专利摘要:
Abstract: A method and compound for suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation rejection are disclosed. The compound is an antisense oligonucleotide analog compound having a targeting sequence complementary to a preprocessed CTLA-4 mRNA region identified by SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of the preprocessed mRNA of the subject. The compound is effective, when administered to a subject, to form within host cells, a heteroduplex structure (i) composed of the preprocessed CTLA-4 mRNA and the oligonucleotide compound, (ii) characterized by a Tm of dissociation of at least 450C, and (iii) resulting in an increased ratio of processed mRNA encoding ligand independent CTLA-4 to processed mRNA encoding full-length CTLA-4.
公开号:AU2013202533A1
申请号:U2013202533
申请日:2013-04-04
公开日:2013-05-16
发明作者:Patrick L. Iversen;Dan V. Mourich;Dwight D. Weller
申请人:AVI Biopharma Inc;
IPC主号:C12Q1-68
专利说明:
WO 2007/056466 PCT/US2006/043507 IIVIUNOISUPPiiESSION COMPOUND AND TREATMENT METHOD FIELD OF THE INVENTION The present invention relates to methods and antisense oligonucleotide 5 analog compounds useful in suppressing an immune response in a mammalian subject, for the treatment and/or prevention of autoimmune conditions and transplantation rejection. REFERENCES 10 Agrawal, S., S. H. Mayrand, et al. (1990). "Site-specific excision from RNA by RNase H and mixed-phosphate-backbone oligodeoxynucleotides." Proc Natl Acad Sci U S A 87(4): 1401-5. Anderson, C. M., W. Xiong, et al. (1999). "Distribution of equilibrative, nitrobenzylthioinosine-sensitive nucleoside transporters (ENTI) in brain." J 15 Neurochem 73(2): 867-73. Anderson, K. P., M. C. Fox, et al. (1996). "Inhibition of human cytomegalovirus immediate-early gene expression by an antisense oligonucleotide complementary to immediate-early RNA." Antimicrob Agents Chemother 40(9): 2004-11. 20 Bonham, M. A., S. Brown, et al. (1995). "An assessment of the antisense properties of RNase H-competent and steric-blocking oligomers." Nucleic Acids Res 23(7): 1197-203. Boudvillain, M., M. Guerin, et al. (1997). "Transplatin-modified oligo(2'-O methyl ribonucleotide)s: a new tool for selective modulation of gene expression." 25 Biochemistry 36(10): 2925-31. Ding, D., S. M. Grayaznov, et al. (1996). "An oligodeoxyribonucleotide N3'- > P5' phosphoramidate duplex forms an A-type helix in solution." Nucleic Acids Res 24(2): 354-60. Gee, J. E., I. Robbins, et al. (1998). "Assessment of high-affinity 30 hybridization, RNase H cleavage, and covalent linkage in translation arrest by antisense oligonucleotides." Antisense Nucleic Acid Drug Dev 8(2): 103-11. Hudziak, R. M., E. Barofsky, et al. (1996). "Resistance of morpholino phosphorodiamidate oligomers to enzymatic degradation." Antisense Nucleic Acid Drug Dev 6(4): 267-72. 1 WO 2007/056466 PCT/US2006/043507 Loke, S. L., C. A. Stein, et al. (1989). "Characterization of oligonucleotide transport into living cells." Proc Natl Acad Sci U S A 86(10): 3474-8. Moulton, H. M., M. C. Hase, et al. (2003). "HIV Tat peptide enhances cellular delivery of antisense morpholino oligomers." Antisense Nucleic Acid Drug 5 Dev 13(1): 31-43. Moulton, H. M. and J. D. Moulton (2003). "Peptide-assisted delivery of steric-blocking antisense oligomers." Curr Opin Mol Ther 5(2): 123-32. Moulton, H. M., M. H. Nelson, et'al. (2004). "Cellular uptake of antisense morpholino oligomers conjugated to arginine-rich peptides." Bioconjug Chem 10 15(2): 290-9. Nelson, M. H., D. A. Stein, et al. (2005). "Arginine-rich peptide conjugation to morpholino oligomers: effects on antisense activity and specificity." Bioconiuq Chem 16(4): 959-66. Pari, G. S., A. K. Field, et al. (1995). "Potent antiviral activity of an antisense 15 oligonucleotide complementary to the intron-exon boundary of human cytomegalovirus genes UL36 and UL37." Antimicrob Agents Chemother 39(5): 1157-61. Stein, D., E. Foster, et al. (1997). "A specificity comparison of four antisense types: morpholino, 2'-O-methyl RNA, DNA, and phosphorothioate DNA." Antisense 20 Nucleic Acid Drug Dev 7(3): 151-7. Summerton, J. and D. Weller (1997). "Morpholino antisense oligomers: design, preparation, and properties." Antisense Nucleic Acid Drug Dev 7(3): 187 95. Toulme, J. J., R. L. Tinevez, et al. (1996). "Targeting RNA structures by 25 antisense oligonucleotides." Biochimie 78(7): 663-73. Vijayakrishnan, L., J. M. Slavik, et al. (2004). "An autoimmune disease associated CTLA-4 splice variant lacking the B7 binding domain signals negatively in T cells." Immunity 20(5): 563-75. Wender, P. A., D. J. Mitchell, et al. (2000). "The design, synthesis, and 30 evaluation of molecules that enable or enhance cellular uptake: peptoid molecular transporters." Proc Natl Acad Sci U S A 97(24): 13003-8. Yakubov, L. A., E. A. Deeva, et al. (1989). "Mechanism of oligonucleotide uptake by cells: involvement of specific receptors " Proc Natl Acad Sci U S A 86(17): 6454-8. 2 WO 2007/056466 PCT/US2006/043507 BACKGROUND OF THE INVENTION Under normal circumstances, the immune system exhibits immune tolerance (i.e. lack of immune responsiveness) to self-antigens. Abnormalities in self-tolerance lead to immune responses against self and debilitating inflammatory 5 disorders commonly called autoimmune diseases. These include rheumatoid arthritis, type I diabetes, systemic lupus erythematosis, inflammatory bowel disease (e.g., Crohn's disease), myasthenia gravis, multiple sclerosis, among many others. Current therapy has variable success and is fraught with risks of over-immunosuppression. Therefore, there is a need for improved 10 immunosuppressive agents that are more effective in treating autoimmune disorders. More effective immunomodulatory agents, particularly those able to restore immunologic tolerance, would therefore be of great benefit. Transplantation is the current treatment of choice for end-stage heart, kidney, and liver disease. Although improved post-transplant immunosuppression 15 has led to excellent short-term allograft survival, acute rejection still occurs and long-term results remain inadequate. Moreover, sub-clinical rejection is still relatively frequent on protocol biopsies and may contribute to chronic rejection. Finally, current therapy requires life-long immunosuppression with attendant risks of infection and malignancy. 20 Therefore, there is a need for improved immunosuppressive agent that are both more effective and more specific for prevention of rejection (with less generalized immunosuppression and side-effects). The ideal therapy would consist of a finite course of treatment that would induce specific tolerance (lack of responsiveness) for the transplant, while leaving the immune system intact to 25 defend against other threats. Achieving tolerance would reduce rejection, increase long-term engraftment, and eliminate continuous immunosuppression, thereby reducing morbidity, mortality, and cost. SUMMARY OF THE INVENTION 30 The invention includes, in one aspect, an oligonucleotide analog compound for use in suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation rejection. The compound is characterized by: (i) a nuclease-resistant backbone, (ii) capable of uptake by mammalian host cells, (iii) containing between 12-40 nucleotide 3 WO 2007/056466 PCT/US2006/043507 bases, ~n'd (iv) iiing a targeting sequence of at least 12 subunits that is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. The compound is capable of 5 reacting with the preprocessed CTLA-4 mRNA in mammalian cells to form a heteroduplex complex (i) characterized by a Tm of dissociation of at least 45 0 C, and (ii) effective to increase the ratio of processed mRNA encoding ligand independent CTLA-4 to processed mRNA encoding full-length CTLA-4 in the cells. The compound may be composed of morpholino subunits linked by 10 phosphorus-containing intersubunit linkages, joining a morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit. The intersubunit linkages are phosphorodiamidate linkages, such as those having the structure: Z--P-X where Y1 =O, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to 15 bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, or alkyl amino, and where X=NR 2 , where each R is independently hydrogen or methyl. The compound may be composed of morpholino subunits linked with the uncharged linkages described above interspersed with linkages that are positively charged at physiological pH. The 20 total number of positively charged linkages is between 2 and no more than half of the total number of linkages. The positively charged linkages have the structure above, where X is 1 -piperazine. The compound may be a conjugate of the compound and an arginine-rich polypeptide effective to promote uptake of the compound into target cells. 25 Exemplary arginine rich peptide have one of the sequences identified as SEQ ID NOS:15-20. The peptide may be covalently coupled at its C terminus to the 5' end of the compound. 4 WO 2007/056466 PCT/US2006/043507 InKone eibbdiment, the targeting sequence of the compound is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 2 within the 5'-end region of exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. An exemplary targeting sequence in this embodiment is that 5 identified by SEQ ID NO: 4. In another embodiment, the targeting sequence is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 3 containing the branch site and splice acceptor site of intron 1 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. Exemplary targeting sequences are those 10 identified by SEQ ID NOS: 6 and 7. Another exemplary targeting sequence is SEQ ID NO: 5 complementary to a region of SEQ ID NO: 1 spanning the intron 1 /exon-2 junction. In another aspect, the invention includes a method of suppressing an immune response in a mammalian subject, for the treatment or prevention of an 15 autoimmune condition or transplantation rejection, by administering to the subject, a pharmaceutically effective amount of the above oligonucleotide analog compound. For the prevention of transplantation rejection in a human subject scheduled to receive a allogeneic organ transplantation, compound administration may be 20 initiated at least oone week before the scheduled transplantation. The administering may be carried out by parenteral administration, at a dose level corresponding to between about 5 to 200 mg compound/day. For the treatment of an autoimmune condition, the compound administration may be continued until a desired improvement in autoimmune condition is 25 observed. The administering may be carried out by parenteral administration, at a dose level corresponding to between about 5 to 200 mg compound/day. These and other objectives and features of the invention full be more fully appreciated when the following detailed description of the invention is read in conjunction with the accompanying drawings. 30 BRIEF DESCRIPTION OF THE FIGURES Figs. IA-1 D show the repeating subunit segment of several preferred morpholino oligonucleotides, designated A through D, constructed using subunits 5 WO 2007/056466 PCT/US2006/043507 having 5-atom (A), six-atom (B) and seven-atom (C-D) linking groups suitable for forming polymers; Figs. 2A-2G show examples of uncharged linkage types in oligonucleotide analogs. Fig. 2H shows an example of a preferred cationic linkage group; 5 Fig. 3 shows full-length, ligand-independent, and secreted splice variant forms of CTLA-4; Figs. 4A-4C show alterations produced in CTLA-4 mRNA derived from B6 and NOD splenocytes after treatment with PMOs targeting splice donor or splice acceptor sequences; 10 Fig. 5 shows an examination of the alterations made to the CTLA-4 mRNA sequence after treatment with splice altering PMOs; Fig. 6 shows the expression of CD69, an early activation marker, on mouse T cells after treatment with the muCTLA-4SA2 splice altering PMO; Fig. 7 shows the influence of CTLA-4 splice altering PMOs on T cell 15 proliferation; Fig. 8 shows that splice alterations induced by CTLA-4 splice altering PMOs affect the adhesion activity of T cells; Fig. 9 shows the impact on the onset of diabetes, as measured by elevated blood sugar, after treatment of NOD mice with CTLA-4 splice-altering PMOs. 20 Fig. I OA and I OB show the impact on the development of elevated blood sugar levels after therapeutic treatment of NOD mice with the muCTLA-4SA2 PMO. Fig. 11 shows the synthetic steps to produce subunits used to produce +PMO containing the (1-piperazino) phosphinylideneoxy cationic linkage as shown 25 in Fig. 2H. DETAILED DESCRIPTION OF THE INVENTION I. Definitions The terms below, as used herein, have the following meanings, unless 30 indicated otherwise. The terms "CTLA-4" and "CD1 52" refer to the cytotoxic T cell antigen-4, a molecule expressed primarily by T lymphocytes that is involved in regulation of the immune response and in the generation of immune tolerance (specific non responsiveness) in transplantation and autoimmunity. The outcome of T cell 6 WO 2007/056466 PCT/US2006/043507 activation is determined by signals from the antigen receptor and opposing, costimulatory signals from CD28 and inhibitory signals from CTLA-4 that are integrated by the T-cell in determining the response to antigen. The terms "immunosuppression" and "immunological tolerance" refer to the 5 formation of T cells that are conditioned, using the methods and compositions of the invention, to induce a T-cell response that suppresses antigen-specific immunity. The term "CTLA-4 mRNA isoforms" refer to the various alternatively spliced mRNA species of the CTLA-4 gene that either occur naturally or that are induced 10 using the compounds and methods of the invention. The terms "antisense oligonucleotides," "antisense oligomer," and "antisense compound" are used interchangeably and refer to a compound having a sequence of nucleotide bases and a subunit-to-subunit backbone that allows the antisense oligomer to hybridize to a target sequence in an RNA by Watson-Crick 15 base pairing, to form an RNA:oligomer heterduplex within the target sequence. The antisense oligonucleotide includes a sequence of purine and pyrimidine heterocyclic bases, supported by a backbone, which are effective to hydrogen bond to corresponding, contiguous bases in a target nucleic acid sequence. The backbone is composed of subunit backbone moieties supporting the purine and 20 pyrimidine heterocyclic bases at positions that allow such hydrogen bonding. These backbone moieties are cyclic moieties of 5 to 7 atoms in length, linked together by phosphorous-containing linkages one to three atoms long. A "morpholino" oligonucleotide refers to a polymeric molecule having a backbone which supports bases capable of hydrogen bonding to typical 25 polynucleotides, wherein the polymer lacks a pentose sugar backbone moiety, and more specifically a ribose backbone linked by phosphodiester bonds which is typical of nucleotides and nucleosides, but instead contains a ring nitrogen with coupling through the ring nitrogen. A preferred "morpholino" oligonucleotide is composed of morpholino subunit structures of the form shown in Fig. IA-1 D, 30 where (i) the structures are linked together by phosphorous-containing linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit, and (ii) Pi and Pj are purine or pyrimidine base-pairing moieties effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide. Exemplary structures for antisense oligonucleotides for 7 WO 2007/056466 PCT/US2006/043507 use'rile inventiiinclude the morpholino subunit types shown in Figs. IA-1D, with the uncharged, phosphorous-containing linkages shown in Figs. 1A-1 D, and more generally, the uncharged linkages 2A-2G. As used herein, an oligonucleotide or antisense oligomer "specifically 5 hybridizes" to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a thermal melting point (Tm) substantially greater than 37"C, preferably at least 45"C, and typically 50"C-80"C or higher. Such hybridization preferably corresponds to stringent hybridization conditions, selected to be about 10 C, and preferably about 500C lower than the Tm for the specific 10 sequence at a defined ionic strength and pH. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Polynucleotides are described as "complementary" to one another when hybridization occurs in an antiparallel configuration between two single-stranded 15 polynucleotides. A double-stranded polynucleotide can be "complementary" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second. Complementarity (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion of bases in opposing strands that are expected to form hydrogen bonds 20 with each other, according to generally accepted base-pairing rules. An antisense compound may be complementary to a target region of a target transcript even if the two base sequences are not 100% complementary, for example if they are 80% complementary or 90% complementary, as long as the heteroduplex structure formed between the compound and transcript has the desired Tm 25 stability, where the degree of complementarity required for stable hybridization would depend on the total number of bases involved, the ratio of G:C to A:T base matches, and other factors known to those of skill in the art. As used herein the term "analog" with reference to an oligomer means a substance possessing both structural and chemical properties similar to those of 30 the reference oligomer. A substantially uncharged, phosphorus containing backbone in an oligonucleotide analog is one in which a majority of the subunit linkages, e.g., between 50-100%, are uncharged at physiological pH, and contain a single phosphorous atom. The analog contains between 12 and 40 subunits, typically 8 WO 2007/056466 PCT/US2006/043507 1 15-25 IiI s ,. and preferably about 18 to 25 subunits. The analog may have exact sequence complementarity to the target sequence or near complementarity, as defined above. A "subunit" of an oligonucleotide analog refers to one nucleotide (or 5 nucleotide analog) unit of the analog. The term may refer to the nucleotide unit with or without the attached intersubunit linkage, although, when referring to a "charged subunit", the charge typically resides within the intersubunit linkage (e.g. a phosphate or phosphorothioate linkage). A preferred morpholino oligomer is a phosphorodiamidate-linked morpholino 10 oligomer, referred to herein as a PMO. Such oligomers are composed of . morpholino subunit structures such as shown in Fig. 28, where X=NH2, NHR, or NR2 (where R is lower alkyl, preferably methyl), Y=O, and Z=O, and Pi and Pj are purine or pyrimidine base-pairing moieties effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, as seen in Fig. 2G. Also preferred 15 are morpholino oligomers where the phosphordiamidate linkages are uncharged linkages as shown in Fig 2G interspersed with cationic linkages as shown in Fig. 2H where, in Fig. 2B, X = 1-piperazino. In another Fig. 2B embodiment, X = lower alkoxy, such as methoxy or ethoxy, Y=NH or NR, where R is lower alkyl, and Z=O. As used herein, a first sequence is an "antisense sequence" or "targeting 20 sequence" with respect to a second sequence or "target sequence" if a polynucleotide whose sequence is the first sequence specifically binds to, or specifically hybridizes with, the second polynucleotide sequence under physiological conditions. As used herein, "effective amount" relative to an antisense oligomer refers 25 to the amount of antisense oligomer administered to a subject, either as a single dose or as part of a series of doses that is effective to inhibit expression of a selected target nucleic acid sequence. 11. Antisense compound for targeting T cells 30 A. Antisense compound Antisense oligomers for use in practicing the invention preferably have the following properties: (1) a backbone that is substantially uncharged, (2) the ability to hybridize with the complementary sequence of a target RNA with high affinity, that is a Tm substantially greater than 37C, preferably at least 4500, and typically 9 WO 2007/056466 PCT/US2006/043507 greater than 50 0 C, e.g., 60OC-80 0 C or higher, (3) a subunit length of at least 8 bases, generally about 8-40 bases, preferably 12-25 bases, and (4) nuclease resistance (Hudziak, Barofsky et al. 1996). In addition, the antisense compound may have the capability for active or facilitated transport as evidenced by (i) 5 competitive binding with a phosphorothioate antisense oligomer, and/or (ii) the ability to transport a detectable reporter into target cells. Candidate antisense oligomers may be evaluated, according to well known methods, for acute and chronic cellular toxicity, such as the effect on protein and DNA synthesis as measured via incorporation of 3H-leucine and 3H-thymidine, 10 respectively. In addition, various control oligonucleotides, e.g., control oligonucleotides such as sense, nonsense or scrambled antisense sequences, or sequences containing mismatched bases, in order to confirm the specificity of binding of candidate antisense oligomers. The outcome of such tests is important in discerning specific effects of antisense inhibition of gene expression from 15 indiscriminate suppression. Accordingly, sequences may be modified as needed to limit non-specific binding of antisense oligomers to non-target nucleic acid sequences. Heteroduplex formation 20 The effectiveness of a given antisense oligomer molecule in forming a heteroduplex with the target mRNA may be determined by screening methods known in the art. For example, the oligomer is incubated in a cell culture containing an mRNA preferentially expressed in activated lymphocytes, and the effect on the target mRNA is evaluated by monitoring the presence or absence of 25 (1) heteroduplex formation with the target sequence and non-target sequences using procedures known to those of skill in the art, (2) the amount of the target mRNA expressed by activated lymphocytes, as determined by standard techniques such as RT-PCR or Northern blot, (3) the amount of protein transcribed from the target mRNA, as determined by standard techniques such as ELISA or 30 Western blotting. (See, for example, (Pari, Field et al. 1995; Anderson, Fox et al. 1996). For the purposes of the invention, a preferred test for the effectiveness of the CTLA-4 antisense oligomer is by measuring CTLA-4 mRNA isoform expression in mature T cells treated with the antisense CTLA-4 oligomer. 10 WO 2007/056466 PCT/US2006/043507 Uptake into cells A second test measures cell transport, by examining the ability of the test compound to transport a labeled reporter, e.g., a fluorescence reporter, into cells. The cells are incubated in the presence of labeled test compound, added at a final 5 concentration between about 10-300 nM. After incubation for 30-120 minutes, the cells are examined, e.g., by microscopy or FACS analysis, for intracellular label. The presence of significant intracellular label is evidence that the test compound is transported by facilitated or active transport. In one embodiment of the invention, uptake into cells is enhanced by 10 administering the antisense compound in combination with an arginine-rich peptide linked to the 5' or 3' end of the antisense oligomer. The peptide is typically 8-16 amino acids and consists of a mixture of arginine, and other amino acids including phenylalanine, cysteine, 6-aminohexanoic acid (Ahx) and beta-alanine (PAla) as discussed further below. Exemplary arginine-rich peptides are listed as SEQ ID 15 NOs: 15-20. RNAse resistance Two general mechanisms have been proposed to account for inhibition of expression by antisense oligonucleotides (Agrawal, Mayrand et al. 1990; Bonham, 20 Brown et al. 1995; Boudvillain, Guerin et al. 1997). In the first, a heteroduplex formed between the oligonucleotide and the viral RNA acts as a substrate for RNaseH, leading to cleavage of the RNA. Oligonucleotides belonging, or proposed to belong, to this class include phosphorothioates, phosphotriesters, and phosphodiesters (unmodified "natural" oligonucleotides). Such compounds 25 expose the RNA in an oligomer:RNA duplex structure to hydrolysis by RNaseH, and therefore loss of function. A second class of oligonucleotide analogs, termed "steric blockers" or, alternatively, "RNaseH inactive" or "RNaseH resistant", have not been observed to act as a substrate for RNaseH, and act by sterically blocking target RNA 30 nucleocytoplasmic transport, splicing, translation, or replication. This class includes methylphosphonates (Toulme, Tinevez et al. 1996), morpholino oligonucleotides, peptide nucleic acids (PNA's), certain 2'-O-allyl or 2'-O-alkyl modified oligonucleotides (Bonham, Brown et al. 1995), and N3'->P5' phosphoramidates (Ding, Grayaznov et al. 1996; Gee, Robbins et al. 1998). 11 WO 2007/056466 PCT/US2006/043507 Aiest oligom er can be assayed for its RNaseH resistance by forming an RNA:oligomer duplex with the test compound, then incubating the duplex with RNaseH under a standard assay conditions, as described (Stein, Foster et al. 1997). After exposure to RNaseH, the presence or absence of intact duplex can 5 be monitored by gel electrophoresis or mass spectrometry. In vivo uptake In accordance with another aspect of the invention, there is provided a simple, rapid test for confirming that a given antisense oligomer type provides the 10 required characteristics noted above, namely, high Tm, ability to be actively taken up by the host cells, and substantial resistance to RNaseH. This method is based on the discovery that a properly designed antisense compound will form a stable heteroduplex with the complementary portion of the CD86 preprocessed or processed RNA target when administered to a mammalian subject, and the 15 heteroduplex subsequently appears in the urine (or other body fluid). Details of this method are also given in co-owned U.S. Patent No. 6,365,351 for "Non Invasive Method for Detecting Target RNA," the disclosure of which is incorporated herein by reference. Briefly, a test oligomer containing a backbone to be evaluated, having a 20 base sequence targeted against a known RNA, is injected into a mammalian subject. The antisense oligomer may be directed against any intracellular RNA, including RNA encoded by a host gene. Several hours (typically 8-72) after administration, the urine is assayed for the presence of the antisense-RNA heteroduplex. If the heteroduplex is detected, the backbone is suitable for use in 25 the antisense oligomers of the present invention. The test oligomer may be labeled, e.g. by a fluorescent or a radioactive tag, to facilitate subsequent analyses, if it is appropriate for the mammalian subject. The assay can be in any suitable solid-phase or fluid format. Generally, a solid phase assay involves first binding the heteroduplex analyte to a solid-phase 30 support, e.g., particles or a polymer or test-strip substrate, and detecting the presence/amount of heteroduplex bound. In a fluid-phase assay, the analyte sample is typically pretreated to remove interfering sample components. If the oligomer is labeled, the presence of the heteroduplex is confirmed by detecting the label tags. For non-labeled compounds, the heteroduplex may be detected by 12 WO 2007/056466 PCT/US2006/043507 immunoassay if in solid phase format or by mass spectroscopy or other known methods if in solution or suspension format. Structural features 5 As detailed above, the antisense oligomer has a base sequence directed to a targeted portion of a cellular gene, preferably the region at or adjacent to a splice site junction of the CTLA-4 mRNA or preprocessed transcript. In addition, the oligomer is able to effectively inhibit expression of the targeted gene when administered to a host cell, e.g. in a mammalian subject. This requirement is met 10 when the oligomer compound (a) has the ability to be taken up by T cells and (b) once taken up, form a duplex with the target RNA with a Tm greater than about 45 0 C; preferably greater than 50 0 C. The ability to be taken up selectively by T cells requires, in part, that the oligomer backbone be substantially uncharged. The ability of the oligomer to form 15 a stable duplex with the target RNA will depend on the oligomer backbone, the length and degree of complementarity of the antisense oligomer with respect to the target, the ratio of G:C to A:T base matches, and the positions of any mismatched bases. The ability of the antisense oligomer to resist cellular nucleases promotes survival and ultimate delivery of the agent to the cell cytoplasm and/or nucleus. 20 Antisense oligonucleotides of 15-20 bases are generally long enough to have one complementary sequence in the mammalian genome. In addition, antisense compounds having a length of at least 12, typically at least 15 nucleotides in length hybridize well with their target mRNA. Due to their hydrophobicity, antisense oligonucleotides tend to interact well with phospholipid 25 membranes, and it has been suggested that following the interaction with the cellular plasma membrane, oligonucleotides are actively transported into living cells (Loke, Stein et al. 1989; Yakubov, Deeva et al. 1989; Anderson, Xiong et al. 1999). Oligomers as long as 40 bases may be suitable, where at least a minimum 30 number of bases, e.g., 12 bases, are complementary to the target sequence. In general, however, facilitated or active uptake in cells is optimized at oligomer lengths less than about 30, preferably less than 25. For PMO oligomers, described further below, an optimum balance of binding stability and uptake generally occurs at lengths of 15-22 bases. 13 WO 2007/056466 PCT/US2006/043507 Morpholino oligonucleotides, particularly phosphoramidate- or phosphorodiamidate-linked morpholino oligonucleotides have been shown to have high binding affinities for complementary or near-complementary nucleic acids. Morpholino oligomers also exhibit little or no non-specific antisense activity, afford 5 good water solubility, are immune to nucleases, and are designed to have low production costs (Summerton and Weller 1997). Morpholino oligonucleotides (including antisense oligomers) are detailed, for example, in co-owned U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185, 444, 5,521,063, and 5,506,337, all of which are 10 expressly incorporated by reference herein In one preferred approach, antisense oligomers for use in practicing the invention are composed of morpholino subunits of the form shown in the above cited patents, where (i) the morpholino groups are linked together by uncharged linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to 15 the 5' exocyclic carbon of an adjacent subunit, and (ii) the base attached to the morpholino group is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide. The purine or pyrimidine base-pairing moiety is typically adenine, cytosine, guanine, uracil, thymine or inosine. Preparation of such oligomers is described in detail in U.S. 20 Patent No. 5,185,444 (Summerton et al., 1993), which is hereby incorporated by reference in its entirety. As shown in this reference, several types of nonionic linkages may be used to construct a morpholino backbone. The antisense activity of the oligomer may be enhanced by using a mixture of uncharged and cationic phosphorodiamidate linkages as shown in Figures 2G 25 and 2H. The total number of cationic linkages in the oligomer can vary from 1 to 10, and be interspersed throughout the oligomer. Preferably the number of charged linkages is at least 2 and no more than half the total backbone linkages, e.g., between 2-8 positively charged linkages, and preferably each charged linkages is separated along the backbone by at least one, preferably at least two 30 uncharged linkages. The antisense activity of various oligomers can be measured in vitro by fusing the oligomer target region to the 5' end a reporter gene (e.g. firefly luciferase) and then measuring the inhibition of translation of the fusion gene mRNA transcripts in cell free translation assays. The inhibitory properties of 14 WO 2007/056466 PCT/US2006/043507 oligomers containing a mixture of uncharged and cationic linkages can be enhanced between, approximately, five to 100 fold in cell free translation assays. Exemplary subunit structures for antisense oligonucleotides of the invention include the morpholino subunit types shown in Figs. 1A-D, each linked by an 5 uncharged, phosphorous-containing subunit linkage, also shown in Figs. 1A-1D. In these figures, the X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures. Alkyl, alkoxy and thioalkoxy 10 preferably include 1-6 carbon atoms, and more preferably 1-4 carbon atoms. Monosubstituted or disubstituted nitrogen preferably refers to lower alkyl substitution, and the cyclic structures are preferably 5- to 7-membered nitrogen heterocycles optionally containing 1-2 additional heteroatoms selected from oxygen, nitrogen, and sulfur. Z is sulfur or oxygen, and is preferably oxygen. 15 Fig. IA shows a phosphorous-containing linkage which forms the five atom repeating-unit backbone shown in Fig. 1A, where the morpholino rings are linked by a 1-atom phosphoamide linkage. Subunit B in Fig. 1 B is designed for 6-atom repeating-unit backbones, as shown in Fig. 1 B. In Fig. 1 B, the atom Y linking the 5' morpholino carbon to the phosphorous group may be sulfur, nitrogen, carbon or, 20 preferably, oxygen. The X moiety pendant from the phosphorous may be any of the following: fluorine; an alkyl or substituted alkyl; an alkoxy or substituted alkoxy; a thioalkoxy or substituted thioalkoxy; or, an unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures. Z is sulfur or oxygen, and is preferably oxygen. Particularly preferred morpholino oligonucleotides include 25 those composed of morpholino subunit structures of the form shown in Fig. 1 B, where X is an amine or alkyl amine of the form X=NR 2 , where R is independently H or CH 3 , that is where X=NH 2 , X=NHCH 3 or X=N(CH 3
)
2 , Y=O, and Z=O. Subunits C-D in Figs. 1 C-D are designed for 7-atom unit-length backbones as shown for structures in Figs. 1 C and 1 D. In Structure C, the X moiety is as in 30 Structure B, and the moiety Y may be methylene, sulfur, or preferably oxygen. In Structure D, the X and Y moieties are as in Structure B. In all subunits depicted in Figs. 1 and 2, each Pi and Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, 15 WO 2007/056466 PCT/US2006/043507 and is preferably selected from adenine, cytosine, guanine, thymine, inosine and uracil. As noted above, the substantially uncharged oligomer may advantageously include a limited number of charged backbone linkages. One example of a 5 cationic charged phophordiamidate linkage is shown in Fig. 2H. This linkage, in which the dimethylamino group shown in Fig 2G is replaced by a 1-piperazino group as shown in Fig. 2H, can be substituted for any linkage(s) in the oligomer. By including between two to eight such cationic linkages, and more generally, at least two and no more than about half the total number of linkages, interspersed 10 along the backbone of the otherwise uncharged oligomer, antisense activity can be enhanced without a significant loss of specificity. The charged linkages are preferably separated in the backbone by at least 1 and preferably 2 or more uncharged linkages. More generally, oligomers with uncharged backbones are shown in Figs. 15 2A-2G. Especially preferred is a substantially uncharged morpholino oligomer such as illustrated by the phosphorodiamidate morpholino oligomer (PMO) shown in Fig. 2G. It will be appreciated that a substantially uncharged backbone may include one or more, e.g., up to 10-20% of charged intersubunit linkages, typically negatively charged phosphorous linkages. An example of a cationic linkage is 20 shown in Fig. 2H, wherein the nitrogen pendant to the phosphate atom in the linkage of Fig 2G is replaced with a 1-piperazino structure. The method for synthesizing the 1 -piperazino group linkages is described below with respect to Fig. 11. 25 Antisense sequence In the methods of the invention, the antisense oligomer is designed to hybridize to a region of the target nucleic acid sequence, under physiological conditions with a Tm substantially greater than 370C, e.g., at least 450C and preferably 60 C-80'C, wherein the target nucleic acid sequence is a processed or 30 preprocessed mRNA preferentially expressed in T cells. The oligomer is designed to have high-binding affinity to the target nucleic acid sequence and may be 100% complementary thereto, or may include mismatches, e.g., to accommodate allelic variants, as long as the heteroduplex formed between the oligomer and the target nucleic acid sequence is sufficiently stable to withstand the action of cellular 16 WO 2007/056466 PCT/US2006/043507 ncIase's and other modes of degradation during its transit from cell to body fluid. Mismatches, if present, are less destabilizing toward the end regions of the hybrid duplex than in the middle. The number of mismatches allowed will depend on the length of the oligomer, the percentage of G:C base pair in the duplex and the 5 position of the mismatch(es) in the duplex, according to well understood principles of duplex stability. Although such an antisense oligomer is not necessarily 100% complementary to a nucleic acid sequence that is preferentially expressed in T cells, it is effective to stably and specifically bind to the target sequence such that 10 expression of the target sequence is modulated. The appropriate length of the oligomer to allow stable, effective binding combined with good specificity is about 8-40 nucleotide base units, and preferably about 12-25 nucleotides. Oligomer bases that allow degenerate base pairing with target bases are also contemplated, assuming base-pair specificity with the target is maintained. 15 The antisense compounds for use in practicing the invention can be synthesized by stepwise solid-phase synthesis, employing methods detailed in the references cited above. The sequence of subunit additions will be determined by the selected base sequence. In some cases, it may be desirable to add additional chemical moieties to the oligomer compounds, e.g. to enhance the 20 pharmacokinetics of the compound or to facilitate capture or detection of the compound. Such a moiety may be covalently attached, typically to the 5'- or 3' end of the oligomer, according to standard synthesis methods. For example, addition of a polyethyleneglycol moiety or other hydrophilic polymer, e.g., one having 10-100 polymer subunits, may be useful in enhancing solubility. One or 25 more charged groups, e.g., anionic charged groups such as an organic acid, may enhance cell uptake. A reporter moiety, such as fluorescein or a radiolabeled group, may be attached for purposes of detection. Alternatively, the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin. 30 In selecting a moiety for attachment or modification of an oligomer antisense, it is generally of course desirable to select chemical compounds of groups that are biocompatible and likely to be tolerated by cells in vitro or in vivo without undesirable side effects. 17 WO 2007/056466 PCT/US2006/043507 B. Arginine-rich polypeptide moiety The use of arginine-rich peptide sequences conjugated to uncharged antisense compounds, e.g., PMO, has been shown to enhance cellular uptake in a variety of cells (Wender, Mitchell et a/. 2000; Moulton, Hase et al. 2003; Moulton 5 and Moulton 2003; Moulton, Nelson et al. 2004; Nelson, Stein et al. 2005) (Iversen, Moulton et al. US Patent Application No. 60/466,703, now U.S. publication number 2004/0265879 Al, published Dec 30, 2004, all of which are incorporated herein by reference. In one embodiment of the invention, the antisense compound is covalently 10 linked at its 3' or 5' end to an arginine rich-peptide effective to enhance uptake of the compound into T cells relative to uptake in the absence of the peptide. The arginine-rich peptide is detailed in the above references to Moulton et al., and described in U.S. publication number 2004/0265879 Al. Preferably, the peptide is composed of d-amino acids, I-amino acids, non-natural amino acids or a 15 combination thereof. Exemplary arginine-rich peptides include those identified by SEQ ID NOS: 15-20, of which those identified as SEQ ID NOS: 16 and 17 are preferred. The transport peptide may significantly enhance cell entry of attached uncharged oligomer compounds, relative to uptake of the compound in the 20 absence of the attached transport moiety. Uptake is preferably enhanced at least twenty fold, and more preferably forty fold, relative to the unconjugated compound. A further benefit of the transport moiety is its expected ability to stabilize a duplex between an antisense oligomer and its target nucleic acid sequence, presumably by virtue of electrostatic interaction between the positively charged 25 transport moiety and the negatively charged nucleic acid. The number of charged subunits in the transporter is less than 14, as noted above, and preferably between 4 and 11, since too high a number of charged subunits may lead to a reduction in sequence specificity. The transport moiety may also lower the effective concentration of an 30 antisense oligomer to achieve antisense activity as measured in both tissue culture and cell-free systems. Cell-free translation systems provide an independent means to assess the enhanced effect of the transport moiety on the antisense oligomer's ability to bind to its target and, through steric blocking, inhibit translation of downstream sequences. 18 WO 2007/056466 PCT/US2006/043507 Ill. Targeting and antisense sequences Previous evidence suggests that CTLA-4 expression could only be augmented by full-scale T cell activation and initiation of the T cell into the cell cycle. The current invention is based upon the finding that CTLA-4 activity can be 5 modulated in naive and activated T cells by manipulating the relative ratios of specific spliced mRNA isoforms of the CTLA-4 gene to increase immunosuppression and immunologic tolerance. More specifically, it has been discovered that administration of an antisense compound that targets the splice region between intron-1 and exon-2 shifts the ratios of CTLA-4 mRNAs and CTLA 10 4 proteins from full length to ligand-independent forms, and that this shift is effective in treating an autoimmune condition or transplantation rejection, and in reducing the risk of transplantation rejection, on pretreating the subject prior to the transplantation operation. Fig. 3 shows various splice variant isoforms of CTLA-4. As seen, the CTLA 15 gene has four exon, designated exons 1-4, with an intron separating each exon pair. The introns are designatred 1-3, where intron-1 is the intervening sequence between exons 1 and 2, intron-2, between exons 2 and 3, and intron-3, between exons 3 and 4. As shown, the full length CTLA isoform is encoded by all four exons, requiring excision of all three introns and preservation of all four exons. A 20 ligand-independent form is of CTLA-4 is formed from exons 1, 3 and 4, requiring excision of intron 1 and adjacent exon 2, and introns 3 and 4. A secreted form of CTLA-4 is formed of exons 1, 2, and 4, requiring excision of intron 1, and a contiguous section of preprocessed mRNA containing intron 2, exon 3 and intron 3. 25 In one general embodiment of the invention, the antisense compound used in the method of the invention has a base sequence that is complementary having a targeting sequence of at least 12 subunits that is complementary to at least 12 subunits of a target sequence identified by identified by SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of preprocessed T cell antigen-4 30 (CTLA-4) mRNA of the subject, e.g., human CTLA-4 antigen mRNA. One exemplary antisense sequence is SEQ ID NO: 5 complementary to a junction spanning portion of the target sequence. In one embodiment, the antisense compound has a base sequence that is complementary to at least 12 subunits of a target sequence identified by SEQ ID 19 WO 2007/056466 PCT/US2006/043507 NO: 2 within th6' "end region of exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. One exemplary antisense sequence targeting this exon sequence is SEQ ID NO: 4. In another embodiment, the antisense compound has a base sequence that 5 is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 3 within the 3'-end region of intron 1, including the intron's branch point site. Exemplary antisense sequences targeting the intron's branch point site and 3'-end sequence are sequences identified by SEQ ID NOS: 6 and 7, respectively. However, other regions of the CTLA-4 mRNA may be targeted, including 10 one or more of, an initiator or promoter site, a 3'-untranslated region, and a 5' untranslated region. Both spliced and unspliced, preprocessed RNA may serve as the template for design of antisense oligomers for use in the methods of the invention. 15 IV. Treating transplantation rejection and autoimmune disorder By manipulating the immune system's normal mechanism for the generation of immune tolerance to self antigens, the present invention provides a method and composition that alters the function and activity of T cells in a way that is advantageous in the treatment of transplantation rejection or autoimmune 20 disorders, such as multiple sclerosis, lupis, myathenia gravis, inflammatory bowel disease and rheumatoid arthritis. By employing an antisense oligomer against CTLA-4 (e.g., SEQ ID NOS: 4 7), the present invention provides a means to alter T cell activation in response to an antigen presented by a mature dendritic cell. This allows the generation of a 25 tolerized T cell population responding to transplanted tissue, when chronically activated as in an autoimmune condition, or by an immunogenic therapeutic protein. The generation of tolerized, anergic T-cells using the compounds and methods of the invention also provides a long-lasting tolerance that has a variety 30 of therapeutic advantages. A. CTLA-4 splice-alterinq antisense olicomers Exemplary target and targeting sequences for the CD1 52 (CTLA-4) gene are listed below in Table 1 and Table 2, respectively. The human CTLA-4 mRNA, 20 WO 2007/056466 PCT/US2006/043507 splice junction (sj), exon (ex), branch point (bp) and intron (in) target and targeting sequences are noted with "hu" and derived from Genbank Accession No. AF411058. The murine CTLA-4 (CD152) sequences are noted with "mu" and are derived from Genbank Accession No. AF142145. The "/" symbol indicates within 5 the target sequences the intron 1 / exon 2 splice site. Table 1. Exemplary CTLA-4 Target Sequences Oligomer Target Sequence (5' to 3') Sp. Net. Range SEQ ID NO. huCTLA-4SA2sj GCATGAGTTCACTGAGTTCCCTTTGGCTTTT hu 87108- 1 CCATGCTAG/CAATGCACGTGGCCCAGCCTG 87207 CTGTGGTACTGGCCAGCAGCCGAGGCATCGC CAGCTTTG huCTLA-4SA2ex /CAATGCACGTGGCCCAGCCTGCTGTGGTAC hu 87148- 2 TGGCCAGCAGCCGAGGCATCGCCAGCTTTG 87207 huCTLA-4SA2in GCATGAGTTCACTGAGTTCCCTTTGGCTTTT hu 87108- 3 CCATGCTAG/ 87147 muCTLA-4SA2sj TCATGAGCCCACTAAGTGCCCTTTGGACTTT mu 4262-4361 8 CCATGTCAG/CCATACAGGTGACCCAACCTT CAGTGGTGTTGGCTAGCAGCCATGGTGTCGC CAGCTTTC muCTLA-4SA2ex /CCATACAGGTGACCCAACCTTCAGTGGTGT mu 4302-4361 9 TGGCTAGCAGCCATGGTGTCGCCAGCTTTC muCTLA-4SA2in TCATGAGCCCACTAAGTGCCCTTTGGACTTT mu 4262-4301 10 CCATGTCAG/ 10 Table 2. Exemplary CTLA-4 Targeting Sequences Oligomer Target Sequence (5' to 3') Sp. SEQ ID NO. huCTLA-4SA2ex GCA GGC TGG GCC ACG TGC ATT G hu 4 huCTLA-4SA2sj CAC GTG CAT TGC TAG CAT GG hu 5 huCTLA-4SA2bp CTA GCA TGG AAA AGC CAA AG hu 6 huCTLA-4SA2in GGA ACT CAG TGA ACT CAT GC hu 7 muCTLA-4SA2 GGT TGG GTC ACC TGT ATG G mu 11 muCTLA-4SA3 CCG GGC ATG GTT CTG GAT C mu 12 muCTLA-4SD2 GTA AGG CGG TGG GTA CAT G mu 13 muCTLA-4SD3 CAT CTT GCT CAA AGA AAC AG mu 14 21 WO 2007/056466 PCT/US2006/043507 B. Treatment methods In one aspect, the invention is directed to methods of inducing immunological tolerance in vivo in a patient, by administering to the patient a therapeutically effective amount of a peptide-conjugated CTLA-4 PMO 5 pharmaceutical composition, as described herein, e.g., a pharmaceutical composition comprising an antisense oligomer complementary to a region of SEQ ID NO: 1, as detailed above. In one embodiment, a subject is in need of tolerized T cells when responding to an allogeneic transplantation. In this embodiment, a CTLA-4 10 antisense compound is administered to the subject in a manner effective to result in blocking the formation of activated T cells. Typically, the patient is treated with the conjugate shortly before, e.g., a few days before, receiving the transplant, then treated periodically, e.g., once every 14 days, until immunological tolerance is established. Immunological tolerance can be monitored during treatment by 15 testing patient T cells for reactivity with donor MHC antigens in a standard in vitro test, as detailed below. For the treatment of an autoimmune disorder, such as multiple sclerosis, lupis, myathenia gravis, inflammatory bowel disease and rheumatoid arthritis, the patient is given an initial single dose of the CTLA-4 antisense conjugate, then 20 additional doses on a periodic basis, e.g., every 3-14 days, until improvement in the disorder is observed. As above, development of immunological tolerance can be monitored during treatment by testing T cells from a blood sample for their ability to react with a selected, relevant antigen in vitro. It will be understood that in vivo administration of such a CTLA-4 antisense 25 compound is dependent upon, (1) the duration, dose and frequency of antisense administration, and (2) the general condition of the subject. A suitable dose can be approximated from animal model studies and extrapolated to patient weight. Typically, one or more doses of CTLA-4 antisense oligomer are administered, generally at regular intervals for a period of about one to two weeks. 30 Preferred doses for oral administration are from about 5 mg oligomer/patient to about 250 mg oligomer/patient (based on an adult weight of 70 kg). In some cases, doses of greater than 250 mg oligomer/patient may be necessary. For parenteral administration, including intravenous, the preferred doses are from 22 WO 2007/056466 PCT/US2006/043507 about 5 mg oligomer/patient to about 200 mg oligomer/patient (based on an adult weight of 70 kg). The antisense agent is generally administered in an amount sufficient to result in a peak blood concentration of at least 200-400 nM antisense oligomer. 5 In general, the method comprises administering to a subject, in a suitable pharmaceutical carrier, an amount of a CTLA-4 morpholino antisense oligomer effective to alter expression of CTLA-4 mRNA isoforms. Effective delivery of an antisense oligomer to the target nucleic acid is an important aspect of the methods described herein. In accordance with the 10 invention, such routes of antisense oligomer delivery include, but are not limited to, inhalation; transdermal delivery; various systemic routes, including oral and parenteral routes, e.g., intravenous, subcutaneous, intraperitoneal, or intramuscular delivery. It is appreciated that any methods which are effective to deliver a CTLA-4 15 PMO to the cells of an allogeneic transplant or to introduce the agent into the bloodstream are also contemplated. In preferred applications of the method, the subject is a human subject and the methods of the invention are applicable to treatment of any condition wherein either promoting immunological tolerance or enhancing immune activation would 20 be effective to result in an improved therapeutic outcome for the subject under treatment. It will be understood that an effective in vivo treatment regimen using a CTLA-4 PMO in the methods of the invention will vary according to the frequency and route of administration as well as the condition of the subject under treatment. 25 Accordingly, such in vivo therapy will generally require monitoring by tests appropriate to the condition being treated and a corresponding adjustment in the dose or treatment regimen in order to achieve an optimal therapeutic outcome. C. Administration of CTLA-4 Antisense Oligomers 30 Transdermal delivery of an antisense oligomer may be accomplished by use of a pharmaceutically acceptable carrier. One example of morpholino oligomer delivery is described in PCT patent application WO 97/40854, incorporated herein by reference. 23 WO 2007/056466 PCT/US2006/043507 In one preferred embodiment, the oligomer is an anti-CTLA-4 morpholino oligomer, contained in a pharmaceutically acceptable carrier, and delivered orally. In a further aspect of this embodiment, the antisense oligomer is administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, 5 in some cases the antisense oligomer is administered intermittently over a longer period of time. It follows that a morpholino antisense oligonucleotide composition may be administered in any convenient vehicle, which is physiologically acceptable. Such an oligonucleotide composition may include any of a variety of standard 10 pharmaceutically accepted carriers employed by those of ordinary skill in the art. Examples of such pharmaceutical carriers include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions such as oil/water emulsions, triglyceride emulsions, wetting agents, tablets and capsules. It will be understood that the choice of suitable physiologically acceptable carrier 15 will vary dependent upon the chosen mode of administration. In some instances liposomes may be employed to facilitate uptake of an antisense oligonucleotide into cells. (See, e.g., Williams, 1996; Lappalainen, et al., 1994; Uhlmann, et al., 1990; Gregoriadis, 1979.) Hydrogels may also be used as vehicles for antisense oligomer administration, for example, as described in WO 20 93/01286. Alternatively, an oligonucleotide may be administered in microspheres or microparticles. (See, e.g., Wu et al., 1987). Sustained release compositions are also contemplated within the scope of this application. These may include semipermeable polymeric matrices in the form of shaped articles such as films or microcapsules. 25 D. Monitoring Treatment The efficacy of a given therapeutic regimen involving the methods described herein, may be monitored, e.g., by conventional FACS assays for the phenotype of cells in the circulation of the subject under treatment or cells in 30 culture. Such analysis is useful to monitor changes in the numbers of cells of various lineages, in particular, activated T and B cells in response to an allogeneic transplant. Phenotypic analysis is generally carried out using monoclonal antibodies specific to the cell type being analyzed. The use of monoclonal antibodies in such 24 WO 2007/056466 PCT/US2006/043507 phenotypic analyses is routinely employed by those of skill in the art for cellular analyses and monoclonal antibodies specific to particular cell types are commercially available. The CTLA-4 PMO treatment regimen may be adjusted (dose, frequency, 5 route, etc.), as indicated, based on the results of the phenotypic and biological assays described above. From the foregoing, it will be appreciated how various objects and features of the invention are met. The specific blockade of activating T cells capable of rejecting transplanted tissues or involved in an autoimmune disorder is an 10 important therapy for numerous human diseases where immunological tolerance is beneficial. The present invention provides a method of specifically blocking the activation of these cells through the use of antisense oligomers designed to inhibit CTLA-4 expression, or enhance expression of specific CTLA-4 isoforms, during the stage of antigen-specific activation and the generation of anergic, tolerized T 15 cells. Antisense CTLA-4 mediated suppression of either chronically activated T cells (i.e. autoimmunity) or naive T cells responding to alloantigens (transplantation) provides a potent and specific therapeutic effect. Additionally, this treatment method is long lived because the immune system is unable to replenish antigen-specific T cell clones once the precursor 20 population is removed from the T cell repertoire. In addition, by specifically targeting the antisense CTLA-4 oligomer to activated T cells, naive T cells would be unaffected, allowing for the patient to respond normally to foreign antigens as soon as the therapy is withdrawn. Moreover, the immune status of the patient prior to the antisense CTLA-4 therapy (e.g. immunity provided by previous 25 vaccinations or infections) would remain intact. EXAMPLES The following examples are presented to further illustrate and explain the present invention and should not be taken as limiting in any regard. The examples 30 provide evidence that treatment with a particular CTLA-4 splice altering PMO will enhance the corresponding CTLA-4 mRNA isoform expression in T cells. These effects appear specific, occurring without upregulation of other activation markers. 25 WO 2007/056466 PCT/US2006/043507 A model has been established whereby murine splenocytes or purified T cells can be treated with the CTLA-4 slice altering PMOs in vitro. A several-fold increase in CTLA-4 mRNA isoform levels is observed within 24 hours. An in vivo animal model system using the non-obese diabetic (NOD) mouse 5 has also been used to investigate the ability of the CTLA-4 splice altering PMOs to alter the course of onset of type 1 diabetes (T1 D). The NOD mouse is a widely used animal model system for T1 D. The compounds of the invention (muCTLA 4SA2; SEQ ID NO:I 1) are shown to delay onset of T1 D in either a prophylactic or therapeutic treatment regimen. 10 Materials and Methods Phosphorodiamidate morpholino oligomers (PMO) are water-soluble antisense molecules that inhibit or alter gene expression by preventing translation or disrupting mRNA splicing. Murine CTLA-4 antisense PMOs are based on the 15 genomic murine CTLA-4 sequence from GenBank (accession number AF142145) and synthesized by AVI BioPharma's (Corvallis, OR) chemistry group according to previously disclosed methods (Summerton and Weller 1997). A hydrogen is conjugated on the 3' end to each PMO along with the arginine-rich peptide P007 (pip-PDA) (SEQ ID NO:16) on the 5' end. Specific CTLA-4 sequences are as 20 follows: muCTLA-4AUG: 5' CCA AGA CAA GCC ATG GCT GG 3'; muCTLA 4SA3: 5' CCG GGC ATG GTT CTG GAT C 3' (SEQ ID NO:12); muCTLA-4SA2: 5' GGT TGG GTC ACC TGT ATG G 3' (SEQ ID NO: 11); muCTLA-4SD2: 5' GTA AGG CGG TGG GTA CAT G 3' (SEQ ID NO:13); muCTLA-4SD3: 5' CAT CTT GCT CAA AGA AAC AG 3' (SEQ ID NO:14). 25 Preparation of Morpholino Oligomers having Cationic Linkages A schematic of a synthetic pathway that can be used to make morpholino subunits containing a (1 piperazino) phosphinylideneoxy linkage is shown in Figure 11; further experimental detail for a representative synthesis is provided in 30 Materials and Methods, below. As shown in the Figure, reaction of piperazine and trityl chloride gave trityl piperazine (Ia), which was isolated as the succinate salt. Reaction with ethyl trifluoroacetate (1 b) in the presence of a weak base (such as diisopropylethylamine or DIEA) provided 1-trifluoroacetyl-4-trityl piperazine (2), which was immediately reacted with HCI to provide the salt (3) in good yield. 26 WO 2007/056466 PCT/US2006/043507 Introduction of the dichlorophosphoryl moiety was performed with phosphorus oxychloride in toluene. The acid chloride (4) is reacted with morpholino subunits (moN), which may be prepared as described in U.S. Patent No. 5,185,444 or in Summerton and 5 Weller, 1997 (cited above), to provide the activated subunits (5,6,7). Suitable protecting groups are used for the nucleoside bases, where necessary; for example, benzoyl for adenine and cytosine, isobutyryl for guanine, and pivaloylmethyl for inosine. The subunits containing the (1 piperazino) phosphinylideneoxy linkage can be incorporated into the existing PMO synthesis 10 protocol, as described, for example in Summerton and Weller (1997), without modification. Splenocyte Culturing Spleens were collected in DME/High Glucose and 1 % FBS media. Using a 15 cell strainer (VWR International, West Chester, PA) the spleens were sieved into a cell suspension, washed twice, and cultured in Mouse Complete Media (RPMI, 10% FBS, 1% antibiotic, 2% 200 nM L-glutamine, and 50 pM beta mercaptethanol). 20 Antisense PMO Treatment Splenocytes from either B6 or NOD mice, at a concentration of 1 to 2 million cells, were plated onto a 12 well plate in Mouse Complete Media. Concanavalin A (Sigma-Aldrich, St. Louis, MO) was added at I pg/mL per well to induce lymphocyte activation. Lyophilized CTLA-4 PMOs were suspended in sterile PBS 25 and added to specified well cultures. Well plates were incubated at 37 0 C for 24 hours. RNA Extraction Splenocyte RNA was extracted using Qiagen's RNeasy Mini Kit (Qiagen USA, Valencia, CA) as per manufacturer's protocol. All isolated RNA was stored 30 at -80 0 C. RT-PCR To convert isolated RNA to DNA and amplify, Invitrogen's SuperScriptTM III One-Step RT-PCR System with Platinum* Taq DNA Polymerase (Invitrogen, 27 WO 2007/056466 PCT/US2006/043507 Carlsbad, CA) was used according to the manufacture's protocol. Targeting the full length CTLA-4 transcript, the following primers were designed from GenBank accession number NM_009843: F 5'-ACA CAT ATG TAG CAC GTA CCT TGG A 3'and R 5'-GGA ATT TTG CAT CCA GCT TTC TAT-3'. To amplify a portion of the 5 ICOS transcript, the primers F 5'-AAG CCG TAC TTC TGC CGT-3' and R 5'-CCA CAA CGA AAG CTG CAC-3' were designed from GenBank accession number BC034852. Primers targeting the CD28 transcript, F 5'-ATG ACA CTC AGG CTG CTG-3' and R 5'-GCA AGC CAT AAC AAA ACA G-3', were designed from GenBank accession number BC034852. All RT-PCR runs were completed on 10 BioRad iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA) according to the following protocol: reverse-transcription reaction at 50*C for 30 min, DNA polymerase activation at 950C for 15 min, 40 cycles of 950C denaturation for 30 sec, annealing for 45 sec at 520C, and extension for 1 min at 720C, and finally a final extension for 10 min at 720C. All RT-PCR products were 15 stored at -20*C. qRT-PCR The flCTLA-4 and IiCTLA-4 quantitative RT-PCR (qRT-PCR) probes and primers were designed by Vijayakrishnan et. al. (Vijayakrishnan, Slavik et al. 20 2004). The full-length CTLA-4 (fICTLA-4) forward (5' ACT CAT GTA CCC ACC GCC A 3'), fICTLA-4 reverse (5' GGG CAT GGT TCT GGA TCA 3') and fICTLA-4 probe (5' CAT GGG CAA CGG GAC GCA GAT TTA T 3') oligonucleotides are as shown. The ligand independent CTLA-4 (liCTLA-4) forward (5' GCC TTT TGT AGC CCT GCT CA 3'), IiCTLA-4 reverse (5' TCA GAA TCC GGG CAT GGT T 3') 25 and liCTLA-4 probe (5' TTC TTT TCA TCC CAG TCT TCT CTG AAG ATC CA 3') primers are also as shown. The PCR protocol was 10 min at 500C, 5 min 950C and 45 cycles of 950C for 10 sec, 580C for 30 sec, and 720C for 45 sec. Example 1. Splice-altered mRNAs derived from B6 and NOD splenocytes 30 after treatment with PMOs targeting splice donor or splice acceptor sequences CTLA-4 mRNA isoforms were examined by RT-PCR using messenger RNA (mRNA) isolated from B6 splenocytes stimulated with mitogen and treated with the various PMOs (10 micromolar) in culture for 24 hours. Alterations to the size of the products were observed by agarose gel electrophoresis stained with EtBr and are 28 WO 2007/056466 PCT/US2006/043507 shown in Fig. 4A. PMOs targeting splice acceptor sites (SA) were more efficient for altering splicing compared to those targeting splice donor sites (SD). Fig. 4B shows the results of RT-PCR examination of mRNA derived from NOD splenocytes treated with PMOs. A similar splice alteration pattern as was seen for 5 PMO-treated B6 splenocytes is induced in cells treated with as little as 0.5 micromolar PMO targeting SA2 (muCTLA-4SA2; SEQ ID NO:11). Fig. 4C is a control expertiment and shows that protein molecules related to CTLA-4 (ICOS and CD28) but lacking target homology are unaffected by treatment with CTLA-4 splice altering PMOs. Splenocytes derived from B10 and NOD mice were treated 10 with PMOs and mRNA splice patterns for CD28 and ICOS, molecules related to CTLA-4, were examined by RT-PCR. No alterations to the mRNAs encoding these molecules were detected. An examination of the alterations made to the CTLA-4 mRNA sequence after treatment with splice altering PMOs was performed to determine if the 15 expected CTLA-4 open reading frames was maintained. The PCR amplicons shown in Fig. 4A were gel isolated, cloned and sequenced to determine the integrity of the polypeptide open reading frame (ORF). The predicted sequence (shown in Fig. 5) as a result of antisense induced excision of exon 2 was obtained with the splice acceptor exon 2 targeting PMO (muCTLA-4SA2; SEQ ID NO: 11). 20 Although some of the clones sequenced from cells treated with the exon 3 targeting PMOs were as predicted the dominant sequence was similar to a natural occurring splice form of CTLA-4 form found in rats (GenBank accession number U90271). 25 Example 2. The effect of CTLA-4 splice altering PMOs on T cell activation, proliferation and adhesion activity. The early activation T cell marker CD69 was examined by flow cytometry after 16hr treatment with anti-CD3 antibody and with or without treatment with muCTLA-4SA2 PMO (SEQ ID NO: 11) at a 5 micromolar concentration. The 30 resulting diminution in CD69 expression compared to untreated stimulated cells demonstrates an influence of the PMO on the activation state of the T cells. The graph in Fig. 6 shows CD69 levels gated on CD4 + cells. The influence of splice altering CTLA-4 PMOs on cell proliferation is shown in Fig. 7. Purified mouse T cells were labeled with CFSE and then stimulated with 29 WO 2007/056466 PCT/US2006/043507 anti-CD3 antibody. The cells were cultured for 48 hrs with either-PMO (5 micromolar) or anti-CTLA-4 antibody or isotype. Cellular division was examined by flow cytometry gating on live cells. Proliferation was inhibited by the CTLA-4 agonist antibody and by treatment with the muCTLA-4SA2 PMO compared to 5 controls as shown in Fig. 7. The effect of splice alterations in CTLA-4 on the adhesion activity of T cells is shown in Fig. 8. Costimulation through CTLA-4 has been reported to enhance the adhesion quality of T cells via the capping LFA-1 and subsequent binding to ICAM-1. The EL4 T cell line was used to examine the effect of CTLA-4 splice 10 altering PMOs on T cell adhesion to ICAM-1. Cells were pretreated with PMO (5 micromolar) for 16 hrs or not and then plated onto triplicate wells of a 96 well plate pre-coated with ICAM-1 (12.5 microgram/ml). Cells were then stimulated with anti CD3 with or without CD28 or CTLA-4 (CD1 52) (both at 10 microgram/ml) costimulation for 1 hr. The loose cells were removed by inverting the plate. The 15 remaining cells were enumerated using a hemocytometer. Example 3. Treatment of NOD mice with CTLA-4 PMOs. To examine the in vivo effect of the CTLA-4 splice altering PMOs, NOD female mice were treat with splice altering PMOs muCTLA-4SA2 or muCTLA 20 4SA3 (SEQ ID NOs: 11 and 12, respectively) or a PMO targeting translation of the CTLA-4 protein AUG (see Materials and Methods). Animals (n=12/group) were treated with PMO (150 microgram i.p.) in 200 microliter saline for 2 weeks starting at age 8 weeks and blood sugar levels (b.s.l.) monitored weekly. Animals exhibiting a b.s.l. above 250 were terminated. As shown in Fig. 9, animals treated 25 with muCTLA-4SA2 developed disease at a point ~ 2 weeks later than controls. A greater percentage of animals developed disease when treated with the muCTLA 4SA3 PMO. To examine the effect of a therapeutic treatment of NOD mice with the muCTLA-4SA2 PMO, a series of animals were monitored weekly for b.s.l. 30 Treatment with muCTLA-4SA2 PMO (200 micrograms/day i.p. for 14 days) began when b.s.l. exceeded 140 mg/dl regardless of the age on the animal. b.s.l. was monitored until the animal reached at least 24 weeks of age or b.s.l. exceeded 250 mg/dl at which time the animal was euthanized. Figure 1 OA shows the results for animals beginning treatment with a b.s.l. below 180 mg/dl. 90% of the mice 30 WO 2007/056466 PCT/US2006/043507 responded to the therapy by exhibiting a decrease in b.s.l. 50 % exhibited a prolonged (24 weeks of age or greater) maintenance of normal b.s.l. Figure 1 0B shows the results for animals beginning treatment with a b.s.l. above 180 mg/dl. 50 percent of the animals demonstrated a reduction in b.s.l. with one animal 5 transiently returning to near normal levels. 31 WO 2007/056466 PCT/US2006/043507 SEQUENCE LISTING Name Target Sequences (5' to 3') SEQ ID NO huCTLA-4SA2sj GCATGAGTTCACTGAGTTCCCTTTGGCTTTTCCATGCTAGCAAT 1 GCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGAGGCA TCGCCAGCTTTG huCTLA-4SA2ex CAATGCACGTGGCCCAGCCTGCTGTGGTACTGGCCAGCAGCCGA 2 GGCATCGCCAGCTTTG huCTLA-4SA2in GCATGAGTTCACTGAGTTCCCTTTGGCTTTTCCATGCTAG 3 muCTLA-4SA2sj TCATGAGCCCACTAAGTGCCCTTTGGACTTTCCATGTCAGCCAT 8 ACAGGTGACCCAACCTTCAGTGGTGTTGGCTAGCAGCCATGGTG TCGCCAGCTTTC muCTLA-4SA2ex CCATACAGGTGACCCAACCTTCAGTGGTGTTGGCTAGCAGCCAT 9 GGTGTCGCCAGCTTTC muCTLA-4SA2in TCATGAGCCCACTAAGTGCCCTTTGGACTTTCCATGTCAG 10 Oligomer Targeting Sequences (5' to 3') huCTLA-4SA2ex GCA GGC TGG GCC ACG TGC ATT G 4 huCTLA-4SA2sj CAC GTG CAT TGC TAG CAT GG 5 huCTLA-4SA2bp CTA GCA TGG AAA AGC CAA AG 6 huCTLA-4SA2in GGA ACT CAG TGA ACT CAT GC 7 muCTLA-4SA2 GGT TGG GTC ACC TGT ATG G 11 muCTLA-4SA3 CCG GGC ATG GTT CTG GAT C 12 muCTLA-4SD2 GTA AGG CGG TGG GTA CAT G 13 muCTLA-4SD3 CAT CTT GCT CAA AGA AAC AG 14 Peptide Sequences* P003 R 9
F
2 C 15 P007 (RAhxR) 4 AhxpAla 16 P008 (RAhx)9PA1a 17 RX4 (RAhx) 4 PA1a 18 RXR2 (RAhxR) 2 Ahx@A1a 19 RB8 (RpAla)a 20 * Standard one letter amino acid code used except for 6-aminohexanoic acid (Ahx) and beta alanine (pAla) 32
权利要求:
Claims (27)
[1] 1. A method of suppressing an immune response in a mammalian subject, for the treatment or prevention of an autoimmune condition or transplantation 5 rejection, comprising (a) administering to the subject, a pharmaceutically effective amount of an oligonucleotide analog compound characterized by: (i) a nuclease-resistant backbone, (ii) capable of uptake by mammalian host cells, 10 (iii) containing between 12-40 nucleotide bases, and (iv) having a targeting sequence of at least 12 subunits that is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject, and 15 (b) by said administering, forming within said cells a heteroduplex structure (i) composed of the preprocessed CTLA-4 mRNA and the oligonucleotide compound, (ii) characterized by a Tm of dissociation of at least 45 0C, and (iii) resulting in an increased ratio of processed mRNA encoding ligand-independent CTLA-4 to processed mRNA encoding full-length CTLA-4. 20
[2] 2. The method of claim 1, wherein the compound to which the subject is exposed is composed of morpholino subunits linked phosphorus-containing intersubunit linkages, joining a morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit. 25
[3] 3. The method of claim 2, wherein said intersubunit linkages are phosphorodiamidate linkages. 33 WO 2007/056466 PCT/US2006/043507
[4] 4. The method of claim 3, wherein said morpholino subunits are joined by phosphorodiamidate linkages, in accordance with the structure: Y N where Y 1 =0, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective 5 to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, or alkyl amino.
[5] 5. The method of claim 2, in which at least 2 and no more than half of the total number of intersubunit linkages are positively charged at physiological pH. 10
[6] 6. The method of claim 2, wherein said morpholino subunits are joined by phosphorodiamidate linkages, in accordance with the structure: z= P-X 'N where Y 1 =0, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to 15 bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X for the uncharged linkages is alkyl, alkoxy, thioalkoxy, or an alkyl amino of the form wherein NR 2 , where each R is independently hydrogen or methyl, and for the positively charged linkages, X is I -piperazine. 20 7. The method of claim 4, wherein X=NR 2 , where each R is independently hydrogen or methyl. 34 WO 2007/056466 PCT/US2006/043507
[7] 8.~The mehoid of claim 2, which the compound to which the subject is exposed is a conjugate of the compound and an arginine-rich polypeptide effective to promote uptake of the compound into target cells. 5 9. The method of claim 8, wherein the arginine rich peptide has one of the sequences identified as SEQ ID NOS:15-20.
[8] 10. The method of claim 8, wherein the arginine-rich peptide is covalently coupled at its C terminus to the 5' end of the compound. 10
[9] 11. The method of claim 1, wherein said targeting sequence is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 2 within the 5'-end region of exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. 15
[10] 12. The method of claim 11, wherein the compound sequence includes the sequence defined by SEQ ID NO: 4.
[11] 13. The method of claim 1, wherein said targeting sequence is 20 complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 3 containing the branch point site and/or splice acceptor site of intron 1 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject.
[12] 14. The method of claim 13, wherein the compound sequence includes one 25 of the sequences defined by SEQ ID NOS: 6 and 7.
[13] 15. The method of claim 1, for prevention of transplantation rejection in a human subject scheduled to receive an allogeneic organ transplantation, wherein said administering is initiated at least one week before the scheduled 30 transplantation. 35 WO 2007/056466 PCT/US2006/043507 1 Thei4method of claim 15, wherein said administering is carried out by parenteral administration, at a dose level corresponding to between about 5 to 200 mg compound/day. 5 17. The method of claim 1, for treatment of an autoimmune condition, wherein said exposing is continued until a desired improvement in autoimmune condition is observed.
[14] 18. The method of claim 17, wherein said administering is carried out by 10 parenteral administration, at a dose level corresponding to between about 5 to 200 mg compound/day.
[15] 19. An oligonucleotide analog compound for use in suppressing an immune response in a mammalian subject, for the treatment or prevention of an 15 autoimmune condition or transplantation rejection, characterized by: (i) a nuclease-resistant backbone, (ii) capable of uptake by mammalian host cells, (iii) containing between 12-40 nucleotide bases, and (iv) having a targeting sequence of at least 12 subunits that is 20 complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 1, spanning the splice junction between intron 1 and exon 2 of preprocessed cytotoxic T cell antigen-4 (CTLA-4) mRNA of the subject, and (b) capable of reacting with the preprocessed CTLA-4 mRNA in mammalian cells to form a heteroduplex complex (i) characterized by a Tm of dissociation of at 25 least 45 0 C, and (ii) resulting in an increased ratio of processed mRNA encoding ligand-independent CTLA-4 to processed mRNA encoding full-length CTLA-4. (i) characterized by a Tm of dissociation of at least 45'C, and (ii) effective to increase the ratio of processed mRNA encoding ligand-independent CTLA-4 to processed mRNA encoding full-length CTLA-4 in the cells. 30
[16] 20. The compound of claim 19, which is composed of morpholino subunits linked by phosphorus-containing intersubunit linkages, joining a morpholino nitrogen of one subunit to a 5' exocyclic carbon of an adjacent subunit. 36 WO 2007/056466 PCT/US2006/043507
[17] 21. The compound of claim 20, wherein said intersubunit linkages are phosphorodiamidate linkages.
[18] 22. The compound of claim 21, wherein said morpholino subunits are 5 joined by phosphorodiamidate linkages, in accordance with the structure: Z=P-X Y P 0<f N where Y 1 =0, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X is alkyl, alkoxy, thioalkoxy, or alkyl amino. 10
[19] 23. The compound of claim 20, in which at least 2 and no more than half of the total number of intersubunit linkages are positively charged at physiological pH. 15 24. The compound of claim 23, wherein said morpholino subunits are joined by phosphorodiamidate linkages, in accordance with the structure: Z=P-X N where Y 1 =0, Z=O, Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, and X 20 for the uncharged linkages is alkyl, alkoxy, thioalkoxy, or an alkyl amino of the form wherein NR 2 , where each R is independently hydrogen or methyl, and for the positively charged linkages, X is 1-piperazine. 37 WO 2007/056466 PCT/US2006/043507
[20] 25. The compound of claim 22, wherein X=NR 2 , where each R is independently hydrogen or methyl.
[21] 26. The compound of claim 19, which is a conjugate of the compound and 5 an arginine-rich polypeptide effective to promote uptake of the compound into target cells.
[22] 27. The compound of claim 25, wherein the arginine rich peptide has one of the sequences identified as SEQ ID NOS:10-15. 10
[23] 28. The compound of claim 27, wherein arginine-rich peptide is covalently coupled at its C terminus to the 3' end of the compound.
[24] 29. The compound of claim 19, whose targeting sequence is 15 complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 2 within the 5'-end region of exon 2 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject.
[25] 30. The compound of claim 29, wherein the compound sequence includes the sequence defined by SEQ ID NO: 4. 20
[26] 31. The compound of claim 19, whose targeting sequence is complementary to at least 12 subunits of a target sequence identified by SEQ ID NO: 3 containing the branch site and splice acceptor site of intron 1 of preprocessed T cell antigen-4 (CTLA-4) mRNA of the subject. 25
[27] 32. The compound of claim 31, wherein the compound sequence includes one of the sequences defined by SEQ ID NOS: 6 and 7. 38
类似技术:
公开号 | 公开日 | 专利标题
US9487786B2|2016-11-08|Immunosuppression compound and treatment method
EP1954836B1|2014-01-08|Immunosuppression compound and treatment method
US10626396B2|2020-04-21|Antisense composition and method for treating muscle atrophy
US8415313B2|2013-04-09|Antisense oligomers and methods for inducing immune tolerance and immunosuppression
US8008469B2|2011-08-30|Antisense compound for inducing immunological tolerance
CA2539972C|2017-05-16|Antisense compound and method for selectively killing activated t cells
AU2017236001A1|2017-10-19|Antisense composition and method for treating muscle atrophy
AU2013202533B2|2015-11-12|Immunosuppression Compound and Treatment Method
AU2015246175A1|2015-12-17|Immunosuppression compound and treatment method
AU2013201250B2|2015-04-30|Antisense composition and method for treating muscle atrophy
同族专利:
公开号 | 公开日
AU2013202533B2|2015-11-12|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
ES2123001T5|1991-06-27|2009-04-16|Bristol-Myers Squibb Company|CTL4A RECEIVER, FUSION PROTEINS CONTAINING IT AND ITS USES.|
GB0113798D0|2001-06-06|2001-07-25|Chiron Spa|Antigens and vectors for vaccination|
法律状态:
2016-03-10| FGA| Letters patent sealed or granted (standard patent)|
优先权:
申请号 | 申请日 | 专利标题
US60/735,000||2005-11-08||
US60/799,976||2006-05-11||
AU2006311586A|AU2006311586A1|2005-11-08|2006-11-08|Immunosuppression compound and treatment method|
AU2013202533A|AU2013202533B2|2005-11-08|2013-04-04|Immunosuppression Compound and Treatment Method|AU2013202533A| AU2013202533B2|2005-11-08|2013-04-04|Immunosuppression Compound and Treatment Method|
AU2015246175A| AU2015246175A1|2005-11-08|2015-10-23|Immunosuppression compound and treatment method|
[返回顶部]