR 1HC3 1' AGAGGCTGCACAGG AGAGTCTCAGGGACCCTCCAGGCTGGACCAA 1051 FRI HC32' AGAGGCTGCACAGGAGAGTTTCAGGGACCCCCCAGGCTGGACCAA 1052 FRIHC33' AGAGGCTGCACAGGAGAGTCTCAGGGACCCCCCAGGCTGAACTAA 0 1053 FRI HC34' AGAGGCTGCACAGGAGAGTCTCAGGGACCTGCCAGGCTGT ACCAA 1054 FRIHC35' AGAGACAGCGCAGGTGAGGGACAGGGTGTCCGAAGGCTTCACCAG 1055 FR1HC36' AGAGACAGTAC AGGTGAGGG ACAGGGTCTGTGAAGGCTTC ACCAG 1056 FRIHC37' ATAGACAGCGCAGGTGAGGGACAGGGTCTCCGAAGGCTTCAACAG 1057 FRI HC38' AGAGACAGTGCAGGTGAGGGACAGGGTCTCCG AAGGCTTC ACCAG 5 1058 FRIHC39' AGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGCTTCACCAG on WO 2006/102095 PCT/US2006/009745 1059 FRIHC40' AGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGCTTCACCAG 1060 FR1HC41' AGAGACAGTGCAGGTGAGGGACAGGGTCTCCGAAGGCTTCACCAG 1061 FR1HC42' AGAACCCTTACAGGAGATCTTCAGAGACTCCCCGGGCTTTTTCAC 1062 FR1HC43' GGAGATGGCACAGGTGAGTGAGAGGGTCTGCGAGGGCTTCACCAG 5 1063 FR1HC44' AGAAGCCTTGCAGGAGACCTTCACTGAGGCCCCAGGCTGCTTCAC [0162] PCR is carried out using the following oligonucleotide combinations (44 in total): FRIHCI/FRIHCI', FRIHC2/FR1HC2', FR1iHC3/FR1HC3', FRIHC4/FR1HC4', FR1HC5/FR1HC5', FR1HC6/FR1HC6', FR1HC7/FR1HC7', FR1HC8/FR1HC8', 0 FRIHC9/FR1HC9 FRIHC10/FR1HC1O FRlHCl 1/FRlHCll', FR1HC12/FR1HC12', FR1HC13/FR1HC13', FR1HC14/FR1HC14', FR1HC15/FR1HC15', FR1HCl 6/FRlHCI 6', FR1HC17/FR1HC17', FR1HC18/FR1HC18', FR1HC19/FR1HC19', FR1HC20/FR1HC20', FRIHC21/FR1HC21', FRIHC22/FR1HC22', FR1HC23/FR1HC23', FR1HC24/FR1HC24', FR1HC25/FR1HC25', FRIHC26/FR1HC26', FRIHC27/FR1HC27', FR1HC28/FR1HC28', 5 FR1HC29/FR1HC29', FR1HC30/FR1HC30', FR1HC31/FR1HC31', FR1HC32/FR1HC32', FR1HC33/FRIHC33', FR1HC34/FR1HC34', FR1HC35/FR1HC35', FR1HC36/FR1HC36', FR1HC37/FR1HC37', FRIHC38/FR1HC38', FR1HC39/FR1HC39', FR1HC40/FR1HC40', FR1HC41/FR1HC41', FR1HC42/FR1HC42', FR1HC43/FR1HC43', or FR1HC44/FRlHC44'. The pooling of the PCR products generates sub-bank 8. 0 [01631 By way of example but not limitation, the construction of heavy chain FR2 sub-bank (according to Chothia definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 30 and Table 3 1 (all shown in the 5' to 3' orientation, name followed by sequence): Table 30. Heavy Chain FR2 (Chothia Definition) Forward Primers (for Sub-Bank 9): 25 1064 FR2HC1 TATGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTT 1065 FR2HC2 TACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTT 1066 FR2HC3 TTATCCATGCACTGGGTGCGACAGGCTCCTGGAAAAGGGCTT 1067 FR2HC4 TATGCTATGCATTGGGTGCGCCAGGCCCCCGGACAAAGGCTT 1068 FR2HC5 CGCTACCTGCACTGGGTGCGACAGGCCCCCGGACAAGCGCTT 30 1069 FR2HC6 TACTATATGCACTGGGTGCGACAGGCCCCTGGACAAGGGCTT 1070 FR2HC7 TCTGCTATGCAGTGGGTGCGACAGGCTCGTGGACAACGCCTT 1071 FR2HC8 TATGCTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTT 1072 FR2HC9 TATGATATCAACTGGGTGCGACAGGCCACTGGACAAGGGCTT 1073 FR2HC 10 ATGGGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTG 35 1074 FR2HCI 1 GTGGGTGTGGGCTGGATCCGTCAGCCCCCAGGAAAGGCCCTG 1075 FR2HC12 ATGTGTGTGAGCTGGATCCGTCAGCCCCCAGGGAAGGCCCTG 1076 FR2HC 13 TACTACATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTG 1077 FR2HC14 TACGACATGCACTGGGTCCGCCAAGCTACAGGAAAAGGTCTG - 1078 FR2HC 15 GCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 10 1079 FR2HC16 AGTGACATGAACTGGGCCCGCAAGGCTCCAGGAAAGGGGCTG 1080 FR2HC 17 TATGGCATGAGCTGGGTCCGCCAAGCTCCAGGGAAGGGGCTG 1081 FR2HC1 8 TATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1082 FR2HC19 TATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1083 FR2HC20 TATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTG -5 1084 FR2HC21 TATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTG 1085 FR2HC22 AGTGACATGAACTGGGTCCATCAGGCTCCAGGAAAGGGGCTG WO 2006/102095 PCT/US2006/009745 1086 FR2HC23 AATGAGATGAGCTGGATCCGCCAGGCTCCAGGGAAGGGGCTG 1087 FR2HC24 TATACCATGCACTGGGTCCGTCAAGCTCCGGGGAAGGGTCTG 1088 FR2HC25 TATAGCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1089 FR2HC26 TATGCTATGAGCTGGTTCCGCCAGGCTCCAGGGAAGGGGCTG 5 1090 FR2HC27 AACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1091 FR2HC28 TATGCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTG 1092 FR2HC29 AACTACATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1093 FR2HC30 TATTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 1094 FR2HC31 CACTACATGGACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTG 0 1095 FR2HC32 TCTGCTATGCACTGGGTCCGCCAGGCTTCCGGGAAAGGGCTG 1096 FR2HC33 TACTGGATGCACTGGGTCCGCCAAGCTCCAGGGAAGGGGCTG 1097 FR2HC34 TATGCCATGCACTGGGTCCGGCAAGCTCCAGGGAAGGGCCTG 1098 FR2HC35 AACTGGTGGGGCTGGATCCGGCAGCCCCCAGGGAAGGGACTG 1099 FR2HC36 TACTACTGGAGCTGGATCCGCCAGCACCCAGGGAAGGGCCTG 5 1100 FR2HC37 TACTACTGGAGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTG 1101 FR2HC38 TACTACTGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTG 1102 FR2HC39 TACTACTGGAGCTGGATCCGGCAGCCCGCCGGGAAGGGACTG 1103 FR2HC40 TACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTG 1104 FR2HC41 TACTACTGGAGCTGGATCCGGCAGCCCCCAGGGAAGGGACTG 0 1105 FR2HC42 TACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTG 1106 FR2HC43 GCTGCTTGGAACTGGATCAGGCAGTCCCCATCGAGAGGCCTT 1107 FR2HC44 TATGGTATGAATTGGGTGCCACAGGCCCCTGGACAAGGGCTT 5 Table 31. Heavy Chain FR2 (Chothia Definition) Reverse Primers (for Sub-Bank 9): 1108 FR2HC1' GATCCATCCCATCCACTCAAGCCCTTGTCCAGGGGCCTG 1109 FR2HC2' GATCCATCCCATCCACTCAAGCCCTTGTCCAGGGGCCTG 1110 FR2HC3' AAAACCTCCCATCCACTCAAGCCCTTTTCCAGGAGCCTG 1111 FR2HC4' GCTCCATCCCATCCACTCAAGCCTTTGTCCGGGGGCCTG 0 1112 FR2HC5' GATCCATCCCATCCACTCAAGCGCTTGTCCGGGGGCCTG 1113 FR2HC6' GATTATTCCCATCCACTCAAGCCCTTGTCCAGGGGCCTG 1114 FR2HC7' GATCCATCCTATCCACTCAAGGCGTTGTCCACGAGCCTG 1115 FR2HC8' GATCCCTCCCATCCACTCAAGCCCTTGTCCAGGGGCCTG 1116 FR2HC9' CATCCATCCCATCCACTCAAGCCCTTGTCCAGTGGCCTG 5 1117 FR2HC10' AATGTGTGCAAGCCACTCCAGGGCCTTCCCTGGGGGCTG 1118 FR2HCI l' AATGAGTGCAAGCCACTCCAGGGCCTTTCCTGGGGGCTG 1119 FR2HC12' AATGAGTGCAAGCCACTCCAGGGCCTTCCCTGGGGGCTG 1120 FR2HC13' AATGTATGAAACCCACTCCAGCCCCTTCCCTGGAGCCTG 1121 FR2HC14' AATAGCTGAGACCCACTCCAGACCTTTTCCTGTAGCTTG +0 1122 FR2HC15' AATACGGCCAACCCACTCCAGCCCCTTCCCTGGAGCCTG 1123 FR2HC 16' AACACCCGATACCCACTCCAGCCCCTTTCCTGGAGCCTT 1124 FR2HC17' AATACCAGAGACCCACTCCAGCCCCTTCCCTGGAGCTTG 1125 FR2HC18' AATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTG 1126 FR2HC19' AATAGCTGAGACCCACTCCAGCCCCTTCCCTGGAGCCTG 45 1127 FR2HC20' TATAACTGCCACCCACTCCAGCCCCTTGCCTGGAGCCTG 1128 FR2HC21' TATAACTGCCACCCACTCCAGCCCCTTGCCTGGAGCCTG 1129 FR2HC22' AACACCCGATACCCACTCCAGCCCCTTTCCTGGAGCCTG 1130 FR2HC23' AATGGATGAGACCCACTCCAGCCCCTTCCCTGGAGCCTG 1131 FR2HC24' ATAAGAGAGACCCACTCCAGACCCTTCCCCGGAGCTTG 50 1132 FR2HC25' AATGTATGAAACCCACTCCAGCCCCTTCCCTGGAGCCTG 1133 FR2HC26' AATGAAACCTACCCACTCCAGCCCCTTCCCTGGAGCCTG 1134 FR2HC27' AATAACTGAGACCCACTCCAGCCCCTTCCCTGGAGCCTG 1135 FR2HC28' AATAGCTGAAACATATTCCAGTCCCTTCCCTGGAGCCTG 1136 FR2HC29' AATAACTGAGACCCACTCCAGCCCCTTCCCTGGAGCCTG 55 1137 FR2HC30' TATGTTGGCCACCCACTCCAGCCCCTTCCCTGGAGCCTG 1138 FR2HC31 ' AGTACGGCCAACCCACTCCAGCCCCTTCCCTGGAGCCTG 1139 FR2HC32' AATACGGCCAACCCACTCCAGCCCTTTCCCGGAAGCCTG 1140 FR2HC33' AATACGTGAGACCCACACCAGCCCCTTCCCTGGAGCTTG 1141 FR2HC34' AATACCTGAGACCCACTCCAGGCCCTTCCCTGGAGCTTG >0 1142 FR2HC35' GATGTACCCAATCCACTCCAGTCCCTTCCCTGGGGGCTG 1143 FR2HC36' GATGTACCCAATCCACTCCAGGCCCTTCCCTGGGTGCTG 1144 FR2HC37' GATTTCCCCAATCCACTCCAGCCCCTTCCCTGGGGGCTG 1145 FR2HC38' GATACTCCCAATCCACTCCAGCCCCTTCCCTGGGGGCTG 1146 FR2HC39' GATACGCCCAATCCACTCCAGTCCCTTCCCGGCGGGCTG WO 2006/102095 PCT/US2006/009745 1147 FR2HC40' GATATACCCAATCCACTCCAGTCCCTTCCCTGGGGGCTG 1148 FR2HC41' GATATACCCAATCCACTCCAGTCCCTTCCCTGGGGGCTG 1149 FR2HC42' GATGATCCCCATCCACTCCAGGCCTTTCCCGGGCATCTG 1150 FR2HC43' TGTCCTTCCCAGCCACTCAAGGCCTCTCGATGGGGACTG 5 1151 FR2HC44' GAACCATCCCATCCACTCAAGCCCTTGTCCAGGGGCCTG 10164] PCR is carried out using the following oligonucleotide combinations (44 in total): FR2HC1/FR2HC1', FR2HC2/FR2HC2', FR2HC3/FR2HC3', FR2HC4/FR2HC4', FR2HC5/FR2HC5', FR2HC6/FR2HC6', FR2HC7/FR2HC7', FR2HC8/FR2HC8', 0 FR2HC9/FR2HC9', FR2HC1O/FR2HC10', FR2HCl 1/FR2HC1 1', FR2HCl2/FR2HC12', FR2HC13/FR2HC13', FR2HC14/FR2HC14', FR2HC15/FR2HC15', FR2HC16/FR2HC16', FR2HC17/FR2HC17', FR2HC18/FR2HC18', FR2HC19/FR2HC19', FR2HC20/FR2HC20', FR2HC21/FR2HC21', FR2HC22/FR2HC22', FR2HC23/FR2HC23', FR2HC24/FR2HC24', FR2HC25/FR2HC25', FR2HC26/FR2HC26', FR2HC27/FR2HC27', FR2HC28/FR2HC28', 5 FR2HC29/FR2HC29', FR2HC30/FR2HC30', FR2HC31/FR2HC31', FR2HC32/FR2HC32', FR2HC33/FR2HC33', FR2HC34/FR2HC34', FR2HC35/FR2HC35', FR2HC36/FR2HC36', FR2HC37/FR2HC37', FR2HC38/FR2HC38', FR2HC39/FR2HC39', FR2HC40/FR2HC40', FR2HC41/FR2HC41', FR2HC42/FR2HC42', FR2HC43/FR2HC43', or FR2HC44/FR2HC44'. The pooling of the PCR products generates sub-bank 9. 0 [01651 By way of example but not limitation, the construction of heavy chain FR3 sub-bank (according to Chothia definition) is carried out using the Polymerase Chain Reaction by overlap extension using the oligonucleotides listed in Table 32 and Table 33 (all shown in the 5' to 3' orientation, name followed by sequence): Table 32. Heavy Chain FR3 (Chothia Definition) Forward Primers (for Sub-Bank 10): 5 H 52 FR3HC1 ACAAACTATGCACAGAAGCTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGG 1153 FR3HC2 ACAAACTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCAGCACAGCCTACATGG 1154 FR3HC3 0 ACAATCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCGAGGACACATCTACAGACACAGCCTACATGG 1155 FR3HC4 ACAAAATATTCACAGGAGTTCCAGGGCAGAGTCACCATTACCAGGGACACATCCGCGAGCACAGCCTACATGG 1156 FR3HC5 ACCAACTACGCACAGAAATTCCAGGACAGAGTCACCATTACCAGGGACAGGTCTATGAGCACAGCCTACATGG 5 1157 FR3HC6 ACAAGCTACGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACGTCCACGAGCACAGTCTACATGG 1158 FR3HC7 ACAAACTACGCACAGAAGTTCCAGGAAAGAGTCACCATTACCAGGGACATGTCCACAAGCACAGCCTACATGG 1159 FR3HC8 0 GCAAACTACGCACAGAAGTTCCAGGGCAGAGTCACGATTACCGCGGACAAATCCACGAGCACAGCCTACATGG H 60 FR3HC9 ACAGGCTATGCACAGAAGTTCCAGGGCAGAGTCACCATGACCAGGAACACCTCCATAAGCACAGCCTACATGG 1161 FR3HC1O AAATCCTACAGCACATCTCTGAAGAGCAGGCTCACCATCTCCAAGGACACCTCCAAAAGCCAGGTGGTCCTTA 5 H 6 2 FR3HCI 1 AAGCGCTACAGCCCATCTCTGAAGAGCAGGCTCACCATCACCAAGGACACCTCCAAAAACCAGGTGGTCCTTA 1163 FR3HC12 AAATACTACAGCACATCTCTGAAGACCAGGCTCACCATCTCCAAGGACACCTCCAAAAACCAGGTGGTCCTTA WO 2006/102095 PCT/U1S2006/009745 11I4 FR3HC13 ATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGGGACAACGCCAAGAACTCACTGTATCTGC H 6 5 FR3HCl4 ACATACTATCCAGGCTCCGTGAAGGGCCGATTCACCATCTCCAGAGAAAATGCCAAGAACTCCTTGTATCTTC 5 1166 FR3HC15 ACAGACTACGCTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACGCTGTATCTGC 1167 FR3HC16 ACGCACTATGTGGACTCCGTGAAGCGCCGATTCATCATCTCCAGAGACAATTCCAGGAACTCCCTGTATCTGC 1168 FR3HC17 [0 ACAGGTTATGCAGACTCTGTGAAGGGCCGATrCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGC 1169 FR3HC18 ATATACTACGCAGACTCAGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGC 1170 FR3HC19 ACATACTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC 15 1171 FR3HC20 AAATACTATGCAGACTCCGTGAAGGGCCGATrCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC 1172 FR3HC21 AAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGC 1173 FR3HC22 0O ACGCACTATGCAGACTCTGTGAAGGGCCGATTCATCATCTCCAGAGACAATTCCAGGAACACCCTGTATCTGC 1174 FR3HC23 ACATACTACGCAGACTCCAGGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC 1175 FR3HC24 ACATACTATGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACAGCAAAAACTCCCTGTATCTGC .5 1176 FR3HC2 5 ATATACTACGCAGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACTCACTGTATCTGC 1177 FR3HC26 ACAGAATACGCCGCGTCTGTGAAAGGCAGATrCACCATCTCAAGAGATGATTCCAAAAGCATCGCCTATCTGC 1178 FR3HC27 0 ACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC 1179 FR3HC28 ACATATTATGCAGACTCTGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC 1180 FR3HC29 ACATACTACGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTTC 5 1181 FR3HC30 AAATACTATGTGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGC 1182 FR3HC31 ACAGAATACGCCGCGTCTGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAGAACTCACTGTATCTGC 1183 FR3HC32 0 ACAGCATATGCTGCGTCGGTGAAAGGCAGGTTCACCATCTCCAGAGATGATTCAAAGAACACGGCGTATCTGC 1184 FR3HC33 ACAAGCTACGCGGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGCTGTATCTGC 1185 FR3HC34 ATAGGCTATGCGGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCCCTGTATCTGC [5 1186 FR3HC35 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA 1187 FR3HC36 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTTACCATATCAGTAGACACGTCTAAGAACCAGTTCTCCCTGA 1188 FR3HC37 50 ACCAACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA 1189 FR3HC38 ACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCCGTAGACACGTCCAAGAACCAGTTCTCCCTGA 1190 FR3HC39 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATGTCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA 55 1191 FR3HC40 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA 1192 FR3HC41 ACCAACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGTAGACACGTCCAAGAACCAGTTCTCCCTGA 1193 FR3HC42 60 ACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGC 1194 FR3HC43 AATGATTATGCAGTATCTGTGAAAAGTCGAATAACCATCAACCCAGACACATCCAAGAACCAGTTCTCCCTGC 1195 FR3HC44 CCAACATATGCCCAGGGCTTCACAGGACGGTTTGTCTTCTCCATGGACACCTCTGCCAGCACAGCATACCTGC 65 Table 33. Heavy Chain FR3 (Chothia Definition) Reverse Primers (for Sub-Bank 10): 1196 FR3HC1' TCTCGCACAGTAATACACGGCCGTGTCGTCAGATCTCAGGCTCCTCAGCTCCATGTAGGCTGTGCTCGTGG 1197 FR3HC2' TCTCGCACAGTAATACACGGCCGTGTCGTCAGATCTCAGCCTGCTCAGCTCCATGTAGGCTGTGCTGATGG 70 1198 FR3HC3' TGTTGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGTCTGTAG 1199 FR3HC4' TCTCGCACAGTAATACACAGCCATGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGCGG WO 2006/102095 PCT/US2006/009745 1200 FR3HC 5 ' TCTTGCACAGTAATACATGGCTGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCATAG 1201 FR3HC6' TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGACTGTGCTCGTGG 5 1202 FR3HC7' TGCCGCACAGTAATACACGGCCGTGTCCTCGGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTTGTGG 1203 FR3HC8' TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGTGG 1204 FR3HC9' .0 TCTCGCACAGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTTATGG 1205 FR3HCIO' CCGTGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATGTTGGTCATGGTAAGGACCACCTGGCTTTTGG 1206 FR3HCH ' GTGTGCACAGTAATATGTGGCTGTGTCCACAGGGTCCATGTTGGTCATTGTAAGGACCACCTGGTTTTTGG .5 1207 FR3HCl2' CCGTGCACAATAATACGTGGCTGTGTCCACAGGGTCCATGTTGGTCATTGTAAGGACCACCTGGTTTTTGG 1208 FR3HC13' TCTCGCACAGTAATACACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGG 1209 FR3HCI4' '0 TCTTGCACAGTAATACACAGCCGTGTCCCCGGCTCTCAGGCTGTTCATTTGAAGATACAAGGAGTTCTTGG 1210 FR3HC15' TGTGGTACAGTAATACACGGCTGTGTCCTCGGTTTTCAGGCTGTTCATI[GCAGATACAGCGTGTTTTTTG 121 1 FR3HCl6' TCTCACACAGTAATACACAGCCATGTCCTCGGCTCTCCGTCTGTTCTTTTGCAGATACAGGGAGTTCCTGG 5 1212 FR3HC17' TCTCGCACAGTGATACAAGGCCGTGTCCTCGGCTCTCAGACTGTTCATTTGCAGATACAGGGAGTTCTTGG 1213 FR3HC18' TCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGG 1214 FR3HC19' 0 TTTCGCACAGTAATATACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGCGTGTTCTTGG 1215 FR3HC20' TCTCGCACAGTAATACACAGCCGTGTCCTCAGCTCTCAGGCTGTTCATTTGCAGATACAGCGTGTTCTTGG 1216 FR3HC2T TCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGCGTGTTCTTGG 5 1217 FR3HC22' TCTCACACAGTAATACACAGCCGTGTCCTCGGCCCTCAGGCTATTCGTTTGCAGATACAGGGTGTTCCTGG 1218 FR3HC23' TCTGGCACAGTAATACACGGCCGTGCCCTCAGCTCTCAGGTTGTTCATTTGAAGATACAGCGTGTTCTTGG 1219 FR3HC24' 0 T TTGCACAGTAATACAAGGCGGTGTCCTCAGTTCTCAGACTGICATTTUCAGATACAGGGAGTTTTTGC 1220 FR3HC25' TCTCGCACAGTAATACACAGCCGTGTCCTCGTCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGG 1221 FR3HC26' TCTAGTACAGTAATACACGGCTGTGTCCTCGGTRfTCAGGCTGTTCATTTGCAGATAGGCGATGCTTTTGG 5 1222 FR3HC27' TCTCGCACAGTAATACACGGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGAAGATACAGCGTGTTCTTGG 1223 FR3HC28' TCTCGCACAGTAATACACAGCCATGTCCTCAGCTCTCAGGCTGCCCATTTGAAGATACAGCGTGTTCTTGG 1224 FR3HC29' 50 TCTCGCACAGTAATACACAGCCGTGTCCTCAGCTCTCAGGCTGTTCATTTGAAGATACAGCGTGTTCTTGG 1225 FR3HC30' TCTCGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTGG 1226 FR3HC31' TCTAGCACAGTAATACACGGCCGTGTCCTCGGTTTTCAGGCTGTTCATTTGCAGATACAGTGAGTTCTTTG >5 1227 FR3HC32' TCTAGTACAGTAATACACGGCCGTGTCCTCGGTTTTCAGGCTGTTCATTTGCAGATACGCCGTGTTCTTTG 1228 FR3HC33' TCTTGCACAGTAATACACAGCCGTGTCCTCGGCTCTCAGACTGTTCATTTGCAGATACAGCGTGTTCTTGG 1229 FR3HC34' 50 TTTTGCACAGTAATACAAGGCCGTGTCCTCAGCTCTCAGACTGTTCATTTGCAGATACAGGGAGTTCTTGG 1230 FR3HC35' TCTCGCACAGTAATACACGGCCGTGTCCACGGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG 1231 FR3HC36' TCTCGCACAGTAATACACGGCCGTGTCCGCGGCAGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTAG >5 1232 FR3HC37' TCTCGCACAGTAATACACAGCCGTGTCCGCGGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG 1233 FR3HC38' TCTCGCACAGTAATACACAGCCGTGTCTGCGGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG 1234 FR3HC39' 70 TCTCGCACAGTAATACACGGCCGTGTCCGCGGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG 1235 FR3HC40' TCTCGCACAGTAATACACGGCCGTGTCCGCAGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG 1236 FR3HC41' TCTCGCACAGTAATACACGGCCGTGTCCGCAGCGGTCACAGAGCTCAGCTTCAGGGAGAACTGGTTCTTGG WO 2006/102095 PCT/US2006/009745 1237 FR3HC42' TCTCGCACAGTAATACATGGCGGTGTCCGAGGCCTTCAGGCTGCTCCACTGCAGGTAGGCGGTGCTGATGG 1238 FR3HC43' TCTTGCACAGTAATACACAGCCGTGTCCTCGGGAGTCACAGAGTTCAGCTGCAGGGAGAACTGGTTCTTGG 5 1239 FR3HC44' TCTCGCACAGTAATACATGGCCATGTCCTCAGCCTTTAGGCTGCTGATCTGCAGGTATGCTGTGCTGGCAG [01661 PCR is carried out using the following oligonucleotide combinations (44 in total): FR3HC1/FR3HC1', FR3HC2/FR3HC2', FR3HC3/FR3HC3', FR3HC4/FR3HC4', 0 FR3HC5/FR3HC5', FR3HC6/FR3HC6', FR3HC7/FR3HC7', FR3HC8/FR3HC8', FR3HC9/FR3HC9', FR3HC1O/FR3HC10', FR3HC11/FR3HC11', FR3HC12/FR3HC12', FR3HC13/FR3HC13', FR3HC14/FR3HC14', FR3HC15/FR3HC15', FR3HC16/FR3HC16', FR3HC17/FR3HC17', FR3HC18/FR3HC18', FR3HC19/FR3HC19', FR3HC20/FR3HC20', FR3HC21/FR3HC21', FR3HC22/FR3HC22', FR3HC23/FR3HC23', FR3HC24/FR3HC24', 5 FR3HC25/FR3HC25', FR3HC26/FR3HC26', FR3HC27/FR3HC27', FR3HC28/FR3HC28', FR3HC29/FR3HC29', FR3HC30/FR3HC30', FR3HC31/FR3HC31', FR3HC32/FR3HC32', FR3HC33/FR3HC33', FR3HC34/FR3HC34', FR3HC35/FR3HC35', FR3HC36/FR3HC36', FR3HC37/FR3HC37', FR3HC38/FR3HC38', FR3HC39/FR3HC39', FR3HC40/FR3HC40', FR3HC41/FR3HC41', FR3HC42/FR3HC42', FR3HC43/FR3HC43', or 0 FR3HC44/FR3HC44'. The pooling of the PCR products generates sub-bank 10. 5.2 Selection of CDRs 101671 In addition to the synthesis of framework region sub-banks, sub-banks of CDRs can be generated and randomly fused in frame with framework regions from framework region sub-banks to produced combinatorial libraries of antibodies (with or Z5 without constant regions) that can be screened for their immunospecificity for an antigen of interest, as well as their immunogenicity in an organism of interest. The combinatorial library methodology of the invention is exemplified herein for the production of humanized antibodies for use in human beings. However, the combinatorial library methodology of the invention can readily be applied to the production of antibodies for use in any organism of 30 interest. [0168] The present invention provides for a CDR sub-bank for each CDR of the variable light chain and variable heavy chain. In one embodiment, a CDR sub-bank comprises at least two different nucleic acid sequences, each nucleotide sequence encoding a particular CDR (e.g., a light chain CDR1). Accordingly, the invention provides a CDR 5 region sub-bank for variable light chain CDR1, variable light chain CDR2, and variable light CDR3 for each species of interest and for each definition of a CDR (e.g., Kabat and Chothia). WO 2006/102095 PCT/US2006/009745 The invention also provides a CDR sub-bank for variable heavy chain CDR1, variable heavy CDR2, and variable heavy chain CDR3 for each species of interest and for each definition of a CDR (e.g., Kabat and Chothia). CDR sub-banks may comprise CDRs that have been identified as part of an antibody that immunospecifically to an antigen of interest. 5 Alternatively, CDR sub-banks may comprise CDRs identified as part of an antibody that immunospecifically to an antigen of interest , wherein said CDRs have been modified (e.g. mutagenized). Optionally, CDR sub-banks may comprise artificial CDRs (e.g. randomized nucleic acid sequences) which have not been derived from an antibody. The CDR sub-banks can b e readily used to synthesize a combinatorial library of antibodies which can b e screened [0 for their immunospecificity for an antigen of interest, as well as their immunogencity in an organism of interest. [0169] For example, light chain CDR sub-banks 12, 13 and 14 can be constructed, wherein CDR sub-bank 12 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR1 according to L5 Kabat system; CDR sub-bank 13 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR2 according to Kabat system; and CDR sub-bank 14 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR3 according to Kabat system. Light chain CDR sub-banks 15, 16 and 17 can be constructed, ,0 wherein CDR sub-bank 15 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR1 according to Chothia system; CDR sub-bank 16 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR2 according to Chothia system; and CDR sub-bank 17 comprises a plurality of nucleic acid 25 sequences comprising nucleotide sequences, each nucleotide sequence encoding light chain CDR3 according to Chothia system [0170] Heavy chain CDR sub-bank 18, 19 and 20 can be constructed, wherein CDR sub-bank 18 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDR1 according to Kabat 30 system; CDR sub-bank 19 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDR2 according to Kabat system; and CDR sub-bank 20 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDR3 WO 2006/102095 PCT/US2006/009745 according to Kabat system. Heavy chain CDR sub-bank 21, 22 and 23 can be constructed, wherein CDR sub-bank 2 1 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDRI according to Chothia system; CDR sub-bank 22 comprises a plurality of nucleic acid sequences 5 comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDR2 according to Chothia system; and CDR sub-bank 23 comprises a plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding heavy chain CDR3 according to Chothia system. [0171] In some embodiments, the CDR sequences are derived from functional 0 antibody sequences. In some embodiments, the CDR sequences are derived from functional antibody sequences which have been modified (e.g., mutagenized). In some embodiments, the CDR sequences are random sequences, which comprises at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 contiguous nucleotide sequence, synthesized by any methods known in the art. The CDR sub-banks can be used for construction of combinatorial sub 5 libraries. Alternatively, a CDR of particular interest can be selected and then used for the construction of combinatorial sub-libraries (see Section 5.3). Optionally, randomized CDR sequences can be selected and then used for the construction of combinatorial sub-libraries (see Section 5.3). 5.3 Construction of Combinatorial Sub-libraries 0 [0172] Combinatorial sub-libraries are constructed by fusing in frame CDRs (e.g., non-human CDRs) with corresponding human framework regions of the FR sub-banks. For example, but not by way of limitation, combinatorial sub-library 1 is constructed by fusing in frame non-human CDR with corresponding kappa light chain human framework regions using sub-banks 1; combinatorial sub-library 2 is constructed by fusing in frame non-human Z5 CDR with corresponding kappa light chain human framework regions using sub-banks 2; combinatorial sub-library 3 is constructed by fusing in frame non-human CDR with corresponding kappa light chain human framework regions using sub-banks 3; combinatorial sub-library 4 is constructed by fusing in frame non-human CDR with corresponding kappa light chain human framework regions using sub-banks 4; combinatorial sub-libraries 5, 6, and 0 7 are constructed by fusing in frame non-human CDRs (Kabat definition for CDR HI and H2) with the corresponding heavy chain human framework regions using sub-banks 5, 6 and 7, respectively; combinatorial sub-libraries 8, 9 and 10 are constructed by fusing in frame non-human CDRs (Chothia definition for CDR HI and H2) with the corresponding heavy o WO 2006/102095 PCT/US2006/009745 chain human framework regions using sub-banks 8, 9 and 10, respectively; combinatorial sub-library 11 is constructed by fusing in frame non-human CDR H3 (Kabat and Chothia definition) with the corresponding human heavy chain framework regions using sub-bank 11. In some embodiments, the non-human CDRs may also be selected from a CDR library. It is 5 contemplated that CDRs may also be derived from human or humanized antibodies or may be random sequences not derived from any species. It is further contemplated that non-human frameworks may be utilized for the construction of sub-libraries. [0173] The construction of combinatorial sub-libraries can be carried out using any method known in the art. An example of a method for the construction of a light chain [0 combinatorial sub-libraries is further detailed in Figure 13B. A similar method may be utilized for the construction of heavy chain combinatorial sub-libraries. In one embodiment, the combinatorial sub-libraries are constructed using the Polymerase Chain Reaction (PCR) (e.g., by overlap extension using the oligonucleotides which overlap a CDR and a FW). In another embodiment, the combinatorial sub-libraries are constructed using direct ligation of .5 CDRs and FWs. In still another embodiment, combinatorial sub-libraries are not constructed using non-stochastic synthetic ligation reassembly. By way of example but not limitation, the combinatorial sub-library 1 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 34 and Table 35 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C ,0 or G, W= A or T and Y= C orT. Table 34. Light Chain FRI Antibody-Specific Forward Primers (for Sub-Library 1) 1240 ALl GATGTTGTGATGACWCAGTCT 1241 AL2 GACATCCAGATGAYCCAGTCT 1242 AL3 GCCATCCAGWTGACCCAGTCT 25 1243 AL4 GAAATAGTGATGAYGCAGTCT 1244 AL5 GAAATTGTGTTGACRCAGTCT 1245 AL6 GAICATTGTGATGACCCAGACT 1246 AL7 GAAATTGTRMTGACWCAGTCT 1247 AL8 GAYATYGTGATGACYCAGTCT 30 1248 AL9 GAAACGACACTCACGCAGTCT 1249 ALl0 GACATCCAGTTGACCCAGTCT 1250 ALI I AACATCCAGATGACCCAGTCT 125 1 AL 12 GCCATCCGGATGACCCAGTCT 1252 AL1 3 GTCATCTGGATGACCCAGTCT 35 Table 35. Light Chain FRI Antibody-Specific Reverse Primers (for Sub-Library 1) 1253 ALI' [first 70% of CDR LI]-GCAGGAGATGGAGGCCGGCTS 1254 AL2' [first 70% of CDR LI J-GCAGG AGAGGGTGRCTCTTTC 1255 AL3' [first 70% of CDR L1]-ACAASTGATGGTGACTCTGTC 1256 AU' [first 70% of CDR LI J-GAAGG AGATGGAGGCCGGCTG 40 1257 AL5' [first 70% of CDR Ll]-GCAGGAGATGGAGGCCTGCTC 1258 AL6' [first 70% of CDR L1]-GCAGGAGATGTTGACTTTGTC 1259 AL7 [first 70% of CDR Ll]-GCAGGTGATGGTGACTTTCTC WO 2006/102095 PCT/US2006/009745 1260 AL8' [first 70% of CDR L1]-GCAGTTGATGGTGGCCCTCTC 1261 AL9' [first 70% of CDR L1]-GCAAGTGATGGTGACTCTGTC 1262 ALlO' [first 70% of CDR Ll]-GCAAATGATACTGACTCTGTC 5 [0174] PCR is carried out with ALl to ALl 3 in combination with ALl' to ALl 0' using sub-bank 1, or a pool of oligonucleotides corresponding to sequences described in Table 1, as a template. This generates combinatorial sub-library 1 (Fig. 13B). 101751 By way of example but not limitation, the combinatorial sub-library 2 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the [0 oligonucleotides in Table 36 and Table 37 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. Table 36. Light Chain FR2 Antibody-Specific Forward Primers (for Sub-Library 2): 1263 BLI [last 70% OfCDR Ll]-TGGYTTCAGCAGAGGCCAGGC L5 1264 BL2 [last 70% of CDR Ll]-TGGTACCTGCAGAAGCCAGGS 1265 BL3 [last 70% of CDR Ll]-TGGTATCRGCAGAAACCAGGG 1266 BL4 [last 70% of CDR Ll]-TGGTACCARC AGAAACCAGG A 1267 BL5 [last 70% of CDR Ll]-TGGTACCARC AGAAACCTGGC 1268 BL6 [last 70% of CDR L1]-TGGTAYCWGCAGAAACCWGGG !0 1269 BL7 [last 70% OfCDR Ll]-TGGTATCAGCARAAACCWGGS 1270 BL8 [last 70% of CDR Ll]-TGGTAYCAGCARAAACCAG 1271 BL9 [last 70% of CDR Ll]-TGGTTTCTGCAG AAAGCCAGG 1272 BLl 0 [last 70% of CDR Ll]-TGGTTTCAGCAGAAACCAGGG Table 37. Light Chain FR2 Antibody-Specific Reverse Primers (for Sub-Library 2) 5 1273 BLl' [first 70% of CDR L2]-ATAGATC AGGAGCTGTGGAGR 1274 BL2' [first 70% of CDR L2]-ATAGATCAGGAGCTTAGGRGC 1275 BL3' [first 70% of CDR Llj-ATAGATGAGGAGCCTGGGMGC 1276 BL4' [first 70% of CDR L2]-RTAGATCAGGMGCTT AGGGGC 1277 BL5' [first 70% of CDR L2]-ATAGATCAGGWGCTTAGGRAC 30 1278 BL6' [first 70% of CDR L2]-ATAGATGAAGAGCTT AGGGGC 1279 BL7' [first 70% of CDR L2]-ATAAATTAGGAGTCTTGG AGG 1280 BL8' [first 70% of CDR L2]-GTAAATG AGCAGCTT AGGAGG 1281 BL9' [first 70% of CDR L2]-ATAGATCAGGAGTGTGGAGAC 1281 BLI 0' [first 70% of CDR L2]-ATAGATCAGGAGCTCAGGGGC 35 1283 BLl 1 [first 70% ofCDR L2]-ATAGATCAGGGACTTAGGGGC 1284 BLl 2' [first 70% of CDR L2]-ATAG AGGAAGAGCTTAGGGGA 1285 BL13' [first 70% of CDR L2]-CTTGATGAGGAGCTTTGGAGA 1286 BLI 4' [first 70% of CDR L2]-ATAAATTAGGCGCCTTGGAGA 1287 BLl 5' [first 70% of CDR L2]-CTTGATGAGGAGCTTTGGGGC 40 1288 BLI 6' [first 70% of CDR L2]-TTGAATAATGAAAATAGCAGC 101761 PCR is earned out with BLl to BL1 0 in combination with BLl 'to BLl 6' using sub-bank 2, or a pool of oligonucleotides corresponding to sequences described in Table 2, as a template. This generates combinatorial sub-library 2 (Fig. 13B). 15 [01771 By way of example but not limitation, the combinatorial sub-library 3 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the 1 fA WO 2006/102095 PCT/US2006/009745 oligonucleotides in Table 38 and Table 39 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. Table 38. Light Chain FR3 Antibody-Specific Forward Primers (for Sub-Library 3): 5 1289 CLI [Last 70% ofCDR L2]-GGGGTCCCAGACAGATTCAGY 1290 CL2 [Last 70% of CDR L2]-GGGGTCCCATCAAGGTTC AGY 1291 CL3 [Last 70% of CDR L2]-GGYATCCCAGCCAGGTTCAGT 1292 CU [Last 70% of CDR L2]-GGRGTCCCWGACAGGTTCAGT 1293 CL5 [Last 70% of CDR L2]-AGCATCCCAGCCAGGTTC AGT [0 1294 CL6 [Last 70% of CDR L2]-GGGGTCCCCTCG AGGTTCAGT 1295 CL7 [Last 70% of CDR L2]-GGAATCCCACCTCGATTCAGT 1296 CL8 [Last 70% of CDR L2]-GGGGTCCCTGACCGATTCAGT 1297 CL9 [Last 70% of CDR L2]-GGCATCCC AGACAGGTTCAGT 1298 CLI 0 [Last 70% of CDR L2]-GGGGTCTCATCGAGGTTCAGT [5 1299 CLI I [Last 70% of CDR L2]-GGAGTGCCAGAT AGGTTCAGT Table 39. Light Chain FR3 Antibody-Specific Reverse Primers (for Sub-Library 3) 1300 CL' [First 70% of CDR L3]-KCAGTAATAAACCCC AACATC 1301 CL2' [First 70% ofCDR L3]-ACAGTAATAYGTTGCAGCATC 1302 CL3' [First 70% of CDR LS]-ACMGTAATAAGTTGCAACATC O 1303 CL4' [First 70% of CDR LS]-RCAGTAATAAGTTGCAAAATC 1304 CL5' [First 70% of CDR L3]-ACAGTAATAARCTGC AAAATC 1305 CL6' [First 70% of CDR LS]-ACARTAGTAAGTTGCAAAATC 1306 CL7' [First 70% of CDR L3]-GCAGTA ATAAACTCC AAMATC 1307 CL8' [First 70% of CDR L3]-GCAGTAAT AAACCCCG ACATC !5 1308 CL9' [First 70% of CDR LSJ-ACAGAAGTAATATGCAGCATC 1309 CLI 0' [First 70% of CDR LSI-ACAGTAATATGTTGCAATATC 13 10 CL I' [First 70% of CDR L3]-ACAGTAATACACTGCAAAATC 13 11 CL12' [First 70% of CDR L3]-ACAGTAATAAACTGCCACATC 0 101781 PCR is carried out with CLl to CLl 1 in combination with CLl' to CL12' using sub-bank 3, or a pool of oligonucleotides corresponding to sequences described in Table 3, as a template. This generates combinatorial sub-library 3 (Fig 13B). [0179] By way of example but not limitation, the combinatorial sub-library 4 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the 35 oligonucleotides in Table 40 and Table 4 1 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. Table 40. Light Chain FR4 Antibody-Specific Forward Primers (for Sub-Library 4): 13 12 DLI [Last 70% of CDR L3]-TTYGGCCARGGGACCAAGSTG 40 1313 DL2 [Last 70% of CDR L3]-TTCGGCCAAGGGACACGACTG 1314 DL3 [Last 70% of CDR L3]-TTCGGCCCTGGG ACCAAAGTG 1315 DL4 [Last 70% of CDR L3]-TTCGGCGGAGGGACCAAGGTG Table 41. Light Chain FR4 Antibody-Specific Reverse Primers (for Sub-Library 4) 1316 DL1' TTTGATYTCCACCTTGGTCCC 15 1317 DL2' TTTGATCTCCAGCTTGGTCCC WO 2006/102095 PCT/US2006/009745 1318 DL3' TTTGATATCCACTTTGGTCCC 1319 DL4' TTTAATCTCCAGTCGTGTCCC [01801 PCR is carried out with DLl to DL4 in combination with DLI ' to DLI 4' 5 using sub-bank 4, or a pool of oligonucleotides corresponding to sequences described in Table 4, as a template. This generates combinatorial sub-library 4 (Fig. 13B). [01811 By way of example but not limitation, the combinatorial sub-library 5 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 42 and Table 43 (all shown in the 5' to 3' orientation, name 10 followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. Table 42. Heavy Chain FRI (Kabat Definition) Antibody-Specific Forward Primers (for Sub-Library 5): 1320 AHI CAGGTKCAGCTGGTGCAGTCT [5 1332211 AHH22 GAGGTGCAGCTGKTGGAGTCT 1322 AH3 CAGSTGCAGCTGCAGGAGTCG 1323 AH4 CAGGTCACCTTGARGGAGTCT 1324 AH5 CARATGCAGCTGGTGCAGTCT 1325 AH6 GARGTGCAGCTGGTGSAGTC 1332266 AHH77 CAGATCACCTTGAAGGAGTCT 1327 AH8 CAGGTSCAGCTGGTRSAGTCT 1328 AH9 CAGGTACAGCTGCAGCAGTCA 1329 AHIO CAGGTGCAGCTACAGCAGTGG Table 43. Heavy -Chain FRI (Kabat Definition) Antibody-Specific Reverse Primers (for !5 Sub-Library 5): 1330 AHK ' [First 70% of CDR H 1]-RGTGAAGGTGTATCCAGAAGC 133 1 AHK2' [First 70% of CDR H1]-GCTGAGTGAGAACCCAGAGAM 1332 AHK3' [First 70% of CDR HI]-ACTGAARGTGAATCCAGAGGC 1333 AHK4' [First 70% of CDR H1]-ACTGACGGTGAAYCCAGAGGC 30 1334 AHK5 '[First 70% of CDR H 1]-GCTGAYGGAGCCACC AGAG A C 1335 AHK6' [First 70% of CDR H1]-RGTAAAGGTGWAWCCAGAAGC 1336 AHK7' [First 70% of CDR HI]-ACTRAAGGTGAAYCCAGAGGC 1337 AHK8 '[First 70% of CDR H 1]-GGTRAARCTGTAWCCAGAASC 1338 AHK9' [First 70% of CDR H1]-AYCAAAGGTGAATCCAGARGC 35 1339 AHK1O'[First 70% of CDR HIJ-RCTRAAGGTGAATCCAGASGC 1340 AHK12 [First 70% of CDR HI]-GGTGAAGGTGTATCCRGAWGC 1341 AHK13'[First 70% of CDR H1]-ACTGAAGGACCCACCATAGAC 1342 AHK14'[First 70% of CDR H1]-ACTGATGGAGCCACCAGAGAC 1343 AHKl 5'[First 70% of CDR HI]-GCTGATGGAGTAACCAGAGAC 40 1344 AHK 6 [First 70% of CDR H 1]-AGTG AGGGTGTATCCGGAAAC 1345 AHK1 7'[First 70% of CDR H1]-GCTGAAGGTGCCTCCAGAAGC 1346 AHKl 8'[First 70% of CDR H1]-AGAGACACTGTCCCCGGAGAT [01821 PCR is earned out with AHl to AHl 0 in combination with AHKl 'to 15 AHK 8' using sub-bank 5, or a pool of oligonucleotides corresponding to sequences described in Table 5, as a template. This generates combinatorial sub-library 5. WO 2006/102095 PCT/US2006/009745 [01831 By way of example but not limitation, the combinatorial sub-library 6 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 44 and Table 45 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and 5 Y= CorT. Table 44. Heavy Chain FR2 (Kabat Definition) Antibody-Specific Forward Primers (for Sub-Library 6): 1347 BHKI [Last 70% of CDR Hl]-TGGGTGCGACAGGCYCCTGGA 1348 BHK2 [Last 70% of CDR H1]-TGGGTGCGMCAGGCCCCCGGA 0 1349 BHK3 [Last 70% of CDR H1]-TGGATCCGTCAGCCCCCAGGR 1350 BHK4 [Last 70% of CDR H1]-TGGRTCCGCCAGGCTCCAGGG 1351 BHK5 [Last 70% OfCDR HI]-TGGATCCGSCAGCCCCCAGGG 1352 BHK6 [Last 70% of CDR H1]-TGGGTCCGSCAAGCTCCAGGG 1353 BHK7 [Last 70% of CDR H1]-TGGGTCCRTCARGCTCCRGGR 5 1354 BHK8 [Last 70% of CDR H1]-TGGGTSCGMCARGCYACWGGA 1355 BHK9 [Last 70% of CDR H1]-TGGKTCCGCCAGGCTCCAGGS 1356 BHKI 0 [Last 70% of CDR H1]-TGGATCAGGCAGTCCCCATCG 1357 BHKl 1 [Last 70% of CDR H1]-TGGGCCCGCAAGGCTCCAGGA 1358 BHKl 2 [Last 70% of CDR H1]-TGGATCCGCCAGCACCCAGGG 0 1359 BHK 3 [Last 70% of CDR H1]-TGGGTCCGCCAGGCTTCCGGG 1360 BHK14 [Last 70% of CDR H1]-TGGGTGCGCCAGATGCCCGGG 1361 BHK15 [Last 70% of CDR H1]-TGGGTGCGACAGGCTCGTGGA 1362 BHKl6 [Last 70% of CDR H1]-TGGATCCGGCAGCCCGCCGGG 1363 BHK 7 [Last 70% of CDR H1]-TGGGTGCCACAGGCCCCTGGA 5 Table 45. Heavy Chain FR2 (Kabat Definition) Antibody-Specific Reverse Primers (for Sub-Library 6): 1364 BHKI ' [First 70% of CDR H2]-TCCCATCCACTCAAGCCYTTG 1365 BHK2' [First 70% of CDR H2]-TCCCATCCACTCAAGCSCTT 1366 BHK3' [First 70% of CDR H2]-WGAGACCCACTCCAGCCCCTT 0 1367 BHK4' [First 70% of CDR H2]-CCCAATCCACTCCAGKCCCTT 1368 BHK5' [First 70% of CDR H2]-TGAGACCCACTCCAGRCCCTT 1369 BHK6' [First 70% of CDR H2]-GCCAACCCACTCCAGCCCYTT 1370 BHK7' [First 70% of CDR H2]-KGCCACCCACTCCAGCCCCTT 1371 BHK8' [First 70% ofCDR H2]-TCCCAGCCACTCAAGGCCTC 5 1372 BHK9' [First 70% of CDR H2]-CCCCATCCACTCC AGGCCTT 1373 BHK 0' [First 70% of CDR H2]-TGARACCCACWCCAGCCCCTT 1374 BHKI 2' [First 70% of CDR H2]-MGAKACCCACTCCAGMCCCTT 1375 BHK13' [First 70% of CDR H2]-YCCMATCCACTCMAGCCCYTT 1376 BHK14' [First 70% of CDR H2]-TCCTATCCACTCAAGGCGTTG to 1377 BHKI 5' [First 70% of CDR H2]-TGCAAGCCACTCCAGGGCCTT 1378 BHK 6' [First 70% of CDR H2]-TGAAACATATTCCAGTCCCTT 1379 BHKI T [First 70% of CDR H2]-CGATACCC ACTCCAGCCCCTT [01841 PCR is earned out with BHK to BHK 7 in combination with BHK1 'to .5 BHKlV using sub-bank 6, or a pool of oligonucleotides corresponding to sequences described in Table 6 as a template. This generates combinatorial sub-library 6. [01851 By way of example but not limitation, the combinatorial sub-library 7 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the 1 n)- WO 2006/102095 PCT/US2006/009745 oligonucleotides in Table 46 and Table 47 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= CorT. Table 46. Heavy Chain FR3 (Kabat Definition) Antibody-Specific Forward Primers 5 (for Sub-Library 7): 1380 CHKI [Last 70% of CDR H2]-AGAGTC ACCATGACCAGGRAC 1381 CHK2 [Last 70% of CDR H2]-AGGCTCACCATCWCCAAGGAC 1382 CHK3 [Last 70% of CDR H2]-CGAGTYACC ATATCAGTAG AC 1383 CHK4 [Last 70% of CDR H2]-CGATTCACCATCTCCAGRGAC [0 1384 CHK5 [Last 70% of CDR H2]-AGATTCACCATCTCM AGAGA 1385 CHK6 [Last 70% of CDR H2]-MGGTTCACCATCTCCAGAGA 1386 CHK7 [Last 70% of CDR H2]-CGATTCAYCATCTCCAGAGA 1387 CHK8 [Last 70% of CDR H2]-CGAGTCACCATRTCMGTAGAC 1388 CHK9 [Last 70% of CDR H2]-AGRGTCACCATKACCAGGGAC [5 1389 CHKI O[Last 70% of CDR H2]-CAGGTC ACCATCTCAGCCGAC 1390 CHKl 1 [Last 70% of CDR H2]-CGAATAACCATCAACCCAGAC 1391 CHKl 2 [Last 70% of CDR H2]-CGGTTTGTCTTCTCCATGGAC 1392 CHKI 3 [Last 70% of CDR H2]-AGAGTCACCATGACCGAGGAC 1393 CHKI 4 [Last 70% of CDR H2]-AGAGTCACGATTACCGCGGAC 0 1394 CHK15 [Last 70% of CDR H2]-AGAGTCACCATGACCACAGAC Table 47. Heavy Chain FR3 (Kabat Definition) Antibody-Specific Reverse Primers (for Sub-Library 7) 1395 CHKl' [First 70% of CDR HS]-TCTAGYACAGTAATAC ACGGC 1396 CHK2' [First 70% ofCDR H3]-TCTCGCACAGTAATACAYGGC 5 1397 CHK3 [First 70% ofCDR H3]-TCTYGCACAGTAATACACAGC 1398 CHK4' [First 70% of CDR H3]-TGYYGCACAGTAATACACGGC 1399 CHK5' [First 70% of CDR H3]-CCGTGCACARTAATAYGTGGC 1400 CHK6' [First 70% ofCDR H3]-TCTGGCACAGTAATACACGGC 1401 CHK7' [First 70% of CDR H3]-TGTGGTACAGT AATACACGGC 0 1402 CHK8' [First 70% ofCDR H3]-TCTCGCACAGTGATACAAGGC 1403 CHK9' [First 70% of CDR H3]-TTTTGCACAGT AATACAAGGC 1404 CHKIO' [First 70% of CDR H3]-TCTTGCACAGTAATACATGGC 1405 CHKI 1 [First 70% of CDR H3]-GTGTGCACAGT AATATGTGGC 1406 CHKI 2' [First 70% of CDR H3]-TTTCGCACAGTAAT ATACGGC 35 1407 CHK13 [First 70% ofCDR H3]-TCTCACACAGTAATACACAGC [0186] PCR is carried out with CHKl to CHKl 5 in combination with CHK 'to CHKl 3' using sub-bank 7, or a pool of oligonucleotides corresponding to sequences described in Table 7, as a template. This generates combinatorial sub-library 7. 40 [01871 By way of example but not limitation, the combinatorial sub-library 8 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 48 and Table 49 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. 15 Table 48. Heavy Chain FRI (Chothia Definition) Antibody-Specific Forward Primers (for Sub-Library 8): WO 2006/102095 PCT/US2006/009745 1408 AHI CAGGTKCAGCTGGTGCAGTCT 1409 AH2 GAGGTGCAGCTGKTGGAGTCT 1410 AH3 CAGSTGCAGCTGCAGGAGTCG 141 1 AH4 CAGGTCACCTTGARGGAGTCT 5 1412 AH5 CARATGCAGCTGGTGCAGTCT 1413 AH6 GARGTGCAGCTGGTGSAGTC 1414 AH7 CAGATCACCTTGAAGGAGTCT 1415 AH8 CAGGTSCAGCTGGTRSAGTCT 1416 AH9 CAGGTACAGCTGCAGCAGTCA 10 1417 AHI O CAGGTGCAGCTACAGCAGTGG Table 49. Heavy Chain FRI (Chothia Definition) Antibody-Specific Reverse Primers (for Sub-Library 8) 1418 AHCI ' [First 70% of CDR HI]- RGAARCCTTGCAGGAGACCTT 1419 AHC2' [First 70% of CDR HI]- RGAAGCCTTGCAGGAAACCTT 15 1420 AHC3' [First 70% ofCDR Hi]- AGATGCCTTGCAGGAAACCTT 1421 AHC4' [First 70% ofCDR HI]- AGAGAMGGTGCAGGTCAGCGT 1422 AHC5' [First 70% of CDR HI]- AGASGCTGCACAGGAGAGTCT 1423 AHC6' [First 70% of CDR HI]- AGAGACAGTRCAGGTGAGGGA 1424 AHC7 [First 70% of CDR HI]- AKAGACAGCGCAGGTGAGGGA 20 1425 AHC8' [First 70% of CDR HI]- AGAGAAGGTGCAGGTCAGTGT 1426 AHC9' [First 70% of CDR Hi]- AGAAGCTGTACAGGAGAGTCT 1427 AHCl 0' [First 70% of CDR HI]- AGAGGCTGCACAGGAGAGTTT 1428 AHC12' [First 70% of CDR HI]- AGAACCCTTACAGG AGATCTT 1429 AHC13' [First 70% of CDR HI]- GGAGATGGCACAGGTGAGTGA 25 [0188] PCR is carried out with AHI to AHI 0 in combination with AHCl 'to AHCl 3' using sub-bank 8, or a pool of oligonucleotides corresponding to sequences described in Table 8, as a template. This generates combinatorial sub-library 8. [0189] By way of example but not limitation, the combinatorial sub-library 9 is 0 constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 50 and Table 5 1 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. Table 50. Heavy Chain FR2 (Chothia Definition) Antibody-Specific Forward Primers 35 (for Sub-Library 9): 1430 BHCI [Last 70% OfCDR H1]-TATGGYATSAGCTGGGTGCGM 1431 BHC2 [Last 70% of CDR H1]-ATGKGTGTGAGCTGGATCCGT 1432 BHC3 [Last 70% of CDR H1]-TACTACTGGRGCTGGATCCGS 1433 BHC4 [Last 70% of CDR H1]-TATGCYATSAGCTGGGTSCGM 40 1434 BHC5 [Last 70% of CDR H1]-TCTGCTATGCASTGGGTSCGM 1435 BHC6 [Last 70% of CDR H1]-TATGCYATGCAYTGGGTSCGS 1436 BHC7 [Last 70% of CDR H 1]-CGCTACCTGCACTGGGTGCGA 1437 BHC8 [Last 70% of CDR HI]-TTATCCATGCACTGGGTGCGA 1438 BHC9 [Last 70% of CDR H 1]-GCCTGGATG AGCTGGGTCCGC 45 1439 BHC 10 [Last 70% of CDR H I]-GCTGCTTGG AACTGG ATC AGG 1440 BHCI 1 [Last 70% of CDR H1]-AATGAGATGAGCTGGATCCGC 1441 BHC12 [Last 70% of CDR H1]-AACTACATGAGCTGGGTCCGC 1442 BHCI 3 [Last 70% of CDR H1]-AACTGGTGGGGCTGGATCCGG 1443 BHC14 [Last 70% of CDR H1]-GTGGGTGTGGGCTGGATCCGT 50 1444 BHC15 [Last 70% OfCDR H1]-CACTACATGGACTGGGTCCGC WO 2006/102095 PCT/US2006/009745 1445 BHC 16 [Last 70% of CDR H 1J-AGTGAC ATGAACTGGGCCCGC 1446 BHC17 [Last 70% of CDR H1]-AGTGACATGAACTGGGTCCAT 1447 BHC1 8 [Last 70% of CDR Hlj-TATACCATGCACTGGGTCCGT 1448 BHC1 9 [Last 70% of CDR H1]-TATGCTATGCACTGGGTCCGC 5 1449 BHC20 [Last 70% of CDR H 1]-TATGCTATGAGCTGGTTCCGC 1450 BHC21 [Last 70% of CDR H1]-TATAGCATGAACTGGGTCCGC 1451 BHC22 [Last 70% of CDR H1]-TATGGCATGCACTGGGTCCGC 1452 BHC23 [Last 70% of CDR HI]-TATTGGATGAGCTGGGTCCGC 1453 BHC24 [Last 70% of CDR H1]-TACGACATGCACTGGGTCCGC 0 1454 BHC25 [Last 70% of CDR H1]-TACTACATGAGCTGGATCCGC 1455 BHC26 [Last 70% of CDR H1]-TACTGGATGCACTGGGTCCGC 1456 BHC27 [Last 70% of CDR H1]-TACTGGATCGGCTGGGTGCGC 1457 BHC28 [Last 70% of CDR H1]-TACTATATGCACTGGGTGCGA 1458 BHC29 [Last 70% of CDR HIJ-TATGATATCAACTGGGTGCGA 5 1459 BHC30 [Last 70% of CDR H 1]-TATGGTATGAATTGGGTGCCA Table 51. Heavy Chain FR2 (Chothia Definition) Antibody-Specific Reverse Primers (for Sub-Library 9) 1460 BHCl' [First 70% ofCDR H2]-AATASCWGAGACCCACTCCAG 1461 BHC2' [First 70% of CDR H2]-AATAASWGAGACCCACTCCAG 9 1462 BHC3' [First 70% of CDR H2]-GMTCCATCCCATCCACTCAAG 1463 BHC4' [First 70% of CDR H2]-GATACKCCCAATCCACTCCAG 1464 BHC5' [First 70% of CDR H2]-GATRTACCCAATCCACTCCAG 1465 BHC6' [First 70% of CDR H2]-AATGWGTGCAAGCCACTCCAG 1466 BHC7' [First 70% of CDR H2]-AAYACCYGAKACCCACTCCAG 5 1467 BHC8' [First 70% of CDR H2]-AATGKATGARACCCACTCC AG 1468 BHC9' [First 70% of CDR H2]-ARTACGGCCAACCCACTCCAG 1469 BHClO' [First 70% of CDR H2]-AAAACCTCCCATCCACTCAAG 1470 BHC1 2' [First 70% of CDR H2]-GATTATTCCCATCCACTCAAG 1471 BHC13' [First 70% of CDR H2]-GATCCATCCTATCCACTCAAG 9 1472 BHC14' [First 70% of CDR H2]-GAACCATCCCATCCACTCAAG 1473 BHC 15' [First 70% of CDR H2]-GATCCCTCCC ATCCACTCAAG 1474 BHC 16' [First 70% of CDR H2]-CATCCATCCCATCCACTCAAG 1475 BHC 7' [First 70% of CDR H2]-TGTCCTTCCCAGCCACTCAAG 1476 BHC 18' [First 70% of CDR H2]-AATACGTGAGACCCACACCAG 5 1477 BHC19' [First 70% of CDR H2]-AATAGCTGAAACATATTCCAG 1478 BHC20' [First 70% of CDR H2]-GATTTCCCCAATCCACTCCAG 1479 BHC2 1' [First 70% of CDR H2]-GATG ATCCCC ATCCACTCC AG 1480 BHC22' [First 70% of CDR H2]-TATAACTGCCACCCACTCCAG 1481 BHC23' [First 70% of CDR H2]-AATGAAACCTACCC ACTCCAG 3 1482 BHC24' [First 70% of CDR H2]-TATGTTGGCCACCCACTCC AG [01901 PCR is carried out with BHCl to BHC30 in combination with BHCl 'to BHC24' using sub-bank 9, or a pool of oligonucleotides corresponding to sequences described in Table 9, as a template. This generates combinatorial sub-library 9. 5 [0191] By way of example but not limitation, the combinatorial sub-library 10 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 52 and Table 53 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. 0 Table 52. Heavy Chain FR3 (Chothia Definition) Antibody-Specific Forward Primers (for Sub-Library 10): WO 2006/102095 PCT/US2006/009745 1483 CHCl [Last 70% of CDR H2}-ACCAACTACAACCCSTCCCTC 1484 CHC2 [Last 70% of CDR H2]--ATATACTACGCAGACTCWGTG 1485 CHC3 [Last 70% of CDR H2]--ACATACTAYGCAGACTCYGTG 1486 CHC4 [Last 70% of CDR H2]--ACMAACTACGCACAGAARTTC 1487 CHC5 [Last 70% of CDR H2]--ACAAACTATGCACAGAAGYT 1488 CHC6 [Last 70% of CDR H2]--ACARGCTAYGCACAGAAGTTC 1489 CHC7 [Last 70% of CDR H2].-AYAGGYTATGCRGACTCTGTG 1490 CHC8 [Last 70% of CDR H2]--AAATMCTACAGCACATCTCTG 1491 CHC9 [Last 70% of CDR H2]--AAATACTATGTGGACTCTGTG 1492 CHCl 0 [Last 70% of CDR H2] -CCAACATATGCCCAGGGCTTC 1493 CHCI I [Last 70% of CDR H2]-GCAAACTACGCACAGAAGTTC 1494 CHC 12 [Last 70% of CDR H2]-AAATACTATGCAGACTCCGTG 1495 CHCl 3 [Last 70% of CDR H2]-AAGCGCTACAGCCCATCTCTG 1496 CHC 14 [Last 70% of CDR H2]-AATGATTATGCAGTATCTGTG 1497 CHC 15 [Last 70% of CDR H2}-ACCAGATACAGCCCGTCCTTC 1498 CHC 16 [Last 70% of CDR H2]-ACAGAATACGCCGCGTCTGTG 1499 CHCL 7 [Last 70% of CDR H2]--ACGCACTATGCAGACTCTGTG 1500 CHCL 8 [Last 70% of CDR H2].-ACGCACTATGTGGACTCCGTG 1501 CHC 19 [Last 70% of CDR H2} -ACAATCTACGCACAGAAGTTC 1502 CHC20 [Last 70% of CDR H2} -ACAAAATATTCACAGGAGTTC 1503 CHC21 [Last 70% of CDR H2].-ACATACTACGCAGACTCCAGG 1504 CHC22 [Last 70% of CDR H2]--ACAAGCTACGCGGACTCCGTG 1505 CHC23 [Last 70% of CDR H2]--ACATATTATGCAGACTCTGTG 1506 CHC24 [Last 70% of CDR H2} -ACAGACTACGCTGCACCCGTG 1507 CHC25 [Last 70% of CDR H2]--ACAGCATATGCTGCGTCGGTG 1508 CHC26 [Last 70% of CDR H2]-ACATACTATCCAGGCTCCGTG 1509 CHC27 [Last 70% of CDR H2}-ACCTACTACAACCCGTCCCTC Table 53. Heavy Chain FR3 (Chothia Definition) Antibody-Specific Reverse Primers (for Sub-Library 10): 1510 CHC' [First 70% of CDR H3]- TSTYGCACAGTAATACACGGC 151 1 CHC2' [First 70% ofCDR H3]- TCTYGCACAGTAATACATGGC 1512 CHC3' [First 70% ofCDR H3]- TCTAGYACAGTAATACACGGC 1513 CHC4' [First 70% ofCDR H3]- CCGTGCACARTAATAYGTGGC 1514 CHC5' [First 70% ofCDR H3]- TCTYGCACAGTAATACACAGC 1515 CHC6' [First 70% ofCDR H3]- GTGTGCACAGTAATATGTGGC 1516 CHC7' [First 70% ofCDR H3]- TGCCGCACAGTAATACACGGC 1517 CHC8' [First 70% ofCDR H3]- TGTGGTACAGTAATACACGGC 151 8 CHC9' [First 70% ofCDR H3]- TCTCACACAGTAATACACAGC 1519 CHClO' [First 70% ofCDR H3]- TCTCGCACAGTGATACAAGGC 1520 CHCL 1' [First 70% ofCDR H3]- TTTCGCACAGTAATATACGGC 1521 CHC12' [First 70% ofCDR H3]- TCTGGCACAGTAATACACGGC 1522 CHC13' [First 70% ofCDR H3]- TTTTGCACAGTAATACAAGGC [0192] PCR is carried out with CHCl to CHC27 in combination with CHCl 'to CHC 13' using sub-bank 10, or a pool of oligonucleotides corresponding to sequences described in Table 10, as a template. This generates combinatorial sub-library 10. [0193] By way of example but not limitation, the combinatorial sub-library 11 is constructed using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides in Table 54 and Table 55 (all shown in the 5' to 3' orientation, name followed by sequence) where K= G or T, M= A or C, R= A or G, S= C or G, W= A or T and Y= C or T. 1 f%'7 WO 2006/102095 PCT/US2006/009745 Table 54. Heavy Chain FR4 (Kabat and Chothia Definition) Antibody-Specific Forward Primers (for Sub-Library 11): 1523 DHl [Last 70"/0 OfCDR HS]-TGGGGCCARGGM ACCCTGGTC 1524 DH2 [Last 70% of CDR HS]-TGGGGSCAAGGGACMAYGGTC 5 1525 DH3 [Last 70% ofCDR H3]-TGGGGCCGTGGCACCCTGGTC Table 55. Heavy Chain FR4 (Kabat and Chothia Definition) Antibody-Specific Reverse Primers (for Sub-Library 11) 1526 DH1' TGAGGAGACRGTGACCAGGGT 1527 DH2' TGARGAGACGGTGACCRTKGT 1528 DH3 TGAGGAGACGGTGACCAGGGT 10194] PCR is carried out with DHl to DHC3 in combination with DHl ' to DH3' using sub-bank 11, or a pool of oligonucleotides corresponding to sequences described in Table 11, as a template. This generates combinatorial sub-library 11. 5 [0195] One of skill in the art can design appropriate primers encoding non-human frameworks for use in the methods of the present invention. One of skill in the art can also design appropriate primers encoding modified and/or random CDRs for use in the methods of the present invention. [0196] In some embodiments, nine combinatorial sub-libraries can be constructed ) using direct ligation of CDRs (e.g., non-human CDRs) and the frameworks (e.g., human frameworks) of the sub-banks. For example, but not by way of limitation, combinatorial sub libraries 1', 2' and 3' are built separately by direct ligation of the non-human CDRs L1, L2 and L3 (in a single stranded or double stranded form) to sub-banks 1, 2 and 3, respectively. In one embodiment, the non-human CDRs (LI, L2 and L3) are single strand nucleic acids. In 5 another embodiment, the non-human CDRs (Ll, L2 and L3) are double strand nucleic acids. Alternatively, combinatorial sub-libraries 1', 2' and 3' can be obtained by direct ligation of the non-human CDRs (LI, L2 and L3) in a single stranded (+) form to the nucleic acid 1-46 listed in Table 1, nucleic acid 47-92 listed in Table 2, and nucleic acid 93-138 listed in Table 3, respectively. 0 [01971 In some embodiments, combinatorial sub-libraries 5' and 6' are built separately by direct ligation of the non-human CDRs Hl and H2 (in a single stranded or double stranded form and according to Kabat definition) to sub-banks 5 and 6, respectively. Alternatively, sub-libraries 5' and 6' can be obtained by direct ligation of the non-human CDRs H 1 and H2 (according to Kabat definition and in a single stranded (+) form) to nucleic 5 acid 144 to 187 listed in Table 5 and 188 to 231 listed in Table 6, respectively. WO 2006/102095 PCT/US2006/009745 [0198] In some embodiments, combinatorial sub-libraries 8' and 9'are built separately by direct ligation of the non-human CDRs H I and H2 (in a single stranded or double stranded form and according to Chothia definition) to sub-banks 8 and 9, respectively. Alternatively, sub-libraries 8' and 9' can be obtained by direct ligation of the non-human CDRs H11 and H2 5 (according to Chothia definition and in a single stranded (+) form) to nucleic acid 276 to 3 19 listed in Table 8 and 320 to 363 of Table 9, respectively. [01991 Combinatorial sub-libraries 11' and 12' are built separately by direct ligation of the non-human CDR H3 (in a single stranded or double stranded form) to sub-bank 7 (Kabat definition) and 10 (Chothia definition), respectively. Alternatively, sub-libraries 11' 0 and 12' can be obtained by direct ligation of non-human CDR H3 (in a single stranded (+) form) to nucleic acid 232 to 275 listed in Table 7 and 364 to 407 of Table 10, respectively. [0200] Direct ligation of DNA fragments can be carried out according to standard protocols. It can be followed by purification/separation of the ligated products from the un ligated ones. 5 5.4 Construction of Combinatorial Libraries [02011 Combinatorial libraries are constructed by assembling together combinatorial sub-libraries of corresponding variable light chain region or variable heavy chain region. Examples of methods useful for the construction of light chain variable region combinatorial libraries are further detailed in Figures 13C-D. In one embodiment, the combinatorial ) libraries are constructed using the Polymerase Chain Reaction (PCR) (e.g., by overlap extension). In another embodiment, the combinatorial libraries are constructed by direct ligation. In still another embodiment, combinatorial libraries are not constructed using non stochastic synthetic ligation reassembly. For example, but not by way of limitation, combinatorial library of human kappa light chain germline frameworks (combination library 5 1) can be built by assembling together sub-libraries 1, 2, 3 and 4 through overlapping regions in the CDRs as described below (also see Fig. 13C and D); two combinatorial libraries of human heavy chain germline frameworks (one for Kabat definition of the CDRs, combination library 2, and one for Chothia definition of the CDRs, combination library 3) can be built by assembling together sub-libraries 5, 6, 7, 11 (Kabat definition) or sub-libraries 8, 9, 10, 11 0 (Chothia definition) through overlapping regions in the CDRs as described below. [02021 In one embodiment, the construction of combinatorial library 1 is carried out using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides *1 AC) WO 2006/102095 PCT/US2006/009745 listed in Table 56 and Table 57 (all shown in the 5' to 3' orientation, the name of the primer followed by the sequence): Table 56. Light Chain Forward Primers (for Combinatorial Library 1): 1529 ALI GATGTTGTGATGACWCAGTCT 1530 AL2 GACATCCAGATGAYCCAGTCT 1531 AL3 GCCATCCAGWTGACCCAGTCT 1532 AL4 GAAATAGTGATGAYGCAGTCT 1533 AL5 GAAATTGTGTTGACRCAGTCT 1534 AL6 GAICATTGTGATGACCCAGACT 1535 AL7 GAAATTGTRMTGACWCAGTCT 1536 AL8 GAYATYGTGATGACYCAGTCT 1537 AL9 GAAACGACACTCACGCAGTCT 1538 ALlO GACATCCAGTTGACCCAGTCT 1539 ALIl AACATCCAGATGACCCAGTCT 1540 AL12 GCCATCCGGATGACCCAGTCT 1541 AL13 GTCATCTGGATGACCCAGTCT Table 57. Light Chain Reverse Primers (for Combinatorial Library 1): 1542 DLI' TTTGATYTCCACCTTGGTCCC 1543 OLT TTTGATCTCCAGCTTGGTCCC 1544 DL3' TTTGATATCCACTTTGGTCCC 1545 DL4' TTTAATCTCCAGTCGTGTCCC [02031 PCR is carried out with ALl to ALl 3 in combination with DLl 'to DL4' using sub-libraries 1, 2, 3 and 4 together, or using the oligonucleotides in Tables 35-40 and a pool of oligonucleotides corresponding to sequences described in Table 1, 2, 3 and 4, as a template. This generates combinatorial library 1 (Fig 13C-D). [0204] In one embodiment, the construction of combinatorial library 2 and 3 is carried out using the Polymerase Chain Reaction (PCR) by overlap extension using the oligonucleotides listed in Table 58 and Table 59 (all shown in the 5' to 3' orientation, name followed by sequence): Table 58. Heavy Chain Forward Primers (for Combinatorial Library 2 and 3, Kabat and Chothia Definition): 1546 AHI CAGGTKCAGCTGGTGCAGTCT 1547 AH2 GAGGTGCAGCTGKTGGAGTCT 1548 AH3 CAGSTGCAGCTGCAGGAGTCG 1549 AH4 CAGGTCACCTTGARGGAGTCT 1550 AH5 CARATGCAGCTGGTGCAGTCT 1551 AH6 GARGTGCAGCTGGTGSAGTC 1552 AH7 CAGATCACCTTGAAGGAGTCT 1553 AH8 CAGGTSCAGCTGGTRSAGTCT 1554 AH9 CAGGTACAGCTGCAGCAGTCA 1555 AHIO CAGGTGCAGCTACAGCAGTGG Table 59. Heavy Chain Reverse Primers (for Combinatorial Library 2 and 3, Kabat and Chothia Definition): 1556 DH1' TGAGGAGACRGTGACCAGGGT 1557 DH2' TGARGAGACGGTGACCRTKGT WO 2006/102095 PCT/US2006/009745 1558 DH3' TGAGGAGACGGTGACCAGGGT [0205] PCR is carried out with AHI to AHI 0 in combination with DHl 'to DH3' using sub-libraries 5, 6, 7, 11 together, or using the oligonucleotides listed in Tables 43-47 5 and 54 and a pool of oligonucleotides corresponding to sequences described in Table 5, 6, 7 and 11, or sub-libraries 8, 9, 10, 11, or using the oligonucleotides listed in Tables 49-54 and a pool of oligonucleotides corresponding to sequences described in Table 8, 9, 10 and 11, together, as a template. This generates combinatorial library 2 or 3, respectively. [0206] In another embodiment, combinatorial libraries are constructed by direct ) ligation. For example, combinatorial library of human kappa light chain germline frameworks (combination library 1') is built by direct sequential ligation of sub-libraries 1', 2', 3' and sub-bank 4 (or nucleic acids 139 to 143, see Table 4) together. This is followed by a Polymerase Chain Reaction step using the oligonucleotides described in Table 60 and Table 6 1. Two combinatorial libraries of human heavy chain germline framework regions (one for Kabat definition of the CDRs, combination library 2'; and one for Chothia definition of the CDRs, combination library 3') are built by direct sequential ligation of sub-libraries 5', 6', IT and sub-bank 11 (Kabat definition) or of sub-libraries 8', 9', 12' and sub-bank II (Chothia definition) together. Alternatively, sub-bank 11 can be substituted with nucleic acids 408 to 413 (see Table 11) in the ligation reactions. This is followed by a Polymerase Chain Reaction step using the oligonucleotides described in Table 62 and Table 63. Table 60. Light Chain Forward Primers (for Combinatorial Library 1'): 1559 ALl GATGTTGTGATGACWCAGTCT 1560 AL2 GACATCCAGATGAYCCAGTCT 1561 AL3 GCCATCCAGWTGACCCAGTCT 5 1562 AL4 GAAATAGTGATGAYGCAGTCT 1563 ALs GAAATTGTGTTGACRCAGTCT 1564 AL6 GAKATTGTGATGACCCAGACT 1565 AL7 GAAATTGTRMTGACWCAGTCT 1566 AL8 GAYATYGTGATGACYCAGTCT 0 1567 AL9 GAAACGACACTCACGCAGTCT 1568 ALlO GACATCCAGTTGACCCAGTCT 1569 ALIl AACATCCAGATGACCCAGTCT 1570 ALl 2 GCCATCCGGATGACCCAGTCT 1571 ALl 3 GTCATCTGGATGACCCAGTCT 5 Table 61. Light Chain Reverse Primers (for Combinatorial Library 1'): 1572 DLF TTTGATYTCCACCTTGGTCCC 1573 DL2' TTTGATCTCCAGCTTGGTCCC 1574 DL3' TTTGATATCCACTTTGGTCCC 1575 DL4' TTTAATCTCCAGTCGTGTCCC 0 WO 2006/102095 PCT/US2006/009745 102071 PCR is carried out with ALl to ALl 3 in combination with DLl ' to DL4' using sub-libraries 1', 2', 3' and sub-bank 4 (or nucleic acids 139 to 143, see Table 4) previously ligated together as a template. This generates combinatorial library 1'. Table 62. Heavy Chain Forward Primers (for Combinatorial Library 2' and 3', Kabat and Chothia Definition): 1576 AHI CAGGTKCAGCTGGTGCAGTCT 1577 AH2 GAGGTGCAGCTGKTGGAGTCT 1578 AH3 CAGSTGCAGCTGCAGGAGTCG 1579 AH4 CAGGTCACCTTGARGGAGTCT 1580 AH5 CARATGCAGCTGGTGCAGTCT 1581 AH6 GARGTGCAGCTGGTGSAGTC 1582 AH7 CAGATCACCTTGAAGGAGTCT 1583 AH8 CAGGTSCAGCTGGTRSAGTCT 1584 AH9 CAGGTACAGCTGCAGCAGTCA 1585 AH1O CAGGTGCAGCTACAGCAGTGG Table 63. Heavy Chain Reverse Primers (for Combinatorial Library 2' and 3', Kabat and Chothia Definition): 1586 DHT TGAGGAGACRGTGACCAGGGT 1587 DH2' TGARGAGACGGTGACCRTKGT 1588 DH3' TGAGGAGACGGTGACCAGGGT 102081 PCR is carried out with AHl to AHl 0 in combination with DHl 'to DH3' using sub-libraries 5', 6', 11' and sub-bank 11 (or nucleic acids 408 to 413, see Table 11) previously ligated together or sub-libraries 8', 9', 12' and sub-bank 11 (or nucleic acids408 to 413, see Table 11) previously ligated together as a template. This generates combinatorial library 2' or 3', respectively. [0209] The sub-banks of framework regions, sub-banks of CDRs, combinatorial sub libraries, and combinatorial libraries constructed in accordance with the present invention can be stored for a later use. The nucleic acids can be stored in a solution, as a dry sterilized 0 lyophilized powder, or a water free concentrate in a hermetically sealed container. In cases where the nucleic acids are not stored in a solution, the nucleic acids can be reconstituted (e.g., with water or saline) to the appropriate concentration for a later use. The sub-banks, combinatorial sub-libraries and combinatorial libraries of the invention are preferably stored at between 2 0 C and 8 0 C in a container indicating the quantity and concentration of the nucleic 5 acids. 5.5 Expression Of The Combinatorial Libraries [02101 The combinatorial libraries constructed in accordance with the present invention can be expressed using any methods know in the art, including but not limited to, WO 2006/102095 PCT/US2006/009745 bacterial expression system, mammalian expression system, and in vitro ribosomal display system. [02111 In certain embodiments, the present invention encompasses the use of phage vectors to express the combinatorial libraries. Phage vectors have particular advantages of providing a means for screening a very large population of expressed display proteins and thereby locate one or more specific clones that code for a desired binding activity. [0212] The use of phage display vectors to express a large population of antibody molecules are well known in the art and will not be reviewed in detail herein. The method generally involves the use of a filamentous phage (phagemid) surface expression vector system for cloning and expressing antibody species of a library. See, e.g., Kang et al, Proc. Natl. Acad. ScL, USA, 88:4363-4366 (1991); Barbas et al, Proc. Natl. Acad. Sci., USA, 88:7978-7982 (1991); Zebedee et al, Proc. Natl. Acad. Sci., USA, 89:3175-3179 (1992); Kang et al, Proc. Natl. Acad. Sci., USA, 88:1 1120-1 1123 (1991); Barbas et al, Proc. Natl. Acad. Sci., USA, 89:4457-4461 (1992); Gram et al, Proc. Natl. Acad. Sci., USA, 89:3576 3580 (1992); Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J. Immunol. Methods 184:177-186 (1995); Kettleborough et al, Eur. J. Immunol. 24:952-958 (1994); Persic et al, Gene 187 9-18 (1997); Burton et al, Advances in Immunology 57:191 280 (1994); PCT application No. PCT/GB91/01 134; PCT publication Nos. WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/1 1236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108. [0213] A specific phagemid vector of the present invention is a recombinant DNA molecule containing a nucleotide sequence that codes for and is capable of expressing a fusion polypeptide containing, in the direction of amino- to carboxy-terminus, (1) a prokaryotic secretion signal domain, (2) a heterologous polypeptide defining an immunoglobulin heavy or light chain variable region, and (3) a filamentous phage membrane anchor domain. The vector includes DNA expression control sequences for expressing the fusion polypeptide, such as prokaryotic control sequences. [0214] The filamentous phage membrane anchor may be a domain of the cpIII or cpVIII coat protein capable of associating with the matrix of a filamentous phage particle, thereby incorporating the fusion polypeptide onto the phage surface. 113 WO 2006/102095 PCT/US2006/009745 [02151 Membrane anchors for the vector are obtainable from filamentous phage M13, fl, fd, and equivalent filamentous phage. Specific membrane anchor domains are found in the coat proteins encoded by gene III and gene VIII. (See Ohkawa et al, J. Biol. Chem., 256:9951-9958, 1981). The membrane anchor domain of a filamentous phage coat protein is a portion of the carboxy terminal region of the coat protein and includes a region of hydrophobic amino acid residues for spanning a lipid bilayer membrane, and a region of charged amino acid residues normally found at the cytoplasmic face of the membrane and extending away from the membrane. For detailed descriptions of the structure of filamentous phage particles, their coat proteins and particle assembly, see the reviews by Rached et al., Microbiol. Rev., 50:401-427 (1986); and Model et al, in "The Bacteriophages: Vol. 2", R. Calendar, ed. Plenum Publishing Co., pp. 375-456 (1988). [0216] The secretion signal is a leader peptide domain of a protein that targets the protein to the periplasmic membrane of gram negative bacteria. An example of a secretion signal is a pelB secretion signal. (Better et al, Science, 240:1041-1043 (1988); Sastry et al, Proc. Natl. Acad. ScL, USA, 86:5728-5732 (1989); and Mullinax et al, Proc. Natl. Acad. ScL, USA, 87:8095-8099 (1990)). The predicted amino acid residue sequences of the secretion signal domain from two pelB gene product variants from Erwinia carotova are described in Lei et al, Nature, 33 1:543-546 (1988). Amino acid residue sequences for other secretion signal polypeptide domains from E. coli useful in this invention as described in Oliver, Escherichia coli and Salmonella Typhimurium, Neidhard, F. C. (ed.), American Society for Microbiology, Washington, D.C., 1:56-69 (1987). [0217] DNA expression control sequences comprise a set of DNA expression signals for expressing a structural gene product and include both 5' and 3' elements, as is well known, operatively linked to the gene. The 5' control sequences define a promoter for initiating 5 transcription and a ribosome binding site operatively linked at the 5' teicninus of the upstream translatable DNA sequence. The 3' control sequences define at least one termination (stop) codon in frame with and operatively linked to the heterologous fusion polypeptide. [0218] In certain embodiments, the vector used in this invention includes a prokaryotic origin of replication or replicon, i.e., a DNA sequence having the ability to direct 0 autonomous replication and maintenance of the recombinant DNA molecule extra chromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith. Such origins of replication are well known in the art. Preferred origins of replication are those that are efficient in the host organism. One contemplated host cell is E. coli. See WO 2006/102095 PCT/US2006/009745 Sambrook et al, in "Molecular Cloning: a Laboratory Manual", 2nd edition, Cold Spring Harbor Laboratory Press, New York (1989). [0219] In addition, those embodiments that include a prokaryotic replicon can also include a nucleic acid whose expression confers a selective advantage, such as drag resistance, to a bacterial host transformed therewith. Typical bacterial drag resistance genes are those that confer resistance to ampicillin, tetracycline, neomycin/kanamycin or chloramphenicol. Vectors typically also contain convenient restriction sites for insertion of translatable DNA sequences. [0220] In some embodiments, the vector is capable of co-expression of two cistrons contained therein, such as a nucleotide sequence encoding a variable heavy chain region and a nucleotide sequence encoding a variable light chain region. Co-expression has been accomplished in a variety of systems and therefore need not be limited to any particular design, so long as sufficient relative amounts of the two gene products are produced to allow assembly and expression of functional heterodimer. [0221] In some embodiments, a DNA expression vector is designed for convenient manipulation in the form of a filamentous phage particle encapsulating a genome. hi this embodiment, a DNA expression vector further contains a nucleotide sequence that defines a filamentous phage origin of replication such that the vector, upon presentation of the appropriate genetic complementation, can replicate as a filamentous phage in single stranded replicative form and be packaged into filamentous phage particles. This feature provides the ability of the DNA expression vector to be packaged into phage particles for subsequent segregation of the particle, and vector contained therein, away from other particles that comprise a population of phage particles. [0222] A filamentous phage origin of replication is a region of the phage genome, as 5 is well known, that defines sites for initiation of replication, termination of replication and packaging of the replicative form produced by replication (see for example, Rasched et al, Microbiol. Rev., 50:401-427, 1986; and Horiuchi, J. MoI. Biol, 188:215-223, 1986). A commonly used filamentous phage origin of replication for use in the present invention is an M13, fl or fd phage origin of replication (Short et al, Nucl. Acids Res., 16:7583-7600, 0 1988). [0223] The method for producing a heterodimeric immunoglobulin molecule generally involves (1) introducing a large population of display vectors each capable of WO 2006/102095 PCT/US2006/009745 expressing different putative binding sites displayed on a phagemid surface display protein to a filamentous phage particle, (3) expressing the display protein and binding site on the surface of a filamentous phage particle, and (3) isolating (screening) the surface-expressed phage particle using affinity techniques such as panning of phage particles against a preselected antigen, thereby isolating one or more species of phagemid containing a display protein containing a binding site that binds a preselected antigen. [0224] The isolation of a particular vector capable of expressing an antibody binding site of interest involves the introduction of the dicistronic expression vector able to express the phagemid display protein into a host cell permissive for expression of filamentous phage genes and the assembly of phage particles. Typically, the host is E. coli. Thereafter, a helper phage genome is introduced into the host cell containing the phagemid expression vector to provide the genetic complementation necessary to allow phage particles to be assembled. [02251 The resulting host cell is cultured to allow the introduced phage genes and display protein genes to be expressed, and for phage particles to be assembled and shed from the host cell. The shed phage particles are then harvested (collected) from the host cell culture media and screened for desirable antibody binding properties. Typically, the harvested particles are "panned" for binding with a preselected antigen. The strongly binding particles are then collected, and individual species of particles are clonally isolated and further screened for binding to the antigen. Phages which produce a binding site of desired antigen binding specificity are selected. [0226] After phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab') 2 fragments can also be employed using methods known in the art such as those disclosed in International Publication No. WO 92/22324; Mullinax et al, BioTechniques 12(6):864-869 (1992); and Sawai et al, AJRI 34:26-34 (1995); and Better et al, Science 240:1041-1043 (1988). Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Patent Nos. 4,946,778 and 5,258,498; Huston et al, Methods in Enzymology 203:46-88 (1991); Shu et al, PNAS 90:7995-7999 (1993); and Skerra et al, Science 240:1038-1040 (1988). WO 2006/102095 PCT/US2006/009745 [0227] The invention also encompasses a host cell containing a vector or nucleotide sequence of this invention. In a specific embodiment, the host cell is E. coli. [0228] In a specific embodiment, a combinatorial library of the invention is cloned into a Ml 3-based phage vector. This vector allows the expression of Fab fragments that 5 contain the first constant domain of the human 71 heavy chain and the constant domain of the human kappa (K) light chain under the control of the lacZ promoter. This can be carried out by hybridization mutagenesis as described in Wu & An, 2003, Methods Mol. Biol., 207, 213 233; Wu, 2003, Methods Mol. Biol, 207, 197-212; and Kunkel et al, 1987, Methods Enzymol. 154, 367-382. Briefly, purified minus strands corresponding to the heavy and light 3 chains to be cloned are annealed to two regions containing each one palindromic loop. Those loops contain a unique Xbal site which allows for the selection of the vectors that contain both VL and V H chains fused in frame with the human kappa (K) constant and first human 71 constant regions, respectively (Wu & An, 2003, Methods Mol. Biol., 207, 213-233, Wu, 2003, Methods Mol. Biol., 207, 197-212). Synthesized DNA is then electroporated into 5 XLI -blue for plaque formation on XLI -blue bacterial lawn or production of Fab fragments as described in Wu, 2003, Methods Mol. Biol, 207, 197-212. [0229] In addition to bacterial/phage expression systems, other host-vector systems maybe utilized in the present invention to express the combinatorial libraries of the present invention. These include, but are not limited to, mammalian cell systems transfected with a ) vector or infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems transfected with a vector or infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors; or bacteria transformed with DNA, plasmid DNA, or cosmid DNA. See e.g., Verma et al, J Immunol Methods. 216(1-2):165-81 (1998). [0230] The expression elements of vectors vary in their strengths and specificities. 5 Depending on the host- vector system utilized, any one of a number of suitable transcription and translation elements may be used. In one aspect, each nucleic acid of a combinatorial library of the invention is part of an expression vector that expresses the humanized heavy and/or light chain or humanized heavy and/or light variable regions in a suitable host. In particular, such nucleic acids have promoters, often heterologous promoters, operably linked 0 to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue-specific. (See Section 5.7 for more detail.) In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in WO 2006/102095 PCT/US2006/009745 the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Roller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature 342:435-438). 102311 The combinatorial libraries can also be expressed using in vitro systems, such as the ribosomal display systems (see Section 5.6 for detail). 5.6 Selection of Re-engineered or Re-shaped Antibodies [02321 The expressed combinatorial libraries can be screened for binding to the antigen recognized by the donor antibody using any methods known in the art. In specific embodiments, a phage display library constructed and expressed as described in section 5.4. ) and 5.7, respectively, is screened for binding to the antigen recognized by the donor antibody, and the phage expressing V H and/or V L domain with significant binding to the antigen can be isolated from a library using the conventional screening techniques (e.g. as described in Harlow, E., and Lane, D., 1988, supra Gherardi, E et al. 1990. J. Immunol. meth. 126 p61 68). The shed phage particles from host cells are harvested (collected) from the host cell culture media and screened for desirable antibody binding properties. Typically, the harvested particles are "panned" for binding with a preselected antigen. The strongly binding particles are then collected, and individual species of particles are clonally isolated and further screened for binding to the antigen. Phages which produce a binding site of desired antigen binding specificity are selected. In certain embodiments, a humanized antibody of the invention has affinity of at least IxIO 6 M-, at least IxIO 7 M 1 , at least IxIO 8 M 1 , or at least 1xi 09 M1 for an antigen of interest. [02331 In other embodiments, the expressed combinatorial libraries are screened for those phage expressing V H and/or VL domain which have altered binding properties for the antigen relative to the donor antibody. In still other embodiments a humanized antibody of 5 the invention will have altered binding properties for the antigen relative to the donor antibody. Examples of binding properties include but are not limited to, binding specificity, equilibrium dissociation constant (KD), dissociation and association rates (Kgyand KO respectively), binding affinity and/or avidity). One skilled in the art will understand that certain alterations are more or less desirable. It is well known in the art that the equilibrium 0 dissociation constant (KD) is defined as kjjk,,. It is generally understood that a binding molecule (e.g., and antibody) with a low KD is preferable to a binding molecule (e.g., and antibody) with a high K D. However, in some instances the value of the ko, or /clmay be WO 2006/102095 PCT/US2006/009745 more relevant than the value of the KD' One skilled in the art can determine which kinetic parameter is most important for a given antibody application. [0234] In one embodiment, the equilibrium dissociation constant (KD) of a phage expressing a modified VH and/or V L domain or a humanized antibody of the invention is 5 decreased by at least 1%, or at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 150%, or at least 200%, or at least 500%, relative to the donor antibody. In another embodiment, the equilibrium dissociation constant (KD) of a phage expressing a modified VH and/or V L domain or a humanized antibody of the invention is ) decreased between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 250 fold, or between 100 fold and 500 fold, or between 250 fold and 1000 fold, relative to the donor antibody. In still other embodiments, the equilibrium dissociation constant (KD) of a phage expressing a modified VH and/or VL domain is decreased by at least 2 fold, or by at least 3 fold, or by at least 5 fold, or by at least 10 fold, or by at least 20 fold, or by at least 50 5 fold, or by at least 100 fold, or by at least 200 fold, or by at least 500 fold, or by at least 1000 fold, relative to the donor antibody. [02351 In another embodiment, the equilibrium dissociation constant (KD) of a phage expressing a modified V H and/or V L domain or a humanized antibody of the invention is increased by at least 1%, or at least 5%, or at least 10%, or at least 20%, or at least 30%, or at ) least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 150%, or at least 200%, or at least 500%, relative to the donor antibody. In still another embodiment, the equilibrium dissociation constant (KD) of a phage expressing a modified VH and/or VL domain is increased between 2 fold and 10 fold, or between 5 fold and 50 fold, or between 25 fold and 250 fold, or between 100 fold and 500 5 fold, or between 250 fold and 1000 fold, relative to the donor antibody. In yet other embodiments, the equilibrium dissociation constant (KD) of a phage expressing a modified VH and/or V L domain or a humanized antibody of the invention is increased by at least 2 fold, or by at least 3 fold, or by at least 5 fold, or by at least 10 fold, or by at least 20 fold, or by at least 50 fold, or by at least 100 fold, or by at least 200 fold, or by at least 500 fold, or by at 0 least 1000 fold, relative to the donor antibody. [02361 In a specific embodiment, a phage library is first screened using a modified plaque lifting assay, termed capture lift. See Watkins et ah, 1997, Anal. Biochem., 253:37 45. Briefly, phage infected bacteria are plated on solid agar lawns and subsequently, are 119 WO 2006/102095 PCT/US2006/009745 overlaid with nitrocellulose filters that have been coated with a Fab-specific reagent (e.g., an anti-Fab antibody). Following the capture of nearly uniform quantities of phage-expressed Fab, the filters are probed with desired antigen-Ig fusion protein at a concentration substantially below the Kd value of the Fab. 5 [02371 In another embodiment, the combinatorial libraries are expressed and screened using in vitro systems, such as the ribosomal display systems (see, e.g., Graddis et ah, Curr Pharm Biotechnol. 3(4):285-97 (2002); Hanes and Plucthau PNAS USA 94:4937-4942 (1997); He, 1999, J. Immunol. Methods, 231:105; Jermutus et al. (1998) Current Opinion in Biotechnology, 9:534-548). The ribosomal display system works by translating a library of ) antibody or fragment thereof in vitro without allowing the release of either antibody (or fragment thereof) or the mRNA from the translating ribosome. This is made possible by deleting the stop codon and utilizing a ribosome stabilizing buffer system. The translated antibody (or fragment thereof) also contains a C-terminal tether polypeptide extension in order to facilitate the newly synthesized antibody or fragment thereof to emerge from the 5 ribosomal tunnel and fold independently. The folded antibody or fragment thereof can be screened or captured with a cognate antigen. This allows the capture of the mRNA, which is subsequently enriched in vitro. The E. coli and rabbit reticulocute systems are commonly used for the ribosomal display. [02381 Other methods know in the art, e.g., PROfusion TM (U.S. Patent No. 6,281,344, ) Phylos Inc., Lexington, MA), Covalent Display (International Publication No. WO 98371 86, Actinova Ltd., Cambridge, U.K.), can also be used in accordance with the present invention. [02391 In another embodiment, an antigen can be bound to a solid support(s), which can be provided by a petri dish, chromatography beads, magnetic beads and the like. As used herein, the term "solid support" is not limited to a specific type of solid support. Rather a 5 large number of supports are available and are known to one skilled in the art. Solid supports include silica gels, resins, derivatized plastic films, glass beads, cotton, plastic beads, polystyrene beads, alumina gels, and polysaccharides. A suitable solid support may be selected on the basis of desired end use and suitability for various synthetic protocols. For example, for peptide synthesis, a solid support can be a resin such as p 0 methylbenzhydrylamine (pMBHA) resin (Peptides International, Louisville, KY), polystyrenes (e.g., PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), including chloromethylpolystyrene, hydroxymethylpolystyrene and aminomethylpolystyrene, poly (dimethylacrylamide)-grafted styrene co-divinyl-benzene (e.g., POLYHIPE resin, WO 2006/102095 PCT/US2006/009745 obtained from Aminotech, Canada), polyamide resin (obtained from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (e.g., TENTAGEL or ARGOGEL, Bayer, Tubingen, Germany) polydimethylacrylamide resin (obtained from Milligen/Biosearch, California), or Sepharose (Pharmacia, Sweden). 5 [0240] The combinatorial library is then passed over the antigen, and those individual antibodies that bind are retained after washing, and optionally detected with a detection system. If samples of bound population are removed under increasingly stringent conditions, the binding affinity represented in each sample will increase. Conditions of increased stringency can be obtained, for example, by increasing the time of soaking or changing the 0 pH of the soak solution, etc. [0241] In another embodiment, enzyme linked immunosorbent assay (ELISA) is used to screen for an antibody with desired binding activity. ELISAs comprise preparing antigen, coating the wells of a microtiter plate with the antigen, washing away antigen that did not bind the wells, adding the antibody of interest conjugated to a detectable compound such as 5 an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the wells and incubating for a period of time, washing away unbound antibodies or non-specifically bound antibodies, and detecting the presence of the antibodies specifically bound to the antigen coating the well. In ELISAs, the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the antibody of interest) 0 conjugated to a detectable compound may be added to the well. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, the detectable molecule could be the antigen conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase). One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as .5 well as other variations of ELISAs known in the art. For further discussion regarding ELISAs see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. I, John Wiley & Sons, Inc., New York at 11.2. 1. [0242] In another embodiment, BlAcore kinetic analysis is used to determine the binding on and off rates (Kd) of antibodies of the invention to a specific antigen. BlAcore 0 kinetic analysis comprises analyzing the binding and dissociation of an antigen from chips with immobilized antibodies of the invention on their surface. See Wu et al., 1999, J. Mol. Biol., 294:151-162. Briefly, antigen-Ig fusion protein is immobilized to a (i -ethyl-3-[3 dimemylaminopropyl]-carbodiimide hydrochloride) and N-hydroxy-succinimide-activated WO 2006/102095 PCT/US2006/009745 sensor chip CM5 by injecting antigen-Ig in sodium acetate. Antigen-Ig is immobilized at a low density to prevent rebinding of Fabs during the dissociation phase. To obtain association rate constant (Kon), the binding rate at six different Fab concentrations is determined at certain flow rate. Dissociation rate constant (Koff) are the average of six measurements obtained by analyzing the dissociation phase. Sensorgrams are analyzed with the BlAevaluation 3.0 program. Kd is calculated from Kd = Koff/Kon. Residual Fab is removed after each measurement by prolonged dissociation. In one embodiment, positive plaques are picked, re-plated at a lower density, and screened again. [0243] In another embodiment, the binding affinity of an antibody (including a scFv or other molecule comprising, or alternatively consisting of, antibody fragments or variants thereof) to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3 H or 1211) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of the present invention and the binding off-rates can be determined from the data by Scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, an antigen is incubated with an antibody of the present invention conjugated to a labeled compound (e.g., 3 H or 1211) in the presence of increasing amounts of an unlabeled second antibody. [0244] Other assays, such as immunoassays, including but not limited to, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin 5 reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, fluorescent immunoassays, and protein A immunoassays, can also be used to screen or further characterization of the binding specificity of a humanized antibody. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York). Exemplary immunoassays ) are described briefly below (which are not intended by way of limitation). [0245] In one embodiment, ELISA is used as a secondary screening on supernatant prepared from bacterial culture expressing Fab fragments in order to confirm the clones identified by the capture lift assay. Two ELISAs can be carried out: (1) Quantification 122 WO 2006/102095 PCT/US2006/009745 ELISA: this can be carried out essentially as described in Wu, 2003, Methods Mol. Biol., 207, 197-212. Briefly, concentrations can be determined by an anti-human Fab ELISA: individual wells of a 96-well Maxisorp Immunoplate are coated with 50 ng of a goat anti human Fab antibody and then incubated with samples (supernatant-expressed Fabs) or 5 standard (human IgG Fab). Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity can be detected with TMB substrate and the reaction quenched with 0.2 M H2SO4. Plates are read at 450 nm. Clones that express detactable amount of Fab are then selected for the next part of the secondary screening. (2) Functional ELISA: briefly, a particular antigen binding activity is determined by the antigen 0 based ELISA: individual wells of a 96-well Maxisorp Immunoplate are coated with 50 ng of the antigen of interest, blocked with l%BSA/0. 1 %Tween 20 and then incubated with samples (supernatant-expressed Fabs). Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity is detected with TMB substrate and the reaction quenched with 0.2 M H2SO4. Plates are read at 450 nm. 5 [02461 Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (I % NP-40 or Triton X- 100, 1 % sodium deoxycholate, 0. 1 % SDS, 0. 15 M NaCl, 0.0 1 M sodium phosphate at pH 7. 2, 1 % Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, 159 aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a 3 period of time (e.g., to 4 hours) at 40 degrees C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 40 degrees C, washing the beads in lysis buffer and re-suspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One of skill in the art would be knowledgeable as to the parameters 5 that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols see, e.g., Ausubel et al., eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, at 10. 16. 1. [0247] Western blot analysis generally comprises preparing protein samples, 0 electrophoresis of the protein samples in a polyacrylamide get (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide get to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the WO 2006/102095 PCT/US2006/009745 membrane in washing buffer (e.g., PBSTween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., 5 horseradish peroxidase or alkaline phosphatase) or radioactive molecule. (e.g., 12P or 1211) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al., eds, 1994, GinTent 0 Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8. 1. [0248] A nucleic acid encoding a modified (e.g., humanized) antibody or fragment thereof with desired antigen binding activity can be characterized by sequencing, such as dideoxynucleotide sequencing using a ABB 00 genomic analyzer. Other immunoassays, such as the two-part secondary ELISA screen described above, can be used to compare the 5 modified (e.g., humanized) antibodies to each other and to the donor antibody in terms of binding to a particular antigen of interest. [0249] The thermal melting temperature (Tm) of the variable region (e.g., Fab domain) of antibodies is known to play a role in denaturation and aggregation. Generally a higher Tm correlates with better stability and less aggregation. As demonstrated by the 0 inventors, the methods disclosed herein can generate a modified antibody with an altered Fab domain T relative to the donor antibody. Accordingly, the present invention provides modified antibodies having an altered Fab domain Tn, relative to the donor antibody. Furthermore, in certain embodiments, the expressed combinatorial libraries are screened for those phage expressing a V H and/or V L domain, wherein said V H and/or V L domain has an .5 altered Tm, relative to the donor antibody. Optionally, or alternatively, the modified (e.g., humanized) antibody or fragment thereof produced by the methods of the invention may be screened for those which have altered variable region Tm relative to the donor antibody. [0250] In one embodiment, a modified (e.g., humanized) antibody or fragment thereof has a variable region Tm that is increased between about I C to about 3 00C, or between about 0 I C and about 2 cPC, or between about I OC and about 1 o 0 C, or between about I C to about 5 0 C. In another embodiment, a modified (e.g., humanized) antibody or fragment thereof has a variable region Tm that is increased at least about 0GC, or at least about 2 0 C, or at least about 3 0 C, or at least about 4 0 C, or at least about 5 0 C, or at least about 6 0 C, or at least about 124 WO 2006/102095 PCT/US2006/009745 7 *C, or at least about 8 0 C, or at least about 9 0 C, or at least about 1 0 0C, or at least about I 1 0 C, .or at least about 12 0 C, or at least about 13 0 C, or at least about 14 0 C, or at least about 15 0 C, or at least about 16 0 C, or at least about 17 0 C, or at least about 18 0 C, or at least about 19 0 C, or at least about 2 cPC, or at least about 25 0 C, or at least about 3 0 0 C, or more. 5 [02511 In one embodiment, a modified (e.g., humanized) antibody or fragment thereof has a variable region Tm that is reduced between about I 0 C to about 3 0 0C, or between about I C and about 2 OC, or between about I C and about oOC, or between about I 0 C to about 5 0 C. In another embodiment, a modified (e.g., humanized) antibody or fragment thereof has a variable region Tn, that is decreased by at least about I C, or at least about 2 0 C, or at least ) about 3 0 C, or at least about 4 0 C, or at least about 5 0 C, or at least about 6 0 C, or at least about 7 0 C, or at least about 8 0 C, or at least about 9 0 C, or at least about 1 0 0C, or at least about 1 1 0 C, or at least about 12 0 C, or at least about 13 0 C, or at least about 14 0 C, or at least about 15 0 C, or at least about 16 0 C, or at least about 17 0 C, or at least about 18 0 C, or at least about 19 0 C, or at least about 2 cPC, or at least about 25 0 C, or at least about 3 0C, or more. [02521 In certain embodiments, the Tm is determined by differential scanning calorimetry (DSC). In a specific embodiment, the Tm of a protein domain (e.g., and antibody variable domain, such as a Fab domain) is measured using a sample containing isolated protein domain molecules. In another embodiment, the Tm of a protein domain is measured using a sample containing an intact protein. In the latter case, the Tm of the domain is deduced from the data of the protein by analyzing only those data points corresponding to the domain of interest. Methods of using DSC to study the denaturation of proteins are well known in the art (see, e.g., Vermeer et ah, 2000, Biophys. J. 78:394-404; Vermeer et ah, 2000, Biophys. J. 79: 2150-2154) and detailed in Example 3, infra. [02531 DSC can detect fine-tuning of interactions between the individual domains of 5 a protein (Privalov et al., 1986, Methods Enzymol. 131 :4-5 1). In one embodiment, DSC measurements are performed using a Setaram Micro-DSC III (Setaram, Caluire, France). The samples are placed in the calorimeter in a 1 ml sample cell against a 1 ml reference cell containing the appropriate blank solution. The cells are stabilized for 4 h at 25'C inside the calorimeter before heating up to the final temperature at a selected heating rate. The transition 0 temperature and enthalpy are determined using the Setaram software (Setaram, Version 1.3). In another embodiment, DSC measurements are performed using a VP-DSC (MicroCal, LLC). In one embodiment, a scan rate of 1 .0C/min and a temperature range of 25 -120'C are employed. A filter period of 8 seconds is used along with a 5 minute pre-scan WO 2006/102095 PCT/US2006/009745 thermostating. Multiple baselines are ran with buffer in both the sample and reference cell to establish thermal equilibrium. After the baseline is subtracted from the sample thermogram, the data are concentration normalized and fitted using the deconvolution function. Melting temperatures are determined following manufacturer procedures using Origin software 5 supplied with the system. [0254] In another embodiment, the Tm curve is obtained using circular dichroism (CD) spectroscopy. Changes in the secondary structure of IgG as a function of temperature and/or, e.g., pH, can be studied by CD spectroscopy (Fasman, 1996, Circular Dichroism and the Conformational Analysis of Biomolecules. Plenum Press, New York). The advantage of 0 this technique are that the spectroscopic signal is not affected by the presence of the surrounding solution and that well-defined procedures are available to elucidate the secondary structure based on reference spectra of the different structure elements (de Jongh et al, 1994, Biochemistry. 33:14521-14528). The fractions of the secondary structural elements can be obtained from the CD spectra. In one embodiment, the CD spectra are measured with 5 a JASCO spectropolarimeter, model J-715 (JASCO International Co., Tokyo, Japan). A quartz cuvette of 0.1 cm light path length is used. Temperature regulation is carried out using a JASCO PTC-348WI (JASCO International) thermocouple. Temperature scans are recorded at a selected heating rate using the Peltier thermocouple with a resolution of 0.2 0 C and a time constant of 16 s. Wavelength scans, in the far-UV region (0.2 nm resolution) are obtained by 3 accumulation of a plurality of scans with a suitable scan rate [0255] The thermal Tm curve can also be measured by light spectrophotometry. When a protein in a solution denatures in response to heating, the molecules aggregate and the solution scatters light more strongly. Aggregation leads to changes in the optical transparency of the sample, and can be measured by monitoring the change in absorbance of 5 visible or ultraviolet light of a defined wavelength. In still another embodiment, fluorescence spectroscopy is used to obtained the T, curve. In one embodiment, intrinsic protein fluorescence, e.g., intrinsic tryptophan fluorescence, is monitored. In another embodiment, fluorescence probe molecules are monitored. Methods of performing fluorescence spectroscopy experiments are well known to those skilled in the art. See, for example, 0 Bashford, C. L. et al, Spectrophotometry and Spectrofluorometry: A Practical Approach, pp. 91-1 14, IRL Press Ltd. (1987); Bell, J. E., Spectroscopy in Biochemistry, Vol. I, pp. 155-194, CRC Press (1981); Brand, L. et al, Ann. Rev. Biochem. 41:843 (1972). 1 1)1 WO 2006/102095 PCT/US2006/009745 [0256] The isoelectric point (pi) of a protein is defined as the pH at which a polypeptide carries no net charge. It is known in the art that protein solubility is typically lowest when the pH of the solution is equal to the isoelectric point (pi) of the protein. It is thus possible to evaluate the solubility of a protein for a given pH, e.g., pH 6, based on its pi. 5 The pi of a protein is also a good indicator of the viscosity of the protein in a liquid formulation. High pi indicates high solubility and low viscosity (especially important for high concentration protein formulations). The pi of a protein also plays a role in biodistribution and non-specific toxicity of proteins. For example, it is known in the art that reducing the pi of recombinant toxins results in lower non-specific toxicity and renal 0 accumulation. Alternatively, increases the pi of antibodies is known to increase their intracellular and/or extravascular localization. One of skill in the art can readily determine what pi dependent characteristics are most desirable for a particular antibody. As demonstrated by the inventors, the methods disclosed herein can generate a modified antibody with an altered pi relative to the donor antibody. Accordingly, the present invention 5 provides modified antibodies having an altered pi relative to the donor antibody. Furthermore, in certain embodiments the expressed combinatorial libraries are screened for those phage expressing a V H and/or VL domain, wherein said VH and/or VL domain has an altered pi relative to the same domain of donor antibody. In still other embodiments, a humanized antibody of the invention will have altered pi relative to the donor antibody. 0 [0257] In one embodiment, a modified (e.g., humanized) antibody or fragment thereof has a pi that is increased by about 0.1 to about 3.0, or by about 0.1 to about 2.0, or by about 0.1 to about 1.0, or by about 0.1 and 0.5 relative to the donor antibody. In another embodiment, a modified (e.g., humanized) antibody or fragment thereof has a pi that is increased by at least about 0.1, at least about 0.2, or by at least 0.3, or by at least 0.4, or by at 5 least 0.5 , or by at least 0.6, or by at least 0.7, or by at least 0.8, or by at least 0.9, or by at least 1, or by at least 1.2, or by at least 1.4, or by at least 1.6, or by at least 1.8, or at least about 2, or by at least 2.2, or by at least 2.4, or by at least 2.6, or by at least 2.8, or at least about 3, or more, relative to the donor antibody. [0258] In one embodiment, a modified (e.g., humanized) antibody or fragment thereof 0 has a pi that is reduced by about 0.1 to about 3.0, or by about 0.1 to about 2.0, or by about 0.1 to about 1.0, or by about 0.1 and 0.5 relative to the donor antibody. In another embodiment, a modified (e.g., humanized) antibody or fragment thereof has a p i that is reduced by at least about 0.1, at least about 0.2, or by at least 0.3, or by at least 0.4, or by at least 0.5 , or by at 127 WO 2006/102095 PCT/US2006/009745 least 0.6, or by at least 0.7, or by at least 0.8, or by at least 0.9, or by at least 1, or by at least 1.2, or by at least 1.4, or by at least 1.6, or by at least 1.8, or at least about 2, or by at least 2.2, orby at least 2.4, orby at least 2.6, orby at least 2.8, or at least about 3, or more, relative to the donor antibody. 5 [0259] The pi of a protein may be determined by a variety of methods including but not limited to, isoelectric focusing and various computer algorithms (see for example Bjellqvist et al., 1993, Electrophoresis 14:1023) and those detailed in Example 3, infra. In one embodiment, p i is determined using a Pharmacia Biotech Multiphor 2 electrophoresis system with a multi temp 3 refrigerated bath recirculation unit and an EPS 3501 X L power 0 supply. Pre-cast ampholine gels (Amersham Biosciences, pi range 2.5-10) are loaded with 5 ig of protein. Broad range p i marker standards (Amersham, p i range 3-10, 8 pL) are used to determine relative pi for the Mabs. Electrophoresis is performed at 1500 V, 50 mA for 105 minutes. The gel is fixed using a Sigma fixing solution (5x) diluted with purified water to Ix. Staining is performed overnight at room temperature using Simply Blue stain (Invitrogen). 5 Destaining is carried out with a solution that consisted of 25% ethanol, 8% acetic acid and 67% purified water. Isoelectric points are determined using a Bio-Rad Densitometer relative to calibration curves of the standards. [0260] A serious limitation relating to the commercial use of antibodies is their production in large amounts. Many antibodies with therapeutic or commercial potential are 0 not produced at high levels and cannot be developed due to inherent production limits. As demonstrated by the inventors, the methods disclosed herein can generate a modified antibody with improved production levels relative to the donor antibody. Accordingly, the present invention provides modified antibodies having improved production levels relative to the donor antibody. Furthermore, in certain embodiments the expressed combinatorial 25 libraries are screened for those phage expressing V H and/or V L domain which have improved production levels relative to the donor antibody. Optionally, or alternatively, the modified [e.g., humanized) antibody or fragment thereof produced by the methods of the invention may be screened for those which have improved production levels relative to the donor antibody. In still other embodiments, a humanized antibody of the invention will have 0 improved production levels relative to the donor antibody. In yet other embodiments, the production levels a humanized antibody of the invention having improved production levels may be further improved by substituting the amino acid residues at positions 40H, 60H, and WO 2006/102095 PCT/US2006/009745 61H, utilizing the numbering system set forth in Kabat, with alanine, alanine and aspartic acid, respectively as disclosed in U.S. Patent Publication No. 2006/0019342. [0261] In a specific embodiment, the production level of a modified antibody or fragment thereof is increased by at least 1%, or at least 5%, or at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 150%, or at least 200%, or at least 500%, relative to the expression of the donor antibody, wherein the same expression system is used for both antibodies. In still another embodiment, the production level of a modified antibody or fragment thereof is increased between 2 fold and 10 fold, or between 5 fold and 50 fold, ) or between 25 fold and 250 fold, or between 100 fold and 500 fold, or between 250 fold and 1000 fold, relative to the expression of the donor antibody, wherein the same expression system is used for both antibodies. In yet other embodiments, the production level of a modified antibody or fragment thereof is increased by at least 2 fold, or by at least 3 fold, or by at least 5 fold, or by at least 10 fold, or by at least 20 fold, or by at least 50 fold, or by at least 100 fold, or by at least 200 fold, or by at least 500 fold, or by at least 1000 fold, relative to the expression of the donor antibody or fragment thereof, wherein the same expression system is used for both antibodies or fragments thereof. 5.7 Production and Characterization of Re-engineered or Re-shaped Antibodies [02621 Once one or more nucleic acids encoding a humanized antibody or fragment thereof with desired binding activity are selected, the nucleic acid can be recovered by standard techniques known in the art. In one embodiment, the selected phage particles are recovered and used to infect fresh bacteria before recovering the desired nucleic acids. [02631 A phage displaying a protein comprising a humanized variable region with a desired specificity or affinity can be elution from an affinity matrix by any method known in 5 the art. In one embodiment, a ligand with better affinity to the matrix is used. In a specific embodiment, the corresponding non-humanized antibody is used. In another embodiment, an elution method which is not specific to the antigen-antibody complex is used. [0264] The method of mild elution uses binding of the phage antibody population to biotinylated antigen and binding to streptavidin magnetic beads. Following washing to 0 remove non-binding phage, the phage antibody is eluted and used to infect cells to give a selected phage antibody population. A disulfide bond between the biotin and the antigen molecule allows mild elution with dithiothreitol. In one embodiment, biotinylated antigen WO 2006/102095 PCT/US2006/009745 can be used in excess but at or below a concentration equivalent to the desired dissociation constant for the antigen-antibody binding. This method is advantageous for the selection of high affinity antibodies (R. E. Hawkins, S. J. Russell and G. Winter J. Mol. Biol. 226 889 896, 1992). Antibodies may also be selected for slower off rates for antigen selection as described in Hawkins et al, 1992, supra. The concentration of biotinylated antigen may gradually be reduced to select higher affinity phage antibodies. As an alternative, the phage antibody may be in excess over biotinylated antigen in order that phage antibodies compete for binding, in an analogous way to the competition of peptide phage to biotinylated antibody described by J. K. Scott & G. P. Smith (Science 249 386-390, 1990). [0265] In another embodiment, a nucleotide sequence encoding amino acids constituting a recognition site for cleavage by a highly specific protease can be introduced between the foreign nucleic acid inserted, e.g., between a nucleic acid encoding an antibody fragment, and the sequence of the remainder of gene III. Non-limiting examples of such highly specific proteases are Factor X and thrombin. After binding of the phage to an affinity matrix and elution to remove non-specific binding phage and weak binding phage, the strongly bound phage would be removed by washing the column with protease under conditions suitable for digestion at the cleavage site. This would cleave the antibody fragment from the phage particle eluting the phage. These phage would be expected to be infective, since the only protease site should be the one specifically introduced. Strongly binding phage could then be recovered by infecting, e.g., E. coli TGl cells. [0266] An alternative procedure to the above is to take the affinity matrix which has retained the strongly bound pAb and extract the DNA, for example by boiling in SDS solution. Extracted DNA can then be used to directly transform E. coli host -cells or alternatively the antibody encoding sequences can be amplified, for example using PCR with suitable primers, and then inserted into a vector for expression as a soluble antibody for further study or a pAb for further rounds of selection. [0267] In another embodiment, a population of phage is bound to an affinity matrix which contains a low amount of antigen. There is competition between phage, displaying high affinity and low affinity proteins, for binding to the antigen on the matrix. Phage displaying high affinity protein is preferentially bound and low affinity protein is washed away. The high affinity protein is then recovered by elution with the ligand or by other procedures which elute the phage from the affinity matrix (International Publication No. W092/01047 demonstrates this procedure). 130 WO 2006/102095 PCT/US2006/009745 [0268] The recovered nucleic acid encoding donor CDRs and humanized framework can be used by itself or can be used to construct nucleic acid for a complete antibody molecule by joining them to the constant region of the respective human template. When the nucleic acids encoding antibodies are introduced into a suitable host cell line, the transfected cells can secrete antibodies with all the desirable characteristics of monoclonal antibodies. [02691 Once a nucleic acid encoding an antibody molecule or a heavy or light chain of an antibody, or fragment thereof (e.g., containing the heavy or light chain variable region) of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a nucleic acid encoding an antibody are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a fragment thereof, or a heavy or light chain CDR, operably linked to a promoter. In a specific embodiment, the expression of an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a fragment thereof, or a heavy or light chain CDR is regulated by a constitutive promoter. In another embodiment, the expression of an antibody molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a fragment thereof, or a heavy or light chain CDR is regulated by an inducible promoter. In another embodiment, the expression of an antibody 5 molecule of the invention, a heavy or light chain of an antibody, a heavy or light chain variable domain of an antibody or a fragment thereof, or a heavy or light chain CDR is regulated by a tissue specific promoter. Such vectors may also include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., International Publication No. WO 86/05807; International Publication No. WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy, the entire light chain, or both the entire heavy and light chains. [02701 The expression vector or vectors is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce 131 WO 2006/102095 PCT/US2006/009745 an antibody of the invention. It will be understood by one of skill in the art that separate vectors comprising a nucleotide sequences encoding the light or heavy chain of an antibody may be introduced into a host cell simultaneously or sequentially. Alternatively, a single vector comprising nucleotide sequences encoding both the light and heavy chains of an antibody may be introduced into a host cell. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention or fragments thereof, or a heavy or light chain thereof, or portion thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In certain embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below. [0271] In one embodiment, the cell line which is transformed to produce the altered antibody is an immortalized mammalian cell line of lymphoid origin, including but not limited to, a myeloma, hybridoma, txioma or quadroma cell line. The cell line may also comprise a normal lymphoid cell, such as a B cell, which has been immortalized by transformation with a virus, such as the Epstein Barr virus. In a specific embodiment, the immortalized cell line is a myeloma cell line or a derivative thereof. [0272] It is known that some immortalized lymphoid cell lines, such as myeloma cell lines, in their normal state, secrete isolated immunoglobulin light or heavy chains. If such a cell line is transformed with the recovered nucleic acid from phage library, it will not be necessary to reconstruct the recovered fragment to a constant region, provided that the normally secreted chain is complementarity to the variable domain of the immunoglobulin chain encoded by the recovered nucleic acid from the phage library. [0273] Although the cell line used to produce the antibodies of the invention is, in certain embodiments, a mammalian cell line, any other suitable cell line may alternatively be used. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) 132 WO 2006/102095 PCT/US2006/009745 containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, NSO, and 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). In 5 some embodiments, bacterial cells such as Escherichia coli are used are used for the expression of a recombinant antibody molecule. In other embodiments, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major 0 intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et ah, 1986, Gene 45:101; and Cockett et ah, 1990, Bio/Technology 8:2). [02741 In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For 5 example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited to, the E. coli expression vector pUR278 (Ruther et ah, 1983, EMBO 12:1791), in which the antibody coding sequence maybe ligated individually into the D vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione 5-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to 5 matrix glutathione agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target can be released from the GST moiety. [0275] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera 0 frugiperda cells. The antibody coding sequence may be cloned individually into non, essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). WO 2006/102095 PCT/US2006/009745 [0276] In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then 5 be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (e.g., see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 8 1:355-359). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These ) signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, 5 transcription terminators, etc. (see, e.g., Bittner et ah, 1987, Methods in Enzymol. 153:516 544). [0277] In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the nucleic acid in a specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein ) products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the 5 primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT20 and T47D, NSO (a murine myeloma cell line that does not endogenously produce any immunoglobulin chains), CRL7030 and HsS78Bst cells. 0 [0278] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody molecule may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression 134 WO 2006/102095 PCT/US2006/009745 control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid 5 confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluation of compositions that interact directly or indirectly with the antibody molecule. ) [0279] A number of selection systems may be used, including but not limited to, the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthineguanine phosphoribosyltransferase (Szybalska & Szybalski, 1992, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy.et al., 1980, Cell 22:8-17) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Wu and Wu, 1991, Biotherapy 3:87 95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May, 1993, TIB TECH 11(5):155-2 15); and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30:147). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such 5 methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre Garapin et al., 1981, J. Mol. Biol. 150:1. ) [0280] The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing I - WO 2006/102095 PCT/US2006/009745 antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257). 5 [0281] The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and D light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, 1986, Nature 322:52; and Kohler, 1980, Proc. Natl. Acad. Sci. USA 77:2 197). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA. [0282] The antibodies of the invention can also be introduced into a transgenic animal 5 (e.g., transgenic mouse). See, e.g., Bruggemann, Arch. Immunol. Ther. Exp. (Warsz). 49(3):203-8 (2001); Bruggemann and Neuberger, Immunol. Today 8:391-7 (1996). Transgene constructs or transloci can be obtained by, e.g., plasmid assembly, cloning in yeast artificial chromosomes, and the use of chromosome fragments. Translocus integration and maintenance in transgenic animal strains can be achieved by pronuclear DNA injection into ) oocytes and various transfection methods using embryonic stem cells. [0283] For example, nucleic acids encoding humanized heavy and/or light chain or humanized heavy and/or light variable regions may be introduced randomly or by homologous recombination into mouse embryonic stem cells. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously 5 with the introduction of nucleic acids encoding humanized antibodies by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then be bred to produce homozygous offspring which express humanized antibodies. 0 [0284] Once an antibody molecule of the invention has been produced by recombinant expression, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, 1 ':-1 WO 2006/102095 PCT/US2006/009745 particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Further, the antibodies of the present invention or fragments thereof may be fused to heterologous polypeptide sequences described herein or otherwise 5 known in the art to facilitate purification. 5.8 Antibody Conjugates [0285] The present invention encompasses antibodies or fragments thereof that are conjugated or fused to one or more moieties, including but not limited to, peptides, polypeptides, proteins, fusion proteins, nucleic acid molecules, small molecules, mimetic 0 agents, synthetic drugs, inorganic molecules, and organic molecules. [02861 The present invention encompasses antibodies or fragments thereof that are recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) to a heterologous protein or polypeptide (or fragment thereof, preferably to a polypepetide of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 5 70, at least 80, at least 90 or at least 100 amino acids) to generate fusion proteins. The fusion does not necessarily need to be direct, but may occur through linker sequences. For example, antibodies may be used to target heterologous polypeptides to particular cell types, either in vitro or in vivo, by fusing or conjugating the antibodies to antibodies specific for particular cell surface receptors. Antibodies fused or conjugated to heterologous polypeptides may also ) be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., International publication No. WO 93/21232; European Patent No. EP 439,095; Naramura et al, 1994, Immunol. Lett. 39:91-99; U.S. Patent No. 5,474,981; Gillies et al, 1992, PNAS 89:1428-1432; and Fell et al.,199, J. Immunol. 146:2446-2452. 10287] The present invention further includes compositions comprising heterologous 5 proteins, peptides or polypeptides fused or conjugated to antibody fragments. For example, the heterologous polypeptides may be fused or conjugated to a Fab fragment, Fd fragment, Fv fragment, F(ab) 2 fragment, a VH domain, a VL domain, a VH CDR, a VL CDR, or fragment thereof. Methods for fusing or conjugating polypeptides to antibody portions are well-known in the art. See, e.g., U.S. Patent Nos. 5,336,603, 5,622,929, 5,359,046, 5,349,053, 5,447,851, 0 and 5,112,946; European Patent No.s EP 307,434 and EP 367, 166; International publication Nos. WO 96/04388 and WO 91/06570; Ashkenazi et al., 1991, Proc. Natl. Acad. Sci. USA 88: 10535-10539; Zheng et al, 1995, J. Immunol. 154:5590-5600; and Vil et al, 1992, Proc. Natl. Acad. Sci. USA 89:1 1337- 11341. WO 2006/102095 PCT/US2006/009745 [02881 Additional fusion proteins may be generated through the techniques of gene shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to alter the activities of antibodies of the invention or fragments thereof (e.g., antibodies or fragments thereof with higher affinities 5 and lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793; 5,81 1,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al, 1997, Curr. Opinion Biotechnol. 8:724-33 ; Harayama, 1998, Trends Biotechnol. 16(2):76-82; Hansson, et al., 1999, J. Mol. Biol. 287:265-76; and Lorenzo and Blasco, 1998, Biotechniques 24(2):308- 313. Antibodies or fragments thereof, or the encoded antibodies or fragments thereof, may be altered by being D subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. One or more portions of a polynucleotide encoding an antibody or antibody fragment may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. [02891 Moreover, the antibodies or fragments thereof can be fused to marker 5 sequences, such as a peptide to facilitate purification. In specific embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al, 1989, Proc. Natl. Acad. Sci. USA 86:821-824, for instance, hexa-histidine provides for convenient purification of the fusion ) protein. Other peptide tags useful for purification include, but are not limited to, the hemagglutinin "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al, 1984, Cell 37:767) and the "flag" tag. [02901 In other embodiments, antibodies of the present invention or fragments, analogs or derivatives thereof can be conjugated to a diagnostic or detectable agent. Such 5 antibodies can be useful for monitoring or prognosing the development or progression of a disorder as part of a clinical testing procedure, such as determining the efficacy of a particular therapy. Such diagnosis and detection can be accomplished by coupling the antibody to detectable substances including, but not limited to various enzymes, such as but not limited to horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; 0 prosthetic groups, such as but not limited to streptavidinlbiotin and avidin/biotin; fluorescent materials, such as but not limited to, umbelliferone, fluorescein, fluorescein isothiocynate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; luminescent materials, such as but not limited to, luminol; bioluminescent materials, such as but not WO 2006/102095 PCT/US2006/009745 limited to, luciferase, luciferin, and aequorin; radioactive materials, such as but not limited to iodine (1311, 1251, 1231, 121I,), carbon (14C), sulfur (3sS), tritium ( 3 H), indium ( 11 5 In, 1131n, 11 2 In, 1 IIn,), and technetium ( 99 Tc), thallium ( 2 01Ti), gallium ( 68 Ga, 67 Ga), palladium (i 0 3 Pd), molybdenum ( 99 Mo), xenon (1 3 3 Xe), fluorine ( 18 F), 15 3 Sm, 177 Lu, 159 Gd, 149 Pm, 140 La, 1 7 5 Yb, 5 166 Ho, 90Y, 4 7 Sc, 186 Re, 188 Re, 142 Pr, i0 5 Pa , 9 6 8 Ge, 5 7 Co, 6 5 Zn, 8 5 Sr, 3 2 P, 153 Gd, 1 6 9 Yb, 5 1 Cr, 54 Mn, 7 5 Se, 113 Sn, and 117 Tin; positron emitting metals using various positron emission tomographies, noradioactive paramagnetic metal ions, and molecules that are radiolabeled or conjugated to specific radioisotopes. [0291] The present invention further encompasses antibodies or fragments thereof 0 that are conjugated to a therapeutic moiety. An antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Therapeutic moieties include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BCNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and D anthramycin (AMC)), Auristatin molecules (e.g., auristatin PHE, bryostatin 1, and solastatin 10; see Woyke et al, Antimicrob. Agents Chemother. 46:3802-8 (2002), Woyke et al, Antimicrob. Agents Chemother. 45:3580-4 (2001), Mohammad et al, Anticancer Drugs 12:735-40 (2001), Wall et al, Biochem. Biophys. Res. Commun. 266:76-80 (1999), Mohammad et al, Int. J. Oncol. 15:367-72 (1999)), hormones (e.g., glucocorticoids, 5 progestins, androgens, and estrogens), DNA-repair enzyme inhibitors (e.g., etoposide or topotecan), kinase inhibitors (e.g., compound STl 571, imatinib mesylate (Kantarjian et al, Clin Cancer Res. 8(7):2167-76 (2002)), cytotoxic agents (e.g., paclitaxel, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, 0 mithramycin, actinomycin D, 1-dehydrotestosterone, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof) and those compounds disclosed in U.S. Pat. Nos. 6,245,759, 6,399,633, 6,383,790, 6,335,156, 6,271,242, 6,242,196, 6,218,410, 6,218,372, 6,057,300, 6,034,053, 5,985,877, 5,958,769, 5,925,376, -1 qr% WO 2006/102095 PCT/US2006/009745 5,922,844, 5,911,995, 5,872,223, 5,863,904, 5,840,745, 5,728,868, 5,648,239, 5,587,459), farnesyl transferase inhibitors (e.g., RI 15777, BMS-214662, and those disclosed by, for example, U.S. Patent Nos: 6,458,935, 6,451,812, 6,440,974, 6,436,960, 6,432,959, 6,420,387, 6,414,145, 6,410,541, 6,410,539, 6,403,581, 6,399,615, 6,387,905, 6,372,747, 6,369,034, 6,362,188, 6,342,765, 6,342,487, 6,300,501, 6,268,363, 6,265,422, 6,248,756, 6,239,140, 6,232,338, 6,228,865, 6,228,856, 6,225,322, 6,218,406, 6,211,193, 6,187,786, 6,169,096, 6,159,984, 6,143,766, 6,133,303, 6,127,366, 6,124,465, 6,124,295, 6,103,723, 6,093,737, 6,090,948, 6,080,870, 6,077,853, 6,071,935, 6,066,738, 6,063,930, 6,054,466, 6,051,582, 6,051,574, and 6,040,305), topoisomerase inhibitors (e.g., camptothecin; irinotecan; SN-38; topotecan; 9-aminocamptothecin; GG-21 1 (GI 14721 1); DX-8951f; IST-622; rubitecan; pyrazoloacridine; XR-5000; saintopin; UCE6; UCE1022; TAN-1518A; TAN-1518B; KT6006; KT6528; ED-i 10; NB-506; ED-i 10; NB-506; and rebeccamycin); bulgarein; DNA minor groove binders such as Hoescht dye 33342 and Hoechst dye 33258; nitidine; fagaronine; epiberberine; coralyne; beta-lapachone; BC-4-1; bisphosphonates (e.g., alendronate, cimadronte, clodronate, tiludronate, etidronate, ibandronate, neridronate, olpandronate, risedronate, piridronate, pamidronate, zolendronate) HMG-CoA reductase inhibitors, (e.g., lovastatin, simvastatin, atorvastatin, pravastatin, fluvastatin, statin, cerivastatin, lescol, lupitor, rosuvastatin and atorvastatin) and pharmaceutically acceptable salts, solvates, clathrates, and prodrugs thereof. See, e.g., Rothenberg, MX., Annals of Oncology 8:837-855(1997); and Moreau, P., et al, J. Med. Chem. 41:1631-1640(1998)), antisense oligonucleotides (e.g., those disclosed in the U.S. Pat. Nos. 6,277,832, 5,998,596, 5,885,834, 5,734,033, and 5,618,709), immunomodulators (e.g., antibodies and cytokines), antibodies, and adenosine deaminase inhibitors (e.g., Fludarabine phosphate and 2-Chlorodeoxyadenosine) . 5 [0292] Further, an antibody or fragment thereof may be conjugated to a therapeutic moiety or drug moiety that modifies a given biological response. Therapeutic moieties or drug moieties are not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, D pseudomonas exotoxin, cholera toxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, -interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF- c, TNF- P, AIM I (see, International publication No. WO 97/33899), AIM II (see, International Publication No. WO 97/3491 1), 140 WO 2006/102095 PCT/US2006/009745 Fas Ligand (Takahashi et al, 1994, J. Immunol., 6:1567-1574), and VEGI (see, International publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, e.g., angiostatin, endostatin or a component of the coagulation pathway (e.g., tissue factor); or, a biological response modifier such as, for example, a lymphokine (e.g., interleukin-1 ("IL-I"), 5 interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), and granulocyte colony stimulating factor ("G-CSF")), a growth factor (e.g., growth hormone ("GH")), or a coagulation agent (e.g., calcium, vitamin K, tissue factors, such as but not limited to, Hageman factor (factor XII), high-molecular-weight kininogen (HMWK), prekallikrein (PK), coagulation proteins-factors 11 (prothrombin), factor 0 V, XIIa, VIII, XIIIa, XI, XIa,, IX, IXa, X, phospholipid. fibrinopeptides A and B from the a and P chains of fibrinogen, fibrin monomer). [0293] Moreover, an antibody can be conjugated to therapeutic moieties such as a radioactive metal ion, such as alph-emiters such as 2 13 Bi or macrocyclic chelators useful for conjugating radiometal ions, including but not limited to, 1 31 In, 131 LU, 131y, 131 Ho, 131 Sm, to 5 polypeptides. In certain embodiments, the macrocyclic chelator is 1,4,7,10 tetraazacyclododecane-N,N',N",N"'-tetraacetic acid (DOTA) which can be attached to the antibody via a linker molecule. Such linker molecules are commonly known in the art and described in Denardo et al, 1998, Clin Cancer Res. 4(10):2483-90; Peterson et al, 1999, Bioconjug. Chem. 10(4):553-7; and Zimmerman et al, 1999, Nucl. Med. Biol. 26(8):943-50,. D [0294] Techniques for conjugating therapeutic moieties to antibodies are well known, see, e.g., Arnon et al, "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al, "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); 5 Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies 84: Biological And Clinical Applications, Pinchera et al (eds.), pp. 475-506 (1985); 'Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al, 0 1982, Immunol. Rev. 62:119-58. [0295] Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980. 1 A1 WO 2006/102095 PCT/US2006/009745 [0296] The therapeutic moiety or drug conjugated to an antibody or fragment thereof should be chosen to achieve the desired prophylactic or therapeutic effect(s) for a particular disorder in a subject. A clinician or other medical personnel should consider the following when deciding on which therapeutic moiety or drug to conjugate to an antibody or fragment 5 thereof: the nature of the disease, the severity of the disease, and the condition of the subject. [0297] Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. 0 5.9 Uses of the Antibodies of the Invention [0298] The present invention provides methods of efficiently humanizing an antibody of interest. The humanized antibodies of the present invention can be used alone or in combination with other prophylactic or therapeutic agents for treating, managing, preventing or ameliorating a disorder or one or more symptoms thereof. 5 [0299] The present invention provides methods for preventing, managing, treating, or ameliorating a disorder comprising administering to a subject in need thereof one or more antibodies of the invention alone or in combination with one or more therapies (e.g., one or more prophylactic or therapeutic agents) other than an antibody of the invention. The present invention also provides compositions comprising one or more antibodies of the invention and D one or more prophylactic or therapeutic agents other than antibodies of the invention and methods of preventing, managing, treating, or ameliorating a disorder or one or more symptoms thereof utilizing said compositions. Therapeutic or prophylactic agents include, but are not limited to, small molecules, synthetic drugs, peptides, polypeptides, proteins, nucleic acids (e.g., DNA and RNA nucleotides including, but not limited to, antisense 5 nucleotide sequences, triple helices, RNAi, and nucleotide sequences encoding biologically active proteins, polypeptides or peptides) antibodies, synthetic or natural inorganic molecules, mimetic agents, and synthetic or natural organic molecules. [0300] Any therapy which is known to be useful, or which has been used or is currently being used for the prevention, management, treatment, or amelioration of a disorder 0 or one or more symptoms thereof can be used in combination with an antibody of the invention in accordance with the invention described herein. See, e.g., Gilman et ah, Goodman and Gilman's: The Pharmacological Basis <f Therapeutics, 10th ed., McGraw 142 WO 2006/102095 PCT/US2006/009745 Hill, New York, 2001 ; The Merck Manual cf Diagnosis and Therapy, Berkow, M.D. et al. (eds.), 17th Ed., Merck Sharp & Dohme Research Laboratories, Rahway, NJ, 1999; Cecil Textbook f Medicine, 20th Ed., Bennett and Plum (eds.), W.B. Saunders, Philadelphia, 1996 for information regarding therapies (e.g., prophylactic or therapeutic agents) which have been or are currently being used for preventing, treating, managing, or ameliorating a disorder or one or more symptoms thereof. Examples of such agents include, but are not limited to, immunomodulatory agents, anti-inflammatory agents (e.g., adrenocorticoids, corticosteroids (e.g., beclomethasone, budesonide, flunisolide, fluticasone, triamcinolone, methlyprednisolone, prednisolone, prednisone, hydrocortisone), glucocorticoids, steroids, non-steriodal anti-inflammatory drugs (e.g., aspirin, ibuprofen, diclofenac, and COX-2 inhibitors), pain relievers, leukotreine antagonists (e.g., montelukast, methyl xanthines, zafirlukast, and zileuton), beta2-agonists (e.g., albuterol, biterol, fenoterol, isoetharie, metaproterenol, pirbuterol, salbutamol, terbutalin formoterol, salmeterol, and salbutamol terbutaline), anticholinergic agents (e.g., ipratropium bromide and oxitropium bromide), sulphasalazine, penicillamine, dapsone, antihistamines, anti-malarial agents (e.g., hydroxychloroquine), anti-viral agents, and antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, erythomycin, penicillin, mithramycin, and anthramycin (AMC)). [0301] The humanized antibodies of the invention can be used directly against a particular antigen. In some embodiments, antibodies of the invention belong to a subclass or isotype that is capable of mediating the lysis of cells to which the antibody binds. In a specific embodiment, the antibodies of the invention belong to a subclass or isotype that, upon complexing with cell surface proteins, activates serum complement and/or mediates antibody dependent cellular cytotoxicity (ADCC) by activating effector cells such as natural killer cells or macrophages. 5 [0302] The biological activities of antibodies are known to be determined, to a large extent, by the constant domains or Fc region of the antibody molecule (Uananue and Benacerraf, Textbook of Immunology, 2nd Edition, Williams & Wilkins, p. 218 (1984)). This includes their ability to activate complement and to mediate antibody-dependent cellular cytotoxicity (ADCC) as effected by leukocytes. Antibodies of different classes and ) subclasses differ in this respect, as do antibodies from the same subclass but different species; according to the present invention, antibodies of those classes having the desired biological activity are prepared. Preparation of these antibodies involves the selection of antibody constant domains and their incorporation in the humanized antibody by known technique. WO 2006/102095 PCT/US2006/009745 For example, mouse immunoglobulins of the IgG3 and lgG2a class are capable of activating serum complement upon binding to the target cells which express the cognate antigen, and therefore humanized antibodies which incorporate IgG3 and lgG2a effector functions are desirable for certain therapeutic applications. [03031 In general, mouse antibodies of the IgG 2 a and IgG 3 subclass and occasionally IgG 1 can mediate ADCC, and antibodies of the IgG 3 , IgG 2 a, and IgM subclasses bind and activate serum complement. Complement activation generally requires the binding of at least two IgG molecules in close proximity on the target cell. However, the binding of only one IgM molecule activates serum complement. [0304] The ability of any particular antibody to mediate lysis of the target cell by complement activation and/or ADCC can be assayed. The cells of interest are grown and labeled in vitro; the antibody is added to the cell culture in combination with either serum complement or immune cells which may be activated by the antigen antibody complexes. Cytolysis of the target cells is detected by the release of label from the lysed cells. In fact, antibodies can be screened using the patient's own serum as a source of complement and/or immune cells. The antibody that is capable of activating complement or mediating ADCC in the in vitro test can then be used therapeutically in that particular patient. [03051 Use of IgM antibodies may be preferred for certain applications, however IgG molecules by being smaller may be more able than IgM molecules to localize to certain types of infected cells. [03061 In some embodiments, the antibodies of this invention are useful in passively immunizing patients. 10307] The antibodies of the invention can also be used in diagnostic assays either in vivo or in vitro for detection/identification of the expression of an antigen in a subject or a biological sample (e.g., cells or tissues). Non-limiting examples of using an antibody, a fragment thereof, or a composition comprising an antibody or a fragment thereof in a diagnostic assay are given in U.S. Patent Nos. 6,392,020; 6,156,498; 6,136,526; 6,048,528; 6,015,555; 5,833,988; 5,81 1,310; 8 5,652,1 14; 5,604,126; 5,484,704; 5,346,687; 5,318,892; 5,273,743; 5,182,107; 5,122,447; 5,080,883; 5,057,313; 4,910,133; 4,816,402; 4,742,000; 4,724,213; 4,724,212; 4,624,846; 4,623,627; 4,618,486; 4,176,174. Suitable diagnostic assays for the antigen and its antibodies depend on the particular antibody used. Non limiting examples are an ELISA, sandwich assay, and steric inhibition assays. For in vivo WO 2006/102095 PCT/US2006/009745 diagnostic assays using the antibodies of the invention, the antibodies may be conjugated to a label that can be detected by imaging techniques, such as X-ray, computed tomography (CT), ultrasound, or magnetic resonance imaging (MRI). The antibodies of the invention can also be used for the affinity purification of the antigen from recombinant cell culture or natural sources. 5.10 Administration and Formulations [03081 The invention provides for compositions comprising antibodies of the invention for use in diagnosing, detecting, or monitoring a disorder, in preventing, treating, managing, or ameliorating of a disorder or one or more symptoms thereof, and/or in research. ) In a specific embodiment, a composition comprises one or more antibodies of the invention. In another embodiment, a composition comprises one or more antibodies of the invention and one or more prophylactic or therapeutic agents other than antibodies of the invention. Preferably, the prophylactic or therapeutic agents known to be useful for or having been or currently being used in the prevention, treatment, management, or amelioration of a disorder or one or more symptoms thereof. In accordance with these embodiments, the composition may further comprise of a carrier, diluent or excipient. [0309] The compositions of the invention include, but are not limited to, bulk drug compositions useful in the manufacture of pharmaceutical compositions (e.g., impure or non sterile compositions) and pharmaceutical compositions (i.e., compositions that are suitable for administration to a subject or patient) which can be used in the preparation of unit dosage forms. Such compositions comprise a prophylactically or therapeutically effective amount of a prophylactic and/or therapeutic agent disclosed herein or a combination of those agents and a pharmaceutically acceptable carrier. In specific embodiments, compositions of the invention are pharmaceutical compositions and comprise an effective amount of one or more 5 antibodies of the invention, a pharmaceutically acceptable carrier, and, optionally, an effective amount of another prophylactic or therapeutic agent. [0310] The pharmaceutical composition can be formulated as an oral or non-oral dosage form, for immediate or extended release. The composition can comprise inactive ingredients ordinarily used in pharmaceutical preparation such as diluents, fillers, 0 disintegrants, sweeteners, lubricants and flavors. In certain embodiments, the pharmaceutical composition is formulated for intravenous administration, either by bolus injection or sustained drip, or for release from an implanted capsule. A typical formulation for intravenous administration utilizes physiological saline as a diluent. WO 2006/102095 PCT/US2006/009745 [0311] Fab or Fab' portions of the antibodies of the invention can also be utilized as the therapeutic active ingredient. Preparation of these antibody fragments is well-known in the art. [0312] The composition of the present invention can also include printed matter that describes clinical indications for which the antibodies can be administered as a therapeutic agent, dosage amounts and schedules, and/or contraindications for administration of the antibodies of the invention to a patient. [0313] The compositions of the invention include, but are not limited to, bulk drug compositions useful in the manufacture of pharmaceutical compositions (e.g., impure or non sterile compositions) and pharmaceutical compositions (i.e., compositions that are suitable for administration to a subject or patient) which can be used in the preparation of unit dosage forms. Such compositions comprise a prophylactically or therapeutically effective amount of a prophylactic and/or therapeutic agent disclosed herein or a combination of those agents and a pharmaceutically acceptable carrier. In certain embodiments, compositions of the invention are pharmaceutical compositions and comprise an effective amount of one or more antibodies of the invention, a pharmaceutically acceptable carrier, and, optionally, an effective amount of another prophylactic or therapeutic agent. [0314] In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant (e.g., Freund's adjuvant (complete and incomplete)), excipient, or vehicle with which the therapeutic is contained in or administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as 5 peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, WO 2006/102095 PCT/US2006/009745 suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. [0315] In one embodiment the compositions of the invention are pyrogen-free formulations which are substantially free of endotoxins and/or related pyrogenic substances. 5 Endotoxins include toxins that are confined inside a microorganism and are released only when the microorganisms are broken down or die. Pyrogenic substances also include fever inducing, thermostable substances (glycoproteins) from the outer membrane of bacteria and other microorganisms. Both of these substances can cause fever, hypotension and shock if administered to humans. Due to the potential harmful effects, even low amounts of 0 endotoxins must be removed from intravenously administered pharmaceutical drug solutions. The Food & Drug Administration ("FDA") has set an upper limit of 5 endotoxin units (EU) per dose per kilogram body weight in a single one hour period for intravenous drug applications (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1):223 (2000)). When therapeutic proteins are administered in amounts of several hundred or 5 thousand milligrams per kilogram body weight, as can be the case with antibodies or F c fusion proteins, even trace amounts of harmful and dangerous endotoxin must be removed. In certain specific embodiments, the endotoxin and pyrogen levels in the composition are less then 10 EU/mg, or less then 5 EU/mg, or less then 1 EU/mg, or less then 0.1 EU/mg, or less then 0.01 EU/mg, or less then 0.001 EU/mg. [0316] When used for in vivo administration, the compostions of the invention should be sterile. The formulations of the invention may be sterilized by various sterilization methods, including sterile filtration, radiation, etc. In one embodiment, the Fc variant protein formulation is filter-sterilized with a presterilized 0.22-micron filter. Sterile compositions for injection can be formulated according to conventional pharmaceutical practice as described in 25 "Remington: The Science & Practice of Pharmacy", 2 1 st ed., Lippincott Williams & Wilkins, (2005). Formulations comprising antibodies of the invention, such as those disclosed herein, ordinarily will be stored in lyophilized form or in solution. It is contemplated that sterile compositions comprising antibodies of the invention are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having an adapter that 30 allows retrieval of the formulation, such as a stopper pierceable by a hypodermic injection needle. [0317] Generally, the ingredients of compositions of the invention are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or WO 2006/102095 PCT/US2006/009745 water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. [03181 The compositions of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. [03191 Various delivery systems are known and can be used to administer one or more antibodies of the invention or the combination of one or more antibodies of the invention and a prophylactic agent or therapeutic agent useful for preventing, managing, treating, or ameliorating a disorder or one or more symptoms thereof, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antibody or antibody fragment, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of administering a prophylactic or therapeutic agent of the invention include, but are not limited to, parenteral administration (e.g., intradermal, intramuscular, intraperitoneal, intravenous and subcutaneous), epidurala administration, intratumoral administration, and mucosal adminsitration (e.g., intranasal and oral routes). In addition, pulmonary administration can be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. See, e.g., U.S. Patent Nos. 6,019,968, 5,985, 320, 5,985,309, 5,934,272, 5,874,064, 5,855,913, 5,290,540, and 4,880,078; and PCT Publication Nos. WO 92/19244, WO 97/32572, WO 97/44013, WO 98/31346, and WO 99/66903. In one embodiment, an antibody of the invention, combination therapy, or a composition of the invention is administered using Alkermes AIRTM pulmonary drug delivery technology (Alkermes, Inc., Cambridge, MA). In a specific embodiment, prophylactic or therapeutic ) agents of the invention are administered intramuscularly, intravenously, intratumorally, orally, intranasally, pulmonary, or subcutaneously. The prophylactic or therapeutic agents may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and 148 WO 2006/102095 PCT/US2006/009745 intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local [03201 In a specific embodiment, it may be desirable to administer the prophylactic or therapeutic agents of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous or non-porous material, including membranes and matrices, such as sialastic membranes, polymers, fibrous matrices (e.g., Tissuel@R), or collagen matrices. In one embodiment, an effective amount of one or more antibodies of the invention antagonists is administered locally to the affected area to a subject to prevent, treat, manage, and/or ameliorate a disorder or a symptom thereof. In another embodiment, an effective amount of one or more antibodies of the invention is administered locally to the affected area in combination with an effective amount of one or more therapies (e.g., one or more prophylactic or therapeutic agents) other than an antibody of the invention of a subject to prevent, treat, manage, and/or ameliorate a disorder or one or more symptoms thereof. [03211 In another embodiment, the prophylactic or therapeutic agent can be delivered in a controlled release or sustained release system. In one embodiment, a pump may be used to achieve controlled or sustained release (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:20; Buchwald et al, 1980, Surgery 88:507; Saudek et al, 1989, N. Engl. J. Med. 321 :574). In another embodiment, polymeric materials can be used to achieve controlled or sustained release of the therapies of the invention (see e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, 1983, J., Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al, 1985, Science 228:190; During et al, 1989, Ann. Neurol. 25:351; Howard et al, 1989, J. Neurosurg. 7 1:105); U.S. Patent No. 5,679,377; U.S. Patent No. 5,916,597; U.S. Patent No. 5,912,015; U.S. Patent No. 5,989,463; U.S. Patent No. 5,128,326; PCT Publication No. WO 99/15154; and PCT Publication No. WO 99/20253. Examples of polymers used in sustained release formulations include, but are not limited to, poly(2 -hydroxy ethyl methacrylate), poly(methyl methacrylate), poly(acrylic acid), poly(ethylene-co-vinyl acetate), poly(methacrylic acid), polyglycolides (PLG), polyanhydrides, poly(N-vinyl pyrrolidone), poly(vinyl alcohol), polyacryl amide, poly(ethylene glycol), polylactides (PLA), poly(lactide-co-glycolides) (PLGA), and WO 2006/102095 PCT/US2006/009745 polyorthoesters. In a specific embodiment, the polymer used in a sustained release formulation is inert, free of leachable impurities, stable on storage, sterile, and biodegradable. In yet another embodiment, a controlled or sustained release system can be placed in proximity of the prophylactic or therapeutic target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2,pp. 115-138 (1984)). [03221 Controlled release systems are discussed in the review by Langer (1990, Science 249: 1527-1 533). Any technique known to one of skill in the art can be used to produce sustained release formulations comprising one or more therapeutic agents of the invention. See, e.g., U.S. Patent No. 4,526,938, PCT publication WO 91/05548, PCT publication WO 96/20698, .Ning et al, 1996, "Intratumoral Radioimmunotheraphy of a Human Colon Cancer Xenograft Using a Sustained-Release Gel," Radiotherapy & Oncology 39:179-189, Song et al., 1995, "Antibody Mediated Lung Targeting of Long-Circulating Emulsions," PDA Journal of Pharmaceutical Science & Technology 50:372-397, Cleek et al, 1997, "Biodegradable Polymeric Carriers for a bFGF Antibody for Cardiovascular Application," Pro. Int'l. Symp. Control. ReI. Bioact. Mater. 24:853-854, and Lam et al, 1997, "Microencapsulation of Recombinant Humanized Monoclonal Antibody for Local Delivery," Proc. Int'l. Symp. Control ReI. Bioact. Mater. 24:759-760. [0323] In a specific embodiment, where the composition of the invention is a nucleic acid encoding a prophylactic or therapeutic agent, the nucleic acid can be administered in vivo to promote expression of its encoded prophylactic or therapeutic agent, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, 5 Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (see, e.g., Joliot et al, 1991, Proc. Natl. Acad. Sci. USA 88:1864-1868). Alternatively, a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression by homologous recombination. 103241 A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include, but are not limited to, parenteral, e.g., intravenous, intradermal, subcutaneous, oral, intranasal (e.g., inhalation), transdermal (e.g., topical), transmucosal, and rectal administration. In a WO 2006/102095 PCT/US2006/009745 specific embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous,- subcutaneous, intramuscular, oral, intranasal, or topical administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, 5 the composition may also include a solubilizing agent and a local anesthetic such as lignocamne to ease pain at the site of the injection. [0325] If the compositions of the invention are to be administered topically, the compositions can be formulated in the form of an ointment, cream, transdermal patch, lotion, gel, shampoo, spray, aerosol, solution, emulsion, or other form well-known to one of skill in 0 the art. See, e.g., Remington's Pharmaceutical Sciences and Introduction to Pharmaceutical Dosage Forms, 19th ed., Mack Pub. Co., Easton, PA (1995). For non-sprayable topical dosage forms, viscous to semi-solid or solid forms comprising a carrier or one or more excipients compatible with topical application and having a dynamic viscosity preferably greater than water are typically employed. Suitable formulations include, without limitation, 5 solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, and the like, which are, if desired, sterilized or mixed with auxiliary agents (e.g., preservatives, stabilizers, wetting agents, buffers, or salts) for influencing various properties, such as, for example, osmotic pressure. Other suitable topical dosage forms include sprayable aerosol preparations wherein the active ingredient, preferably in combination with a solid or liquid 0 inert carrier, is packaged in a mixture with a pressurized volatile (e.g., a gaseous propellant, such as freon) or in a squeeze bottle. Moisturizers or humectants can also be added to pharmaceutical compositions and dosage forms if desired. Examples of such additional ingredients are well-known in the art. [0326] If the method of the invention comprises intranasal administration of a 25 composition, the composition can be formulated in an aerosol form, spray, mist or in the form of drops. In particular, prophylactic or therapeutic agents for use according to the present invention can be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide 30 or other suitable gas). In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges (composed of, e.g., gelatin) for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch. 151 WO 2006/102095 PCT/US2006/009745 103271 If the method of the invention comprises oral administration, compositions can be formulated orally in the form of tablets, capsules, cachets, gelcaps, solutions, suspensions, and the like. Tablets or capsules can be prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyrrolidone, or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose, or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets maybe coated by methods well known in the art. Liquid preparations for oral administration may take the form of, but not limited to, solutions, syrups or suspensions, or they may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives, or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils); and preservatives (e.g., methyl or propyl p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring, and sweetening agents as appropriate. Preparations for oral administration may be suitably formulated for slow release, controlled release, or sustained release of a prophylactic or therapeutic agent(s). [03281 The method of the invention may comprise pulmonary administration, e.g., by use of an inhaler or nebulizer, of a composition formulated with an aerosolizing agent. See, e.g., U.S. Patent Nos. 6,019,968, 5,985, 320, 5,985,309, 5,934,272, 5,874,064, 5,855,913, 5,290,540, and 4,880,078; and PCT Publication Nos. WO 92/19244, WO 97/32572, WO 97/44013, WO 98/31346, and WO 99/66903. In a specific embodiment, an antibody of the invention, combination therapy, and/or composition of the invention is administered using Alkermes AIRTM pulmonary drug delivery technology (Alkermes, Inc., Cambridge, MA). [0329] The method of the invention may comprise administration of a composition formulated for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Formulations for injection may be presented in unit dosage form (e.g., in ampoules or in multi-dose containers) with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, WO 2006/102095 PCT/US2006/009745 the active ingredient may be in powder form for constitution with a suitable vehicle (e.g., sterile pyrogen- free water) before use. [03301 The methods of the invention may additionally comprise of administration of compositions formulated as depot preparations. Such long acting formulations may be 5 administered by implantation (e.g., subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compositions may be formulated with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives (e.g., as a sparingly soluble salt). [0331] The methods of the invention encompasses administration of compositions 0 formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc. 5 [0332] Generally, the ingredients of compositions are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the mode of administration is infusion, composition can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. D Where the mode of administration is by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration. [0333] In particular, the invention also provides that one or more of the prophylactic or therapeutic agents, or pharmaceutical compositions of the invention is packaged in a hermetically sealed container such as an ampoule or sachette indicating the quantity of the 5 agent. In one embodiment, one or more of the prophylactic or therapeutic agents, or pharmaceutical compositions of the invention is supplied as a dry sterilized lyophilized powder or water free concentrate in a hermetically sealed container and can be reconstituted (e.g., with water or saline) to the appropriate concentration for administration to a subject. In certain embodiments, one or more of the prophylactic or therapeutic agents or pharmaceutical 0 compositions of the invention is supplied as a dry sterile lyophilized powder in a hermetically sealed container at a unit dosage of at least 5 mg, at least 10 mg, at least 15 mg, at least 25 mg, at least 35 mg, at least 45 mg, at least 50 mg, at least 75 mg, or at least 100 mg. The I C11 WO 2006/102095 PCT/US2006/009745 lyophilized prophylactic or therapeutic agents or pharmaceutical compositions of the invention should be stored at between 2 0 C and 8 0 C in its original container and the prophylactic or therapeutic agents, or pharmaceutical compositions of the invention should be administered within 1 week, within 5 days, within 72 hours, within 48 hours, within 24 hours, 5 within 12 hours, within 6 hours, within 5 hours, within 3 hours, or within 1 hour after being reconstituted. In an alternative embodiment, one or more of the prophylactic or therapeutic agents or pharmaceutical compositions of the invention is supplied in liquid form in a hermetically sealed container indicating the quantity and concentration of the -agent. In certain embodiments, the liquid form of the administered composition is supplied in a ) hermetically sealed container at least 0.25 mg/ml, at least 0.5 mg/ml, at least 1 mg/ml, at least 2.5 mg/ml, at least 5 mg/ml, at least 8 mg/ml, at least 10 mg/ml, at least 15 mg/kg, at least 25 mg/ml, at least 50 mg/ml, at least 75 mg/ml or at least 100 mg/ml. The liquid form should be stored at between 2 0 C and 8 0 C in its original container. [0334] Generally, the ingredients of the compositions of the invention are derived 5 from a subject that is the same species origin or species reactivity as recipient of such compositions. Thus, in a specific embodiment, human or humanized antibodies are administered to a human patient for therapy or prophylaxis. 5.10.1 Gene Therapy [03351 In a specific embodiment, nucleic acid sequences comprising nucleotide sequences encoding an antibody of the invention or another prophylactic or therapeutic agent of the invention are administered to treat, prevent, manage, or ameliorate a disorder or one or more symptoms thereof by way of gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. hi this embodiment of the invention, the nucleic acids produce their encoded antibody or 5 prophylactic or therapeutic agent of the invention that mediates a prophylactic or therapeutic effect. [0336] Any of the methods for gene therapy available in the art can be used according to the present invention. For general reviews of the methods of gene therapy, see Goldspiel et al, 1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; 0 Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, Science 260:926 932 (1993); and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH 11(5):155-215. Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in WO 2006/102095 PCT/US2006/009745 Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990). [03371 In one embodiment, the method of the invention comprises administration of a composition comprising nucleic acids encoding antibodies or another prophylactic or 5 therapeutic agent of the invention, said nucleic acids being part of an expression vector that expresses the antibody, another prophylactic or therapeutic agent of the invention, or fragments or chimeric proteins or heavy or light chains thereof in a suitable host. In particular, such nucleic acids have promoters, generally heterologous promoters, operably linked to the antibody coding region, said promoter being inducible or constitutive, and, ) optionally, tissue- specific. In another embodiment, nucleic acid molecules are used in which the coding sequences of an antibody or another prophylactic or therapeutic agent of the invention and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al, 1989, Nature 342:435-438). In specific embodiments, the expressed antibody or other prophylactic or therapeutic agent is a single chain antibody; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments thereof, of the antibody or another prophylactic or therapeutic agent of the invention. [0338] Delivery of the nucleic acids into a subject may be either direct, in which case the subject is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the subject. These two approaches are known, respectively, as in vivo or er vivo gene therapy. 5 [03391 In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retrovirals or other viral vectors 3 (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the WO 2006/102095 PCT/US2006/009745 nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432) (which can be used to target cell types specifically expressing the receptors). In another embodiment, nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt 5 endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., International Publication Nos. WO 92/06180; WO 92/22635; W092/20316; W093/14188; and WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by 0 homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932 8935; and Zijlstra et al, 1989, Nature 342:435-438). [0340] In a specific embodiment, viral vectors that contains nucleic acid sequences encoding an antibody, another prophylactic or therapeutic agent of the invention, or fragments thereof are used. For example, a retroviral vector can be used (see Miller et al, 5 1993, Meth. Enzymol. 217:581-599). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding the antibody or another prophylactic or therapeutic agent of the invention to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a subject. More detail about retroviral 0 vectors can be found in Boesen et al, 1994, Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdr 1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al, 1994, J. Clin. Invest. 93:644-651; Klein et al, 1994, Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 5 4:129-141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:1 10-114. [0341] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, 0 endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, 1993, Current Opinion in Genetics and Development 3:499-503 present a review of adenovirus-based gene therapy. Bout et al, 1994, Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer WO 2006/102095 PCT/US2006/009745 genes to the respiratory epithelia of rhesus monkeys. Other instances of the use -of adenoviruses in gene therapy can be found in Rosenfeld et al, 1991, Science 252:431-434; Rosenfeld et al, 1992, Cell 68:143-155; Mastrangeli et al, 1993, J. Clin. Invest. 9 1:225-234; PCT Publication W094/12649; and Wang et al, 1995, Gene Therapy 2:775-783. In a 5 specific embodiment, adenovirus vectors are used. [0342] Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al, 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; and U.S. Patent No. 5,436,146). [0343] Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated D transfection, or viral infection. Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a subject. [0344] In this embodiment, the nucleic acid is introduced into a cell prior to 5 administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the ) introduction of foreign genes into cells (see, e.g., Loeffler and Behr, 1993, Meth. Enzymol. 217:599-618; Cohen et al, 1993, Meth. Enzymol. 217:618-644; Clin. Pharma. Ther. 29:69 92 (1985)) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the 5 nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny. [0345] The resulting recombinant cells can be delivered to a subject by various methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or progenitor cells) may be administered intravenously. The amount of cells envisioned for use depends on 0 the several factors including, but not limited to, the desired effects and the patient state, and can be determined by one skilled in the art. WO 2006/102095 PCT/US2006/009745 103461 Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, mast cells, 5 megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells (e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.). In a specific embodiment, the cell used for gene therapy is autologous to the subject. 103471 In an embodiment in which recombinant cells are used in gene therapy, 0 nucleic acid sequences encoding an antibody or fragment thereof are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g., 5 PCT Publication WO 94/08598; Stemple and Anderson, 1992, Cell 7 1:973-985; Rheinwald, 1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic Proc. 61:771). [0348] In a specific embodiment, the nucleic acid to be introduced for purposes of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the 0 appropriate inducer of transcription. 5.11 Dosage and Frequency of Administration [03491 The amount of a prophylactic or therapeutic agent or a composition of the present invention which will be effective in the treatment, management, prevention, or amelioration of a disorder or one or more symptoms thereof can be determined by standard 5 clinical. The frequency and dosage will vary according to factors specific for each patient depending on the specific therapy or therapies (e.g., the specific therapeutic or prophylactic agent or agents) administered, the severity of the disorder, disease, or condition, the route of administration, as well as age, body, weight, response, the patient's immune status, and the past medical history of the patient. For example, the dosage of a prophylactic or therapeutic 0 agent or a composition of the invention which will be effective in the treatment, prevention, management, or amelioration of a disorder or one or more symptoms thereof can be determined by administering the composition to an animal model such as, e.g., the animal models disclosed herein or known to those skilled in the art. In addition, in vitro assays may WO 2006/102095 PCT/US2006/009745 optionally be employed to help identify optimal dosage ranges. Suitable regimens can be selected by one skilled in the art by considering such factors and by following, for example, dosages reported in the literature and recommended in the Physician ' Desk Reference (57th ed., 2003). 5 [03501 The toxicity and/or efficacy of the prophylactic and/or therapeutic protocols of the instant invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be. expressed as the ratio LD, 5 /ED 50 . Therapies that exhibit large therapeutic indices are preferred. While therapies that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. [0351] The data obtained from the cell culture assays and animal studies can be used 5 in formulating a range of dosage of the prophylactic and/or therapeutic agents for use in humans. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any therapy used in the method of the invention, the therapeutically effective dose can be ) estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 5 0 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid 5 chromatography. [0352] For peptides, polypeptides, proteins, fusion proteins, and antibodies, the dosage administered to a patient is typically 0.01 mg/kg to 100 mg/kg of the patient's body weight. In certain embodiments, the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, or between 1 mg/kg to 10 mg/kg of the patient's 0 body weight. Generally, human and humanized antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. WO 2006/102095 PCT/US2006/009745 [03531 Exemplary doses of a small molecule include milligram or microgram amounts of the small molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 5 micrograms per kilogram). [0354] The dosages of prophylactic or therapeutically agents are described in the Physicians' Desk Reference (56th ed., 2002). 5.12 Biological Assays [03551 Antibodies of the present invention or fragments thereof may be characterized 0 in a variety of ways well-known to one of skill in the art. In particular, antibodies of the invention or fragments thereof may be assayed for the ability to immunospecifically bind to an antigen. Such an assay may be performed in solution (e.g., Houghten, 1992, Bio/Techniques 13:412 421), on beads (Lam, 1991, Nature 354:82 84), on chips (Fodor, 1993, Nature 364:555 556), on bacteria (U.S. Patent No. 5,223,409), on spores (U.S. Patent 5 Nos. 5,571,698; 5,403,484; and 5,223,409), on plasmids (Cull et al, 1992, Proc. Natl. Acad. Sci. USA 89:1865 1869) or on phage (Scott and Smith, 1990, Science 249:386 390; Cwirla et al., 1990, Proc. Natl. Acad. Sci. USA 87:6378 6382; and Felici, 1991, J. Mol. Biol. 222:301 310). Antibodies or fragments thereof that have been identified can then be assayed for specificity and affinity. D [0356] The antibodies of the invention or fragments thereof may be assayed for immunospecific binding to a specific antigen and cross-reactivity with other antigens by any method known in the art. Immunoassays which can be used to analyze immunospecific binding and cross-reactivity include, but are not limited to, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme 5 linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few. Such assays are routine and well-known in the art (see, e.g., Ausubel et al., eds., 1994, Current Protocols in Molecular Biology, Vol. 1, John 0 Wiley & Sons, Inc., New York). Exemplary immunoassays are described briefly in Section 5.6. WO 2006/102095 PCT/US2006/009745 [0357] The antibodies of the invention or fragments thereof can also be assayed for their ability to inhibit the binding of an antigen to its host cell receptor using techniques known to those of skill in the art. For example, cells expressing a receptor can be contacted with a ligand for that receptor in the presence or absence of an antibody or fragment thereof 5 that is an antagonist of the ligand and the ability of the antibody or fragment thereof to inhibit the ligand' s binding can measured by, for example, flow cytometry or a scintillation assay. The ligand or the antibody or antibody fragment can be labeled with a detectable compound such as a radioactive label (e.g., 32p, 35S, and 1251) or a fluorescent label (e.g., fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde 0 and fluorescamine) to enable detection of an interaction between the ligand and its receptor. Alternatively, the ability of antibodies or fragments thereof to inhibit a ligand from binding to its receptor can be determined in cell-free assays. For example, a ligand can be contacted with an antibody or fragment thereof that is an antagonist of the ligand and the ability of the antibody or antibody fragment to inhibit the ligand from binding to its receptor can be 5 determined. Preferably, the antibody or the antibody fragment that is an antagonist of the ligand is immobilized on a solid support and the ligand is labeled with a detectable compound. Alternatively, the ligand is immobilized on a solid support and the antibody or fragment thereof is labeled with a detectable compound. A ligand may be partially or completely purified (e.g., partially or completely free of other polypeptides) or part of a cell ) lysate. Alternatively, a ligand can be biotinylated using techniques well known to those of skill in the art (e.g., biotinylation kit, Pierce Chemicals; Rockford, IL). [0358] An antibody or a fragment thereof constructed and/or identified in accordance with the present invention can be tested in vitro and/or in vivo for its ability to modulate the biological activity of cells. Such ability can be assessed by, e.g., detecting the expression of 5 antigens and genes; detecting the proliferation of cells; detecting the activation of signaling molecules (e.g., signal transduction factors and kinases); detecting the effector function of cells; or detecting the differentiation of cells. Techniques known to those of skill in the art can be used for measuring these activities. For example, cellular proliferation can be assayed by 3 H-thymidine incorporation assays and trypan blue cell counts. Antigen expression can be 0 assayed, for example, by immunoassays including, but are not limited to, competitive and non-competitive assay systems using techniques such as western blots, immunohistochemistry radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion 161 WO 2006/102095 PCT/US2006/009745 precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, and FACS analysis. The activation of signaling molecules can be assayed, for example, by kinase assays and electrophoretic shift assays (EMSAs). 5 [0359] The antibodies, fragments thereof, or compositions of the invention are preferably tested in vitro and then in vivo for the desired therapeutic or prophylactic activity prior to use in humans. For example, assays which can be used to determine whether administration of a specific pharmaceutical composition is indicated include cell culture assays in which a patient tissue sample is grown in culture and exposed to, or otherwise 10 contacted with, a pharmaceutical composition, and the effect of such composition upon the tissue sample is observed. The tissue sample can be obtained by biopsy from the patient. This test allows the identification of the therapeutically most effective therapy (e.g., prophylactic or therapeutic agent) for each individual patient. In various specific embodiments, in vitro assays can be carried out with representative cells of cell types .5 involved a particular disorder to determine if a pharmaceutical composition of the invention has a desired effect upon such cell types. For example, in vitro asssay can be carried out with cell lines. [0360] The effect of an antibody, a fragment thereof, or a composition of the invention on peripheral blood lymphocyte counts can be monitored/assessed using standard .0 techniques known to one of skill in the art. Peripheral blood lymphocytes counts in a subject can be determined by, e.g., obtaining a sample of peripheral blood from said subject, separating the lymphocytes from other components of peripheral blood such as plasma using, e.g., Ficoll-Hypaque (Pharmacia) gradient centrifugation, and counting the lymphocytes using trypan blue. Peripheral blood T-cell counts in subject can be determined by, e.g., 25 separating the lymphocytes from other components of peripheral blood such as plasma using, e.g., a use of Ficoll-Hypaque (Pharmacia) gradient centrifugation, labeling the T-cells with an antibody directed to a T-cell antigen which is conjugated to FITC or phycoerythrin, and measuring the number of T-cells by FACS. [0361] The antibodies, fragments, or compositions of the invention used to treat, 30 manage, prevent, or ameliorate a viral infection or one or more symptoms thereof can be tested for their ability to inhibit viral replication or reduce viral load in in vitro assays. For example, viral replication can be assayed by a plaque assay such as described, e.g., by Johnson et al., 1997, Journal of Infectious Diseases 176:1215-1224 176:1215-1224. The WO 2006/102095 PCT/US2006/009745 antibodies or fragments thereof administered according to the methods of the invention can also be assayed for their ability to inhibit or downregulate the expression of viral polypeptides. Techniques known to those of skill in the art, including, but not limited to, western blot analysis, northern blot analysis, and RT-PCR can be used to measure the expression of viral polypeptides. [0362] The antibodies, fragments, or compositions of the invention used to treat, manage, prevent, or ameliorate a bacterial infection or one or more symptoms thereof can b e tested in in vitro assays that are well-known in the art. In vitro assays known in the art can also be used to test the existence or development of resistance of bacteria to a therapy. Such ) in vitro assays are described in Gales et al., 2002, Diag. Nicrobiol. Infect. Dis. 44(3):301-3 11; Hicks et al., 2002, Clin. Microbiol. Infect. 8(11): 753-757; and Nicholson et al., 2002, Diagn. Microbiol. Infect. Dis. 44(1): 101-107. [0363] The antibodies, fragments, or compositions of the invention used to treat, manage, prevent, or ameliorate a fungal infection or one or more symptoms thereof can be tested for anti-fungal activity against different species of fungus. Any of the standard anti fungal assays well-known in the art can be used to assess the anti-fungal activity of a therapy. The anti-fungal effect on different species of fungus can be tested. The tests recommended by the National Committee for Clinical Laboratories (NCCLS) (See National Committee for Clinical Laboratories Standards. 1995, Proposed Standard M27T. Villanova, Pa.) and other ) methods known to those skilled in the art (Pfaller et al., 1993, Infectious Dis. Clin. N. Am. 7: 435-444) can be used to assess the anti-fungal effect of a therapy. The antifungal properties of a therapy may also be determined from a fungal lysis assay, as well as by other methods, including, inter alia, growth inhibition assays, fluorescence-based fungal viability assays, flow cytometry analyses, and other standard assays known to those skilled in the art. 5 [0364] For example, the anti-fungal activity of a therapy can be tested using macrodilution methods and/or microdilution methods using protocols well-known to those skilled in the art (see, e.g., Clancy et al., 1997 Journal of Clinical Microbiology, 35(1 1): 2878-82; Ryder et al., 1998, Antimicrobial Agents and Chemotherapy, 42(5): 1057-61; U.S. 5,521,153; U.S. 5,883,120, U.S. 5,521,169). Briefly, a fungal strain is cultured in an 0 appropriate liquid media, and grown at an appropriate temperature, depending on the particular fungal strain used for a determined amount of time, which is also depends on the particular fungal strain used. An innoculum is then prepared photometrically and the turbidity of the suspension is matched to that of a standard, e.g., a McFarland standard. The 163 WO 2006/102095 PCT/US2006/009745 effect of a therapy on the turbidity of the inoculum is determined visually or spectrophotometrically. The minimal inhibitory concentration ("MIC") of the therapy is determined, which is defined as the lowest concentration of the lead compound which prevents visible growth of an inoculum as measured by determining the culture turbidity. 103651 The anti-fungal activity of a therapy can also be determined utilizing colorimetric based assays well-known to one of skill in the art. One exemplary colorimetric assay that can be used to assess the anti-fungal activity of a therapy is described by Pfaller et al. (1994, Journal of Clinical Microbiology, 32(8): 1993-6; also see Tiballi et al., 1995, Journal of Clinical Microbiology, 33(4): 915-7). This assay employs a colorimetric endpoint using an oxidation-reduction indicator (Alamar Biosciences, Inc., Sacramento CA). [0366] The anti-fungal activity of a therapy can also be determined utilizing photometric assays well-known to one of skill in the art (see, e.g., Clancy et al., 1997 Journal of Clinical Microbiology, 35(11): 2878-82; Jahn et al., 1995, Journal of Clinical Microbiology, 33(3): 661-667). This photometric assay is based on quantifying mitochondrial respiration by viable fungi through the reduction of 3-(4,5-dimethyl 2thiazolyl)-2,5,-diphenyl-2H-tetrazolium bromide (MTT) to formazan. MICs determined by this assay are defined as the highest concentration of the test therapy associated with the first precipitous drop in optical density. In some embodiments, the therapy is assayed for anti fungal activity using macrodilution, microdilution and MTT assays in parallel. [0367] Further, any in vitro assays known to those skilled in the art can be used to evaluate the prophylactic and/or therapeutic utility of an antibody therapy disclosed herein for a particular disorder or one or more symptoms thereof. [03681 The antibodies, compositions, or combination therapies of the invention can be tested in suitable animal model systems prior to use in humans. Such animal model systems 5 include, but are not limited to, rats, mice, chicken, cows, monkeys, pigs, dogs, rabbits, etc. Any animal system well-known in the art may be used. Several aspects of the procedure may vary; said aspects include, but are not limited to, the temporal regime of administering the therapies (e.g., prophylactic and/or therapeutic agents) whether such therapies are administered separately or as an admixture, and the frequency of administration of the therapies. WO 2006/102095 PCT/US2006/009745 [0369] Animal models can be used to assess the efficacy of the antibodies, fragments thereof, or compositions of the invention for treating, managing, preventing, or ameliorating a particular disorder or one or more symptom thereof. [0370] The administration of antibodies, compositions, or combination therapies 5 according to the methods of the invention can be tested for their ability to decrease the time course of a particular disorder by at least 25%, at least 50%, at least 60%, at least 75%, at least 85%, at least 95%, or at least 99%. The antibodies, compositions, or combination therapies of the invention can also be tested for their ability to increase the survival period of humans suffering from a particular disorder by at least 25%, at least 50%, at least 60%, at 0 least 75%, at least 85%, at least 95%, or at least 99%. Further, antibodies, compositions, or combination therapies of the invention can be tested for their ability reduce the hospitalization period of humans suffering from viral respiratory infection by at least 60%, at least 75%, at least 85%, at least 95%, or at least 99%. Techniques known to those of skill in the art can be used to analyze the function of the antibodies, compositions, or combination 5 therapies of the invention in vivo. [0371] Further, any in vivo assays known to those skilled in the art can be used to evaluate the prophylactic and/or therapeutic utility of an antibody, a fragment thereof, a composition, a combination therapy disclosed herein for a particular disorder or one or more symptoms thereof. 0 [0372] The toxicity and/or efficacy of the prophylactic and/or therapeutic protocols of the instant invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be Z5 expressed as the ratio LD50/ED50. Therapies that exhibit large therapeutic indices are preferred. While therapies that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such agents to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects. [0373] The data obtained from the cell culture assays and animal studies can be used 0 in formulating a range of dosage of the prophylactic and/or therapeutic agents for use in humans. The dosage of such agents lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within WO 2006/102095 PCT/US2006/009745 this range depending upon the dosage form employed and the route of administration utilized. For any therapy used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the 5 concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. 5.13 Kits 0 [0374] The invention provides kits comprising sub-banks of antibody framework regions of a species of interest. The invention also provides kits comprising sub-banks of CDRs of a species of interest. The invention also provides kits comprising combinatorial sub-libraries that comprises plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding one framework region (e.g., FRI) in frame 5 fused to one corresponding CDR (e.g., CDR1). The invention further provides kits comprising combinatorial libraries that comprises plurality of nucleic acid sequences comprising nucleotide sequences, each nucleotide sequence encoding the framework regions and CDRs fused in-frame (e.g., FR1+CDR1+FR2+CDR2+FR3+CDR3+FR4). [0375] In some embodiments, the invention provides kits comprising sub-banks of 0 human immunoglobulin framework regions, sub-banks of CDRs, combinatorial sub-libraries, and/or combinatorial libraries. In one embodiment, the invention provides a kit comprising a framework region sub-bank for variable light chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Kabat system. In another embodiment, the invention provides a kit comprising a framework region sub-bank for 25 variable light chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Chothia system. In another embodiment, the invention provides a kit comprising a framework region sub-bank for variable heavy chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Kabat system. In another embodiment, the invention provides a kit comprising a framework region sub-bank 0 for variable heavy chain framework region 1, 2, 3, and/or 4, wherein the framework region is defined according to the Chothia system. In yet another embodiment, the invention provides a kit comprising sub-banks of both the light chain and the heavy chain frameworks. 166 WO 2006/102095 PCT/US2006/009745 [0376] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with a humanized antibody of the invention. The pharmaceutical pack or kit may further comprises one or more other prophylactic or therapeutic agents useful for the treatment of a particular disease. The invention also provides a pharmaceutical pack or 5 kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. D 5.14 Article of Manufacture [0377] The present invention also encompasses a finished packaged and labeled pharmaceutical product. This article of manufacture includes the appropriate unit dosage form in an appropriate vessel or container such as a glass vial or other container that is hermetically sealed. In the case of dosage forms suitable for parenteral administration the 5 active ingredient is sterile and suitable for administration as a particulate free solution. In other words, the invention encompasses both parenteral solutions and lyophilized powders, each being sterile, and the latter being suitable for reconstitution prior to injection. Alternatively, the unit dosage form may be a solid suitable for oral, transdermal, topical or mucosal delivery. ) [0378] In a specific embodiment, the unit dosage form is suitable for intravenous, intramuscular or subcutaneous delivery. Thus, the invention encompasses solutions, preferably sterile, suitable for each delivery route. [03791 As with any pharmaceutical product, the packaging material and container are designed to protect the stability of the product during storage and shipment. Further, the 5 products of the invention include instructions for use or other informational material that advise the physician, technician or patient on how to appropriately prevent or treat the disease or disorder in question. In other words, the article of manufacture includes instruction means indicating or suggesting a dosing regimen including, but not limited to, actual doses, monitoring procedures (such as methods for monitoring mean absolute lymphocyte counts, 0 tumor cell counts, and tumor size) and other monitoring information. [0380] More specifically, the invention provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, I £111 WO 2006/102095 PCT/US2006/009745 intravenous (i.v.) bag, envelope and the like; and at least one unit dosage form of a pharmaceutical agent contained within said packaging material. The invention further provides an article of manufacture comprising packaging material, such as a box, bottle, tube, vial, container, sprayer, insufflator, intravenous (i.v.) bag, envelope and the like; and at least 5 one unit dosage form of each pharmaceutical agent contained within said packaging material. [0381] In a specific embodiment, an article of manufacture comprises packaging material and a pharmaceutical agent and instructions contained within said packaging material, wherein said pharmaceutical agent is a humanized antibody and a pharmaceutically acceptable carrier, and said instructions indicate a dosing regimen for preventing, treating or .0 managing a subject with a particular disease. In another embodiment, an article of manufacture comprises packaging material and a pharmaceutical agent and instructions contained within said packaging material, wherein said pharmaceutical agent is a humanized antibody, a prophylactic or therapeutic agent other than the humanized antibody and a pharmaceutically acceptable carrier, and said instructions indicate a dosing regimen for 5 preventing, treating or managing a subject with a particular disease. In another embodiment, an article of manufacture comprises packaging material and two pharmaceutical agents and instructions contained within said packaging material, wherein said first pharmaceutical agent is a humanized antibody and a pharmaceutically acceptable carrier and said second pharmaceutical agent is a prophylactic or therapeutic agent other than the humanized 0 antibody, and said instructions indicate a dosing regimen for preventing, treating or managing a subject with a particular disease. [0382] The present invention provides that the adverse effects that may be reduced or avoided by the methods of the invention are indicated in informational material enclosed in an article of manufacture for use in preventing, treating or ameliorating one or more 25 symptoms associated with a disease. Adverse effects that may be reduced or avoided by the methods of the invention include but are not limited to vital sign abnormalities (e.g., fever, tachycardia, bardycardia, hypertension, hypotension), hematological events (e.g., anemia, lymphopenia, leukopenia, thrombocytopenia), headache, chills, dizziness, nausea, asthenia, back pain, chest pain (e.g., chest pressure), diarrhea, myalgia, pain, pruritus, psoriasis, 30 rhinitis, sweating, injection site reaction, and vasodilatation. Since some of the therapies may be immunosuppressive, prolonged immunosuppression may increase the risk of infection, including opportunistic infections. Prolonged and sustained immunosuppression may also result in an increased risk of developing certain types of cancer. WO 2006/102095 PCT/US2006/009745 [0383] Further, the information material enclosed in an article of manufacture can indicate that foreign proteins may also result in allergic reactions, including anaphylaxis, or cytosine release syndrome. The information material should indicate that allergic reactions may exhibit only as mild pruritic rashes or they may be severe such as erythroderma, Stevens Johnson syndrome, vasculitis, or anaphylaxis. The information material should also indicate that anaphylactic reactions (anaphylaxis) are serious and occasionally fatal hypersensitivity reactions. Allergic reactions including anaphylaxis may occur when any foreign protein is injected into the body. They may range from mild manifestations such as urticaria or rash to lethal systemic reactions. Anaphylactic reactions occur soon after exposure, usually within 10 minutes. Patients may experience paresthesia, hypotension, laryngeal edema, mental status changes, facial or pharyngeal angioedema, airway obstruction, bronchospasm, urticaria and pruritus, serum sickness, arthritis, allergic nephritis, glomerulonephritis, temporal arthritis, or eosinophilia. 103841 The information material can also indicate that cytokine release syndrome is an acute clinical syndrome, temporally associated with the administration of certain activating anti T cell antibodies. Cytokine release syndrome has been attributed to the release of cytokines by activated lymphocytes or monocytes. The clinical manifestations for cytokine release syndrome have ranged from a more frequently reported mild, self limited, "flu like" illness to a less frequently reported severe, life threatening, shock like reaction, which may include serious cardiovascular, pulmonary and central nervous system manifestations. The syndrome typically begins approximately 30 to 60 minutes after administration (but may occur later) and may persist for several hours. The frequency and severity of this symptom complex is usually greatest with the first dose. With each successive dose, both the incidence and severity of the syndrome tend to diminish. 5 Increasing the amount of a dose or resuming treatment after a hiatus may result in a reappearance of the syndrome. As mentioned above, the invention encompasses methods of treatment and prevention that avoid or reduce one or more of the adverse effects discussed herein. 5.15 Specific Embodiments [03851 1. A nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region, said first nucleotide sequence encoding the humanized heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain WO 2006/102095 PCT/US2006/009745 complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and each heavy chain framework region is from a sub-bank of human heavy chain framework regions. [0386] 2. A nucleic acid sequence comprising a first nucleotide sequence encoding a humanized light chain variable region, said first nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and each light chain framework region is from a sub bank of human light chain framework regions. [0387] 3. The nucleic acid sequence of embodiment 1 further comprising a second nucleotide sequence encoding a donor light chain variable region. [0388] 4. The nucleic acid sequence of embodiment 1 further comprising a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequenced encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and each light chain framework region is from a sub-bank of human light chain framework regions. [0389] 5. The nucleic acid sequence of embodiment 2 further comprising a second nucleotide sequence encoding a donor heavy chain variable region. [0390] 6. The nucleic acid sequence of embodiment 1, wherein one or more of the CDRs derived from the donor antibody heavy chain variable region contains one or more WO 2006/102095 PCT/US2006/009745 mutations relative to the nucleic acid sequence encoding the corresponding CDR in the donor antibody. [0391] 7. The nucleic acid sequence of embodiment 2, wherein one or more of the CDRs derived from the donor antibody light chain variable region contains one or more 5 mutations relative to the nucleic acid sequence encoding the corresponding CDR in the donor antibody. [0392] 8. The nucleic acid sequence of embodiment 4, wherein one or more of the CDRs derived from the donor antibody light chain variable region contains one or more mutations relative to the nucleic acid sequence encoding the corresponding CDR in the donor 0 antibody. [0393] 9. A nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region, said first nucleotide acid sequence encoding the humanized heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain 5 CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind 0 to an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. [0394] 10. A nucleic acid sequence comprising a first nucleotide sequence encoding a humanized light chain variable region, said first nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence 5 encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub 0 bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions. WO 2006/102095 PCT/US2006/009745 [0395] 11. The nucleic acid of embodiment 9 further comprising a second nucleotide sequence encoding a donor light chain variable region. [0396] 12. The nucleic acid sequence of embodiment 9 further comprising a second nucleotide sequence encoding a humanized light chain variable region, said second 5 nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light .0 chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0397] 13. The nucleic acid sequence of embodiment 9 further comprising a second nucleotide sequence encoding a humanized light chain variable region, said second 5 nucleotide sequence encoding the humanized light chain variable region produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light 0 chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0398] 14. The nucleic acid sequence of embodiment 10 further comprising a second 25 nucleotide sequence encoding a donor heavy chain variable region. [0399] 15. The nucleic acid sequence of embodiment 10 further comprising a second nucleotide sequence encoding a humanized heavy chain variable region, said second nucleotide sequence encoding the humanized heavy chain variable region produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid 30 sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a WO 2006/102095 PCT/US2006/009745 nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. 5 [0400] 16. An antibody encoded by the nucleic acid sequence of embodiment 3. [0401] 17. An antibody encoded by the nucleic acid sequence of embodiment 4. [0402] 18. An antibody encoded by the nucleic acid sequence of embodiment 5. [0403] 19. An antibody encoded by the nucleic acid sequence of embodiment 8. [0404] 20. An antibody encoded by the nucleic acid sequence of embodiment 11. 0 [0405] 2 1. An antibody encoded by the nucleic acid sequence of embodiment 12. [0406] 22. An antibody encoded by the nucleic acid sequence of embodiment 13. [0407] 23. An antibody encoded by the nucleic acid sequence of embodiment 14. [0408] 24. An antibody encoded by the nucleic acid sequence of embodiment 15. [0409] 25. An antibody of any of embodiments 16-24, wherein said antibody has one 5 or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0410] 26. The antibody of any of embodiments 16-24, wherein said antibody has 20 improved binding properties relative to the donor antibody and wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0411] 27. The antibody of embodiments 26, wherein an improved binding property is the equilibrium dissociation constant (KD) of the antibody for an antigen. Z5 [0412] 28. The antibody of any of embodiments 16-24, wherein said antibody has improved stability and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0413] 29. The antibody of embodiments 28, wherein said stability is in vivo stability or in vitro stability. 173 WO 2006/102095 PCT/US2006/009745 [04141 30. The antibody of any of embodiments 16-24, wherein said antibody has improved Tm and wherein the improvement is a increase in Tm of between about IOC and 2 d 3 C, relative to the donor antibody. [04151 3 1. The antibody of any of embodiments 16-24, wherein said antibody has improved pi and wherein the improvement is a increase in pi of between about 0.5 and 2.0, relative to the donor antibody. [0416] 32. The antibody of any of embodiments 16-24, wherein said antibody has improved pi and wherein the improvement is a decrease in pi of between about 0.5 and 2.0, relative to the donor antibody. 104171 33. The antibody of any of embodiments 16-24, wherein said antibody has improved production levels and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [04181 34. The antibody of any of embodiments 16-24, wherein said antibody has improved effector function and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0419] 35. The antibody of embodiment 34, wherein said effector function is ADCC. [04201 36. The antibody of embodiment 34, wherein said effector function is CDC. 0 [0421] 37. A cell engineered to contain the nucleic acid sequence of embodiment 1. [0422] 38. A cell engineered to contain the nucleic acid sequence of embodiment 2. 104231 39. The cell of embodiment 16 further engineered to contain the nucleic acid sequence of embodiment 2. [04241 40. A cell engineered to contain the nucleic acid of embodiment 3. 5 104251 41. A cell engineered to contain the nucleic acid of embodiment 4. [0426] 42. A cell engineered to contain the nucleic acid of embodiment 5. [0427] 43. A cell engineered to contain the nucleic acid sequence of embodiment 9. [0428] 44. A cell engineered to contain the nucleic acid sequence of embodiment 10. WO 2006/102095 PCT/US2006/009745 [0429] 45. The cell of embodiment 22 further engineered to contain the nucleic acid sequence of embodiment 10. [0430] 46. A cell engineered to contain the nucleic acid sequence of embodiment 11. [0431] 47. A cell engineered to contain the nucleic acid sequence of embodiment 12. 5 [0432] 48. A cell engineered to contain the nucleic acid sequence of embodiment 13. [0433] 49. A cell engineered to contain the nucleic acid sequence of embodiment 14. [0434] 50. A cell engineered to contain the nucleic acid sequence of embodiment 15. [0435] 51. A cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region, said cell produced ) by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid 5 sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. 0 [0436] 52. A cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a humanized light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid 5 sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light 0 chain framework region is from a sub-bank of human light chain framework regions. WO 2006/102095 PCT/US2006/009745 [0437] 53. A cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region and a second nucleotide sequence encoding a humanized light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide 5 sequence encoding a humanized heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain 0 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a humanized light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid 5 sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs of the heavy chain variable region are derived from a donor antibody heavy chain variable region, the CDRs of the light chain variable region are derived from a donor light chain variable region, at least one heavy chain framework region is from a sub-bank of 0 human heavy chain framework regions, and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0438] 54. A cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a 25 nucleotide sequence encoding a humanized heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1 , a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a 0 heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. WO 2006/102095 PCT/US2006/009745 [0439] 55. A cell comprising a first nucleic acid sequence comprising a first nucleotide sequence encoding a humanized light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region synthesized by fusing 5 together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein .0 at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0440] 56. A cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region and a second nucleotide 5 sequence encoding a humanized light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework 0 region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a humanized light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic 25 acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs 0 derived from donor antibodies that immunospecifically bind to an antigen, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework 177 WO 2006/102095 PCT/US2006/009745 region is from a sub-bank of human heavy chain framework regions, and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0441] 57. A cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region and a second nucleotide 5 sequence encoding a humanize light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework 0 region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a humanized light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic 5 acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain 0 variable region, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions, and at least one light chain framework region is from a sub-bank of human light chain framework regions. 5 [0442] 58. A cell comprising a nucleic acid sequence comprising a first nucleotide sequence encoding a humanized heavy chain variable region and a second nucleotide sequence encoding a humanized light chain variable region, said cell produced by the process comprising introducing into a cell a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region synthesized by fusing together a 0 nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain WO 2006/102095 PCT/US2006/009745 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4; and (ii) a second nucleotide sequence encoding a humanized light chain variable region synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain 5 framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, the light chain D variable region CDRs are derived from a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions, and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0443] 59. The cell of embodiment 5 1 further comprising a second nucleic acid 5 sequence comprising a second nucleotide sequence encoding a humanized light chain variable region. [0444] 60. The cell of embodiment 51 further comprising a second nucleic acid sequence comprising a second nucleotide sequence encoding a light chain variable region. [0445] 6 1. The cell of embodiment 52 further comprising a second nucleic acid ) sequence comprising a second nucleotide sequence encoding a heavy chain variable region. [0446] 62. The cell of embodiment 54 further comprising a second nucleic acid sequence comprising a second nucleotide sequence encoding a humanized light chain variable region. [0447] 63. The cell of embodiment 54 further comprising a second nucleic acid 5 sequence comprising a second nucleotide sequence encoding a light chain variable region. [0448] 64. The cell of embodiment 55 further comprising a second nucleic acid sequence comprising a second nucleotide sequence encoding a heavy chain variable region. [0449] 65. A cell containing nucleic acid sequences encoding a humanized antibody that immunospecifically binds to an antigen, said cell produced by the process comprising: 0 (a) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said first WO 2006/102095 PCT/US2006/009745 nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and at least one heavy chain framework region is from a sub bank of human heavy chain framework regions; and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework region. [0450] 66. A cell containing nucleic acid sequences encoding a humanized antibody that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain WO 2006/102095 PCT/US2006/009745 framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to 5 an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid 0 sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light 5 chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework region. 0 [0451] 67. A cell containing nucleic acid sequences encoding a humanized antibody that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide acid sequence encoding a heavy chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid sequence 25 encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain 30 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to WO 2006/102095 PCT/US2006/009745 an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; and (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said 5 nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light 0 chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain 5 framework region is from a sub-bank of human light chain framework regions. [0452] 68. A cell containing nucleic acid sequences encoding a humanized antibody that immunospecifically binds to an antigen, said cell produced by the process comprising: (a) introducing into a cell a nucleic acid sequence comprising a nucleotide 0 sequence encoding a heavy chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain complementarity determining region (CDR) 1, a nucleic acid sequence encoding a heavy chain framework region 2, a .5 nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and at least 0 one heavy chain framework region is from a sub-bank of human heavy chain framework regions; and WO 2006/102095 PCT/US2006/009745 (b) introducing into a cell a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid 5 sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain 0 framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions. 5 [0453] 69. A method of producing a humanized heavy chain variable region, said method comprising expressing the nucleotide sequence encoding the humanized heavy chain variable region in the cell of embodiment 51 or 54. [0454] 70. A method of producing a humanized light chain variable region, said method comprising expressing the nucleotide sequence encoding the humanized light chain 0 variable region in the cell of embodiment 52 or 55. [0455] 7 1. A method of producing a humanized antibody, said method comprising expressing the nucleic acid sequence comprising the first nucleotide sequence encoding the humanized heavy chain variable region and the second nucleotide sequence encoding the humanized light chain variable region in the cell of embodiment 53, 54, 57, 58, 59, 60, 61, 5 62, 63 or 64. [0456] 72. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising expressing the nucleic acid sequences encoding the humanized antibody contained in the cell of embodiment 65, 66, 67 or 68. [0457] 73. A method of producing a humanized antibody that immunospecifically 0 binds to an antigen, said method comprising: (a) generating sub-banks of heavy chain framework regions; WO 2006/102095 PCT/US2006/009745 (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework ) region 4, wherein the CDRs are derived from a donor antibody heavy chain variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized variable light chain variable region; and (d) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0458] 74. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of heavy chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence 5 encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework 0 region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to 184 WO 2006/102095 PCT/US2006/009745 an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized 5 variable light chain variable region; and (d) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0459] 75. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: .0 (a) generating sub-banks of light chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence 5 encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework 0 region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank ofhuman light chain framework regions; (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized 25 variable heavy chain variable region; and (d) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0460] 76. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: 0 (a) generating sub-banks of light chain framework regions; WO 2006/102095 PCT/US2006/009745 (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence 5 encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework 3 region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub bank of human light chain framework regions; (c) introducing the nucleic acid sequence into a cell containing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized variable heavy chain variable region; and (d) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0461] 77. A method of producing a humanized antibody that immunospecifically ) binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide 5 sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain 0 framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy 186 WO 2006/102095 PCT/US2006/009745 chain variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide 5 sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain D framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework regions; 5 (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0462] 78. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence 5 encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain 0 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to 187 WO 2006/102095 PCT/US2006/009745 an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide 5 sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework regions; 5 (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0463] 79. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence 5 encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain 0 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy 188 WO 2006/102095 PCT/US2006/009745 chain variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRI, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub bank of human light chain framework regions; (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0464] 80. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a humanized heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is from a sub-bank of heavy chain 189 WO 2006/102095 PCT/US2006/009745 CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (d) synthesizing a nucleic acid sequence comprising a nucleotide sequence 5 encoding a humanized light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub bank of human light chain framework regions; (e) introducing the nucleic acid sequences into a cell; and (f) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0465] 81. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide 5 sequence encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1 , a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence ) encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy 190 WO 2006/102095 PCT/US2006/009745 chain framework region 4, and (ii) a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid 5 sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain 0 framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region, the light chain variable region CDRs are derived from a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at 5 least one light chain framework region is from a sub-bank of human light chain framework regions; (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. 9 [0466] 82. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide 5 sequence encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence 0 encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy 191 WO 2006/102095 PCT/US2006/009745 chain framework region 4, and (ii) a second nucleotide. sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, the light chain variable region CDRs are derived from a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions; (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0467] 83. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a 192 WO 2006/102095 PCT/US2006/009745 heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions; (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0468] 84. A method of producing a humanized antibody that immunospecifically binds to an antigen, said method comprising: (a) generating sub-banks of light chain framework regions; (b) generating sub-banks of heavy chain framework regions; (c) synthesizing a nucleic acid sequence comprising: (i) a first nucleotide sequence encoding a humanized heavy chain variable region, said first nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRl, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a 193 WO 2006/102095 PCT/US2006/009745 heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second nucleotide sequence encoding a humanized light chain variable region, said second nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRl, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions; (d) introducing the nucleic acid sequence into a cell; and (e) expressing the nucleotide sequences encoding the humanized heavy chain variable region and the humanized light chain variable region. [0469] 85. The method of embodiment 73, 74, 75 or 76 further comprising (e) screening for a humanized antibody that immunospecifically binds to the antigen. [0470] 86. The method of embodiment 73, 74, 75 or 76 further comprising (e) screening for a humanized antibody with one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. 194 WO 2006/102095 PCT/US2006/009745 [04711 87. The method of embodiment 85, further comprising step (f) screening for a humanized antibody with one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 5 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0472] 88. The method of embodiment 79, 80, 8 1 or 82 further comprising (g) screening for a humanized antibody that immunospecifically binds to the antigen. [04731 89. The method of embodiment 79, 80, 81 or 82 further comprising (g) 0 screening for a humanized antibody with one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. 5 [04741 90. The method of embodiment 88, further comprising step (h) screening for a humanized antibody with one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the D donor antibody. [0475] 91. The method of embodiment 85, 86, 87 or 88 further comprising (f) screening for a humanized antibody that immunospecifically binds to the antigen. 104761 892. The method of any of embodiments 85, 86, 87 or 88 further comprising (f) screening for a humanized antibody with one or more improved characteristics, selected 5 from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [04771 93. The method of embodiment 91, further comprising step (g) screening for a 0 humanized antibody with one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, solubility, production levels or effector function, wherein the improvement is between about 1% and 195 WO 2006/102095 PCT/US2006/009745 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. 104781 94. A humanized antibody produced by the method of embodiment 69. [0479] 95. A humanized antibody produced by the method of embodiment 70. [04801 96. A humanized antibody produced by the method of embodiment 7 1. [0481] 97. A humanized antibody produced by the method of embodiment 72. [0482] 98. A humanized antibody produced by the method of any one of embodiments 73-84. [0483] 99. A humanized antibody produced by the method of embodiment 85. [0484] 100. A humanized antibody produced by the method of embodiment 86. [0485] 101. A humanized antibody produced by the method of embodiment 87. [04861 102. A humanized antibody produced by the method of embodiment 88. [0487] 103. A humanized antibody produced by the method of embodiment 89. [0488] 104. A humanized antibody produced by the method of embodiment 90. [0489] 105. A humanized antibody produced by the method of embodiment 91. 10490] 106. A humanized antibody produced by the method of embodiment 92. 10491] 107. A humanized antibody produced by the method of embodiment 93. [0492] 108. A composition comprising the humanized antibody of embodiment 94, and a carrier, diluent or excipient. [0493] 109. A composition comprising the humanized antibody of embodiment 95, and a carrier, diluent or excipient. [0494] 110. A composition comprising the humanized antibody of embodiment 96, and a carrier, diluent or excipient. 10495] 111. A composition comprising the humanized antibody of embodiment 97, and a carrier, diluent or excipient. [0496] 112. A composition comprising the humanized antibody of embodiment 98, and a carrier, diluent or excipient. WO 2006/102095 PCT/US2006/009745 [0497] 113. A composition comprising the humanized antibody of embodiment 99, and a carrier, diluent or excipient. [0498] 114. A composition comprising the humanized antibody of embodiment 100, and a carrier, diluent or excipient. 5 [0499] 115. A composition comprising the humanized antibody of embodiment 101, and a carrier, diluent or excipient. [0500] 116. A composition comprising the humanized antibody of embodiment 102, and a carrier, diluent or excipient. [0501] 117. A composition comprising the humanized antibody of embodiment 103, .0 and a carrier, diluent or excipient. [0502] 118. A composition comprising the humanized antibody of embodiment 104, and a carrier, diluent or excipient. [0503] 119. A composition comprising the humanized antibody of embodiment 105, and a carrier, diluent or excipient. 5 [0504] 120. A composition comprising the humanized antibody of embodiment 106, and a carrier, diluent or excipient. [0505] 121. A composition comprising the humanized antibody of embodiment 107, and a carrier, diluent or excipient. 20 [0506] 122. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized heavy chain variable regions, said cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding humanized heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework 25 region 1, a nucleic acid sequence encoding a heavy chain CDRl , a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from a donor antibody heavy chain 0 variable region and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. 197 WO 2006/102095 PCT/US2006/009745 [0507] 123. A population of cells comprising nucleic acid sequences comprising nucleotide acid sequences encoding a plurality of humanized heavy chain variable regions, said cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding humanized heavy chain variable regions each 5 synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain 0 framework region 4, wherein at least one CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions. [0508] 124. A population of cells comprising nucleic sequences comprising nucleotide sequences encoding a plurality of humanized light chain variable regions, said 5 cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain ) CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from a donor antibody light chain variable region and at least one light chain framework region is from a sub-bank of human light chain framework regions. 5 [0509] 125. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized light chain variable regions, said cells produced by the process comprising introducing into cells nucleic acid sequences comprising nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework 0 region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain WO 2006/102095 PCT/US2006/009745 framework region 4, wherein at least one CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0510] 126. The cells of embodiment 122, wherein the cells further comprise a 5 nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region. [0511] 127. The cells of embodiment 123, wherein the cells further comprise a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region. 0 [0512] 128. The cells of embodiment 124, wherein the cells further comprise a nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region. [0513] 129. The cells of embodiment 125, wherein the cells further comprise a nucleic acid sequence comprising a nucleotide sequence encoding a humanized light chain 5 variable region. [0514] 130. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized heavy chain variable regions and a plurality of humanized light chain variable regions, said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of 0 nucleotide sequences encoding humanized heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence .5 encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence 0 encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs 199 WO 2006/102095 PCT/US2006/009745 are derived from a donor antibody heavy chain variable region, the light chain variable region CDRs are derived from a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0515] 13 1. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized heavy chain variable regions and a plurality of humanized light chain variable regions, said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding humanized heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, the light chain variable region CDRs are derived from 5 a donor antibody light chain variable region, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0516] 132. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized heavy chain variable regions and a plurality of humanized light chain variable regions, said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding humanized heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a Mnn WO 2006/102095 PCT/US2006/009745 nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain 5 framework region 4, and (ii) a second set of nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework ) region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the heavy chain variable region CDRs are derived from a donor antibody heavy chain variable region, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0517] 133. A population of cells comprising nucleic acid sequences comprising nucleotide sequences encoding a plurality of humanized heavy chain variable regions and a plurality of humanized light chain variable regions, said cells each produced by the process comprising introducing into cells nucleic acid sequences comprising: (i) a first set of nucleotide sequences encoding humanized heavy chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding a heavy chain CDR2, a 5 nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, and (ii) a second set of nucleotide sequences encoding humanized light chain variable regions each synthesized by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a D nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one heavy chain variable region WO 2006/102095 PCT/US2006/009745 CDR is from a sub-bank of heavy chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one light chain variable region CDR is from a sub-bank of light chain CDRs derived from donor antibodies that immunospecifically bind to an antigen, at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions and at least one light chain framework region is from a sub-bank of human light chain framework regions. [0518] 134. A method of identifying a humanized antibody that immunospecifically binds to an antigen, said method comprising expressing the nucleic acid sequences in the cells of embodiment 126, 127, 128 or 129 and screening for a humanized antibody that has an affinity of 1 x 106 M' or above for said antigen. [0519] 135. A method of identifying a humanized antibody that immunospecifically binds to an antigen, said method comprising expressing the nucleic acid sequences in the cells of embodiment 130, 131, 132 or 133 and screening for a humanized antibody that has an affinity of 1 x 106 M-, or above for said antigen. [0520] 136. A method of identifying a humanized antibody that immunospecifically binds to an antigen and has one or more improved characteristics, selected from the group consisting of: binding properties, stability, melting temperature (Tm), pi, (e) solubility, production levels or effector function, relative to a donor antibody said method comprising (i) expressing the nucleic acid sequences in the cells of embodiment 126, 127, 128, 129, 130, 131, 132 or 133, (ii) screening for a humanized antibody that has an affinity of 1 x 10 6 M~, or above for said antigen and (iii) screening for a humanized antibody that has the desired improved characteristics, relative to a donor antibody. [0521] 137. The method of embodiment 136, wherein said improved characteristic is binding properties and wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0522] 138. The method of embodiment 137, wherein the improved binding property is the equilibrium dissociation constant (KD) of the antibody for an antigen. [0523] 139. The method of embodiment 136, wherein said improved characteristic is stability and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0524] 140. The method of embodiment 139, wherein said stability is in vivo stability or in vitro stability. 202 WO 2006/102095 PCT/US2006/009745 [0525] 141. The method of embodiment 136, wherein said improved characteristic is Tn, and wherein the improvement is a increase in Tm of between about I 0 C and 2cPC, relative to the donor antibody. [0526] 142. The method of embodiment 136, wherein said improved characteristic is 5 pi and wherein the improvement is a increase in pi of between about 0.5 and 2.0, relative to the donor antibody. [0527] 143. The method of embodiment 136, wherein said improved characteristic is pi and wherein the improvement is a decrease in pi of between about 0.5 and 2.0, relative to the donor antibody. D [0528] 144. The method of embodiment 136, wherein said improved characteristic is production levels and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0529] 145. The method of embodiment 136, wherein said improved characteristic is effector function and wherein the improvement is between about 2% and 500%, relative to 5 the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0530] 146. The method of embodiment 145, wherein said effector function is ADCC. [0531] 147. The method of embodiment 145, wherein said effector function is CDC. [0532] 148. A humanized antibody identified by the method of embodiment 134. [0533] 149. A humanized antibody identified by the method of embodiment 135. 0 [0534] 150. A humanized antibody identified by the method of embodiment 136. [0535] 151. A humanized antibody identified by the method of embodiment 137. [0536] 152. A humanized antibody identified by the method of embodiment 138. [0537] 153. A humanized antibody identified by the method of embodiment 139. [0538] 154. A humanized antibody identified by the method of embodiment 140. 5 [0539] 155. A humanized antibody identified by the method of embodiment 141. [0540] 156. A humanized antibody identified by the method of embodiment 142. [0541] 157. A humanized antibody identified by the method of embodiment 143. [0542] 158. A humanized antibody identified by the method of embodiment 144. WO 2006/102095 PCT/US2006/009745 [0543] 159. A humanized antibody identified by the method of embodiment 146. [0544] 160. A humanized antibody identified by the method of embodiment 147. [0545] 161. A composition comprising the humanized antibody of embodiment 148, and a carrier, diluent or excipient. 5 [0546] 162. A composition comprising the humanized antibody of embodiment 149, and a carrier, diluent or excipient. [0547] 163. A composition comprising the humanized antibody of embodiment 150, and a carrier, diluent or excipient. [0548] 164. A composition comprising the humanized antibody of any one of 0 embodiments 151 to 160, and a carrier, diluent or excipient. [0549] 165. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a first nucleic acid sequence comprising a nucleotide sequence encoding a modified heavy chain variable region, said 5 nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain 5 framework region is from a sub-bank of human heavy chain framework regions; (b) introducing the first nucleic acid sequence into a cell and introducing into the cell a second nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region selected from the 0 group consisting of a donor variable light chain variable region and a humanized light chain variable region; 204 WO 2006/102095 PCT/US2006/009745 (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and (e) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability, melting temperature (TmI); pi; solubility; production levels and effector function; wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0550] 166. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a first nucleic acid sequence comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions; (b) introducing the first nucleic acid sequence into a cell and introducing into the cell a second nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region selected from the group consisting of a donor heavy chain variable region and a humanized heavy chain variable region; WO 2006/102095 PCT/US2006/009745 (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and 5 (e) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability, melting temperature (Tm); pi; solubility; production levels and effector function; wherein the improvement is between about 1% and 500%, relative to the donor 0 antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0551] 167. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a nucleic acid sequence comprising a nucleotide sequence 5 encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding 0 heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from said donor antibody heavy chain variable region that immunospecifically binds Z5 said antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence 0 encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain 206 WO 2006/102095 PCT/US2006/009745 framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from said donor antibody light chain variable region that immunospecifically binds said 5 antigen and at least one light chain framework region is from a sub bank of human light chain framework regions; (c) introducing the nucleic acid sequences generated in steps (a) and (b) into a cell; (d) expressing the nucleotide sequences encoding the modified heavy 3 chain variable region and the modified light chain variable region; (e) screening for a modified antibody that immunospecifically binds to the antigen; and (f) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium 5 dissociation constant (K,)); stability, melting temperature (Tb); pi; solubility; production levels and effector function; wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0552] 168. The method of embodiment 165, 166 or 167, wherein an improved binding property is the equilibrium dissociation constant (KD) of the antibody for an antigen. [0553] 169. The method of embodiment 165, 166 or 167, wherein said improved characteristic is stability and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor 5 antibody. [0554] 170. The method of embodiment 169, wherein said stability is in vivo stability or in vitro stability. [0555] 171. The method of embodiment 165, 166 or 167, wherein said improved characteristic is Tm and wherein the improvement is a increase in TI of between about I 0 C 0 and 2 0PC, relative to the donor antibody. WO 2006/102095 PCT/US2006/009745 [0556] 172. The method of embodiment 165, 166 or 167, wherein said improved characteristic is pi and wherein the improvement is a increase in pi of between about 0.5 and 2.0, relative to the donor antibody. [0557] 173. The method of embodiment 165, 166 or 167, wherein said improved characteristic is pi and wherein the improvement is a decrease in pi of between about 0.5 and 2.0, relative to the donor antibody. [0558] 174. The method of embodiment 165, 166 or 167, wherein said improved characteristic is production levels and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [05591 175. The method of embodiment 165, 166 or 167, wherein said improved characteristic is effector function and wherein the improvement is between about 2% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. 10560] 176. The method of embodiment 175 wherein said effector function is ADCC. [0561] 177. The method of embodiment 175, wherein said effector function is CDC. [05621 178. A method of improving the binding affinity of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a first nucleic acid sequence comprising a nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; 208 WO 2006/102095 PCT/US2006/009745 (b) introducing the first nucleic acid sequence into a cell and introducing into the cell a second nucleic acid sequence comprising a nucleotide sequence encoding a light chain variable region selected from the group consisting of a donor variable light chain variable region and a 5 humanized light chain variable region; (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and 0 (e) screening for a modified antibody having improved binding affinity, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0563] 179. A method of improving the binding affinity of a donor antibody that 5 immunospecifically binds to an antigen, said method comprising: (a) synthesizing a first nucleic acid sequence comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1 , a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain 5 framework region 4, wherein at least one CDR is derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions; (b) introducing the first nucleic acid sequence into a cell and introducing 0 into the cell a second nucleic acid sequence comprising a nucleotide sequence encoding a heavy chain variable region selected from the 209 WO 2006/102095 PCT/US2006/009745 group consisting of said donor heavy chain variable region and a humanized heavy chain variable region; (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; 5 (d) screening for a modified antibody that immunospecifically binds to the antigen; and (e) screening for a modified antibody having improved binding affinity, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to 0 the donor antibody. [0564] 180. A method of improving the binding affinity of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a modified heavy chain variable region, said nucleotide 5 sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain ) framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region is from a 5 sub-bank of human heavy chain framework regions; (b) synthesizing a nucleic acid sequence comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence 0 encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain ninf WO 2006/102095 PCT/US2006/009745 CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub 5 bank of human light chain framework regions; (c) introducing the nucleic acid sequences generated in steps (a) and (b) into a cell; (d) expressing the nucleotide sequences encoding the modified heavy chain variable region and the modified light chain variable region; 0 (e) screening for a modified antibody that immunospecifically binds to the antigen; and (f) screening for a modified antibody having improved binding affinity, wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to 5 the donor antibody. [0565] 181. The method of embodiment 178, 179 or 180, wherein said binding property is the equilibrium dissociation constant (KD) of the antibody for an antigen. [0566] 182. An antibody produced by the methods of any one of embodiments 165 to 181. 0 [0567] 183. A modified antibody that immunospecifically binds an antigen having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability, melting temperature (Tm); pi, solubility; production levels and effector function, encoded by a nucleic acid sequence comprising: a first nucleotide sequence encoding a modified heavy chain variable region, said nucleotide .5 sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a 0 heavy chain framework region 4, wherein at least one CDR is derived from a donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region is from a sub-bank of human heavy chain framework regions; and a second nucleotide sequence encoding a light chain variable region, wherein the improvement 21 1 WO 2006/102095 PCT/US2006/009745 is between about 1% and 500%, relative to a donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0568] 184. The modified antibody of embodiment 183, wherein the second nucleotide encodes a light chain variable region selected from the group consisting of a donor 5 light chain variable region, a humanized light chain variable region and a modified light chain variable region. [0569] 185. A modified antibody that immunospecifically binds an antigen having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability, melting temperature (Tm); pi, solubility; production [0 levels and effector function, encoded by a nucleic acid sequence comprising: a first nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding light .5 chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from a donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub-bank of human light chain framework regions; and a second ,0 nucleotide sequence encoding a heavy chain variable region, and wherein the improvement is between about 1% and 500%, relative to a donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [0570] 186. The modified antibody of embodiment 185, wherein the second nucleotide encodes a heavy chain variable region selected from the group consisting of a 25 donor heavy chain variable region, a humanized heavy chain variable region and a modified heavy chain variable region. [0571] 187. A modified antibody that immunospecifically binds an antigen having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability, melting temperature (Tm); pi, solubility; production 30 levels and effector function, encoded by a nucleic acid sequence comprising: (a) a first nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic 919) WO 2006/102095 PCT/US2006/009745 acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRl, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a 5 heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from a donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region is 0 from a sub-bank of human heavy chain framework regions; and (b) a second nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence 5 encoding a light chain framework region 2, a nucleic acid sequence encoding light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from a donor 3 antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub bank of human light chain framework regions, wherein the improvement is between about 1% and 500%, relative to a donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. 5 [0572] 188. The modified antibody of embodiments 183, 184, 185, 186 or 187, wherein said improved characteristic is binding affinity. [0573] 189. The modified antibody of embodiment 188, wherein an improved binding property is the equilibrium dissociation constant (KD) of the antibody for an antigen. [0574] 190. The modified antibody of embodiments 183, 184, 185, 186 or 187, 0 wherein said improved characteristic is stability. [0575] 191. The modified antibody embodiment 190, wherein said stability is in vivo stability or in vitro stability. 213 WO 2006/102095 PCT/US2006/009745 [05761 192. The modified antibody of embodiments 183, 184, 185, 186 or 187, wherein said improved characteristic is Tm and wherein the improvement is a increase in Tm of between about IOC and 20cC, relative to the donor antibody. [05771 193. The modified antibody of embodiments 183, 184, 185, 186 or 187, 5 wherein said improved characteristic is pi and wherein the improvement is a increase in pi of between about 0.5 and 2.0, relative to the donor antibody. [05781 194. The modified antibody of embodiments 183, 184, 185, 186 or 187, wherein said improved characteristic is pi and wherein the improvement is a decrease in pi of between about 0.5 and 2.0, relative to the donor antibody. 3 [05791 195. The modified antibody of embodiments 183, 184, 185, 186 or 187, wherein said improved characteristic is production levels. [05801 196. The modified antibody of embodiments 183, 184, 185, 186 or 187, wherein said improved characteristic is effector function. [05811 197. The method of embodiment 196 wherein said effector function is ADCC. 5 [0582] 198. The method of embodiment 196, wherein said effector function is CDC. [05831 199. A modified antibody that immunospecifically binds an antigen encoded by a nucleic acid sequence comprising a first nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a J heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from a donor antibody heavy chain variable region that immunospecifically 5 binds said antigen and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions and a second nucleotide sequence encoding a light chain variable region. [0584] 200. A modified antibody that immunospecifically binds an antigen encoded by a nucleic acid sequence comprising a first nucleotide sequence encoding a modified light 0 chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light WO 2006/102095 PCT/US2006/009745 chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from a donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub-bank of light chain framework regions and a second nucleotide sequence encoding a heavy chain variable region. [0585] 201. A modified antibody that immunospecifically binds an antigen encoded by a nucleic acid sequence comprising a first nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRl, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein at least one CDR is derived from a donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region is from a sub-bank of heavy chain framework regions and a second nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein at least one CDR is derived from a donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region is from a sub-bank of light chain framework regions. [0586] 202. The modified antibody of embodiments 199, 200 or 201, wherein said donor antibody is not human and wherein at least one sub-bank of framework regions is a human sub-bank of framework regions. [0587] 203. The modified antibody of embodiment 202, wherein at least one framework region derived from the sub-bank of human framework regions has less than 60%, n I Ir WO 2006/102095 PCT/US2006/009745 or less than 70%, or less than 80%, or less than 90% homology to the corresponding framework of the donor antibody. [0588] 204. The modified antibody of any of embodiments 199, 200, 20 1, 202 or 203, wherein the modified antibody binds to an antigen with an affinity that is the same or 5 improved relative to the donor antibody. 6. EXAMPLE 1 Reagents [0589] All chemicals were of analytical grade. Restriction enzymes and DNA modifying enzymes were purchased from New England Biolabs, Inc. (Beverly, MA). pfu 0 DNA polymerase and oligonucleotides were purchased from Invitrogen (Carlsbad, CA). Human EphA2-Fc fusion protein (consisting of human EphA2 fused with the Fc portion of a human IgGl (Carles-Kinch et al. Cancer Res. 62: 2840-2847 (2002)) was expressed in human embryonic kidney (HEK) 293 cells and purified by protein G affinity chromatography using standard protocols. Streptavidin magnetic beads were purchased from Dynal (Lake 5 Success, NY). Human EphA2-Fc biotinylation was carried out using an EZ-Link Sulfo NHS-LC-Biotinylation Kit according to the manufacturer's instructions (Pierce, Rockford, IL). 6.1 Cloning and sequencing of the parental monoclonal antibody [0590] A murine hybridoma cell line (B233) secreting a monoclonal antibody (mAb) 0 raised against the human receptor tyrosine kinase EphA2 (Kinch et al. Clin. Exp. Metastasis. 20:59-68 (2003)) was acquired by Medlmmune, Inc. This mouse mAb is referred to as mAb B233 thereafter. Cloning and sequencing of the variable heavy (VH) and light (VL) genes of mAb B233 were carried out after isolation and purification of the messenger RNA from B233 using a Straight A's mRNA Purification kit (Novagen, Madison, WI) according to the 5 manufacturer's instructions. cDNA was synthesized with a First Strand cDNA synthesis kit (Novagen, Madison, WI) as recommended by the manufacturer. Amplification of both V H and V L genes was canied out using the IgGV H and IgicVL oligonucleotides from the Mouse Ig-Primer Set (Novagen, Madison, WI) as suggested by the manufacturer. DNA fragments resulting from productive amplifications were cloned into pSTBlue-1 using the Perfectly 0 Blunt Cloning Kit (Novagen, Madison, WI). Multiple V H and VL clones were then sequenced by the dideoxy chain termination method (Sanger et al, Proc. Natl. Acad. Sci. USA. 74: 5463-5467 (1977)) using a AB13000 sequencer (Applied Biosystems, Foster City, WO 2006/102095 PCT/US2006/009745 CA). The consensus sequences of mAb B233 VL (VL- 233 ) and VH (V H- 233 ) genes are shown in Figure 1. 6.2 Selection of the human frameworks [0591] Human framework genes were selected from the publicly available pool of 5 antibody germline genes. More precisely, this included 46 human germline kappa chain genes (Al, AlO, Al 1, A14, A17, A18, A19, A2, A20, A23, A26, A27, A3, A30, A5, A7, B2, B3, LI, LlO, LIl, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4/18a, L5, L6, L8, L9, 01, 011, 012, 014, 018, 02, 0 4 and 08; K.F. Schable, et al, Biol. Chem. Hoppe Seyler 374:1001-1022, (1993); J. Brensing-Kuppers, et al, Gene 191:173-181(1997)) 10 for the 1st, 2nd and 31d frameworks and 5 human germline J sequences for the 4th framework (JKI, JK2, JK3, JK4 and JK5; P.A. Hieter, et al, J. Biol. Chem. 257:1516-1522 (1982)). The heavy chain portion of the library included 44 human germline heavy chain sequences (VHl 18, VH1-2, VH1-24, VH1-3, VH1-45, VHl -46, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-1 1, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, l5 VH3-35, VH3-38, VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1 and VH7-8; F. Matsuda, et al, J. Exp. Med. 188:1973-1975 (1998)) for the 1st, 2nd and 31d frameworks and 6 human germline J sequences for the 4f framework (JHl, JH2, JH3, JH4, JH5 and JH6; J.V. Ravetch, et al, Cell 27(3 Pt 2): 583-591 (1981)). !0 6.3 Construction of the framework-shuffled libraries 6.3.1 Description of the libraries [0592] Three main framework-shuffled libraries (library A, B and C) were constructed. Library A included a light chain framework shuffled sub-library (V L subl) paired with the heavy chain ofmAb B233 (VH- 2 33 ). Library B included a heavy chain 25 framework shuffled sub-library (VH subl) paired with the fixed framework shuffled light chains VL -1 2 C8 and VL - 8 G 7 (see § 6.4.1.1, § 6.4.1.2 and § 6.4.1.3). Library C included a light chain framework shuffled sub-library (V L sub2) paired with a heavy chain framework shuffled sub-library (V H sub2). [0593] The construction of the framework shuffled VH and VL sub-libraries was 30 earned out using the oligonucleotides shown in Tables 1-7 and 11. More precisely, the oligonucleotides described in Tables 1-7 and 11 encode the complete sequences of all known human framework germline genes for the light (K) and heavy chains, Kabat definition. The oligonucleotides described in Tables 64 and 65 encode part of the CDRs of mAb B233 and 217 WO 2006/102095 PCT/US2006/009745 are overlapping with the corresponding human germline frameworks. With respect to Table 64, with the exception of ALl -13 and DL 1 U-4U, each oligonucleotide encodes portions of one CDR of mAb B233 (underlined) and of one human germline light chain framework (Kabat definition; Kabat et al, Sequences of Proteins of Immunological Interest, U.S. Public 5 Health Service, National Institutes of Health, Washington, DC, 1991). CDRL1, L2 and L3 are encoded by ALlU- lO/BLI- 10, BL10-160/CL1-1 1 and CL1O-120/DL1-4, respectively. Oligonucleotides AL1-13 contain a M13 gene 3 leader overlapping sequence (bold) and oligonucleotides DLlOI-40 contain a CK overlapping sequence (bold). With respect to table 65, with the exception of AHI-10 and DH1I-30, each oligonucleotide D encodes portions of one CDR of mAb B233 (underlined) and of one human germline heavy chain framework (Kabat definition). CDRHl, H2 and H3 are encoded by AH1U-17U/BH1 17, BHl10-1 6U/CH1 -15 and CH10-13I0/DH1-3, respectively. Oligonucleotides AHl-10 contain a M13 gene 3 leader overlapping sequence (bold) whereas oligonucleotides DHlJ 3U contain a Cia overlapping sequence (bold). (K=G or T, M=A or C, R=A or G, S=C or G, 5 W=A or T and Y=C or T). Table 64. Oligonucleotides used for the fusion of mAb B233 light chain CDRs with human germline light chain frameworks. 1589 ALl s -GGTCGTTCCATTTTACTCCCACTCCGATGTTGTGATGACWCAGTCT-S' 1590 AL2 S '-GGTCGTTCCATTTTACTCCCACTCCGACATCCAGATGAYCCAGTCT-S' ) 1591 AL3 5 -GGTCGTTCCATTTTACTCCCACTCCGCCATCCAGWTGACCCAGTCT-S 1592 AL4 5 -GGTCGTTCCATTTTACTCCCACTCCGAAATAGTGATGAYGCAGTCT-S 1593 AL5 5 -GGTCGTTCCATTTTACTCCCACTCCGAAATTGTGTTGACRCAGTCT-S 1594 AL6 5 -GGTCGTTCCATTTTACTCCCACTCCGAKATTGTGATGACCCAGACT-S 1595 AL7 5 -GGTCGTTCCATTTTACTCCCACTCCGAAATTGTRMTGACWCAGTCT-S ) 1596 AL8 5 -GGTCGTTCCATTTTACTCCCACTCCGAYATYGTGATGACYCAGTCT-S 1597 AL9 5 -GGTCGTTCCATTTTACTCCCACTCCGAAACGACACTCACGCAGTCT- 3' 1598 ALlO 5'-GGTCGTTCCATTTTACTCCCACTCCGACATCCAGTTGACCCAGTCT- 3' 1599 ALIl 5'-GGTCGTTCCATTTTACTCCCACTCCAACATCCAGATGACCCAGTCT-S 1600 AL1 2 5'-GGTCGTTCCATTTTACTCCCACTCCGCCATCCGGATGACCCAGTCT-S 0 1601 AL1 3 5' -GGTCGTTCCATTTTACTCCCACTCCGTCATCTGGATGACCCAGTCT-S' 1602 AL1U 5' -TAATACTTTGGCTGGCCCT GCAGGAGATGGAGGCCGGC-S' 1603 AL2U --TAATACTTTGGCTGGCCCTGCAGGAGAGGGTGRCTCTTTC-S' 1604 AL3U 5'- TAATACTTTGGCTGGCCCT ACAASTGATGGTGACTCTGTC-S' 1605 AL4U s '-TAATACTTTGGCTGGCCCTGAAGGAGATGGAGGCCGGCTG- 3' 5 1606 AL50 5' '- -TAATACTTTGGCTGGCCCTGCAGGAGATGGAGGCCTGCTC-S' 1607 AL6U 5'-TAATACTTTGGCTGGCCCT GCAGGAGATGTTGACTTTGTC-S' 1608 AL7U 5'-TAATACTTTGGCTGGCCCT GCAGGTGATGGTGACTTTCTC-S' 1609 AL8U 5'-TAATACTTTGGCTGGCCCT GCAGTTGATGGTGGCCCTCTC-S' 1610 AL9U 5'-TAATACTTTGGCTGGCCCT GCAAGTGATGGTGACTCTGTC-S' 0 1611 AL1OU 5 ' -TAATACTTTGGCTGGCCCT GCAAATGATACTGACTCTGTC-S' 1612 BLl s '-CCAGCCAAAGTATTAGCAACAACCTACAC TGGYTTCAGCAGAGGCCAGGC-S 1613 BL2 s -CCAGCCAAAGTATTAGCAACAACCTACAC TGGTACCTGCAGAAGCCAGGS-S 1614 BL3 s '-CCAGCCAAAGTATTAGCAACAACCTACAC TGGTATCRGCAGAAACCAGGG-S 1615 BL4 5 -CCAGCCAAAGTATTAGCAACAACCTACAC TGGTACCARCAGAARCCAGGA-S 5 1616 BL5 s -CCAGCCAAAGTATTAGCAACAACCTACAC TGGTACCARCAGAAACCTGGC- 3' 1617 BL6 5 -CCAGCCAAAGTATTAGCAACAACCTACAC TGGTAYCWGCAGAAACCWGGG-S 1618 BL7 5 '-CCAGCCAAAGTATTAGCAACAACCTACAC TGGTATCAGCARAAACCWGGS-S 1619 BL8 5 '-CCAGCCAAAGTATTAGCAACAACCTACACTGGTAYCAGCARAAACCAG-S 1620 BL 9 5 - CCAGCCAAAGTATTAGCAACAACCTACAC TGGTTTCTGCAGAAAGCCAGG-S 0 1621 BL1O 5 '-CCAGCCAAAGTATTAGCAACAACCTACACTGGTTTCAGCAGAAACCAGGG-S ,,1 O WO 2006/102095 PCT/US2006/009745 1622 BL1U 5'- GATGGACTGGAAAACATA ATAGATCAGGAGCTGTGGAG-S' 1623 BL2U 5'- GATGGACTGGAAAACATA ATAGATCAGGAGCTTAGGRGC-S 1624 BL3U 5' -GATGGACTGGAAAACATAA TAGATGAGGAGCCTGGGMGC-S' 1625 BL4U 5'-GATGGACTGGAAAACATA RTAGATCAGGMGCTTAGGGGC-S 1626 BL5U 5'- GATGGACTGGAAAACATA ATAGATCAGGWGCTTAGGRAC-S' 1627 BL60 5'- GATGGACTGGAAAACATA ATAGATGAAGAGCTTAGGGGC-S 1628 BL7U 5'- GATGGACTGGAAAACATA ATAAATTAGGAGTCTTGGAGG-S 1629 BL8U 5' - GATGGACTGGAAAACATA GTAAATGAGCAGCTTAGGAGG- 3 1630 BL9U 5'- GATGGACTGGAAAACATA ATAGATCAGGAGTGTGGAGAC- 3' 1631 BL1OU 5 '-GATGGACTGGAAAACATAA TAGATCAGGAGCTCAGGGGC-S 1632 BLI1U 5 '-GATGGACTGGAAAACATA ATAGATCAGGGACTTAGGGGC-S 1633 BL12U 5 '-GATGGACTGGAAAACATA ATAGAGGAAGAGCTTAGGGGA- 3 1634 BL13U 5 '-GATGGACTGGAAAACATA CTTGATGAGGAGCTTTGGAGA-S 1635 BL14U 5 '- GATGGACTGGAAAACATA ATAAATTAGGCGCCTTGGAGA-S' 1636 BL15U 5 '-GATGGACTGGAAAACATA CTTGATGAGGAGCTTTGGGGC-S 1637 BLl 6U 5 '-GATGGACTGGAAA ACATA TTGAATA ATGA AAATAGCAGC-S 1638 CL1 5 '-GTTTTCCAGTCCATCTCT GGGGTCCCAGACAGATTCAGY-S 1639 CL2 5 '-GTTTTCCAGTCCATCTCT GGGGTCCCATCAAGGTTCAGY-S' 1744 CL3 5 '-GTTTTCCAGTCCATCTCT GGYATCCCAGCCAGGTTCAGT-S' 1745 CL4 5 '--GTTTTCCAGTCCATCTCT GGRGTCCCWGACAGGTTCAGT-S' 1746 CL5 5 '-GTTTTCCAGTCCATCTCT AGCATCCCAGCCAGGTTCAGT-S' 1747 CL6 5 '-GTTTTCCAGTCCATCTCT GGGGTCCCCTCGAGGTTCAGT-S' 1748 CL7 5 ' -GTTTTCCAGTCCATCTCT GGAATCCCACCTCGATTCAGT-S 1749 CL8 5 '-GTTTTCCAGTCCATCTCT GGGGTCCCTGACCGATTCAGT-S 1750 CL9 5 '-GTTTTCCAGTCCATCTCT GGCATCCCAGACAGGTTCAGT-S' 1751 CLIO 5 '- GTTTTCCAGTCCATCTCT GGGGTCTCATCGAGGTTCAGT-S' 1752 CLIl 5 '-GTTTTCCAGTCCATCTCT GGAGTGCCAGATAGGTTCAGT-S' 1753 CL1U 5'- CCAGCTGTTACTCTGTTG KCAGTAATAAACCCCAACATC- 3' 1754 CL2U 5'- CCAGCTGTTACTCTGTTG ACAGTAATAYGTTGCAGCATC-S' 1755 CL3U 5'- CCAGCTGTTACTCTGTTGA CMGTAATAAGTTGCAACATC- 3' 1756 CL4U 5'- CCAGCTGTTACTCTGTTG RCAGTAATAAGTTGCAAAATC- 3' 1757 CL5U 5'- CCAGCTGTTACTCTGTTGA CAGTAATAARCTGCAAAATC-S 1758 CL6U 5'- CCAGCTGTTACTCTGTTG ACARTAGTAAGTTGCAAAATC-S' 1759 CL7U 5'- CCAGCTGTTACTCTGTTG GCAGTAATAAACTCCAAMATC-S' 1760 CL8U 5'- CCAGCTGTTACTCTGTTG GCAGTAATAAACCCCGACATC- 3' 1761 CL9U 5'- CCAGCTGTTACTCTGTTG ACAGAAGTAATATGCAGCATC-S' 1762 CL1OU 5 '-CCAGCTGTTACTCTGTTG ACAGTAATATGTTGCAATATC-S' 1763 CLI1U 5 '-CCAGCTGTTACTCTGTTG ACAGTAATACACTGCAAAATC-S 1764 CL12U 5 '-CCAGCTGTTACTCTGTTG ACAGTAATAAACTGCCACATC-S 1765 DL1 5 '-CAGAGTAACAGCTGGCCGCTCACG TTYGGCCARGGGACCAAGSTG-S 1766 DL2 5 '-CAGAGTAACAGCTGGCCGCTCACG TTCGGCCAAGGGACACGACTG-S 1767 DL3 5 '- CAGAGTAACAGCTGGCCGCTCACG TTCGGCCCTGGGACCAAAGTG-S 1768 DL4 5 '-CAGAGTAACAGCTGGCCGCTCACG TTCGGCGGAGGGACCAAGGTG-S 1769 DL1U 5'- GATGAAGACAGATGGTGCAGCCACAGTACGTTTGATYTCCACCTTGG-S' 1770 DL2U 5'- GATGAAGACAGATGGTGCAGCCACAGTACGTTTGATCTCCAGCTTGG-S 1771 DL3U 5'- GATGAAGACAGATGGTGCAGCCACAGTACGTTTGATATCCACTTTGG-S 1772 DL4U 5' - GATGAAGACAGATGGTGCAGCCACAGTACGTTTAATCTCCAGTCGTG-S' Table 65. Oligonucleotides used for the fusion of niAb B233 heavy chain CDRs with human germline heavy chain frameworks. 1640 AH1 5' - GCTGGTGGTGCCGTTCTATAGCCATAGCCAGGTKCAGCTGGTGCAGTCT-' 1641 AH2 5' - GCTGGTGGTGCCGTTCTATAGCCATAGCGAGGTGCAGCTGKTGGAGTCT-S' 1642 AH3 5' - GCTGGTGGTGCCGTTCTATAGCCATAGCCAGSTGCAGCTGCAGGAGTCG-S' 1643 AH4 5 ' - GCTGGTGGTGCCGTTCTATAGCCATAGCCAGGTCACCTTGARGGAGTCT-S 16644 4 H55Q ''- -GCTGGTGGTGCCGTTCTATAGCCATAGCCARATGCAGCTGGTGCAGTCT-S' 1645 AH6 5'- GCTGGTGGTGCCGTTCTATAGCCATAGCGARGTGCAGCTGGTGSAGTC-S' 1646 AH7 5'- GCTGGTGGTGCCGTTCTATAGCCATAGCCAGATCACCTTGAAGGAGTCT-S 1647 AH8 5' - GCTGGTGGTGCCGTTCTATAGCCATAGCCAGGTSCAGCTGGTRSAGTCT-S' 1648 AH9 5' - GCTGGTGGTGCCGTTCTATAGCCATAGCCAGGTACAGCTGCAGCAGTCA-S' 1664499 H~11oo 5' '-GCTGGTGGTGCCGTTCTATAGCCATAGCCAGGTGCAGCTACAGCAGTGG-S' 1650 AH1U 5 '-GTTCATGGAGTAATCRGTGAAGGTGTATCCAGAAGC-S' 1651 AH2U 5 '-GTTCATGGAGTAATC GCTGAGTGAGAACCCAGAGAM-S' 1652 AH3U 5 '-GTTCATGGAGTAATCA CTGAARGTGAATCCAGAGGC-S' 1653 AH4U 5 '-GTTCATGGAGTAATC ACTGACGGTGAAYCCAGAGGC-S' 1654 AH5U 5 '-GTTCATGGAGTAATC GCTGAYGGAGCCACCAGAGAC-S' 1655 AH6U 5 '-GTTCATGGAGTAATCRGTAAAGGTGWAWCCAGAAGC-S WO 2006/102095 PCT/US2006/009745 1656 AH7U 5 '-GTTCATGGAGTAATC ACTRAAGGTGflAYCCAGAGGC-3 1657 AH8U 5 '-GTTCATGGAGTAATC GGTRAARCTGTAWCCAGAASC-S 1658 AH9U 5 '-GTTCATGGAGTAATC AYCAAAGGTGAATCCAGARGC-S 1659 AHlOU 5' - GTTCATGCAGTAATC RCTRAAGGTGAATCCAGASGC-S' 5 1660 AHIlU 5 '-GTTCATGGAGTAATC GGTGAAGGTGTATCCRGAWGC-3 1661 AH12U 5 '-GTTCATGGAGTAATC ACTGAAGGACCCACCATAGAC-S 1662 AH13U 5'-GTTCATGGAGTAATC ACTGATGGAGCCACCAGAGAC-S 1663 AH14U 5 '-GTTCATGGAGTAATC GCTGATGGAGTAACCAGAGAC-S 1664 AH15U 5 '-GTTCATGGAGTAATC AGTGAGGGTGTATCCGGAAAC-S .0 1665 AH6l U 5 '-GTTCATGGAGTAATC GCTGAAGGTGCCTCCAGAAGC-S 1666 AH17U 5 ' -GTTCATGGAGTAATC AGAGACACTGTCCCCGGAGAT-S' 1667 BH1 5 '-GATTACTCCATGAAC TGGGTGCGACAGGCYCCTGGA- 3' 1668 BH2 5'- GATTACTCCATGAAC TGGGTGCGMCAGGCCCCCGGA-S' 1669 BH3 5 -GATTACTCCATGAAC TGGATCCGTCAGCCCCCAGGR-S' 5 1670 BH4 5 '- CATTACTCC'AT-AA(C TGGRTCCGCCAGGCTCCAGGG-S' 1671 BH5 5'- GATTACTC'C.ATAAC TGGATCCGSCAGCCCCCAGGG-S' 1672 BH6 5'- CATTACTCCATG-AAr- TGGGTCCGSCAAGCTCCAGGG-S' 1673 BH7 5'- GATTACTCCAT(AAC TGGGTCCRTCARGCTCCRGGR-S' 1674 BH8 5'- GATTACTCCAT(AAC TGGGTSCGMCARGCYACWGGA-S' 0 1675 BH9 5'- GATTATCCrAT.AAC TGGKTCCGCCAGGCTCCAGGS-S' 1676 BHlO 5'- GATTACTCCATCAAC' TGGATCAGGCAGTCCCCATCG-S' 1677 BHIl 5' - GATTACTCCATCA Ar TGGGCCCGCAAGGCTCCAGGA-S' 1678 BH12 5 '-GATTACTCCATGAAC TGGATCCGCCAGCACCCAGGG-S' 1679 BH13 5'- GATTACTCCATCAAC TGGGTCCGCCAGGCTTCCGGG-S' 5 1680 BHl 4 S'-GATTACTCCATGAAC TGGGTGCGCCAGATGCCCGGG-S' 1681 BH15 5' - GATTACTCCATGlAAC TGGGTGCGACAGGCTCGTGGA-S' 1682 BHl 6 s '-GATTACTCCATGAAC TGGATCCGGCAGCCCGCCGGG-S' 1683 BHl 7 5 1-GATTACTCCATGAAC TGGGTGCCACAGGCCCCTGGA- S' 1684 BHlU 5 '--TGTGTAATCATTAGCTTTGTTTCTAATAAATCCCATCCACTCAAGCCYTTG-S 0 1685 BH2U 5' - TGTTGTATAATCATTAGCTTTCTTTCTAATAAA TCCCATCCACTCAAGCSCTT-S' 1686 BH3U 5- TcTTQTOTAATrATTACTTTATTTCTAATAAA WGAGACCCACTCCAGCCCCTT-S' 1687 BH4U 5- TGTTATGTAATCATTA~rTTTATTTrTAATAAA CCCAATCCACTCCAGKCCCTT-S' 1688 BH5U s '-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA TGAGACCCACTCCAGRCCCTT-S 1689 BH6U 5' - TGTTCTTAATCATTAGCTTT-TTTrTAATAAA GCCAACCCACTCCAGCCCYTT-S' 5 1690 BH7U 5 '-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA KGCCACCCACTCCAGCCCCTT-S' 1691 BH8U 5 '-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA TCCCAGCCACTCAAGGCCTC-S 1692 BH9U 5 '-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA CCCCATCCACTCCAGGCCTT-S 1693 BHlOU 5' - TTTTTAATCATTAcTTTcTTTcTAATAAA TGARACCCACWCCAGCCCCTT-S' 1694 BHIlU 5'- TQTT-TGTAATCATTArTTTrTTTCTAATAAA MGAKACCCACTCCAGMCCCTT-eS 0 1695 BH12U 5 '-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA YCCMATCCACTCMAGCCCYTT-S 1696 1BH13U s ' -TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA TCCTATCCACTCAAGGCGTTG-S 1697 BH14U 5'-TGTTGTGTAATCATTAGCTTTGTTTCTAATAAA TGCAAGCCACTCCAGGGCCTT-S 1698 BH15U 5 TGTTCTGTAATCATTAGPTTTCTTTCTAATAAA TGAAACATATTCCAGTCCCTT-S' 1699 BH1 6U 5- T(TTGTCTAATCATTAGCTTTTTTCTAATAAA CGATACCCACTCCAGCCCCTT-S' +5 1700 CHl 5' -GCTTGATTACACAACAGAGTACAGTGCATCTGTGAGGGT AGAGTCACCATGACCAGGRAC- S 1701 CH2 5 '- GCTAATGATTACACAACAGAGTACAGTGCATCTGTGGGGT AGGCTCACCATCWCCAAGGAC-S 1702 CH3 5 '- GCTAATGATTACACAACAGAGTACAGTGCATCTGTGGGGT CGAGTYACCATATCAGTAGAC-S 1703 CH4 5 '-GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAAGGGT CGATTCACCATCTCCAGRGAC-S 1704 CH5 5 -GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAAGGGT AGATTCACCATCTCMAGAGA-S >0 1705 CH6 5 '- GCTAATGATTACACAACAGAGTACAGTGCATCTGTGGGGT MGGTTCACCATCTCCAGAGA-S 1706 CH7 5 '- GCTAATGATTACACAACAGAGTACAGTGCATCTGTGGGGT CGATTCAYCATCTCCAGAGA-S 1707 CH8 5 - CTAATGATTACACAArAGArTACGTGCATCTGT(AACGT CGAGTCACCATRTCMGTAGAC-S' 1708 CH9 5 '-GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAGGGT AGRGTCACCATKACCAGGGAC-S 1709 CHli 5'-GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAGGGT CAGGTCACCATCTCAGCCGAC-S >5 1710 CHIl 5'- GCTATGATTACACAACAGAGTACAGTGCATCTGTGAAGGGT CGAATAACCATCAACCCAGAC-S 1711 CH12 s -CTAATGATTACACAACAGAGTACAGTGCATCTGTGAAGGGT CGTTTGTCTTCTCCATGGAC-S 1712 CH13 5 -GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAGGGTA GAGTCACCATGACCGAGGAC-S 1713 CH14 5'-GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAGGGT AGAGTCACGATTACCGCGGAC-S 1714 CHl 5 5 '-GCTAATGATTACACAACAGAGTACAGTGCATCTGTGAGGGT AGAGTCACCATGACCACAGAC -3' 0 1715 CHlU 5 '- GTCCAT AGCATGAT ACCTAGGGTA TCTAGYACAGTAAT ACACGGC- 3' 1716 CH2U 5 '-GTCCATAGCATGATACCTAGGGTA TCTCGCACAGTAATACAYGGC-S 1717 CH3U 5 '-GTCCATAGCATGATACCTAGGGTA TCTYGCACAGTAATACACAGC-S 1718 CH4U 5 '-GTCCATAGCATGATACCTAGGGTA TGYYGCACAGTAATACACGGC-S 1719 CH5U 5 '-GTCCATAGCATGATACCTAGGGTA CCGTGCACARTAATAYGTGGC-S 5 1720 CH60 5 '-GTCCATAGCATGATACCTAGGGTA TCTGGCACAGTAATACACGGC- S 1721 CH7U 5'- GTCrATAGCATGATACCTAGGGTA TGTGTACAGTAATACACGGC-S' 1722 CH8U 5 '-GTCCATAGCATGATACCTAGGGTATCTCGCACAGTGATACAAGGC-S 220 WO 2006/102095 PCT/US2006/009745 1723 CH9U 5' - GTCCAT AGCATGATACCTAGGGTA TTTTGCACAGTAAT ACAAGGC- 3 ' 1724 CHlOt) 5 '-GTCCAT AGCATGATACCTAGGGTA TCTTGCACAGTAAT ACATGGC- 3 1725 CHl 10 5 '-GTCCATAGCATGATACCTAGGGTA GTGTGCACAGTAATATGTGGC- 3 1726 CH120 5 '-GTCCATAGCATGATACCTAGGGTA TTTCGCACAGTAATATACGGC-S 5 1727 CH13U 5 ' -GTCCATAGCATGATACCTAGGGTA TCTCACACAGTAATACACAGC-S 1728 DH1 5 -CCTAGGTATCATGCTATGGACTCC TGGGGCCARGGMACCCTGGTC-S 1729 DH2 5 -CCTAGGTATCATGCTATGGACTCC TGGGGSCAAGGGACMAYGGTC-S 1730 DH3 5 '-CCTAGGTATCATGCTATGGACTCC TGGGGCCGTGGCACCCTGGTC-S 1731 DH1U 5 ' -GGAAGACCGATGGGCCCTTGGTGGAGGCTGAGGAGACRGTGACCAGGGT-S' 0 1732 DH2U 5'-GGAAGACCGATGGGCCCTTGGTGGAGGCTGARGAGACGGTGACCRTKGT-S' 1733 DH3U 5 ' -GGAAGACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGT-S' 6.3.2 Construction of the V 1 Hand VL sub-libraries [0594] V L subl sub-library was assembled sequentially using the polymerase chain 5 reaction (PCR) by overlap extension. Ho et al, Gene 77:51-59 (1989). More precisely, so called "intermediate" PCRs were carried out to synthesize each individual human germline framework fused in frame with a portion of the corresponding donor CDRs using the following oligonucleotide combinations: AL1-13/AL1U-iOU/1-46, BL1-10/BL1U-16U/47 92, CLl-1 1/CL1U-12U/93-138 and DL1-4/DL1U-4U/139-143 for the 1st, 2nd, 3rd and 4th ) frameworks, respectively. This was carried out usingpfu DNA polymerase (PCR SuperMix, Invitrogen) in 100 gl volume and approximately 5 pmol of oligonucleotides ALl -13, ALlU 1OU, BLl-10, BL1U-16U, CLl-Il, CL1U-12U, DL1 -4 and DL1U-4U and approximately 100 pmol of oligonucleotides 1-143. The PCR program consisted of 5 min at 95 0 C; 1 min at 94 0 C, 1 min at 45 0 C, 1 min at 72 0 C for 30 cycles then 8 min at 72 0 C. A second PCR i ("assembly PCR") was then carried out usingpfu DNA polymerase (PCR SuperMix, Invitrogen), 0.5-2 g1 of each of the "intermediate" PCRs, 25 pmol of each of the oligonucleotides DL1U, DL2U, DL3U, DL4U (see Table 64) and 100 pmol of the biotinylated oligonucleotide 5'-GGTCGTTCCATTTTACTCCCAC-S' (SEQ ID NO. 1734) in a 100 p reaction volume. The assembly PCR program consisted of 5 min at 95 0 C; 30 s at 0 94 0 C, 30 s at 5 cPC, 45 s at 72 0 C for 30 cycles then 8 min at 72 0 C. [0595] V Hsubl, v H sub2 and V L sub2 framework-shuffled sub-libraries were also synthesized using the PCR by overlap extension. Ho et al, Gene 77:51-59 (1989). This total in vitro synthesis of the framework shuffled VH and VL genes was done essentially as described H. Wu et al, Methods Mol. Biol. 207: 213-233 (2003). Briefly, a first so-called 5 "fusion PCR" was carried out usingpfu DNA polymerase (PCR SuperMix, Invitrogen). Construction of VH subl was earned out using approximately 3-10 pmol of each of the oligonucleotides described in Tables 5, 6, 1, 11 and 65 in a 100 1 reaction volume. Construction of VH sub2 was canied out using approximately 0.5 pmol of each of the oligonucleotides described in Tables 5, 6, 7, 11 and 65 in a 100 pl reaction volume. 91 WO 2006/102095 PCT/US2006/009745 Construction of VL sub2 was carried out using approximately 0.5 pmol of each of the oligonucleotides described in Tables 1, 2, 3, 4, and 64 in a 100 l reaction volume. For each V H subl, V H sub2 and V L sub2 sub-library, the fusion PCR program consisted of 1 min at 95 0 C; 20 s at 94 0 C, 30 s at 500C, 30 s at 72 0 C for 5 cycles; 20 s at 94 0 C, 30 s at 55 0 C, 30 s at 5 72 0 C for 25 cycles then 7 min at 72 0 C. A second so-called "synthesis PCR" then followed. More precisely, VH subl and VH sub2 sub-libraries were synthesized usingpfu DNA polymerase (PCR SuperMix, Invitrogen), 2-3 g1 of the corresponding "fusion PCR", 30 pmol of each of the oligonucleotides DHlU, DH2U, DH3U (see Table 65) and 100 pmol of the biotinylated oligonucleotide 5'-GCTGGTGGTGCCGTTCTATAGCC-S' (SEQ ID NO. 1735) in a 100 1 reaction volume. VL sub2 sub-library was synthesized usingpfu DNA polymerase (PCR SuperMix, Invitrogen), 3 1 of the corresponding "fusion PCR", 25 pmol of each of the oligonucleotides DLlU, DL2U, DL3U, DL4U (see Table 64) and 100 pmol of the biotinylated oligonucleotide 5'-GGTCGTTCCATTTTACTCCCAC-S' (SEQ ID NO. 1734) in a 100 p1 reaction volume. For each V H subl, V H sub2 and V L sub2 sub-library, the synthesis PCR program consisted of 5 min at 94 0 C; 1 min at 94 0 C, 1 min at 45 0 C, 1 min at 72 0 C for 30 cycles then 8 min at 72 0 C. 6.3.3 Synthesis of the VL -12C8 and VL-8G7 genes [05961 V- 12C8 and VL- 8 G7 light chain genes, used in the context of library B (VL 12C8+V L-8G7+V H subl), were synthesized by PCR from the corresponding V region encoding M13 phage vector (see § § 6.4.1.1, 6.4.1.2, 6.4.1.3) using the 12C8for/12C8back and 8G7for/8G7back oligonucleotide combinations, respectively (see below). [05971 12C8for 5' GGTCGTTCCATTTTACTCCCACTCCGCCATCCAGTTGACTCAGTCTCC 3'(biotinylated) (SEQ ID NO. 1736) 5 [05981 12C8back 5' GATGAAGACAGATGGTGCAGCCACAGTACG TTTGATCTCCAGCTTGGTCCCTCC 3' (SEQ ID NO. 1737) [05991 8G7for 5' GGTCGTTCCATTTTACTCCCACTCCGAAATTGTGTTGACACAGTCTCCAG-S' (biotinylated) (SEQ ID NO. 1738) 11) WO 2006/102095 PCT/US2006/009745 [0600] 8G7back 5' GATGAAGACAGATGGTGCAGCCACAGTACG TTTGATATCCACTTTGGTCCCTC-B' (SEQ ID NO. 1739). [06011 Oligonucleotides 12C8for and 8G7for contain a M13 gene 3 leader 5 overlapping sequence (bold). Oligonucleotides 8G7back and 12C8back contain a CK overlapping sequence (underlined). 6.3.4 Synthesis of the Vf233 and VL- 2 3 3 genes 10602] V H- 2 33 and VL- 233 heavy and light chain genes, used in the context of a chimaeric Fab positive control (VH- 2 3 3 +VL- 2 3 3 ) or of library A (VL subl+V H- 2 3 3 ), were .0 synthesized by PCR from the corresponding pSTBlue-1 (see § 6. l)vector using the 233Hfor/233Hback and 233Lfor/233Lback oligonucleotide combinations, respectively (see below). [06031 233Hfor 5' gctggtggtgccgttctatagccatagcGAGGTGAAGCTGGTGGAGTCTGGAGGAG-3' 5 (biotinylated) (SEQ ID NO. 1740) [0604] 233Hback 5' ggaagaccgatgggcccttggtggaggc TGAGGAGACGGTGACTGAGGTTCCTTG-3 ' (SEQ ID NO. 1741) [0605] 233Lfor 5' 0 ggtcgttecattttactcccactccGATATTGTGCTAACTCAGTCTCCAGCCACCCTG-3' (biotinylated) (SEQ ID NO. 1742) [0606] 233Lback 5' gatgaagacagatggtgcagccacagtacg TTTCAGCTCCAGCTTGGTCCCAGCACCGAACG-3' (SEQ ID NO. 1743) 25 [0607] Oligonucleotides 233Hfor and 233Lfor contain a M13 gene 3 leader overlapping sequence (bold). Oligonucleotide 233Hback contains a Cici overlapping sequence (underlined). Oligonucleotide 233Lback contains a CK overlapping sequence (underlined). 6.3.5 Cloning of the various V regions into a phage expression vector 30 [0608] Libraries A, B and C as well as the chimaeric Fab version of inAb B233 were cloned into a M13-based phage expression vector. This vector allows the expression of Fab 223 WO 2006/102095 PCT/US2006/009745 fragments that contain the first constant domain of a human 71 heavy chain and the constant domain of a human kappa (K) light chain under the control of the lacZ promoter (Figure 2). The cloning was carried out by hybridization mutagenesis, Kunkel et al, Methods Enzymol. 154:367-382 (1987), as described Wu et al, Methods Mol. Biol. 207: 213-233 (2003). Briefly, minus single-stranded DNA corresponding to the various V regions of interest (see § 6.3.2, § 6.3.3 and § 6.3.4) was purified from the final PCR products by ethanol precipitation after dissociation of the double-stranded PCR product using sodium hydroxide and elimination of the biotinylated strand by streptavidin-coated magnetic beads as described (H. Wu, et al, Methods Mol. Biol. 207: 213-233(2003); H. Wu, Methods Mol. Biol. 207: 197 212 (2003)). Equimolar amounts of different minus strands were mixed as follows: V H 2 3 3 /VL subl, VH subl/V L- 8 G 7 L- 12 C 8 , VH sub2/VL sub2 and VH- 2 33 /VL- 2 3 3 to construct library A, library B, library C and chimaeric Fab 233, respectively. These different mixes were then individually annealed to two regions of the vector containing each one palindromic loop. Those loops contained a unique Xbal site which allows for the selection of the vectors that contain both V L and V H chains fused in frame with the human kappa (K) constant and first human y constant regions, respectively. Synthesized DNA was then electroporated into XLl -Blue for plaque formation on XLI -Blue bacterial lawn or production of Fab fragments as described Wu et al, Methods Mol. Biol. 207: 213-233 (2003). 6.4 Screening of the libraries 6.4.1 Primary screen 6.4.1.1 Description [0609] The primary screen consisted of a single point ELISA (SPE) which was carried out using periplasmic extracts prepared from 1 ml-bacterial culture grown in 96 deep well plates and infected with individual recombinant M13 clones (see § 6.3.5) essentially as described in Wu et al, Methods Mol. Biol. 207: 213-233 (2003). Briefly, individual wells of a 96-well Maxisorp Immunoplate were coated with 20-500 ng of a goat anti-human Fab antibody, blocked with 3% BSA/PBS for 2h at 37 0 C and incubated with samples (periplasm expressed Fabs) for Ih at room temperature. 300 ng/well of biotinylated human EphA2-Fc was then added for Ih at room temperature. This was followed by incubation with neutravidin-horseradish peroxydase (HRP) conjugate for 40 min at room temperature. HRP activity was detected with terra methyl benzidine (TMB) substrate and the reaction quenched with 0.2 M H 2 S0 4 . Plates were read at 450 nm. 6.4.1.2 Results of the primary screen WO 2006/102095 PCT/US2006/009745 [0610] Out of- 500 clones from library A that were screened using 100 ng of the goat anti-human Fab capture reagent, 14 exhibited a significant signal (OD 45 0 ranging from 0.2-0.6). This typically corresponded to a signal at least 1.3-fold above the corresponding background signal (OD 450 ranged from 0.1-0.4) of an irrelevant antibody (MEDI-493; S. 5 Johnson et al, J. Infect. Dis. 176: 1215-1224 (1997)). Under these conditions, Fab 233 exhibited an OD 4 50 ranging from 0.4-0.6. 10611] Out of- 200 clones from library A that were screened using 20 ng of the goat anti-human Fab capture reagent, 4 exhibited a significant signal (OD 4 50 ranging from 0.2 0.4). This typically corresponded to a signal at least 2-fold above the corresponding 0 background signal of an irrelevant antibody (OD 4 50 of 0.1). Under these conditions, Fab 233 exhibited an OD 45 0 ranging from 0.2-0.3. [0612] Out of- 750 clones from library A that were screened using 500 ng of the goat anti-human Fab capture reagent, 16 exhibited a significant signal (OD 4 50 ranging from 0.1-0.7). This typically corresponded to a signal at least 1.3-fold above the corresponding 5 background signal of an irrelevant antibody (OD450 ranged from 0.06-0.2). Under these conditions, Fab 233 exhibited an OD 4 50 ranging from 0.1-0.6. Clones VH-233N L-l 2 C8 and V H-233/V L- 8 G 7 were isolated from this round of screening and both exhibited an OD450 of 0.4 (same plate background OD 4 50 values were 0.1 and 0.2, respectively; same plate Fab 233 OD450 values were 0.2 and 0.5, respectively). D [0613] Out of- 750 clones from library B that were screened using 500 ng of the goat anti-human Fab capture reagent, 27 exhibited a significant signal (OD 4 50 ranging from 0.3 2.8). This typically corresponded to a signal at least 1.3-fold above the corresponding background signal of an irrelevant antibody (OD450 ranged from 0.2-0.3). Under these conditions, both VH- 2 3 3 /VL- 2 C8 and VH- 2 33 /VL 8 G 7 exhibited OD450 values ranging from 5 0.2-0.4. Clones VH-2G6/V L1 2 C 8 , VH-6H1 l/VL- 8 G7 and VH- 7 E 8 /VL 8 G 7 were isolated from this round of screening and exhibited an OD450 of 2.8, 2.5 and 1.6, respectively (same plate background OD450 values were 0.3, 0.2 and 0.2, respectively; same plate VH- 23 3 /V L 12C8 OD450 values were 0.4, 0.3 and 0.3, respectively; same plate VH- 2 3 3 /VL 8 G 7 OD 4 50 values were 0.4, 0.3 and 0.3, respectively). 0 [0614] Out of - 1150 clones from library C that were screened using 500 ng of the goat anti-human Fab capture reagent, 36 exhibited a significant signal (OD 45 0 ranging from 0.1-0.3). This typically corresponded to a signal at least 1.3-fold above the corresponding 225 WO 2006/102095 PCT/US2006/009745 background signal of an irrelevant antibody (OD 45 0 ranged from 0.07-0.1). Under these conditions, Fab 233 exhibited an OD 4 50 ranging from 0.1-0.2. 6.4.1.3 Validation of the positive clones [06151 Altogether, 9 clones from library A, 7 clones from library B and 0 clone from 5 library C were re-confirmed in a second, independent, single point ELISA using periplasmic extracts prepared from 15 ml-bacterial culture and 500 ng of the goat anti-human Fab capture reagent. Specifically, two clones from library A (VH- 2 3 3 /VL 1 2 C 8 and VH-233/V-8G7) that exhibited amongst the highest [specific OD 450 /background OD 45 o] ratio (ranging from approximately 15-50) were further characterized by dideoxynucleotide sequencing using a 0 AB13 000 genomic analyzer. DNA sequence analysis of clone V H-233/V L-1 2 C 8 revealed that its heavy chain contained a single base substitution at base 104 resulting in a substitution (N to S) at position H35 (Kabat numbering). This mutation was corrected using the QuickChange XL site-directed mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. Corrected clone VH- 2 3 3 /V L-1 2 C 8 exhibited a [specific 5 OD 450 /background OD 450 ] ratio up to approximately 50 (similar to mutated VH- 2 3 3 /V L-l 2 C 8 ) which indicated retention of binding to EphA2-Fc. Partially humanized clones VH- 2 3 3 /V L~ 12C8 and VH-233/V L- 8 G 7 were then selected for further characterization by a secondary screen (see § 6.4.2). The sequences ofVL-12C8 and VL-8G7 are indicated in Figure 3. As mentioned above, these two humanized light chains were then included in the design of D Library B. Three clones from this library that exhibited amongst the highest [specific OD 450 /background OD 450 ]ratio (approximately 40) were further characterized by dideoxynucleotide sequencing. This lead to the identification of three different humanized heavy chains (VH- 2 G6, VH-6H1 1 and VH-7E8; see Figure 3). VH- 2 G 6 , VH-6H1 1 and VH- 7 E8 were found to be paired with VL-1 2 C8, VL- 8 G7 and VL- 8 G7, respectively. These three fully 5 humanized clones were then selected for further characterization by a secondary screen (see §6.4.2). 6.4.2 Secondary screen 6.4.2.1 Description [06161 In order to further characterize the previously identified humanized clones (see 0 § 6.4.1.3), a secondary screen using Fab fragments expressed in periplasmic extracts prepared from 15 ml-bacterial culture was earned out. More precisely, two ELISAs were used: (i) a functional ELISA in which individual wells of a 96-well Maxisorp Immunoplate were coated with 500 ng of human EphA2-Fc and blocked with 3%BSA/PBS for 2h at 37 0 C. 2-fold WO 2006/102095 PCT/US2006/009745 serially diluted samples were then added and incubated for Ih at room temperature. Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity was detected with TMB substrate and the reaction quenched with 0.2 M H 2 SO 4 . Plates were read at 450 nm; (ii) an anti-human Fab quantification ELISA which 5 was carried out essentially as described. Wu et al., Methods Mol. Biol. 207: 213-233 (2003). Briefly, individual wells of a 96-well Immulon Immunoplate were coated with 100 ng of a goat anti-human Fab antibody and then incubated with 2-fold serially diluted samples (starting at a 1/25 dilution) or standard (human IgG Fab, 500-3.91 ng/ml). Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity .0 was detected with TMB substrate and the reaction quenched with 0.2 M H 2 SO 4 . Plates were read at 450 nm. 6.4.2.2 Results of the secondary screen [06171 The two-part secondary ELISA screen allowed us to compare Fab clones VH 233/V 1 2 C8, VH-233/VL- 8 G 7 , V H- 2 G 6 N L-1 2 C 8 , V H-6H 1 1/V L-8G 7 and VH- 7 E 8 /VL-8G7 to 5 each other and to the chimaeric Fab of mAb B233 (VH- 2 3 3 /VL- 2 3 3 ) in terms of binding to human EphA2. As shown in Figure 4, all framework shuffled Fabs retain binding to human EphA2 as compared with the chimaeric Fab of mAb B233. Interestingly, some clones whose heavy and light chains are both humanized (VH- 2 G 6 /VL12C8 and VH- 7 E 8 /VL-8G7) exhibit better apparent binding to human EphA2-Fc than clones in which only the same light chains 0 are humanized (VH- 2 3 3 /VL- 2 C8 and VH- 2 3 3 /VL- 8 G 7 ). This indicates the existence of a process whereby humanized heavy chains are specifically selected for optimal binding to the antigen in the context of a given humanized light chain. In order to further characterize the different fully humanized molecules, clones VH-2G6/V 1 2 C8, VH-6H1 1/Vu8G7 and VH 7E8/VL8G7 as well as the chimaeric form of mAb B233 (VH- 2 3 3 /VL- 2 3 3 ) were then cloned 25 and expressed as a full length human IgGl (see § 6.5). 6.5 Cloning, expression and purification of the various humanized versions of mAb B233 in a human IgGI format [0618] The variable regions of framework shuffled clones VH-2G6, VH-6H1 1, V H 7E8, VL-1 2 C8 and VL-8G7 and of VH-233 and VL- 2 33 were PCR-amplified from the 30 corresponding V region-encoding M13 phage vectors usingpfu DNA polymerase. They were then individually cloned into mammalian expression vectors encoding a human cytomegalovirus major immediate early (hCMVie) enhancer, promoter and 5'-untranslated region. M. Boshart, et al, Cell 4 1:521-530 (1985). In this system, a human y chain is WO 2006/102095 PCT/US2006/009745 secreted along with a human K chain. S. Johnson, et at, Infect. Dis. 176:1215-1224 (1997). The different constructs were expressed transiently in human embryonic kidney (HEK) 293 cells and harvested 72 hours post-transfection. The secreted, soluble human IgGIs were purified from the conditioned media directly on 1 ml HiTrap protein A or protein G columns 5 according to the manufacturer's instructions (APBiotech, Inc., Piscataway, NJ). Purified human IgGIs (typically >95%homogeneity, asjudged by SDS-PAGE) were recovered in yields varying from 2-13 gg/ml conditioned media, dialyzed against phosphate buffered saline (PBS), flash frozen and stored at -70 0 C. 6.6 BlAcore analysis of the binding of framework-shuffled, chimaeric and mAb 0 B233 IgGs to EphA2-Fc [06191 The interaction of soluble VH- 2 G 6 /VL-l 2 C 8 , VH- 6 H1 1/VL- 8 G7, VH-7E8/V 8G7 and VH-23 3 /VL- 2 33 IgGs as well as of mAb B233 with immobilized EphA2-Fc was monitored by surface plasmon resonance detection using a BlAcore 3000 instrument (Pharmacia Biosensor, Uppsala, Sweden). EphA2-Fc was coupled to the dextran matrix of a 5 CM5 sensor chip (Pharmacia Biosensor) using an Amine Coupling Kit as described (B. Johnsson et ai, Anal. Biochem. 198: 268-277 (1991)) at a surface density of between 105 and 160 RU. IgGs were diluted in 0.01 M HEPES pH 7.4 containing 0.15 M NaCl, 3 mM EDTA and 0.005% P20. AU subsequent dilutions were made in the same buffer. AUbinding experiments were performed at 25'C with IgG concentrations typically ranging from 100 nM 0 to 0.2 nM at a flow rate of 75 pL/min; data were collected for approximately 25 min and one 1-min pulse of IM NaCl, 50 mM NaOH was used to regenerate the surfaces. IgGs were also flowed over an uncoated cell and the sensorgrams from these blank runs subtracted from those obtained with EphA2-Fc-coupled chips. Data were fitted to a 1:1 Langmuir binding model. This algorithm calculates both the /%. and the kff from which the apparent Z5 equilibrium dissociation constant, KD, is deduced as the ratio of the two rate constants (koff ic 0 ). The values obtained are indicated in Table 66. Table 66. Affinity measurements for the binding of different IgGs to human EphA2-Fca Antibody Association rate (k)b Dissociation rate (/cfb Dissociation Constant (KD)c 0 (M'.s I) (S- 1 ) (nM) B233 (murine) 2.8 x 10 1.1 x 104 0.4 V,,-B233/VL-B233 (chimaeric) 2.4 x 15 8.0 x 10-5 0.3 VH- 2 G6/VL-12C8 (humanized) 6.4 x 101 1.9 x 10-4 3.0 VH- 6 H11/V-8G7 (humanized) 9.6 x 10 4 1.8 x 104 1.9 5 VH, 7 E8/VL8G7 (humanized) 9.3 x 10 3 4.5 x 104 48 11Q WO 2006/102095 PCT/US2006/009745 aAffmity measurements were carried out by BlAcore as reported in Description of Method. bKinetic parameters represent the average of 5-18 individual measurements. 9(D was calculated as a ration of the rate constants (kff/ 5 6.7 Expression Yields [06201 The expression levels of the humanized antibodies was compared to that of the chimeric antibody as follows. Human embryonic kidney (HEK) 293 cells were transiently transfected with the various antibody constructs in 35 mm, 6-wells dishes using Lipofectamine and standard protocols. Supernatants were harvested twice at 72 and 144 ) hours post-transfection (referred to as 1st and 2nd harvest, respectively). The secreted, soluble human IgGIs were then assayed in terms of production yields by ELISA. Specifically, transfection supernatants collected twice at three days intervals (see above) were assayed for antibody production using an anti-human IgG ELISA. Individual wells of a 96-well Biocoat plate (BD Biosciences, San Jose, CA) coated with a goat anti-human IgG were incubated i with samples (supernatants) or standards (human IgG, 0.5-100 ng/ml), then with a horse radish peroxydase conjugate of a goat anti-human IgG antibody. Peroxydase activity was detected with 3,3',5,5'-tetramethylbenzidine and the reaction was quenched with 0.2 M H2SO 4 . Plates were read at 450 nm and the concentration was determined. The yields (gg/ml) for several transfections and harvests are shown in Table 67. The average recoveries after purification for the humanized antibodies are also shown. [06211 These data demonstrate that the expression of an antibody can be improved by humanization using a framework shuffling approach. Two of the three humanized antibodies generated by this method have improved expression as compared to the B 233 chimaeric IgG. Table 67: Antibody Expression Levels in Mammalian Cells 5 Transfection # 1 Transfection #2 Transfection #3 Transfection #4 H11H21 Hl H2 Hl H2 HI H2 pg/ml Rg/ml pg/mg pg/ml B233 SERIES: CHM. B 2332 1.7 0 CHM. B 2332 1.8- 1.7-2.3 7E8 3.1- 4.3-7 6HI 1 1.9- 1.8-3.3 2G6 44.1-20.0 20.1-13.6 4.7-2.6 9.8-7.4 5 Purification/recovery data: 6Hl 1: 2 gg purified protein/ml supernatant 7E8: ~ 5 gg purified protein/ml supernatant 2G6: 7-13 gg purified protein/ml supernatant 220 WO 2006/102095 PCT/US2006/009745 1 HI = Transient transfection first harvest, H2 = Transient transfection second harvest. 2 Data corresponding to two independent clones of chimaeric B233. 6.8 Analysis of the framework-shuffled variants 6.8.1 Sequence analysis [06221 Overall, two unique humanized light chains (VL-12C8 and VL-8G7) and three unique humanized heavy chains (VH-2G6, V H-6H1 1and VH-7E8) were found that supported efficient binding to human EphA2-Fc. The promiscuous nature of humanized light chain V L 8G7 is highlighted by its ability to mediate productive binding in the context of two different heavy chains (V H-7E8 and V H- 6 H1 1). All of these humanized variants exhibited a high level of global amino acid identity to mAb B233 in the corresponding framework regions, ranging from 76-83% for the heavy chains and from 64-69% for the light chains (Figure 5). This can be explained by the fact that high-homology human frameworks are more likely to retain parental key residues. Analysis of individual frameworks revealed a wider range of differences, ranging from 48% for the first framework of VL-12C8 to 91% for the fourth framework of VH-2G6, Vf-6H1 l and VH7E8. [06231 Interestingly, humanized heavy chain VH-7E8 consisted exclusively of human frameworks that were a perfect match with human framework germline sequences (Figure 5). Humanized heavy chains VH-6H1 I and VH-2G6 contained one and two human frameworks, respectively, that exhibited a near-perfect match with the most related human framework germline sequences (Figure 5). The differences amounted to a maximum of three residues per chain (V H-2G6) and two residues per framework (first framework of V H-2G6). In no cases did these differences encode amino acids not found in other most distant human framework germline sequences. Thus, arguably, these clones may also be referred to as "fully humanized". Humanized light chains VL-12C8 and VL-8G7 contained one and three 5 human frameworks, respectively, that exhibited a near-perfect match with the most related human framework germline sequences (Figure 5). The number of differences amounted to a maximum of three residues per chain (VL-8G7 ) and one residue per framework (first, second and fourth framework ofVL-8G7; fourth framework of V L-1 2 C 8 ). However, here again, the residues at these positions were also found in other, less homologous human framework sequences; therefore these variants may also be referred to as fully humanized. Since these differences were not built-in within our libraries, we attribute their origin to a combination of factors such as PCR fidelity and/or oligonucleotides quality. 6.8.2 Binding analysis 230 WO 2006/102095 PCT/US2006/009745 [0624] It is worth nothing that only a two-step humanization process in which the light and heavy chains of mAb B233 were successively humanized (Library A and B) allowed us to isolate humanized clones retaining binding to human EphA2-Fc. Indeed, screening of a library in which both the light and heavy chains were simultaneously 5 humanized (Library C) did not allow us to recover molecules exhibiting detectable binding to this antigen. This probably reflects factors such as sub-optimal library quality, incomplete library sampling and/or inefficient prokaryotic expression of a portion of the library. We anticipate that screening a larger number of clones would have resulted in the identification of humanized antibody fragments retaining binding to human EphA2. 0 [0625] As expected in light of their identical heavy and light chains variable regions, parental mAb B233 and its chimaeric IgG version exhibited virtually identical dissociation constant (KD = 0.4 and 0.3 nM, respectively; Table 66). Humanized clones V 1 H-6H1 1/VL 8G7 and V H-2G6/V L-1 2 C 8 , when formatted as a human IgGI, exhibited avidities towards human EphA2 which were similar to the parental and chimaeric version of mAb B233 (KD 5 1.9 and 3.0 nM, respectively; Table 66). This corresponded to a small avidity decrease of 6 and 10-fold, respectively, when compared with parental mAb B233. Humanized clone VH 7E8/V L- 8 G 7 exhibited the lowest avidity (KD = 48 nM), which corresponded to a larger decrease of 160-fold when compared with parental mAb B233. It is worth noting that in terms of strength of binding to EphA2-Fc, the BlAcore-based ranking of humanized IgG ,0 clones VH-6H1 l/VL- 8 G7, VH-2G6/VL-12C8 and VH-7E 8 /VL-8G7 (Table 66) was different from the ELISA-based ranking that utilized their Fab counterparts (Figure 4). This is particularly striking in the case of clone V H-7E8/V L- 8 G 7 which showed the lowest avidity (Table 66), yet consistently exhibited the highest signal by ELISA titration (Figure 4). We do not know what accounts for this difference but think that it is likely attributable to the format 25 of the assays and/or imprecision in the quantification ELISA. Alternatively, it is possible that this discrepancy reflects unique, clone-specific correlations between affinity (as measured in Figure 4) and avidity (as measured in Table 66). Indeed, individual bivalent binding measurements depend on various factors such as the particular spatial arrangements of the corresponding antigen binding sites or the local antigen surface distribution (D.M. Crothers, 30 et al. hmnuno chemistry 9: 341-357(1972); K.M. MOller, et al, Anal. Biochem. 261 : 49 158(1998)). 231 WO 2006/102095 PCT/US2006/009745 7. EXAMPLE 2 Reagents [0626] All chemicals were of analytical grade. Restriction enzymes and DNA 5 modifying enzymes were purchased from New England Biolabs, Inc. (Beverly, MA). SuperMixpfu DNA polymerase and oligonucleotides were purchased from Invitrogen (Carlsbad, CA). pfu ultra DNA polymerase was purchased from Stratagene (La Jolla, CA). Human EphA2-Fc fusion protein (consisting of human EphA2 fused with the Fc portion of a human IgGl; Carles-Kinch et ah, Cancer Res. 62: 2840-2847 (2002)) was expressed in 0 human embryonic kidney (HEK) 293 cells and purified by protein G affinity chromatography using standard protocols. Streptavidin magnetic beads were purchased from Dynal (Lake Success, NY). Human EphA2-Fc biotinylation was carried out using an EZ-Link Sulfo NHS-LC-Biotinylation Kit according to the manufacturer's instructions (Pierce, Rockford, IL). 5 7.1 Cloning and sequencing of the parental monoclonal antibody [0627] A murine hybridoma cell line secreting a monoclonal antibody (mAb) raised against the human receptor tyrosine kinase EphA2. Coffman et ah, Cancer Res. 63:7907 7912 (2003). was generated in Medlmmune, Inc. This mouse mAb is referred to as EA2 thereafter. Coffman et ah, Cancer Res. 63: 7907-7912 (2003). Cloning and sequencing of 0 the variable heavy (VH) and light (VL) genes of mAb EA2 were carried out after isolation and purification of the messenger RNA from the EA2 secreting cell line using a Straight A's mRNA Purification kit (Novagen, Madison, WI) according to the manufacturer's instructions. cDNA was synthesized with a First Strand cDNA synthesis kit (Novagen, Madison, WI) as recommended by the manufacturer. Amplification of both VH and VL genes Z5 was carried out using the IgGVn and IgKVL oligonucleotides from the Mouse Ig-Primer Set (Novagen, Madison, WI) as suggested by the manufacturer. DNA fragments resulting from productive amplifications were cloned into pSTBlue-1 using the Perfectly Blunt Cloning Kit (Novagen, Madison, WI). Multiple VH and VL clones were then sequenced by the dideoxy chain termination method (Sanger et ah, Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467 (1977)) 0 using a ABI 3000 sequencer (Applied Biosystems, Foster City, CA). The sequences of mAb EA2 VL (VL-EA2) and VH (VH-EA2) genes are shown in Figure 6. WO 2006/102095 PCT/US2006/009745 7.2 Selection of the human frameworks [0628] Human framework genes were selected from the publicly available pool of antibody germline genes. More precisely, this included: - 46 human germline kappa chain genes: Al, AlO, Al 1, A14, A17, A18, A19, A2, 5 A20, A23, A26, A27, A3, A30, A5, A7, B2, B3, LI, LlO, LIl, L12, L14, L15, L16, L18, L19, L2, L20, L22, L23, L24, L25, L4/18a, L5, L6, L8, L9, 01, Oi1, 012, 014, 018, 02, 0 4 and 0 8 (Schable et al, Biol. Chem. Hoppe Seyler 374: 1001-1022 (1993); Brensig-Kuppers et al, Gene 191: 173-1811997)) for the 1st, 2nd and 3rd frameworks. 0 - 5 human germline JK sequences: JN1, JK2, JK3, JK4 and JK5 (Hieter et al, J. Biol. Chem. 257: 1516-1522 (1982) for the 4th framework. - 44 human germline heavy chain genes: VH1-18, VH1-2, VH1-24, VH1-3, VH1-45, VH1-46, VH1-58, VH1-69, VH1-8, VH2-26, VH2-5, VH2-70, VH3-1 1, VH3-13, VH3-15, VH3-16, VH3-20, VH3-21, VH3-23, VH3-30, VH3-33, V113-35, VH3-38, 5 VH3-43, VH3-48, VH3-49, VH3-53, VH3-64, VH3-66, VH3-7, VH3-72, VH3-73, VH3-74, VH3-9, VH4-28, VH4-31, VH4-34, VH4-39, VH4-4, VH4-59, VH4-61, VH5-51, VH6-1 and VH7-81 (Matsuda et al, J. Exp. Med. 188: 1973-1975 (1998)) for the 1st, 2nd and 3rd frameworks. - 6 human germline JH sequences: JHl, JH2, JH3, JH4, JH5 and JH6 (Ravetch et al, 3 Cell 27: 583-591 (1981)) for the 4th framework. 7.3 Construction of the framework-shuffled libraries 7.3.1 Description of the libraries [0629] One main framework-shuffled library (library D) was constructed. Library D included a light chain framework shuffled sub-library (V L sub3) paired with a heavy chain 5 framework shuffled sub-library (V H sub3). Construction of the framework shuffled V H and VL sub-libraries was carried out using the oligonucleotides shown in Tables 1-7 , 11, 68 and 69. More precisely, the oligonucleotides described in Tables 1-7 and 11 encode the complete sequences of all known human framework germline genes for the light (K) and heavy chains, respectively, Kabat definition. These oligonucleotides are "universal" and can be used for 0 the humanization of any antibody of interest. The primers described in Tables 68 and 69 encode part of the CDRs of mAb EA2 and are overlapping with the corresponding human germline frameworks. With respect to Table 68, with the exception of AL1EA2-13EA2 and WO 2006/102095 PCT/US2006/009745 DL1UEA2-4UEA2, each oligonucleotide encodes portions of one CDR of mAb EA2 (bold) and of one human germline light chain framework (Kabat definition; Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Public Health Service, National Institutes of Health, Washington, DC, 1991). CDRL1, L2 and L3 are encoded by AL1UEA2 1OUEA2/BL1EA2-1OEA2, BL1 UEA2- 160EA2/CL1EA2- 11EA2 and CL1 EA2 12OEA2/DL1EA2-4EA2, respectively. Oligonucleotides AL1EA2-13EA2 contain a M13 gene 3 leader overlapping sequence (underlined) and oligonucleotides DL1UEA2-4UEA2 contain a CK overlapping sequence (underlined). K=G or T, M=A or C, R=A or G, S=C or G, W=A or T and Y=C or T. With respect to Table 69, with the exception of AH1EA2 1OEA2 and DH IJEA2-3OEA2, each oligonucleotide encodes portions of one CDR of mAb EA2 (bold) and of one human germline heavy chain framework (Kabat definition). CDRH, H2 and H3 are encoded by AH10EA2-170EA2/BH1EA2-17EA2, BH1UEA2 1 6UEA2/CH1EA2-15EA2 and CH1UEA2-13UEA2/DH1EA2-3EA2, respectively. Oligonucleotides AH1EA2-1OEA2 contain a Ml 3 gene 3 leader overlapping sequence (underlined) whereas oligonucleotides DH1 EA2-3OEA2 contain a Cyl overlapping sequence (underlined). K=G or T, M=A or C, R=A or G, S=C or G, W=A or T and Y=C or T. Table 68. Oligonucleotides used for the fusion of mAb EA2 light chain CDRs with human germline light chain frameworks. 1782 AL1 EA2 s '-qqtcqttccattttactcccactcc GATGTTGTGATGACWCAGTCT-3' 1783 AL2 EA2 5 -qqtcqttccattttactcccactcc GACATCCAGATGAYCCAGTCT-3' 1784 AL3 EA2 5 -qqtcqttccattttactcccactcc GCCATCCAGWTGACCCAGTCT-3 ' 1785 AL4 EA2 s -qqtcqttccattttactcccactcc GAAATAGTGATGAYGCAGTCT-3' 1786 AL5 EA2 s '-qqtcqttccattttactcccactcc GAAATTGTGTTGACRCAGTCT-3' 1787 AL6 EA2 s '-qqtcqttccattttactcccactcc GAKATTGTGATGACCCAGACT-3' 1788 AL7 EA2 5 -qqtcqttccattttactcccactcc GAAATTGTRMTGACWCAGTCT-3' 1789 AL8 EA2 s '-qqtcqttccattttactcccactcc GAYATYGTGATGACYCAGTCT-3' 1790 AL9 EA2 s' -qqtcqttccattttactcccactcc GAAACGACACTCACGCAGTCT-3' 17 91 ALlO EA2 5, -qqtcqttccattttactcccactcc GACATCCAGTTGACCCAGTCT-3' 1792 ALIl EA2 5 -qqtcqttccattttactcccactccAACATCCAGATGACCCAGTCT-3' 1793 AL12 EA2 s' -qqtcqttccattttactcccactccGCCATCCGGATGACCCAGTCT-3' 1794 AL13 EA2 s-qqtcqttccattttactcccactcc GTCATCTGGATGACCCAGTCT-3' 1795 AL1U EA2 5 '-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGGAGATGGAGGCCGGC- S 17 96 AL2U EA2 5 '-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGGAGAGGGTGRCTCTTTC-S' 1797 AL3U EA2 5'-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTACAASTGATGGTGACTCTGTC-S' 1798 AL4U EA2 5 '-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGAAGGAGATGGAGGCCGGCTG-S' 1799 AL5U EA2 5 -GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGGAGATGGAGGCCTGCTC- S 1800 AL6U EA2 5 -GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGGAGATGTTGACTTTGTC- S 1801 AL7U EA2 5 ' -GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGGTGATGGTGACTTTCTC-S' 1802 AL8U EA2 5'-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAGTTGATGGTGGCCCTCTC-S' 1803 AL9U EA2 5 '-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAAGTGATGGTGACTCTGTC-S' 1804 AL1OU EA2 5 '-GCTTAAATAGTTATTAATGTCCTGACTCGCCTTGCAAATGATACTGACTCTGTC-S' 1805 BL1 EA2 5 '-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGYTTCAGCAGAGGCCAGGC- S' 1806 BL2 EA2 5 ' -AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTACCTGCAGAAGCCAGGS-S ' 1807 BL3 EA2 5'-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTATCRGCAGAAACCAGGG-S' 1808 BL4 EA2 5' -AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTACCARCAGAAACCAGGA-S' 1809 BL5 EA2 5 '-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTACCARCAGAAACCTGGC- S' 9.4 WO 2006/102095 PCT/US2006/009745 1810 BL 6 EA2 5 '-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTAYCWGCAGAAACCWGGG- S 1811 BL7 EA2 5' -AAGGCGASTCaGGACATTAATAACTATTTAAGCTGGTATCAGCARAAACCWGGS-S' 1812 BL8 EA2 5' -AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTAYCAGCARAAACCAG-S' 1813 BL9 EA2 5'-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTTTCTGCAGAAAGCCAGG-S' 1814 BL10 EA2 5 '-AAGGCGAGTCAGGACATTAATAACTATTTAAGCTGGTTTCAGCAGAAACCAGGG-S' 1815 BL1O EA2 5 '-ATCTACCAATCTGTTTGCACGATAGATCAGGAGCTGTGGAG- S 1816 BL2U EA2 5'-ATCTACCAATCTGTTTGCACGATAGATCAGGAGCTTAGGRGC-S' 1817 BL3U EA2 5 ' -ATCTACCAATCTGTTTGCACGATAGATGAGGAGCCTGGGMGC-S, 1818 BL4U EA2 5 ' -ATCTACCAATCTGTTTGCACGRTAGATCAGGMGCTTAGGGGC-S' 1819 BL5U EA2 5'-ATCTACCAATCTGTTTGCACGATAGATCAGGWGCTTAGGRAC-S' 1820 BL6U EA2 5'-ATCTACCAATCTGTTTGCACGATAGATGAAGAGCTTAGGGGC-S' 1821 BL7U EA2 5'-ATCTACCAATCTGTTTGCACGATAAATTAGGAGTCTTGGAGG-S' 1822 BL8U EA2 5' -ATCTACCAATCTGTTTGCACGGTAAATGAGCAGCTTAGGAGG-S' 1823 BL9U EA2 5' -ATCTACCAATCTGTTTGCACGATAGATCAGGAGTGTGGAGAC-S' 1824 BL1OU EA2 5' -ATCTACCAATCTGTTTGCACGATAGATCAGGAGCTCAGGGGC-S' 1825 BLl IU EA2 5 '-ATCTACCAATCTGTTTGCACGATAGATCAGGGACTTAGGGGC- S 1826 BL12U EA2 5'-ATCTACCAATCTGTTTGCACGATAGAGGAAGAGCTTAGGGGA-S' 1827 BL13U EA2 5 ' -ATCTACCAATCTGTTTGCACGCTTGATGAGGAGCTTTGGAGA-S' 1828 BL14U EA2 5'-ATCTACCAATCTGTTTGCACGATAAATTAGGCGCCTTGGAGA-S' 1829 BL15U EA2 5' -ATCTACCAATCTGTTTGCACGCTTGATGAGGAGCTTTGGGGC-S' 1830 BL16U EA2 5' -ATCTACCAATCTGTTTGCACGTTGAATAATGAAAATAGCAGC- S 1831 CL1 EA2 CGTGCAAACAGATTGGTAGATGGGGTCCCAGACAGATTCAGY Table 69. Oligonucleotides used for the fusion of mAb EA2 light chain CDRs with human germline heavy chain frameworks. 1832 AHl EA2 5'-Gctqqtqqtqccqttctataqccataqc CAGGTKCAGCTGGTGCAGTCT-3' 1833 AH2 EA2 5'-Gctqqtqqtqccqttctatagccataqc GAGGTGCAGCTGKTGGAGTCT-3' 1834 AH3 EA2 5 ' -Gctqqtgqtqccq ttctataqccataqc CAGSTGCAGCTGCAGGAGTCG-3' 1835 AH4 EA2 5'-Gctqqtqqtqccqttctataqccataqc CAGGTCACCTTGARGGAGTCT-3' 1836 AH5 EA2 5'-Gctqqtqqtqccqttctataqccataqc CARATGCAGCTGGTGCAGTCT-3' 1837 AH6 EA2 5'-Gctqqtqqtqccqttctataqccataqc GARGTGCAGCTGGTGSAGTC-3' 1838 AH7 EA2 5' -Gctggtggtgccq ttctataqccataqc CAGATCACCTTGAAGGAGTCT-3' 1839 AH8 EA2 5' -Gctqqtqqtqccqttctataqccataqc CAGGTSCAGCTGGTRSAGTCT-3' 1840 AH9 EA2 5'-Gctqqtqqtqccqttctataqccataqc CAGGTACAGCTGCAGCAGTCA-3' 1841 AHlO EA2 5'-Gctqqtqqtqccqttctataqccataqc CAGGTGCAGCTACAGCAGTGG-;;' 1842 AHK1U EA2 5 ' -AGACATGGTATAGCTRGTGAAGGTGTATCCAGAAGC-S' 1843 AHK2U EA2 5'-AGACATGGTATAGCTGCTGAGTGAGAACCCAGAGAM-S' 1844 AHK3U EA2 5'-AGACATGGTATAGCTACTGAARGTGAATCCAGAGGC-S' 1845 AHK4U EA2 5 '-AGACATGGTATAGCTACTGACGGTGAAYCCAGAGGC- S' 1846 AHK5U EA2 5' -AGACATGGTATAGCTGCTGAYGGAGCCACCAGAGAC- S 1847 AHK 6U EA2 5'-AGACATGGTATAGCTRGTAAAGGTGWAWCCAGAAGC-S' 1848 AHK7U EA2 5'-AGACATGGTATAGCTACTRAAGGTGAAYCCAGAGGC-S' 1849 AHK8U EA2 s '-AGACATGGTATAGCTGGTRAARCTGTAWCCAGAASC-S' 1850 AHK9U EA2 5'-AGACATGGTATAGCTAYCAAAGGTGAATCCAGARGC-S' 1851 AHK1OU EA2 5'-AGACATGGTATAGCTRCTRAAGGTGAATCCAGASGC-S' 1852 AHK12U EA2 5'-AGACATGGTATAGCTGGTGAAGGTGTATCCRGAWGC-S' 1853 AHK13U EA2 5 '-AGACATGGTATAGCTACTGAAGGACCCACCATAGAC- S 1854 AHK1 4U EA2 5'-AGACATGGTATAGCTACTGATGGAGCCACCAGAGAC-S' 1855 AHKl 5U EA2 5'-AGACATGGTATAGCTGCTGATGGAGTAACCAGAGAC-S' 1856 AHK1 6U EA2 5'-AGACATGGTATAGCTAGTGAGGGTGTATCCGGAAAC-S' 1857 AHK17U EA2 5'-AGACATGGTATAGCTGCTGAAGGTGCCTCCAGAAGC-S' 1858 AHK1 8U EA2 5'-AGACATGGTATAGCTAGAGACACTGTCCCCGGAGAT-S' 1859 BHK1 EA2 5'-AGCTATACCATGTCTTGGGTGCGACAGGCYCCTGGA-S' 1860 BHK2 EA2 S -AGCTATACCATGTCTTGGGTGCGMCAGGCCCCCGGA-S' 1861 BHK3 EA2 5'-AGCTATACCATGTCTTGGATCCGTCAGCCCCCAGGR-S' 1862 BHK4 EA2 5 ' -AGCTATACCATGTCTTGGRTCCGCCAGGCTCCAGGG-S 1863 BHK5 EA2 5 ' -AGCTATACCATGTCTTGGATCCGSCAGCCCCCAGGG-S 1864 BHK 6 EA2 5'-AGCTATACCATGTCTTGGGTCCGSCAAGCTCCAGGG-S' 1865 BHK7 EA2 5'-AGCTATACCATGTCTTGGGTCCRTCARGCTCCRGGR-S' 1866 BHK8 EA2 5'-AGCTATACCATGTCTTGGGTSCGMCARGCYACWGGA-S' 1867 BHK9 EA2 S -AGCTATACCATGTCTTGGKTCCGCCAGGCTCCAGGS-S' 1868 BHK10 EA2 5 ' -AGCTATACCATGTCTTGGATCAGGCAGTCCCCATCG-S' 1869 BHKI1 EA2 5'-AGCTATACCATGTCTTGGGCCCGCAAGGCTCCAGGA-S' 1870 BHK12 EA2 5' -AGCTATACCATGTCTTGGATCCGCCAGCACCCAGGG-S' 1871 BHK13 EA2 5'-AGCTATACCATGTCTTGGGTCCGCCAGGCTTCCGGG-S' 1872 BHK14 EA2 5'-AGCTATACCATGTCTTGGGTGCGCCAGATGCCCGGG-S' 7235 WO 2006/102095 PCT/US2006/009745 1873 AGCTATACCATGTCTTGGGTGCGACAGGCTCGTGGA, BHK1 5 EA2 1874 AGCTATACCATGTCTTGGATCCGGCAGCCCGCCGGG, BHK1 6 EA2 1875 AGCTATACCATGTCTTGGGTGCCACAGGCCCCTGGA, BHK17 EA2 187 6 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTTCCCATCCACTCAAGCCYTTG, BHK1U EA2 5 1877 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTTCCCATCCACTCAAGCSCTT, BHK2U EA2 1878 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTWGAGACCCACTCCAGCCCCTT, BHK3U EA2 187 9 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTCCCAATCCACTCCAGKCCCTT, BHK4U EA2 1880 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTTGAGACCCACTCCAGRCCCTT, BHK5U EA2 1881 GGATAGTAGGTGTAAGTACCACCACTACTAATGGTGCCAACCCACTCCAGCCCYTT, BHK 6U EA2 0 7.3.2 Construction of the V Hand V L sub-libraries [0630] Framework-shuffled V H sub3 sub-library was synthesized using the PCR by overlap extension. Ho et ah, Gene 77: 51-59 (1989). A total in vitro synthesis of the framework shuffled V H gene was done essentially as described. Wu, Methods Mol. Biol. 207: 5 197-212 (2003). Briefly, a first so-called "fusion PCR" was carried out usingpfu DNA polymerase (PCR SuperMix, Invitrogen) and approximately 1 pmol of each of the oligonucleotides described in Tables 5, 6, 7, 11 and 69 in a 50-100 Rl reaction volume. The fusion PCR program consisted of 20 s at 94 0 C, 30 s at 500C, 30 s at 72 0 C for 5 cycles and of 20 s at 94 0 C, 30 s at 55 0 C, 30 s at 72 0 C for 25 cycles. A second so-called "synthesis PCR" 0 then followed usingpfu ultra DNA polymerase, 2-4 g1 of the "fusion PCR", ~ 30 pmol of each of the oligonucleotides DH1UEA2, DH2UEA2, DH3UEA2 (see Table 69) and ~ 100 pmol of the biotinylated oligonucleotide 5'-GCTGGTGGTGCCGTTCTATAGCC-S' (SEQ ID NO. 1735) in a 50-100 gl reaction volume. The synthesis PCR program consisted of 20 s at 94 0 C, 30 s at 500C, 30 s at 72 0 C for 5 cycles and of20 s at 94 0 C, 30 s at 55 0 C, 30 s at 72 0 C 5 for 30 cycles. [0631] Construction of framework-shuffled VL sub3 sub-library was carried out in a similar fashion. More precisely, a first "fusion PCR" was carried out usingpfu ultra DNA polymerase (Stratagene) and approximately 1 pmol of each of the oligonucleotides described in Tables 1, 2, 3, 4 and 68 in a 50-100 gl reaction volume. The fusion PCR program 0 consisted of 20 s at 94 0 C, 30 s at 5o0C, 30 s at 72 0 C for 5 cycles and of 20 s at 94 0 C, 30 s at 55 0 C, 30 s at 72 0 C for 25 cycles. A second "synthesis PCR" then followed usingpfu ultra DNA polymerase, 2-4 p1 of the "fusion PCR", ~ 30 pmol of each of each of the oligonucleotides DL1UEA2, DL2UEA2, DL3UEA2, DL4UEA2 (see Table 68) and ~ 100 pmol of the biotinylated oligonucleotide 5'-GGTCGTTCCATTTTACTCCCAC-S' (SEQ ID 5 NO. 1734) in a 50-100 pl reaction volume. The synthesis PCR program consisted of 20 s at 94 0 C 5 30 s at 50 0 C, 30 s at 72 0 C for 5 cycles and of 20 s at 94 0 C, 30 s at 55 0 C, 30 s at 72 0 C for 30 cycles. WO 2006/102095 PCT/US2006/009745 7.3.3 Synthesis of the V-EA2 and VL-EA2 genes [06321 VH-EA2 and VL-EA2 heavy and light chain genes, used in the context of a chimaeric Fab positive control (V H-EA2+V L-EA2), were synthesized by PCR from the corresponding pSTBlue-1 vector (see § 7.1) using the EA2Hfor/EA2Hback and 5 EA2Lfor/EA2Lback oligonucleotide combinations, respectively. [0633] EA2Hfor: 5' GCTGGTGGTGCCGTTCTATAGCCATAGCGACGTGAAGCTGGTGGAGTCTGGG GGAGGCT-3' (biotinylated) (SEQ ID NO. 1882) [06341 EA2Hback: 5' 0 GGAAGACCGATGGGCCCTTGGTGGAGGC TGCAGAGACAGTGACCAGAGTCCC-S' (SEQ ID NO. 1883) [0635] EA2Lfor: 5' GGTCGTTCCATTTTACTCCCACTCCGACATCAAGATGACCCAGTCTCCATCTTC C-3' (biotinylated) (SEQ ID NO. 1884) 5 [0636] EA2Lback: 5' GATGAAGACAGATGGTGCAGCCACAGTACG TTTTATTTCCAGCTTGGTCCCCCCT CCGAA-3' (SEQ ID NO. 1885) [0637] Oligonucleotides EA2Hfor and EA2Lfor contain a M 13 gene 3 leader overlapping sequence (bold). Oligonucleotide EA2Hback contains a Cyi overlapping 3 sequence (underlined). Oligonucleotide EA2Lback contains a CK overlapping sequence (underlined). 7.3.4 Cloning of the various V regions into a phage expression vector [0638] Library D as well as the chimaeric Fab version of mAb EA2 were cloned into a M 13-based phage expression vector. This vector allows the expression of Fab fragments 5 that contain the first constant domain of a human yl heavy chain and the constant domain of a human kappa (K) light chain under the control of the lacZpromoter (Figure 2). The cloning was earned out by hybridization mutagenesis, Kunkel et ah, Methods Enzymol. 154: 367-3 82 (1987) as described Wu, Methods MoL Biol. 207: 197-212 (2003). Briefly, minus single stranded DNA corresponding to the various V regions of interest (see § 7.3.2 and § 7.3.3) was 0 purified from the final PCR products by ethanol precipitation after dissociation of the double stranded PCR product using sodium hydroxide and elimination of the biotinylated strand by streptavidin-coated magnetic beads as described (Wu, Methods Mol. Biol. 207: 197-212 917 WO 2006/102095 PCT/US2006/009745 (2003); Wu et al, Methods Mol. Biol. 207: 213-233 (2003)). Equimolar amounts of the different minus strands were mixed as follows: V H-EA2/ L EA2 and V H sub3/VL sub3 to construct chimaeric EA2 and library D, respectively. These different mixes were then individually annealed to two regions of the vector containing each one palindromic loop. 5 Those loops contained a unique Xbal site which, when restricted by Xbal, allows for the selection of the vectors that contain both VL and V H chains fused in frame with the human kappa (K) constant and first human yl constant regions, respectively (Wu, Methods Mol. Biol. 207: 197-212 (2003); Wu et al., Methods Mol. Biol. 207: 213-233 (2003)), at the expense of the digested parental template. Synthesized DNA was then electroporated into 0 XL1 -Blue for plaque formation on XLl -Blue bacterial lawn or production of Fab fragments as described Wu, Methods Mol. Biol. 207: 197-212 (2003). 7.4 Screening of the libraries 7.4.1 Primary screen 7.4.1.1 Description 5 [0639] The primary screen consisted of a single point ELISA (SPE) which was carried out using periplasmic extracts prepared from 1 ml-bacterial culture grown in 96 deep well plates and infected with individual recombinant M13 clones (see § 7.3.4) essentially as described Wu, Methods Mol. Biol. 207: 197-212 (2003). Briefly, individual wells of a 96 well Maxisorp Immunoplate were coated with 1 gg of a goat anti-human Fd antibody (Saco, .0 ME), blocked with 3% BSA/PBS for 2 h at 37 0 C and incubated with samples (periplasm expressed Fabs) for 2 h at room temperature. 300-600 ng/well of biotinylated human EphA2 Fc was then added for 2 h at room temperature. This was followed by incubation with neutravidin-horseradish peroxydase (HRP) conjugate (Pierce, IL) for 40 min at room temperature. HRP activity was detected with tetra methyl benzidine (TMB) substrate and the 25 reaction quenched with 0.2 M H 2 SO 4 . Plates were read at 450 nm. 7.4.1.2 Result of the primary screen [0640] Out of- 1200 clones from library D that were screened as described in § 7.4.1 .1., one particular clone (named 4H5 thereafter) exhibited a significant signal (OD450 = 3). This typically corresponded to a signal 10-fold above the corresponding background 30 signal of an irrelevant antibody (OD 4 50 =0.3). Under these conditions, Fab EA2 also exhibited an OD 4 50 of 3. 7.4.1.3 Validation of clone 4115 WO 2006/102095 PCT/US2006/009745 [06411 Clone 4H5 was re-confirmed in a-second, independent, single point ELISA using periplasmic extracts prepared from 15 ml-bacterial culture (Wu, Methods Mol. Biol. 207: 197-212 (2003)) and 1 jg/well of the goat anti-human Fd capture reagent as described in § 7.4.1.1. Under these conditions, clone 4H5 exhibited a [specific OD 450 /background OD 45 0 ] 5 ratio of approximately 30 (similar to EA2). Clone 4H5 was further characterized by dideoxynucleotide sequencing (Sanger et ah, Proc. Natl. Acad. Sci. U.S.A. 74: 5463-5467 (1977)) using a ABI 3000 genomic analyzer. DNA sequence analysis revealed that its light chain CDR3 contained a single base substitution (GAG to GTG) resulting in a substitution (E to V) at position L93 (Kabat numbering). This mutation was corrected using the 0 QuickChange XL site-directed mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. 7.4.1.4 Validation of "corrected" clone 4H5 [0642] "Corrected" clone 4115 was characterized in a single point ELISA using periplasmic extracts prepared from 45 ml-bacterial culture (Wu, Methods Mol. Biol. 207: 5 197-212 (2003)) and 1 jg/well of the goat anti-human Fd capture reagent as described in § 7.4.1.1. Under these conditions, "corrected" clone 4H5 exhibited a [specific OD 45 o/background OD 4 50 ]ratio of approximately 11, clone 4H5 exhibited a [specific OD 4 5 o/background OD 45 0 ] ratio of approximately 23 and EA2 exhibited a [specific OD 4 5 o/background OD 45 0 ] ratio of approximately 15. This indicated that "corrected" clone O 4115 retained good binding to EphA2-Fc. Clones 4H5 and its CDRL3 corrected version were then further characterized by a secondary screen (see § 7.4.2). The sequences of 4H5 and corrected version thereof aligned with their murine counterpart (EA2) are indicated in Figure 7. 7.4.2 Secondary screen 5 7.4.2.1 Description [06431 In order to further characterize the previously identified humanized clones (see § 7.4.1), a secondary screen using Fab fragments expressed in periplasmic extracts prepared from 45 mi-bacterial culture (Wu, Methods Mol. Biol. 207: 197-212 (2003)) was carried out. More precisely, two ELISAs were used: (i) a functional ELISA in which individual wells of a 0 96-well Maxisorp Immunoplate were coated with ~ 500 ng of human EphA2-Fc and blocked with 3%BSA/PBS for 2 h at 37 0 C. 2-fold serially diluted samples were then added and incubated for 1 h at room temperature. Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity was detected with TMB substrate WO 2006/102095 PCT/US2006/009745 and the reaction quenched with 0.2 M H 2 S0 4 . Plates were read at 450 nm; (ii) an anti-human Fab quantification ELISA which was carried out essentially as described Wu, Methods Mol. Biol. 207: 197-212 (2003). Briefly, individual wells of a 96-well BlOcoat plate (BD Biosciences, CA) were incubated with 2-fold serially diluted samples or standard (human IgG 5 Fab, 25-0.39 ng/ml). Incubation with a goat anti-human kappa horseradish peroxydase (HRP) conjugate then followed. HRP activity was detected with TMB substrate and the reaction quenched with 0.2 M H2SO4. Plates were read at 450 nm. 7.4.2.2 Results of the secondary screen [0644] The two-part secondary ELISA screen described in § 7.4.2.1 allowed us to 0 compare Fab clones 4H5 and its CDRL3 corrected version to each other and to the chimaeric Fab of mAb EA2 in terms of binding to human EphA2. As shown in Figure 8, both framework shuffled Fabs exhibit better binding to human EphA2 when compared with the chimaeric Fab of mAb EA2. The fact that clone 4H5 exhibits better binding to human EphA2 when compared with its corrected version indicates that the change in CDRL3 had an 5 affinity boosting effect. 7.5 Analysis of the framework-shuffled variant 4115 7.5.1 Sequence analysis [0645] Overall, one unique humanized light chain (VL-4H5) and one unique humanized heavy chain (VH-4H5) were found that, in combination with one another, D supported efficient binding to human EphA2-Fc. This humanized variant exhibited a high level of global amino acid identity to mAb EA2 ranging from 61 to 78% for the light and heavy chains, respectively (Figure 9). This can be explained in part by the fact that high homology human frameworks are more likely to retain parental key residues. Analysis of the individual frameworks revealed a wider range of differences, ranging from 57% for the 5 second framework of VH-4H5 to 83% for the first framework of VH-4H5. [0646] Interestingly, humanized heavy chain VH-4H5 consisted of three human frameworks (2nd, 3rd and 4th) that were a perfect match with human framework germline sequences (Figure 9). The 1st framework of this chain exhibited a near-perfect match (29 out of 30 residues) with the most related human framework germline sequence (Figure 9). Thus, 0 overall, the difference amounted to only one residue in the heavy chain. Interestingly, this difference encoded an amino acid found in other most distant human framework germline sequences. Thus, arguably, this heavy chain is fully humanized. Humanized light chain VL 4H5 consisted of three human frameworks (Ist, 2nd and 4th) that were a perfect match with I AI WO 2006/102095 PCT/US2006/009745 human framework germline sequences (Figure 9). The 3rd framework of this chain exhibited a near-perfect match (30 out of 32 residues) with the most related human framework germline sequence (Figure 9). Thus, overall, the difference amounted to only two residue in the light chain. However, here again, the residues at these positions were also found in other, less 5 homologous human framework sequences; therefore this light chain may also be referred to as fully humanized. Since these differences were not built-in within our libraries, we attribute their origin to a combination of factors such as PCR fidelity and/or oligonucleotides quality. [06471 Humanized chains V H- 4 H 5 and V L- 4 H 5 both derived their first three 0 frameworks from at least two different germline families (Figure 9). 7.5.2 Binding analysis [06481 In the case described here, a one-step humanization process in which the light and heavy chains of mAb EA2 were simultaneously humanized (Library D) allowed us to identify one humanized clone exhibiting significantly better binding to human EphA2-Fc 5 when compared with the chimaeric molecule. This approach also allowed us to isolate one humanized, affinity matured clone, with an even better binding affinity to human EpliA2-Fc. 7.5.2.1 Cloning, expression and purification of the various humanized versions of mAb EA2 in a human IgGI format 106491 The variable regions of framework shuffled clones 4H5 and "corrected" 4H5 0 were PCR-amplified from the corresponding V region-encoding M13 phage vectors (see § 7.4.1 .2) usingpfu DNA polymerase. They were then individually cloned into mammalian expression vectors encoding ahuman cytomegalovirus major immediate early (hCMVie) enhancer, promoter and 5'-untranslated region (M. Boshart, et al, 1985, Cell 4 1:521-530). In this system, a human yl chain is secreted along with a human K chain (S. Johnson, et al., .5 1997, Infect. Dis. 176:1215-1224). The different constructs were expressed transiently in HEK 293 cells and harvested 72 and 144 hours post-transfection. The secreted, soluble human IgGIs were purified from the conditioned media directly on, 1 ml HiTrap protein A or protein G columns according to the manufacturer's instructions (APBiotech, Inc., Piscataway, NJ). Purified human IgGIs (typically > 95% homogeneity, asjudged by SDS-PAGE) were 0 dialyzed against phosphate buffered saline (PBS), flash frozen and stored at -70 0 C. 7.5.2.2 BlAcore analysis of the binding of framework-shuffled and mAb EA2 IgGs to EphA2-Fc I)A I WO 2006/102095 PCT/US2006/009745 [06501 The interaction of soluble VH- 4 H 5 /VL- 4 H 5 (or "4H5") and VH- 4 H 5 /VL "corrected" 4H5 (or "corrected" 4H5) IgGs as well as of mAb EA2 with immobilized EphA2-Fc was monitored by surface plasmon resonance detection using a BlAcore 3000 instrument (Pharmacia Biosensor, Uppsala, Sweden). EphA2-Fc was coupled to the dextran matrix of a CM5 sensor chip (Pharmacia Biosensor) using an Amine Coupling Kit as described (B. Johnsson et al., 1991, Anal. Biochem. 198: 268-277) at a surface density of approximately 500 RU. IgGs were diluted in 0.01 M HEPES pH 7.4 containing 0.15 M NaCl, 3 mM EDTA and 0.005% P20. AU subsequent dilutions were made in the same buffer. All binding experiments were performed at 25*C with IgG concentrations typically ) ranging from 100 nM to 0.2 nM at a flow rate of 75 pL/min; data were collected for approximately 25 min and two 30-sec pulse of IM NaCl, 50 mM NaOH was used to regenerate the surfaces. IgGs were also flowed over an uncoated cell and the sensorgrams from these blank runs subtracted from those obtained with EphA2-Fc-coupled chips. Data were fitted to a 1:1 Langmuir binding model. This algorithm calculates both the io and the kqff from which the apparent equilibrium dissociation constant, KD, is deduced as the ratio of the two rate constants jef/ jo). The values obtained are indicated in Table 70. [06511 Humanized clones VH 4 H5/VL4H5 and VH- 4 H5/VL"corrected" 4H5, when formatted as a human IgGl, exhibited avidities towards human EphA2 which were superior to the parental mAb EA2 (KD = 67 and 1400 pM, respectively; Table 70). This corresponded to an avidity increase of 90 and 4-fold, respectively, when compared with parental mAb EA2. Table 70. Affinity measurements for the binding of different IgGs to human EphA2-Fe a Antibody Association rate (k 0 ,) Dissociation rate (kff) Dissociation Constant (KD)b (M's') (s-') (pM) EA2 (murine) 5.17.10s 3.07.10- 5938 5 VrI-4H5/VL-4H5 9.8.10 6.6.10- 5 67 "corrected" 4H5 7.5.10' 1.05.10 3 1400 aAffinity measurements were carried out by BlAcore as reported in Description of Method. bKD was calculated as a ratio of the rate constants (k/kff/). ) 8. EXAMPLE 3 [06521 The thermal melting temperature (Tm) of the variable domain of antibodies is known to play a role in denaturation and aggregation. Generally a higher Tm correlates with better stability and less aggregation. As the process of framework-shuffling alters the 5 variable region it was likely that the Tm of the framework-shuffled antibodies had been changed. The Tm of chimaeric B233 and the framework-shuffled antibodies were measured WO 2006/102095 PCT/US2006/009745 by differential scanning calorimetry (DSC) using a VP-DSC (MicroCal, LLC) using a scan rate of 1.0 C/min and a temperature range of 25 -HO 0 C. A filter period of 8 seconds was used along with a 15 minute pre-scan thermostating. Samples were prepared by dialysis into 10 mM Histidine-HCl, pH 6 using Pierce dialysis cassettes (3.5 kD). Mab concentrations 5 were 200-400 pg/mL as determined by A 28 0 - Melting temperatures were determined following manufacturer procedures using Origin software supplied with the system. Briefly, multiple baselines were run with buffer in both the sample and reference cell to establish thermal equilibrium. After the baseline was subtracted from the sample thermogram, the data were concentration normalized and fitted using the deconvolution function. Although some 0 antibodies have complex profiles with multiple peaks arising from the melting of subdomains within the molecule, the melting of the Fab domains are known to generate the largest peaks seen in the DSC scans of intact antibodies. For the purposes of this analysis the temperature of the largest peak is used as the Tm of the Fab. When analyzed as a purified fragment the Fe domain used to generate all the full length IgGs has two major T, peaks at approximately 5 67 0 C and 83 0 C (Figure 10, top left panel). However, these peaks may shift slightly when intact antibodies are analyzed due to changes in conformation and stability conferred to the molecule by the Fab domain. [0653] The Fab domain of chimaeric EA2 has a relatively high Tn, of-80'C (Figure 10, top right), which is increased to ~82'C in the corresponding framework-shuffled 0 antibodies 4H5 and 4H5 corrected (Figure 10 bottom left and right panels, respectively). The modest 20C increase in the Tm for 4H5 and 4H5 corrected may reflect the fact that the starting T of chimaeric EA2 was already fairly high. The DSC scan of chimaeric B233 (Figure 11, top left) has a complex profile with the largest peak, the T, of the Fab portion, at -62 OC, significantly lower than the Fe portion of the molecule. The T of the Fab peak increases Z5 dramatically to -75 0 C in all three of the framework-shuffled antibodies 2G6, 6H 1 and 7E8 (see, Figure 11, top right and bottom left and right panels, respectively). The shift in Ti represents a significant increase in stability for each of these antibodies. [06541 The pi of an antibody can play a role in the solubility and viscosity of antibodies in solution as well as affecting the nonspecific toxicity and biodistribution. Thus, 0 for certain clinical applications there maybe an optimal pi for a antibody independent of its binding specificity. To examine the extent of pi changes in framework-shuffled antibodies the pi of the chimaeras EA2 and B233 as well as all the selected framework-shuffled antibodies were determined by native isoelectric focusing polyacrylamide gel electrophoresis WO 2006/102095 PCT/US2006/009745 (IEF-PAGE) analysis. Briefly, Pre-cast ampholine gels (Amersham Biosciences, pi range 3.5-9.5) were loaded with 8 ptg of protein. Protein samples were dialyzed in 10 mM Histidine pH-6 before loading on the gel. Broad range pi marker standards (Amersham, pi range 3-10, 8 pL) were used to determine relative pi for the Mabs. Electrophoresis was performed at 5 1500 V, 50 mA for 105 minutes. The gel was fixed for 45 minutes using a Sigma fixing solution (5x) diluted with purified water to Ix. Staining was performed overnight at room temperature using Simply Blue stain (Invitrogen). Destaining was carried out with a solution that consisted of 25% ethanol, 8% acetic acid and 67% purified water. Isoelectric points were determined using a Bio-Rad GS-800 Densitometer with Quantity One Imaging 0 Software. The results shown in Figure 12, clearly demonstrate that the pi of an antibody can be altered by framework-shuffling. The chimaeric antibody EA2 has a pi of-8.9 while the framework-shuffled 4H5 and 4H5 corrected antibodies both have a lower pi (-8.3 and -8.1, respectively). The opposite situation was seen for chimaeric B233. The pi of chimaeric B233 is -8.0, each of the framework-shuffled antibodies had an increased pi. 6H 1 has a pi 5 of -8.9, both 2G6 and 7E8 have a pi of -8.75. [0655] Interestingly, while all the framework-shuffled antibodies showed an increase in Tm, some had increased pi (the B233 derived antibodies) while others had decreased pi (the EA2 derived antibodies). Likewise, the production levels of the B233 derived antibodies did not correlate with changes in pi or Tm* 0 [0656] As detailed above, the binding properties (e.g., binding affinity), production levels, Tm and pi of antibodies can be altered by the framework-shuffle methods described. Thus, by applying the appropriate selection and/or screening criteria, one or more of these antibody properties can be altered using the framework-shuffle methods described. For example, in addition to binding specificity, framework-shuffled antibodies can be screened Z5 for those that have altered binding properties, improved production levels, a desired Tm or a certain pi. Accordingly, framework-shuffling can be used, for example, to optimize one or more properties of an antibody during the humanization process, or to optimize an existing donor antibody regardless of species of origin. Furthermore, the framework-shuffling method can be used to generate a "surrogate" antibody for use in an animal model from an 0 existing human antibody. n~ A A WO 2006/102095 PCT/US2006/009745 References Cited and Equivalents: [06571 Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. All references cited herein are incorporated herein by reference in their entireties and for all 5 purposes to the same extent as if each individual publication or patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. In addition, the following patent applications: U.S. 60/496,367, filed on August 18, 2003;U.S. 10/920,899, filed on August 18, 2004, U.S. 60/662,945 filed March 18, 2005 and U.S. 60/675,439 filed April 28, 2005 are each incorporated by reference their entirety. 0
权利要求:
Claims (14) [1] 1. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified heavy chain variable region., said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDRI, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding heavy chain framework regions; (b) introducing the plurality of polynucleotide sequences into a populations of cells and introducing into the cells a second polynucleotide sequence comprising a nucleotide sequence encoding a donor light chain variable region or a modified light chain variable region, wherein the CDRs are derived from a donor antibody light chain variable region; (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and (e) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD); stability; melting temperature (Tm); pI; and production levels wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [2] 2. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide 246 sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRi, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic aid sequences encoding light chain framework regions; (b) introducing the plurality of polynucleotide sequences into a population of cells and introducing into the cells a second polynucleotide sequence comprising a nucleotide sequence encoding a donor heavy chain variable region or a modified heavy chain variable region, wherein the CDRs are derived from a donor antibody heavy chain variable region; (c) expressing the nucleotide sequences encoding the modified light chain variable region and the heavy chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and (e) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (Ko); stability; melting temperature (Tm, 1 ); p; and production levels wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [3] 3. A method of improving one or more characteristic of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR 1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain 247 CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding heavy chain framework regions; (b) synthesizing a plurality of nucleotide sequences each comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fu sing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding light chain framework regions; (c) introducing the plurality of polynucleotide sequences generated in steps (a) and (b) into a population of cells; (d) expressing the nucleotide sequences encoding the modified heavy chain variable region and the modified light chain variable region; (e) screening for a modified antibody that immunospecifically binds to the antigen; and (f) screening for a modified antibody having one or more improved characteristics, selected from the group consisting of: equilibrium dissociation constant (KD) stability; melting temperature (Tm,); pI; and production levels wherein the improvement is between about 1% and 500%, relative to the donor antibody or is between about 2 fold and 1000 fold, relative to the donor antibody. [4] 4. The method of claim 1, 2 or 3, wherein the improved characteristic is the equilibrium dissociation constant (KD) of the antibody for an antigen, and wherein the improvement is between about 50% and 500%, relative to the donor antibody. 248 [5] 5. The method of claim 1, 2 or 3, wherein said improved characteristic is Tm, and wherein the improvement is a increase in T, of between about 5 0 C and 20C, relative to the donor antibody. [6] 6. The method of claim 1, 2 or 3, wherein said improved characteristic is pi and wherein the improvement is a increase in pI of between about 0.5 and 2.0 or a decrease in pi of between about 0.5 and 2.0, relative to the donor antibody. [7] 7. The method of claim 1, 2 or 3, wherein said improved characteristic is production levels, wherein the improvement is between about 25% and 500%, relative to the donor antibody. [8] 8. A method of improving the equilibrium dissociation constant (KD) of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding heavy chain framework regions; (b) introducing the plurality of polynucleotide sequences into a population of cells and introducing into the cells a polynucleotide sequence comprising a nucleotide sequence encoding a a donor variable light chain variable region or a modified light chain variable region, wherein the CDRs are derived from a donor antibody light chain variable region; (c) expressing the nucleotide sequences encoding the modified heavy chain variable region and the light chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and 249 (e) screening for a modified antibody having an improved equilibrium dissociation constant (KD), wherein the improvement is between about 25% and 500%, relative to the donor antibody. [9] 9. A method of improving the equilibrium dissociation constant (KD) of a donor antibody that immunospecifically binds to an antigen, said method comprising: (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDR1, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nucleic acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding light chain framework regions; (b) introducing the plurality of polynucletotide sequences into a population of cells and introducing into the cells a polynucleotide sequence comprising a nucleotide sequence encoding the donor heavy chain variable region, or modified heavy chain variable region, wherein the CDRs are derived from a donor antibody heavy chain variable region; (c) expressing the nucleotide sequences encoding the modified light chain variable region and the heavy chain variable region; (d) screening for a modified antibody that immunospecifically binds to the antigen; and (e) screening for a modified antibody having an improved equilibrium dissociation constant (KD), wherein the improvement is between about 25% and 500%, relative to the donor antibody. [10] 10. A method of improving the equilibrium dissociation constant (KD) of a donor antibody that immunospecifically binds to an antigen, said method comprising: 250 (a) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified heavy chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a heavy chain framework region 1, a nucleic acid sequence encoding a heavy chain CDR1, a nucleic acid sequence encoding a heavy chain framework region 2, a nucleic acid sequence encoding heavy chain CDR2, a nucleic acid sequence encoding a heavy chain framework region 3, a nucleic acid sequence encoding a heavy chain CDR3, and a nucleic acid sequence encoding a heavy chain framework region 4, wherein the CDRs are derived from said donor antibody heavy chain variable region that immunospecifically binds said antigen and at least one heavy chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding heavy chain framework regions; (b) synthesizing a plurality of polynucleotide sequences each comprising a nucleotide sequence encoding a modified light chain variable region, said nucleotide sequence produced by fusing together a nucleic acid sequence encoding a light chain framework region 1, a nucleic acid sequence encoding a light chain CDRi, a nucleic acid sequence encoding a light chain framework region 2, a nucleic acid sequence encoding a light chain CDR2, a nuclei acid sequence encoding a light chain framework region 3, a nucleic acid sequence encoding a light chain CDR3, and a nucleic acid sequence encoding a light chain framework region 4, wherein the CDRs are derived from said donor antibody light chain variable region that immunospecifically binds said antigen and at least one light chain framework region nucleic acid sequence is from a sub-bank comprising a plurality of nucleic acid sequences encoding light chain framework regions; (c) introducing the plurality of polynucleotide sequences generated in steps (a) and (b) into a cell; (d) expressing the nucleotide sequences encoding the modified heavy chain variable region and the modified light chain variable region; (e) screening for a modified antibody that immunospecifically binds to the antigen; and (f) screening for a modified antibody having an improved equilibrium dissociation constant (KD), wherein the improvement is between about 25% and 500%, relative to the donor antibody. 251 [11] 11. The method of any one of claims 1-10, wherein the framework region sub-bank(s) comprise framework regions from non-human framework sequences and/or framework regions from functional non-human antibody sequences. [12] 12. The method of claim 11, wherein the non-human framework sequences and/or non human antibody sequences are from non-human primates or rodents. [13] 13. The method of any one of claims 1-10, wherein the framework region sub-bank(s) comprise framework regions from human germline framework sequences and/or framework regions from functional human antibody sequences. [14] 14. An antibody produced by the method of any one of claims 1-13. 252
类似技术:
公开号 | 公开日 | 专利标题 AU2004286198B2|2010-07-08|Humanization of antibodies US20100216975A1|2010-08-26|Framework-Shuffling Of Antibodies AU2006227377B2|2013-01-31|Framework-shuffling of antibodies US20090297514A1|2009-12-03|Humanization of antibodies US20190256578A1|2019-08-22|Engineered Rabbit Antibody Variable Domains And Uses Thereof AU2013204018C1|2015-11-19|Framework-shuffling of antibodies AU2014227505A1|2014-10-09|Engineered rabbit antibody variable domains and uses thereof
同族专利:
公开号 | 公开日 AU2013204018C1|2015-11-19| AU2013204018B2|2015-07-23|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 US20050048617A1|2003-08-18|2005-03-03|Medimmune, Inc.|Humanization of antibodies| US20050042664A1|2003-08-22|2005-02-24|Medimmune, Inc.|Humanization of antibodies|
法律状态:
2015-08-27| DA2| Applications for amendment section 104|Free format text: THE NATURE OF THE AMENDMENT IS AS SHOWN IN THE STATEMENT(S) FILED 30 JUL 2015 . | 2015-11-19| DA3| Amendments made section 104|Free format text: THE NATURE OF THE AMENDMENT IS AS SHOWN IN THE STATEMENT(S) FILED 30 JUL 2015 | 2015-11-26| FGA| Letters patent sealed or granted (standard patent)| 2016-10-13| MK14| Patent ceased section 143(a) (annual fees not paid) or expired|
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 US60/662,945||2005-03-18|| US60/675,439||2005-04-28|| AU2006227377A|AU2006227377B2|2005-03-18|2006-03-17|Framework-shuffling of antibodies| AU2013204018A|AU2013204018C1|2005-03-18|2013-04-11|Framework-shuffling of antibodies|AU2013204018A| AU2013204018C1|2005-03-18|2013-04-11|Framework-shuffling of antibodies| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|