专利摘要:
The present invention provides gene sets the expression of which is important in the diagnosis and/or prognosis of cancer, in particular of breast cancer. 4058201_1 (GHMatters) P59406.AU.2
公开号:AU2013200793A1
申请号:U2013200793
申请日:2013-02-14
公开日:2013-03-07
发明作者:Joffre B. Baker;John L. Bryant;Soonmyung Paik;Steven Shak
申请人:Genomic Health Inc;NSABP Foundation Inc;
IPC主号:C12N15-00
专利说明:
PREDICTION OF LIKELIHOOD OF CANCER RECURRENCE The entire disclosure in the complete specification of our Australian Patent Application No. 2010202424 is by this cross-reference incorporated into the present 5 specification. Background of the Invention Field of the Invention 10 The present invention provides gene sets the expression of which is important in the diagnosis and/or prognosis of cancer. Description of the Related Art Oncologists have a number of treatment options available to them, including different 15 combinations of chemotherapeutic drugs that are characterized as "standard of care," and a number of drugs that do not carry a label claim for particular cancer, but for which there is evidence of efficacy in that cancer. Best likelihood of good treatment outcome requires that patients be assigned to optimal available cancer treatment, and that this assignment be made as quickly as possible following diagnosis. 20 Currently, diagnostic tests used in clinical practice are single analyte, and therefore do not capture the potential value of knowing relationships between dozens of different markers. Moreover, diagnostic tests are frequently not quantitative, relying on immunohistochemistry. This method often yields different results in different laboratories, in part because the reagents are not standardized, and in part because the interpretations are subjective and 25 cannot be easily quantified. RNA-based tests have not often been used because of the problem of RNA degradation over time and the fact that it is difficult to obtain fresh tissue samples from patients for analysis. Fixed paraffin-embedded tissue is more readily available and methods have been established to detect RNA in fixed tissue. However, these methods typically do not allow for the study of large numbers of genes (DNA or RNA) from small 30 amounts of material. Thus, traditionally fixed tissue has been rarely used other than for immunohistochemistry detection of proteins. 2 4058201_1 (GHMatters) P59406.AU.2 In the past few years, several groups have published studies concerning the classification of various cancer types by microarray gene expression analysis (see, e.g. Golub et al., Science 286:531-537 (1999); Bhattacharjae et al., Proc. Natl. Acad. Sci. USA 98:13790-13795 (2001); Chen-Hsiang et al., Bioinformatics 17 (Suppl. 1):S316-S322 (2001); 5 Ramaswamy et al., Proc. Natl. Acad. Sci. USA 98:15149-15154 (2001)). Certain classifications of human breast cancers based on gene expression patterns have also been reported (Martin et al., Cancer Res. 60:2232-2238 (2000); West et al., Proc. Natl. Acad. Sci. USA 98:11462-11467 (2001); Sorlie et al., Proc. Natl. Acad. Sci. USA 98:10869-10874 (2001); Yan et al., Cancer Res. 61:8375-8380 (2001)). However, these studies mostly focus 10 on improving and refining the already established classification of various types of cancer, including breast cancer, and generally do not provide new insights into the relationships of the differentially expressed genes, and do not link the findings to treatment strategies in order to improve the clinical outcome of cancer therapy. Although modem molecular biology and biochemistry have revealed hundreds of 15 genes whose activities influence the behavior of tumor cells, state of their differentiation, and their sensitivity or resistance to certain therapeutic drugs, with a few exceptions, the status of these genes has not been exploited for the purpose of routinely making clinical decisions about drug treatments. One notable exception is the use of estrogen receptor (ER) protein expression in breast carcinomas to select patients to treatment with anti-estrogen drugs, such 20 as tamoxifen. Another exceptional example is the use of ErbB2 (Her2) protein expression in breast carcinomas to select patients with the Her2 antagonist drug Herceptin@ (Genentech, Inc., South San Francisco, CA). Despite recent advances, the challenge of cancer treatment remains to target specific treatment regimens to pathogenically distinct tumor types, and ultimately personalize tumor 25 treatment in order to maximize outcome. Hence, a need exists for tests that simultaneously provide predictive information about patient responses to the variety of treatment options. This is particularly true for breast cancer, the biology of which is poorly understood. It is clear that the classification of breast cancer into a few subgroups, such as ErbB2+ subgroup, and subgroups characterized by low to absent gene expression of the estrogen receptor (ER) 30 and a few additional transcriptional factors (Perou et al., Nature 406:747-752 (2000)) does not reflect the cellular and molecular heterogeneity of breast cancer, and does not allow the design of treatment strategies maximizing patient response. 3 4058201_1 (GHMatters) P59406.AU.2 In particular, once a patient is diagnosed with cancer, such as breast or ovarian cancer, there is a strong need for methods that allow the physician to predict the expected course of disease, including the likelihood of cancer recurrence, long-term survival of the patient, and the like, and select the most appropriate treatment option accordingly. 5 It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Australia or any other country. Summary of the Invention 10 The present invention provides a set of genes, the expression of which has prognostic value, specifically with respect to disease-free survival. The present invention accommodates the use of archived paraffin-embedded biopsy material for assay of all markers in the set, and therefore is compatible with the most widely available type of biopsy material. It is also compatible with several different methods of 15 tumor tissue harvest, for example, via core biopsy or fine needle aspiration. Further, for each member of the gene set, the invention specifies oligonucleotide sequences that can be used in the test. In one aspect, the present invention concerns a method of predicting the likelihood of long-term survival of a cancer patient without the recurrence of cancer, comprising 20 determining the expression level of one or more prognostic RNA transcripts or their expression products in a cancer cell obtained from the patient, normalized against the expression level of all RNA transcripts or their products in said cancer cell, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is the transcript of one or more genes selected from the group consisting of B_Catenin; BAG1; 25 BIN1; BUB1; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAPi; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRi; FOXM1; GRB7; GSTM1; GSTM3; HER2; HNRPAB; IDI; IGF1R; ITGA7; Ki_67; KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS; 30 wherein expression of one or more of BUBi; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CTSL2; EpCAM; FOXM1; GRB7; HER2; HNRPAB; Ki_67; KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; PCNA; PREP; 4 4058201_1 (GHMatters) P59406.AU.2 PTTG1; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS indicates a decreased likelihood of long-term survival without cancer recurrence; and the expression of one or more of BAGI; BCatenin; BINI; CEGP1; CIAP1; cMYC; DKFZp586MO7; DR5; EstRI; GSTM1; GSTM3; IDI; IGF1R; ITGA7; NPDO09; 5 PR; and RPLPO indicates an increased likelihood of long-term survival without cancer recurrence. In various embodiments, the expression level of at least 2, or at least 5, or at least 10, or at least 15, or at least 20, or a least 25 prognostic RNA transcripts or their expression products is determined. 10 In another embodiment, the cancer is breast cancer or ovarian cancer. In yet another embodiment, the cancer is node negative, ER positive breast cancer. In a further embodiment, the RNA comprises intronic RNA. In a still further embodiment, the expression level of one or more prognostic RNA transcripts or their expression products of one or more genes selected from the group 15 consisting of MMP9, GSTM1, MELK, PR, DKFZp586MO7, GSTM3, CDC20, CCNB1, STMY3, GRB7, MYBL2, CEGP1, SURV, LMNB1, CTSL2, PTTG1, BAGI, KNSL2, CIAP1, PREP, NEK2, EpCAM, PCNA, C20_orfl, ITGA7, IDI BCatenin, EstRI, CDH1, TS HER2, and cMYC is determined, wherein expression of one or more of C20_orfl; CCNB1; CDC20; CDH1; 20 CTSL2; EpCAM; GRB7; HER2; KNSL2; LMNB1; MCM2; MMP9; MYBL2; NEK2; PCNA; PREP; PTTG1; STMY3; SURV; TS; and MELK indicates a decreased likelihood of long-term survival without cancer recurrence; and the expression of one or more of BAGI; BCatenin; CEGP1; CIAP1; cMYC; DKFZp586MO7; EstRI; GSTM1; GSTM3; IDI; ITGA7; and PR indicates an increased 25 likelihood of long-term survival without cancer recurrence. In another embodiment, the expression level of one or more prognostic RNA transcripts or their expression products of one or more genes selected from the group consisting of GRB7, SURV, PR, LMNB1, MYBL2, HER2, GSTM1, MELK, S20_orfl, PTTG1, BUBI, CDC20, CCNB1, STMY3, KNSL2, CTSL2, MCM2, NEK2, DR5, Ki_67, 30 CCNE2, TOP2A, PCNA, PREP, FOXM1, NME1, CEGP1, BAGI, STK15, HNRPAB, EstRI, MMP9, DKFZp586M07, TS, Src, BINI, NP009, RPLPO, GSTM3, MMP12, TFRC, and IGF1R is determined, 5 4058201_1 (GHMatters) P59406.AU.2 wherein expression of one or more of GRB7; SURV; LMNB1; MYBL2; HER2; MELK; C20_orfl; PTTG1; BUBI; CDC20; CCNB1; STMY3; KNSL2; CTSL2; MCM2; NEK2; Ki_67; CCNE2; TOP2A_4; PCNA; PREP; FOXM1; NME1; STK15; HNRPAB; MMP9; TS; Src; MMP12; and TFRC indicates a decreased likelihood of long 5 term survival without cancer recurrence; and the expression of one or more of PR; GSTM1; DR5; CEGP1; BAGI; EstRI; DKFZp586MO7; BINI; NPDO09; RPLPO; GSTM3; IGF1R indicates an increased likelihood of long-term survival without cancer recurrence. In another aspect, the invention concerns a method of predicting the likelihood of 10 long-term survival of a cancer patient without the recurrence of cancer, comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a cancer cell obtained from said patient, normalized against the expression level of all RNA transcripts or their products in the cancer cell, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is 15 the transcript of one or more genes selected from the group consisting of GRB7; LMNB1; ER; STMY3; KLK1O; PR; KRT5; FGFR1; MCM6; SNRPF, wherein expression of one or more of GRB7, LMNB1, STMY3, KLK1O, FGFR1, and SNRPF indicates a decreased likelihood or long term survival without cancer recurrence; and 20 the expression of one or more of ER, PR, KRT5 and MCM6 ER, PR, KRT5 and MCM6indicates an increased likelihood of long-term survival without cancer recurrence. In an embodiment of this method, the RNA is isolated from a fixed, wax-embedded breast cancer tissue specimen of the patient. In another embodiment, the RNA is isolated from core biopsy tissue or fine needle 25 aspirate cells. In a different aspect, the invention concerns an array comprising polynucleotides hybridizing to two or more of the following genes: BCatenin; BAGI; BINI; BUBI; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAPI; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRI; FOXM1; GRB7; GSTM1; GSTM3; HER2; 30 HNRPAB; IDI; IGF1R; ITGA7; Ki_67; KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS, immobilized on a solid surface. 6 4058201_1 (GHMatters) P59406.AU.2 In an embodiment, the array comprises polynucleotides hybridizing to two or more of the following genes: MMP9, GSTM1, MELK, PR, DKFZp586MO7, GSTM3, CDC20, CCNB1, STMY3, GRB7, MYBL2, CEGP1, SURV, LMNB1, CTSL2, PTTG1, BAGI, KNSL2, CIAPI, PREP, NEK2, EpCAM, PCNA, C20_orfl, ITGA7, IDI BCatenin, EstRI, 5 CDH1, TS HER2, and cMYC. In another embodiment, the array comprises polynucleotides hybridizing to two or more of the following genes: GRB7, SURV, PR, LMNB1, MYBL2, HER2, GSTM1, MELK, S20_orfl, PTTG1, BUBI, CDC20, CCNB1, STMY3, KNSL2, CTSL2, MCM2, NEK2, DR5, Ki_67, CCNE2, TOP2A, PCNA, PREP, FOXM1, NME1, CEGP1, BAGI, STK15, 10 HNRPAB, EstRI, MMP9, DKFZp586MO7, TS, Src, BINI, NP009, RPLPO, GSTM3, MMP12, TFRC, and IGF1R. In a further embodiment, the arrays comprise polynucleotides hybridizing to at least 3, or at least 5, or at least 10, or at least 15, or at least 20, or at least 25 of the listed genes. In a still further embodiment, the arrays comprise polynucleotides hybridizing to all 15 of the listed genes. In yet another embodiment, the arrays comprise more than one polynucleotide hybridizing to the same gene. In an additional embodiment, the arrays comprise intron-based sequences. In another embodiment, the polynucleotides are cDNAs, which can, for example, be 20 about 500 to 5000 bases long. In yet another embodiment, the polynucleotides are oligonucleotides, which can,. for example, be about 20 to 80 bases long. The arrays can, for example, be immobilized on glass, and can contain hundreds of thousand, e.g. 330,000 oligonucleotides. 25 In a further aspect, the invention concerns a method of predicting the likelihood of long-term survival of a patient diagnosed with invasive breast cancer, without the recurrence of breast cancer, comprising the steps of (a) determining the expression levels of the RNA transcripts or the expression products of genes of a gene set selected from the group consisting of BCatenin; BAGI; 30 BINI; BUB1; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAP1; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRI; FOXM1; GRB7; GSTM1; GSTM3; HER2; HNRPAB; IDI; IGF1R; ITGA7; Ki_67; KNSL2; LMNB1; MCM2; MELK; 7 4058201_1 (GHMatters) P59406.AU.2 MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS in a breast cancer cell obtained from the patient, normalized against the expression levels of all RNA transcripts or their expression products in said breast cancer cell, or of a reference set of RNA transcripts or 5 their products; (b) subjecting the data obtained in step (a) to statistical analysis; and; (c) determining whether the likelihood of said long-term survival has increased or decreased. In a still further aspect, the invention concerns a method of preparing a personalized 10 genomics profile for a patient, comprising the steps of (a) subjecting RNA extracted from a breast tissue obtained from the patient to gene expression analysis; (b) determining the expression level in the tissue of one or more genes selected from the breast cancer gene set listed in any one of Tables 1 and 2, wherein the expression 15 level is normalized against a control gene or genes and optionally is compared to the amount found in a breast cancer reference tissue set; and (c) creating a report summarizing the data obtained by said gene expression analysis. The breast tissue may comprise breast cancer cells. 20 In another embodiment, the breast tissue is obtained from a fixed, paraffin-embedded biopsy sample, in which the RNA may be fragmented. The report may include prediction of the likelihood of long term survival of the patient and/or a recommendation for a treatment modality of said patient. In a further aspect, the invention concerns a method for measuring levels of mRNA 25 products of genes listed in Tables 1 and 2 by real time polymerase chain reaction (RT-PCR), by using an amplicon listed in Table and a primer-probe set listed in Tables 4A - 4D. In a still further aspect, the invention concerns a PCR primer-probe set listed in Tables 4A - 4D, and a PCR amplicon listed in Table 3. 30 8 4058201_1 (GHMatters) P59406.AU.2 Detailed Description of the Preferred Embodiment A. Definitions Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention 5 belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994), and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, NY 1992), provide one skilled in the art with a general guide to many of the terms used in the present application. One skilled in the art will recognize many methods and materials similar or 10 equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below. In the claims which follow and in the description of the invention, except where the context requires otherwise due to express language or necessary implication, the word 15 "comprise" or variations such as "comprises" or "comprising" is used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. The term "microarray" refers to an ordered arrangement of hybridizable array elements, preferably polynucleotide probes, on a substrate. 20 The term "polynucleotide," when used in singular or plural, generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double-stranded DNA, DNA including single- and double stranded regions, single- and double-stranded RNA, and RNA including single- and double 25 stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term "polynucleotide" as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more 30 of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term "polynucleotide" specifically includes cDNAs. The term includes DNAs (including cDNAs) 9 4058201_1 (GHMatters) P59406.AU.2 and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritiated bases, are included within the term "polynucleotides" as defined 5 herein. In general, the term "polynucleotide" embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells. The term "oligonucleotide" refers to a relatively short polynucleotide, including, without limitation, single-stranded deoxyribonucleotides, single- or double-stranded 10 ribonucleotides, RNA:DNA hybrids and double-stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms. 15 The terms "differentially expressed gene," "differential gene expression" and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as breast cancer, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lower level at different stages of the same 20 disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a different polypeptide product. Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two 25 or more genes or their gene products, or a comparison of the ratios of the expression between two or more genes or their gene products, or even a comparison of two differently processed products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically cancer, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or 30 cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, "differential gene expression" is considered to be 10 4058201_1 (GHMatters) P59406.AU.2 present when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject. 5 The term "over-expression" with regard to an RNA transcript is used to refer to the level of the transcript determined by normalization to the level of reference mRNAs, which might be all measured transcripts in the specimen or a particular reference set of mRNAs. The phrase "gene amplification" refers to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line. The duplicated region (a 10 stretch of amplified DNA) is often referred to as "amplicon." Usually, the amount of the messenger RNA (mRNA) produced, i.e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed. The term "prognosis" is used herein to refer to the prediction of the likelihood of cancer-attributable death or progression, including recurrence, metastatic spread, and drug 15 resistance, of a neoplastic disease, such as breast cancer. The term "prediction" is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs, and also the extent of those responses, or that a patient will survive, following surgical removal or the primary tumor and/or chemotherapy for a certain period of time without cancer recurrence. The predictive methods of the present invention can be used 20 clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as surgical intervention, chemotherapy with a given drug or drug combination, and/or radiation therapy, or whether long-term survival of the patient, following surgery and/or termination 25 of chemotherapy or other treatment modalities is likely. The term "long-term" survival is used herein to refer to survival for at least 3 years, more preferably for at least 8 years, most preferably for at least 10 years following surgery or other treatment. The term "tumor," as used herein, refers to all neoplastic cell growth and 30 proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues. 11 4058201_1 (GHMatters) P59406.AU.2 The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to, breast cancer, ovarian cancer, colon cancer, lung cancer, prostate cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, liver 5 cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, and brain cancer. The "pathology" of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines 10 or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, neoplasia, premalignancy, malignancy, invasion of surrounding or distant tissues or organs, such as lymph nodes, etc. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, 15 washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the 20 higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). 25 "Stringent conditions" or "high stringency conditions", as defined herein, typically: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50'C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM 30 sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42'C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, 12 4058201_1 (GHMatters) P59406.AU.2 sonicated salmon sperm DNA (50 [tg/ml), 0.1% SDS, and 10% dextran sulfate at 42 C, with washes at 42'C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55'C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55'C. "Moderately stringent conditions" may be identified as described by Sambrook et al., 5 Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37 0 C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate 10 (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50'C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like. In the context of the present invention, reference to "at least one," "at least two," "at 15 least five," etc. of the genes listed in any particular gene set means any one or any and all combinations of the genes listed. The term "node negative" cancer, such as "node negative" breast cancer, is used herein to refer to cancer that has not spread to the lymph nodes. The terms "splicing" and "RNA splicing" are used interchangeably and refer to RNA 20 processing that removes introns and joins exons to produce mature mRNA with continuous coding sequence that moves into the cytoplasm of an eukaryotic cell. In theory, the term "exon" refers to any segment of an interrupted gene that is represented in the mature RNA product (B. Lewin. Genes IV Cell Press, Cambridge Mass. 1990). In theory the term "intron" refers to any segment of DNA that is transcribed but 25 removed from within the transcript by splicing together the exons on either side of it. Operationally, exon sequences occur in the mRNA sequence of a gene as defined by Ref. SEQ ID numbers. Operationally, intron sequences are the intervening sequences within the genomic DNA of a gene, bracketed by exon sequences and having GT and AG splice consensus sequences at their 5' and 3' boundaries. 30 13 4058201_1 (GHMatters) P59406.AU.2 B. Detailed Description The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such 5 techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual", 2 "d edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984); "Animal Cell Culture" (R.I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology", 4 th edition (D.M. Weir & C.C. Blackwell, eds., Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian 10 Cells" (J.M. Miller & M.P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987); and "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994). 1. Gene Expression Profiline Methods of gene expression profiling include methods based on hybridization 15 analysis of polynucleotides, methods based on sequencing of polynucleotides, and proteomics-based methods. The most commonly used methods known in the art for the quantification of mRNA expression in a sample include northern blotting and in situ hybridization (Parker & Barnes, Methods in Molecular Biology 106:247-283 (1999)); RNAse protection assays (Hod, Biotechniques 13:852-854 (1992)); and PCR-based methods, such as 20 reverse transcription polymerase chain reaction (RT-PCR) (Weis et al., Trends in Genetics 8:263-264 (1992)). Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. Representative methods for sequencing-based gene expression analysis include Serial Analysis of Gene Expression (SAGE), and gene expression analysis 25 by massively parallel signature sequencing (MPSS). 2. PCR-based Gene Expression Profiling Methods a Reverse Transcriptase PCR (RT-PCR) Of the techniques listed above, the most sensitive and most flexible quantitative method is RT-PCR, which can be used to compare mRNA levels in different sample 30 populations, in normal and tumor tissues, with or without drug treatment, to characterize patterns of gene expression, to discriminate between closely related mRNAs, and to analyze RNA structure. 14 4058201_1 (GHMatters) P59406.AU.2 The first step is the isolation of mRNA from a target sample. The starting material is typically total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines, respectively. Thus RNA can be isolated from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, 5 testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. formalin-fixed) tissue samples. General methods for mRNA extraction are well known in the art and are disclosed in standard textbooks of molecular biology, including Ausubel et al., Current Protocols of 10 Molecular Biology, John Wiley and Sons (1997). Methods for RNA extraction from paraffin embedded tissues are disclosed, for example, in Rupp and Locker, Lab Invest. 56:A67 (1987), and De Andr6s et al., BioTechniques 18:42044 (1995). In particular, RNA isolation can be performed using purification kit, buffer set and protease from commercial manufacturers, such as Qiagen, according to the manufacturer's instructions. For example, 15 total RNA from cells in culture can be isolated using Qiagen RNeasy mini-columns. Other commercially available RNA isolation kits include MasterPureTM Complete DNA and RNA Purification Kit (EPICENTRE@, Madison, WI), and Paraffin Block RNA Isolation Kit (Ambion, Inc.). Total RNA from tissue samples can be isolated using RNA Stat-60 (Tel Test). RNA prepared from tumor can be isolated, for example, by cesium chloride density 20 gradient centrifugation. As RNA cannot serve as a template for PCR, the first step in gene expression profiling by RT-PCR is the reverse transcription of the RNA template into cDNA, followed by its exponential amplification in a PCR reaction. The two most commonly used reverse transcriptases are avilo myeloblastosis virus reverse transcriptase (AMV-RT) and Moloney 25 murine leukemia virus reverse transcriptase (MMLV-RT). The reverse transcription step is typically primed using specific primers, random hexamers, or oligo-dT primers, depending on the circumstances and the goal of expression profiling. For example, extracted RNA can be reverse-transcribed using a GeneAmp RNA PCR kit (Perkin Elmer, CA, USA), following the manufacturer's instructions. The derived cDNA can then be used as a template in the 30 subsequent PCR reaction. Although the PCR step can use a variety of thermostable DNA-dependent DNA polymerases, it typically employs the Taq DNA polymerase, which has a 5'-3' nuclease 15 4058201_1 (GHMatters) P59406.AU.2 activity but lacks a 3'-5' proofreading endonuclease activity. Thus, TaqMan@ PCR typically utilizes the 5'-nuclease activity of Taq or Tth polymerase to hydrolyze a hybridization probe bound to its target amplicon, but any enzyme with equivalent 5' nuclease activity can be used. Two oligonucleotide primers are used to generate an amplicon typical of a PCR 5 reaction. A third oligonucleotide, or probe, is designed to detect nucleotide sequence located between the two PCR primers. The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent dye. Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, 10 the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data. 15 TaqMan@ RT-PCR can be performed using commercially available equipment, such as, for example, ABI PRISM 7 7 0 0 TM Sequence Detection System TM (Perkin-Elmer-Applied Biosystems, Foster City, CA, USA), or Lightcycler (Roche Molecular Biochemicals, Mannheim, Germany). In a preferred embodiment, the 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI PRISM 7700TM Sequence Detection TM 20 System . The system consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 96-well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data. 25 5'-Nuclease assay data are initially expressed as Ct, or the threshold cycle. As discussed above, fluorescence values are recorded during every cycle and represent the amount of product amplified to that point in the amplification reaction. The point when the fluorescent signal is first recorded as statistically significant is the threshold cycle (C). To minimize errors and the effect of sample-to-sample variation, RT-PCR is usually 30 performed using an internal standard. The ideal internal standard is expressed at a constant level among different tissues, and is unaffected by the experimental treatment. RNAs most 16 4058201_1 (GHMatters) P59406.AU.2 frequently used to normalize patterns of gene expression are mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) and f-actin. A more recent variation of the RT-PCR technique is the real time quantitative PCR, which measures PCR product accumulation through a dual-labeled fluorigenic probe (i.e., 5 TaqMan@ probe). Real time PCR is compatible both with quantitative competitive PCR, where internal competitor for each target sequence is used for normalization, and with quantitative comparative PCR using a normalization gene contained within the sample, or a housekeeping gene for RT-PCR. For further details see, e.g. Held et al., Genome Research 6:986-994 (1996). 10 The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are given in various published journal articles {for example: T.E. Godfrey et al. J. Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J. Pathol. 158: 419-29 [2001]}. Briefly, a representative process starts with cutting about 10 Pim 15 thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. b. MassARR AY System 20 In the MassARRAY-based gene expression profiling method, developed by Sequenom, Inc. (San Diego, CA) following the isolation of RNA and reverse transcription, the obtained cDNA is spiked with a synthetic DNA molecule (competitor), which matches the targeted cDNA region in all positions, except a single base, and serves as an internal standard. The cDNA/competitor mixture is PCR amplified and is subjected to a post-PCR 25 shrimp alkaline phosphatase (SAP) enzyme treatment, which results in the dephosphorylation of the remaining nucleotides. After inactivation of the alkaline phosphatase, the PCR products from the competitor and cDNA are subjected to primer extension, which generates distinct mass signals for the competitor- and cDNA-derives PCR products. After purification, these products are dispensed on a chip array, which is pre-loaded with 30 components needed for analysis with matrix-assisted laser desorption ionization time-of flight mass spectrometry (MALDI-TOF MS) analysis. The cDNA present in the reaction is 17 4058201_1 (GHMatters) P59406.AU.2 then quantified by analyzing the ratios of the peak areas in the mass spectrum generated. For further details see, e.g. Ding and Cantor, Proc. Natl. Acad. Sci. USA 100:3059-3064 (2003). c. Other PCR-based Methods Further PCR-based techniques include, for example, differential display (Liang and 5 Pardee, Science 257:967-971 (1992)); amplified fragment length polymorphism (iAFLP) (Kawamoto et al., Genome Res. 12:1305-1312 (1999)); BeadArray T M technology (Illumina, San Diego, CA; Oliphant et al., Discovery of Markers for Disease (Supplement to Biotechniques), June 2002; Ferguson et al., Analytical Chemistry 72:5618 (2000)); BeadsArray for Detection of Gene Expression (BADGE), using the commercially available 10 Luminex100 LabMAP system and multiple color-coded microspheres (Luminex Corp., Austin, TX) in a rapid assay for gene expression (Yang et al., Genome Res. 11:1888-1898 (2001)); and high coverage expression profiling (HiCEP) analysis (Fukumura et al., Nucl. Acids. Res. 31(16) e94 (2003)). 3. Microarravs 15 Differential gene expression can also be identified, or confirmed using the microarray technique. Thus, the expression profile of breast cancer-associated genes can be measured in either fresh or paraffin-embedded tumor tissue, using microarray technology. In this method, polynucleotide sequences of interest (including cDNAs and oligonucleotides) are plated, or arrayed, on a microchip substrate. The arrayed sequences are then hybridized with specific 20 DNA probes from cells or tissues of interest. Just as in the RT-PCR method, the source of mRNA typically is total RNA isolated from human tumors or tumor cell lines, and corresponding normal tissues or cell lines. Thus RNA can be isolated from a variety of primary tumors or tumor cell lines. If the source of mRNA is a primary tumor, mRNA can be extracted, for example, from frozen or archived paraffin-embedded and fixed (e.g. 25 formalin-fixed) tissue samples, which are routinely prepared and preserved in everyday clinical practice. In a specific embodiment of the microarray technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferably at least 10,000 nucleotide sequences are applied to the substrate. The microarrayed genes, immobilized on the 30 microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes may be generated through incorporation of fluorescent nucleotides by reverse transcription of RNA extracted from tissues of interest. Labeled 18 4058201_1 (GHMatters) P59406.AU.2 cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the array. After stringent washing to remove non-specifically bound probes, the chip is scanned by confocal laser microscopy or by another detection method, such as a CCD camera. Quantitation of hybridization of each arrayed element allows for assessment of corresponding 5 mRNA abundance. With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hybridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been 10 shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(2):106-149 (1996)). Microarray analysis can be performed by commercially available equipment, following manufacturer's protocols, such as by using the Affymetrix GenChip technology, or Incyte's 15 microarray technology. The development of microarray methods for large-scale analysis of gene expression makes it possible to search systematically for molecular markers of cancer classification and outcome prediction in a variety of tumor types. 4. Serial Analvsis of Gene Expression (SAGE) 20 Serial analysis of gene expression (SAGE) is a method that allows the simultaneous and quantitative analysis of a large number of gene transcripts, without the need of providing an individual hybridization probe for each transcript. First, a short sequence tag (about 10-14 bp) is generated that contains sufficient information to uniquely identify a transcript, provided that the tag is obtained from a unique position within each transcript. Then, many 25 transcripts are linked together to form long serial molecules, that can be sequenced, revealing the identity of the multiple tags simultaneously. The expression pattern of any population of transcripts can be quantitatively evaluated by determining the abundance of individual tags, and identifying the gene corresponding to each tag. For more details see, e.g. Velculescu et al., Science 270:484-487 (1995); and Velculescu et al., Cell 88:243-51 (1997). 19 4058201_1 (GHMatters) P59406.AU.2 5. Gene Expression Analvsis by Massivelv Parallel Signature Sequencine (MPSS) This method, described by Brenner et al., Nature Biotechnology 18:630-634 (2000), is a sequencing approach that combines non-gel-based signature sequencing with in vitro 5 cloning of millions of templates on separate 5 pm diameter microbeads. First, a microbead library of DNA templates is constructed by in vitro cloning. This is followed by the assembly of a planar array of the template-containing microbeads in a flow cell at a high density (typically greater than 3 x 106 microbeads/cm 2 ). The free ends of the cloned templates on each microbead are analyzed simultaneously, using a fluorescence-based 10 signature sequencing method that does not require DNA fragment separation. This method has been shown to simultaneously and accurately provide, in a single operation, hundreds of thousands of gene signature sequences from a yeast cDNA library. 6. Immunohistochemistrv Immunohistochemistry methods are also suitable for detecting the expression levels 15 of the prognostic markers of the present invention. Thus, antibodies or antisera, preferably polyclonal antisera, and most preferably monoclonal antibodies specific for each marker are used to detect expression. The antibodies can be detected by direct labeling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase. Alternatively, 20 unlabeled primary antibody is used in conjunction with a labeled secondary antibody, comprising antisera, polyclonal antisera or a monoclonal antibody specific for the primary antibody. Immunohistochemistry protocols and kits are well known in the art and are commercially available. 7. Proteomics 25 The term "proteome" is defined as the totality of the proteins present in a sample (e.g. tissue, organism, or cell culture) at a certain point of time. Proteomics includes, among other things, study of the global changes of protein expression in a sample (also referred to as "expression proteomics"). Proteomics typically includes the following steps: (1) separation of individual proteins in a sample by 2-D gel electrophoresis (2-D PAGE); (2) identification 30 of the individual proteins recovered from the gel, e.g. my mass spectrometry or N-terminal sequencing, and (3) analysis of the data using bioinformatics. Proteomics methods are valuable supplements to other methods of gene expression profiling, and can be used, alone 20 4058201_1 (GHMatters) P59406.AU.2 or in combination with other methods, to detect the products of the prognostic markers of the present invention. 8. General Description of the mRNA Isolation, Purification and Amplification 5 The steps of a representative protocol for profiling gene expression using fixed, paraffin-embedded tissues as the RNA source, including mRNA isolation, purification, primer extension and amplification are provided in various published journal articles (for example: T.E. Godfrey et al,. J Molec. Diagnostics 2: 84-91 [2000]; K. Specht et al., Am. J Pathol. 158: 419-29 [2001]). Briefly, a representative process starts with cutting about 10 10 pm thick sections of paraffin-embedded tumor tissue samples. The RNA is then extracted, and protein and DNA are removed. After analysis of the RNA concentration, RNA repair and/or amplification steps may be included, if necessary, and RNA is reverse transcribed using gene specific promoters followed by RT-PCR. Finally, the data are analyzed to identify the best treatment option(s) available to the patient on the basis of the characteristic 15 gene expression pattern identified in the tumor sample examined, dependent on the predicted likelihood of cancer recurrence. 9. Breast Cancer Gene Set, Assaved Gene Subsequences, and Clinical Application of Gene Expression Data An important aspect of the present invention is to use the measured expression of 20 certain genes by breast cancer tissue to provide prognostic information. For this purpose it is necessary to correct for (normalize away) both differences in the amount of RNA assayed and variability in the quality of the RNA used. Therefore, the assay typically measures and incorporates the expression of certain normalizing genes, including well known housekeeping genes, such as GAPDH and Cyp1. Alternatively, normalization can be based 25 on the mean or median signal (Ct) of all of the assayed genes or a large subset thereof (global normalization approach). On a gene-by-gene basis, measured normalized amount of a patient tumor mRNA is compared to the amount found in a breast cancer tissue reference set. The number (N) of breast cancer tissues in this reference set should be sufficiently high to ensure that different reference sets (as a whole) behave essentially the same way. If this condition is 30 met, the identity of the individual breast cancer tissues present in a particular set will have no significant impact on the relative amounts of the genes assayed. Usually, the breast cancer tissue reference set consists of at least about 30, preferably at least about 40 different FPE 21 4058201_1 (GHMatters) P59406.AU.2 breast cancer tissue specimens. Unless noted otherwise, normalized expression levels for each mRNA/tested tumor/patient will be expressed as a percentage of the expression level measured in the reference set. More specifically, the reference set of a sufficiently high number (e.g. 40) of tumors yields a distribution of normalized levels of each mRNA species. 5 The level measured in a particular tumor sample to be analyzed falls at some percentile within this range, which can be determined by methods well known in the art. Below, unless noted otherwise, reference to expression levels of a gene assume normalized expression relative to the reference set although this is not always explicitly stated. 10. Design of Intron-Based PCR Primers and Probes 10 According to one aspect of the present invention, PCR primers and probes are designed based upon intron sequences present in the gene to be amplified. Accordingly, the first step in the primer/probe design is the delineation of intron sequences within the genes. This can be done by publicly available software, such as the DNA BLAT software developed by Kent, W.J., Genome Res. 12(4):656-64 (2002), or by the BLAST software including its 15 variations. Subsequent steps follow well established methods of PCR primer and probe design. In order to avoid non-specific signals, it is important to mask repetitive sequences within the introns when designing the primers and probes. This can be easily accomplished by using the Repeat Masker program available on-line through the Baylor College of 20 Medicine, which screens DNA sequences against a library of repetitive elements and returns a query sequence in which the repetitive elements are masked. The masked intron sequences can then be used to design primer and probe sequences using any commercially or otherwise publicly available primer/probe design packages, such as Primer Express (Applied Biosystems); MGB assay-by-design (Applied Biosystems); Primer3 (Steve Rozen and Helen 25 J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386) The most important factors considered in PCR primer design include primer length, melting temperature (Tm), and G/C content, specificity, complementary primer sequences, 30 and 3'-end sequence. In general, optimal PCR primers are generally 17-30 bases in length, and contain about 20-80%, such as, for example, about 50-60% G+C bases. Tm's between 50 and 80 'C, e.g. about 50 to 70 'C are typically preferred. 22 4058201_1 (GHMatters) P59406.AU.2 For further guidelines for PCR primer and probe design see, e.g. Dieffenbach, C.W. et al., "General Concepts for PCR Primer Design" in: PCR Primer, A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1995, pp. 133-155; Innis and Gelfand, "Optimization of PCRs" in: PCR Protocols, A Guide to Methods and Applications, CRC 5 Press, London, 1994, pp. 5-11; and Plasterer, T.N. Primerselect: Primer and probe design. Methods Mol. Biol. 70:520-527 (1997), the entire disclosures of which are hereby expressly incorporated by reference. Further details of the invention will be described in the following non-limiting Example. 10 23 4058201_1 (GHMatters) P59406.AU.2 Example A Phase II Study of Gene Expression in 242 Malignant Breast Tumors A gene expression study was designed and conducted with the primary goal to molecularly characterize gene expression in paraffin-embedded, fixed tissue samples of 5 invasive breast ductal carcinoma, and to explore the correlation between such molecular profiles and disease-free survival. Studv design Molecular assays were performed on paraffin-embedded, formalin-fixed primary breast tumor tissues obtained from 252 individual patients diagnosed with invasive breast 10 cancer. All patients were lymph node-negative, ER-positive, and treated with Tamoxifen. Mean age was 52 years, and mean clinical tumor size was 2 cm. Median follow-up was 10.9 years. As of January 1, 2003, 41 patients had local or distant disease recurrence or breast cancer death. Patients were included in the study only if histopathologic assessment, performed as described in the Materials and Methods section, indicated adequate amounts of 15 tumor tissue and homogeneous pathology. Materials and Methods Each representative tumor block was characterized by standard histopathology for diagnosis, semi-quantitative assessment of amount of tumor, and tumor grade. When tumor area was less than 70% of the section, the tumor area was grossly dissected and tissue was 20 taken from 6 (10 micron) sections. Otherwise, a total of 3 sections (also 10 microns in thickness each) were prepared. Sections were placed in two Costar Brand Microcentrifuge Tubes (Polypropylene, 1.7 mL tubes, clear). If more than one tumor block was obtained as part of the surgical procedure, the block most representative of the pathology was used for analysis. 25 Gene Expression Analvsis mRNA was extracted and purified from fixed, paraffin-embedded tissue samples, and prepared for gene expression analysis as described in chapter 6 above. Molecular assays of quantitative gene expression were performed by RT-PCR, using the ABI PRISM 7900TM Sequence Detection SystemTM (Perkin-Elmer-Applied Biosystems, 30 Foster City, CA, USA). ABI PRISM 7900TM consists of a thermocycler, laser, charge-coupled device (CCD), camera and computer. The system amplifies samples in a 384-well format on a thermocycler. During amplification, laser-induced fluorescent signal is 24 4058201_1 (GHMatters) P59406.AU.2 collected in real-time through fiber optics cables for all 384 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data. Analysis and Results Tumor tissue was analyzed for 187 cancer-related genes and 5 reference genes. 5 Adequate RT-PCR profiles were obtained from 242 of the 252 patients. The threshold cycle (CT) values for each patient were normalized based on the median of the 7 reference genes for that particular patient. Clinical outcome data were available for all patients from a review of registry data and selected patient charts. Outcomes were classified as: Event: Alive with local, regional or distant breast cancer recurrence or death 10 due to breast cancer. No Event: Alive without local, regional or distant breast cancer recurrence or alive with contralateral breast cancer recurrence or alive with non-breast second primary cancer or died prior to breast cancer recurrence. Analysis was performed by: 15 A. determination of the relationship between normalized gene expression and the binary outcomes of 0 or 1; B. Analysis of the relationship between normalized gene expression and the time to outcome (0 or 1 as defined above) where patients who were alive without breast cancer recurrence or who died due to a cause other than breast cancer were censored. This approach 20 was used to evaluate the prognostic impact of individual genes and also sets of multiple genes. Analysis of patients with invasive breast carcinoma bv binarv approach In the first (binary) approach, analysis was performed on all 242 patients with invasive breast carcinoma. A t test was performed on the groups of patients classified as 25 either no recurrence and no breast cancer related death at 10 years, versus recurrence, or breast cancer-related death at 10 years, and the p-values for the differences between the groups for each gene were calculated. Table 1 lists the 33 genes for which the p-value for the differences between the groups was <0.05. The first column of mean expression values pertains to patients who had a 30 metastatic recurrence of nor died from breast cancer. The second column of mean expression values pertains to patients who neither had a metastatic recurrence of nor died from breast cancer. 25 4058201_1 (GHMatters) P59406.AU.2 Table 1 Mean group Mean group A B Gene Event No event T statistic P value MMP9 -3.15 -4.27 3.75 0.00 GSTM1 -5.02 -4.03 -3.56 0.00 MELK -3.89 -4.66 3.34 0.00 PR -4.56 -3.18 -3.27 0.00 DKFZp586MO7 -3.83 -2.94 -3.09 0.00 GSTM3 -2.56 -1.69 -3.06 0.00 MCM2 -3.51 -4.08 3.03 0.00 CDC20 -3.01 -3.75 3.01 0.00 CCNB1 -4.48 -5.17 3.02 0.00 STMY3 -0.58 -1.20 2.95 0.00 GRB7 -1.93 -3.01 2.98 0.00 MYBL2 -3.91 -4.78 2.91 0.01 CEGP1 -3.00 -1.85 -2.89 0.01 SURV -4.23 -5.06 2.88 0.01 LMNB1 -2.40 -2.91 2.81 0.01 CTSL2 -5.74 -6.39 2.83 0.01 PTTG1 -3.49 -4.14 2.72 0.01 BAG1 -1.76 -1.30 -2.58 0.01 KNSL2 -3.35 -4.06 2.60 0.01 CIAP1 -4.44 -4.02 -2.58 0.01 PREP -3.34 -3.74 2.56 0.01 NEK2 -5.25 -5.80 2.53 0.01 EpCAM -1.95 -2.31 2.50 0.01 PCNA -2.79 -3.13 2.42 0.02 C20_orf1 -2.48 -3.09 2.39 0.02 ITGA7 -4.53 -3.87 -2.37 0.02 ID1 -2.58 -2.17 -2.30 0.02 B_Catenin -1.32 -1.08 -2.28 0.03 EstR1 -0.78 -0.12 -2.28 0.03 CDH1 -2.76 -3.27 2.20 0.03 TS -2.86 -3.29 2.18 0.03 HER2 0.53 -0.22 2.18 0.03 cMYC -3.22 -2.85 -2.16 0.04 In the foregoing Table 1, negative t-values indicate higher expression, associated with 5 better outcomes, and, inversely, higher (positive) t-values indicate higher expression associated with worse outcomes. Thus, for example, elevated expression of the CCNB 1 gene (t-value = 3.02; CT mean alive< CT mean deceased) indicates a reduced likelihood of disease free survival. Similarly, elevated expression of the GSTM1 gene (t-value = -3.56; CT mean alive> CT mean deceased) indicates an increased likelihood of disease free survival. 26 4058201_1 (GHMatters) P59406.AU.2 Thus, based on the data set forth in Table 1, the expression of any of the following genes in breast cancer indicates a reduced likelihood of survival without cancer recurrence: C20_orfl; CCNB1; CDC20; CDH1; CTSL2; EpCAM; GRB7; HER2; KNSL2; LMNB1; MCM2; MMP9; MYBL2; NEK2; PCNA; PREP; PTTG1; STMY3; SURV; TS; MELK. 5 Based on the data set forth in Table 1, the expression of any of the following genes in breast cancer indicates a better prognosis for survival without cancer recurrence: BAGI; BCatenin; CEGP1; CIAPI; cMYC; DKFZp586MO7; EstRI; GSTM1; GSTM3; IDI; ITGA7; PR. 10 Analvsis of multiple genes and indicators of outcome Two approaches were taken in order to determine whether using multiple genes would provide better discrimination between outcomes. First, a discrimination analysis was performed using a forward stepwise approach. Models were generated that classified outcome with greater discrimination than was obtained with any single gene alone.; 15 According to a second approach (time-to-event approach), for each gene a Cox Proportional Hazards model (see, e.g. Cox, D. R., and Oakes, D. (1984), Analysis of Survival Data, Chapman and Hall, London, New York) was defined with time to recurrence or death as the dependent variable, and the expression level of the gene as the independent variable. The genes that have a p-value < 0.05 in the Cox model were identified. For each gene, the Cox 20 model provides the relative risk (RR) of recurrence or death for a unit change in the expression of the gene. One can choose to partition the patients into subgroups at any threshold value of the measured expression (on the CT scale), where all patients with expression values above the threshold have higher risk, and all patients with expression values below the threshold have lower risk, or vice versa, depending on whether the gene is 25 an indicator of bad (RR>1.01) or good (RR<1.01) prognosis. Thus, any threshold value will define subgroups of patients with respectively increased or decreased risk. The results are summarized in Table 2, which lists the 42 genes for which the p-value for the differences between the groups was <0.05. 27 4058201_1 (GHMatters) P59406.AU.2 Table 2 Gene Relative Risk p-value GRB7 1.52 0.000011 SURV 1.57 0.000090 PR 0.74 0.000129 LMNB1 1.92 0.000227 MYBL2 1.46 0.000264 HER2 1.46 0.000505 GSTM1 0.68 0.000543 MELK 1.59 0.000684 C20_orf1 1.59 0.000735 PTTG1 1.63 0.001135 BUB1 1.58 0.001425 CDC20 1.54 0.001443 CCNB1 1.60 0.001975 STMY3 1.47 0.002337 KNSL2 1.48 0.002910 CTSL2 1.43 0.003877 MCM2 1.59 0.005203 NEK2 1.48 0.006533 DR5 0.62 0.006660 Ki_67 1.46 0.008188 CCNE2 1.38 0.009505 TOP2A 1.38 0.009551 PCNA 1.67 0.010237 PREP 1.69 0.012308 FOXM1 1.52 0.012837 NME1 1.46 0.013622 CEGP1 0.84 0.013754 BAG1 0.68 0.015422 STK15 1.46 0.017013 HNRPAB 1.96 0.017942 EstR1 0.80 0.018877 MMP9 1.19 0.019591 DKFZp586MO7 0.79 0.020073 TS 1.44 0.025186 Src 1.70 0.037398 BIN1 0.75 0.038979 NPDO09 0.80 0.039020 RPLPO 0.52 0.041575 GSTM3 0.84 0.041848 MMP12 1.27 0.042074 TFRC 1.57 0.046145 IGF1R 0.78 0.046745 Based on the data set forth in Table 2, the expression of any of the following genes in breast cancer indicates a reduced likelihood of survival without cancer recurrence: GRB7; 5 SURV; LMNB1; MYBL2; HER2; MELK; C20_orfl; PTTG1; BUBI; CDC20; CCNB1; 28 4058201_1 (GHMatters) P59406.AU.2 STMY3; KNSL2; CTSL2; MCM2; NEK2; Ki_67; CCNE2; TOP2A-4; PCNA; PREP; FOXM1; NME1; STK15; HNRPAB; MMP9; TS; Src; MMP12; TFRC. Based on the data set forth in Table 2, the expression of any of the following genes in breast cancer indicates a better prognosis for survival without cancer recurrence: PR; 5 GSTM1; DR5; CEGP1; BAGI; EstRI; DKFZp586M07; BINI; NPD009; RPLPO; GSTM3; IGF1R. The binary and time-to-event analyses, with few exceptions, identified the same genes as prognostic markers. For example, comparison of Tables 1 and 2 shows that 10 genes were represented in the top 15 genes in both lists. Furthermore, when both analyses 10 identified the same gene at [<0.10], which happened for 26 genes, they were always concordant with respect to the direction (positive or negative sign) of the correlation with survival/recurrence. Overall, these results strengthen the conclusion that the identified markers have significant prognostic value. Multivariate gene analysis of 242 patients with invasive breast carcinoma 15 For Cox models comprising more than two genes (multivariate models), stepwise entry of each individual gene into the model is performed, where the first gene entered is pre selected from among those genes having significant univariate p-values, and the gene selected for entry into the model at each subsequent step is the gene that best improves the fit of the model to the data. This analysis can be performed with any total number of genes. In 20 the analysis the results of which are shown below, stepwise entry was performed for up to 10 genes. Multivariate analysis was performed using the following equation:; RR=exp[coef(geneA) x Ct(geneA) + coef(geneB) x Ct(geneB) + coef(geneC) x Ct(geneC) + 25 In this equation, coefficients for genes that are predictors of beneficial outcome are positive numbers and coefficients for genes that are predictors of unfavorable outcome are negative numbers. The "Ct" values in the equation are ACts, i.e. reflect the difference between the average normalized Ct value for a population and the normalized Ct measured for the patient in question. The convention used in the present analysis has been that ACts 30 below and above the population average have positive signs and negative signs, respectively (reflecting greater or lesser mRNA abundance). The relative risk (RR) calculated by solving 29 4058201_1 (GHMatters) P59406.AU.2 this equation will indicate if the patient has an enhanced or reduced chance of long-term survival without cancer recurrence. A multivariate stepwise analysis, using the Cox Proportional Hazards Model, was performed on the gene expression data obtained for all 242 patients with invasive breast 5 carcinoma. The following ten-gene set has been identified by this analysis as having particularly strong predictive value of patient survival: GRB7; LMNB1; ER; STMY3; KLK1O; PR; KRT5; FGFR1; MCM6; SNRPF. In this gene set ER, PR, KRT5 and MCM6 contribute to good prognosis, while GRB7, LMNB1, STMY3, KLK1O, FGFR1, and SNRPF contribute to poor prognosis. 10 While the present invention has been described with reference to what are considered to be the specific embodiments, it is to be understood that the invention is not limited to such embodiments. To the contrary, the invention is intended to cover various modifications and equivalents included within the spirit and scope of the appended claims. For example, while the disclosure focuses on the identification of various breast cancer associated genes and gene 15 sets, and on the personalized prognosis of breast cancer, similar genes, gene sets and methods concerning other types of cancer are specifically within the scope herein. In particular, the present gene sets or variants thereof can be used as prognostic markers to predict the likelihood of long-term survival or cancer recurrence in the case of ovarian cancer. All references cited throughout the disclosure are hereby expressly incorporated by 20 reference. TABLE 3 Gene Accessi Start Stop SEQ ID Sequence on NO. B- NM_001 1549 1629 SEQ ID GGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCT Catenin 904 NO: 1 GTGCTCTTCGTCATCTGA BAG1 NM_004 673 754 SEQ ID CGTTGTCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTC 323 NO: 2 CACAGGAAGAGGTTGAAC BIN1 NM_004 866 942 SEQ ID CCTGCAAAAGGGAACAAGAGCCCTTCGCCTCCAGATGGCTCCCCTGCCGCCACCCCCGAGAT 305 NO: 3 CAGAGTCAACCACG BUB1 NM_004 1002 1070 SEQ ID CCGAGGTTAATCCAGCACGTATGGGGCCAAGTGTAGGCTCCCAGCAGGAACTGAGAGCGCCA 336 NO:4 TGTCTT C20 NM_012 2675 2740 SEQ ID TCAGCTGTGAGCTGCGGATACCGCCCGGCAATGGGACCTGCTCTTAACCTCAAACCTAGGAC orf1 112 NO: 5 CGT CCNB1 NM_031 823 907 SEQ ID TTCAGGTTGTTGCAGGAGACCATGTACATGACTGTCTCCATTATTGATCGGTTCATGCAGAATA 966 NO: 6 ATTGTGTGCCCAAGAAGATG CCNE2 NM_057 2026 2108 SEQ ID ATGCTGTGGCTCCTTCCTAACTGGGGCTTTCTTGACATGTAGGTTGCTTGGTAATAACCTTTTT 749 NO: 7 GTATATCACAATTTGGGT CDC20 NM_001 679 747 SEQ ID TGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGT 255 NO:8 GCAAGC CDH1 NM_004 2499 2580 SEQ ID TGAGTGTCCCCCGGTATCTTCCCCGCCCTGCCAATCCCGATGAAATTGGAAATTTTATTGATGA 360 NO: 9 AAATCTGAAAGCGGCTG CEGP1 NM_020 563 640 SEQ ID TGACAATCAGCACACCTGCATTCACCGCTCGGAAGAGGGCCTGAGCTGCATGAATAAGGATCA 974 NO: 10 CGGCTGTAGTCACA CIAP1 NM_001 1822 1894 SEQ ID TGCCTGTGGTGGGAAGCTCAGTAACTGGGAACCAAAGGATGATGCTATGTCAGAACACCGGA 166 NO: 11 GGCATTTTCC cMYC NM_002 1494 1578 SEQ ID TCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCT 467 NO: 12 GAGACAGATCAGCAACAACCG CTSL2 NM_001 671 738 SEQ ID TGTCTCACTGAGCGAGCAGAATCTGGTGGACTGTTCGCGTCCTCAAGGCAATCAGGGCTGCAA 333 NO:13 TGGT 30 4058201_1 (GHMatters) P59406.AU.2 DKFZp AL05022 559 633 SEQ ID TCCATTTTCTACCTGTTAACCTTCATCATTTTGTGCAGGCCCTGGAAGCAAAGAGAGGAAGGGA 586 7 NO: 14 CCGACTGCAT DR5 NM_003 1127 1211 SEQ ID CTCTGAGACAGTGCTTCGATGACTTTGCAGACTTGGTGCCCTTTGACTCCTGGGAGCCGCTCA 842 NO: 15 TGAGGAAGTTGGGCCTCATGG EpCAM NM_002 435 510 SEQ ID GGGCCCTCCAGAACAATGATGGGCTTTATGATCCTGACTGCGATGAGAGCGGGCTCTTTAAGG 354 NO: 16 CCAAGCAGTGCA EstR1 NM_000 1956 2024 SEQ ID CGTGGTGCCCCTCTATGACCTGCTGCTGGAGATGCTGGACGCCCACCGCCTACATGCGCCCA 125 NO: 17 CTAGCC FGFR1 NM_023 2685 2759 SEQ ID CACGGGACATTCACCACATCGACTACTATAAAAAGACAACCAACGGCCGACTGCCTGTGAAGT 109 NO: 18 GGATGGCACCC FOXM1 NM_021 1898 1980 SEQ ID CCACCCCGAGCAAATCTGTCCTCCCCAGAACCCCTGAATCCTGGAGGCTCACGCCCCCAGCC 953 NO: 19 AAAGTAGGGGGACTGGATTT GRB7 NM_005 1275 1342 SEQ ID CCATCTGCATCCATCTTGTTTGGGCTCCCCACCCTTGAGAAGTGCCTCAGATAATACCCTGGT 310 NO: 20 GGCC GSTM1 NM_000 93 179 SEQ ID AAGCTATGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGTGGCT 561 NO: 21 GAATGAAAAATTCAAGCTGGGCC GSTM3 NM_000 248 324 SEQ ID CAATGCCATCTTGCGCTACATCGCTCGCAAGCACAACATGTGTGGTGAGACTGAAGAAGAAAA 849 NO:22 GATTCGAGTGGAC HER2 NM_004 1138 1208 SEQ ID CGGTGTGAGAAGTGCAGCAAGCCCTGTGCCCGAGTGTGCTATGGTCTGGGCATGGAGCACTT 448 NO:23 GCGAGAGG HNRPA NM_004 1086 1170 SEQ ID CAAGGGAGCGACCAACTGATCGCACACATGCTTTGTTTGGATATGGAGTGAACACAATTATGTA B 499 NO: 24 CCAAATTTAACTTGGCAAAC ID1 NM_002 286 356 SEQ ID AGAACCGCAAGGTGAGCAAGGTGGAGATTCTCCAGCACGTCATCGACTACATCAGGGACCTTC 165 NO: 25 AGTTGGA IGF1R NM_000 3467 3550 SEQ ID GCATGGTAGCCGAAGATTTCACAGTCAAAATCGGAGATTTTGGTATGACGCGAGATATCTATGA 875 NO: 26 GACAGACTATTACCGGAAA ITGA7 NM_002 633 712 SEQ ID GATATGATTGGTCGCTGCTTTGTGCTCAGCCAGGACCTGGCCATCCGGGATGAGTTGGATGGT 206 NO: 27 GGGGAATGGAAGTTCT KI-67 NM_002 42 122 SEQ ID CGGACTTTGGGTGCGACTTGACGAGCGGTGGTTCGACAAGTGGCCTTGCGGGCCGGATCGTC 417 NO: 28 CCAGTGGAAGAGTTGTAA KLK10 NM_002 966 1044 SEQ ID GCCCAGAGGCTCCATCGTCCATCCTCTTCCTCCCCAGTCGGCTGAACTCTCCCCTTGTCTGCA 776 NO: 29 CTGTTCAAACCTCTG KNSL2 BC0007 1266 1343 SEQ ID CCACCTCGCCATGATTTTTCCTTTGACCGGGTATTCCCACCAGGAAGTGGACAGGATGAAGTG 12 NO: 30 TTTGAAGAGATTGC KRT5 NM_000 1605 1674 SEQ ID TCAGTGGAGAAGGAGTTGGACCAGTCAACATCTCTGTTGTCACAAGCAGTGTTTCCTCTGGAT 424 NO: 31 ATGGCA LMNB1 NM_005 1500 1566 SEQ ID TGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTG 573 NO: 32 GGG MCM2 NM_004 2442 2517 SEQ ID GACTTTTGCCCGCTACCTTTCATTCCGGCGTGACAACAATGAGCTGTTGCTCTTCATACTGAAG 526 NO:33 CAGTTAGTGGC MCM6 NM_005 2669 2751 SEQ ID TGATGGTCCTATGTGTCACATTCATCACAGGTTTCATACCAACACAGGCTTCAGCACTTCCTTT 915 NO: 34 GGTGTGTTTCCTGTCCCA MELK NM_014 22 87 SEQ ID AACCCGGCGATCGAAAAGATTCTTAGGAACGCCGTACCAGCCGCGTCTCTCAGGACAGCAGG 791 NO:35 CCC MMP12 NM_002 816 894 SEQ ID CCAACGCTTGCCAAATCCTGACAATTCAGAACCAGCTCTCTGTGACCCCAATTTGAGTTTTGAT 426 NO: 36 GCTGTCACTACCGT MMP9 NM_004 124 191 SEQ ID GAGAACCAATCTCACCGACAGGCAGCTGGCAGAGGAATACCTGTACCGCTATGGTTACACTCG 994 NO: 37 GGTG MYBL2 NM_002 599 673 SEQ ID GCCGAGATCGCCAAGATGTTGCCAGGGAGGACAGACAATGCTGTGAAGAATCACTGGAACTC 466 NO: 38 TACCATCAAAAG NEK2 NM_002 102 181 SEQ ID GTGAGGCAGCGCGACTCTGGCGACTGGCCGGCCATGCCTTCCCGGGCTGAGGACTATGAAG 497 NO:39 TGTTGTACACCATTGGCA NME1 NM_000 365 439 SEQ ID CCAACCCTGCAGACTCCAAGCCTGGGACCATCCGTGGAGACTTCTGCATACAAGTTGGCAGG 269 NO: 40 AACATTATACAT NPDOO NM_020 589 662 SEQ ID GGCTGTGGCTGAGGCTGTAGCATCTCTGCTGGAGGTGAGACACTCTGGGAACTGATTTGACCT 9 686 NO:41 CGAATGCTCC PCNA NM_002 157 228 SEQ ID GAAGGTGTTGGAGGCACTCAAGGACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCG 592 NO: 42 GTGTAAACC PR NM_000 1895 1980 SEQ ID GCATCAGGCTGTCATTATGGTGTCCTTACCTGTGGGAGCTGTAAGGTCTTCTTTAAGAGGGCA 926 NO: 43 ATGGAAGGGCAGCACAACTACT PREP NM_002 889 965 SEQ ID GGGACGGTGTTCACATTCAAGACGAATCGCCAGTCTCCCAACTATCGCGTGATCAACATTGAC 726 NO:44 TTCTGGGATCCTG PTTG1 NM_004 48 122 SEQ ID GGCTACTCTGATCTATGTTGATAAGGAAAATGGAGAACCAGGCACCCGTGTGGTTGCTAAGGA 219 NO:45 TGGGCTGAAGC RPLPO NM_001 791 866 SEQ ID CCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTT 002 NO:46 CCCACTTGCTGA SNRPF NM_003 71 150 SEQ ID GGCTGGTCGGCAGAGAGTAGCCTGCAACATTCGGCCGTGGTTTACATGAGTTTACCCCTCAAT 095 NO: 47 CCCAAACCTTTCCTCA Src NM_004 979 1043 SEQ ID CCTGAACATGAAGGAGCTGAAGCTGCTGCAGACCATCGGGAAGGGGGAGTTCGGAGACGTGA 383 NO:48 TG STK15 NM_003 1101 1170 SEQ ID CATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATGATTGAAG 600 NO:49 GTCGGA STMY3 NM_005 2090 2180 SEQ ID CCTGGAGGCTGCAACATACCTCAATCCTGTCCCAGGCCGGATCCTCCTGAAGCCCTTTTCGCA 940 NO: 50 GCACTGCTATCCTCCAAAGCCATTGTA SURV NM_001 737 817 SEQ ID TGTTTTGATTCCCGGGCTTACCAGGTGAGAAGTGAGGGAGGAAGAAGGCAGTGTCCCTTTTGC 168 NO: 51 TAGAGCTGACAGCTTG TFRC NM_003 2110 2178 SEQ ID GCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCC 234 NO:52 TGAGT TOP2A NM_001 4505 4577 SEQ ID AATCCAAGGGGGAGAGTGATGACTTCCATATGGACTTTGACTCAGCTGTGGCTCCTCGGGCAA 067 NO: 53 AATCTGTAC TS NM_001 764 829 SEQ ID GCCTCGGTGTGCCTTTCAACATCGCCAGCTACGCCCTGCTCACGTACATGATTGCGCACATCA 071 NO: 54 CG 31 4058201_1 (GHMatters) P59406.AU.2 TABLE 4 Gene Accession Name SEQ ID NO Sequence B-Catenin NM 001904 S2150/B-Cate.f3 SEQ ID NO:55 GGCTCTTGTGCGTACTGTCCTT 22 B-Catenin NM_001904 S2151/B-Cate.r3 SEQ ID NO:56 TCAGATGACGAAGAGCACAGATG 23 B-Catenin NM_001904 S5046/B-Cate.p3 SEQ ID NO:57 AGGCTCAGTGATGTCTTCCCTGTCACCAG 29 BAG1 NM_004323 S1 386/BAG1.f2 SEQ ID NO:58 CGTTGTCAGCACTTGGAATACAA 23 BAG1 NM_004323 S1 387/BAG1.r2 SEQ ID NO:59 GTTCAACCTCTTCCTGTGGACTGT 24 BAG1 NM_004323 S4731/BAG1.p2 SEQ ID NO:60 CCCAATTAACATGACCCGGCAACCAT 26 BIN1 NM_004305 S2651/BIN1.f3 SEQ ID NO:61 CCTGCAAAAGGGAACAAGAG 20 BIN1 NM_004305 S2652/BIN1.r3 SEQ ID NO:62 CGTGGTTGACTCTGATCTCG 20 BIN1 NM_004305 S4954/BIN1.p3 SEQ ID NO:63 CTTCGCCTCCAGATGGCTCCC 21 BUB1 NM 004336 S4294/BUB1.f1 SEQ ID NO:64 CCGAGGTTAATCCAGCACGTA 21 BUB1 NM_004336 S4295/BUB1.r1 SEQ ID NO:65 AAGACATGGCGCTCTCAGTTC 21 BUB1 NM_004336 S4296/BUB1.p1 SEQ ID NO:66 TGCTGGGAGCCTACACTTGGCCC 23 C20 orf1 NM 012112 S3560/C20 or.f1 SEQ ID NO:67 TCAGCTGTGAGCTGCGGATA 20 C20 orf1 NM_012112 S3561/C20 or.rl SEQ ID NO:68 ACGGTCCTAGGTTTGAGGTTAAGA 24 C20 orfl NM_012112 S3562/C20 or.pl SEQ ID NO:69 CAGGTCCCATTGCCGGGCG 19 CCNB1 NM_031966 S1720/CCNB1.f2 SEQ ID NO:70 TTCAGGTTGTTGCAGGAGAC 20 CCNB1 NM_031966 S1721/CCNB1.r2 SEQ ID NO:71 CATCTTCTTGGGCACACAAT 20 CCNB1 NM_031966 S4733/CCNB1.p2 SEQ ID NO:72 TGTCTCCATTATTGATCGGTTCATGCA 27 CCNE2 NM_057749 S1458/CCNE2.f2 SEQ ID NO:73 ATGCTGTGGCTCCTTCCTAACT 22 CCNE2 NM_057749 S1459/CCNE2.r2 SEQ ID NO:74 ACCCAAATTGTGATATACAAAAAGGTT 27 CCNE2 NM_057749 S4945/CCNE2.p2 SEQ ID NO:75 TACCAAGCAACCTACATGTCAAGAAAGCCC 30 CDC20 NM 001255 S4447/CDC20.f1 SEQ ID NO:76 TGGATTGGAGTTCTGGGAATG 21 CDC20 NM_001255 S4448/CDC20.rl SEQ ID NO:77 GCTTGCACTCCACAGGTACACA 22 CDC20 NM_001255 S4449/CDC20.pl SEQ ID NO:78 ACTGGCCGTGGCACTGGACAACA 23 CDH1 NM 004360 S0073/CDH1.f3 SEQ ID NO:79 TGAGTGTCCCCCGGTATCTTC 21 CDH1 NM_004360 S0075/CDH1.r3 SEQ ID NO:80 CAGCCGCTTTCAGATTTTCAT 21 CDH1 NM_004360 S4990/CDH1.p3 SEQ ID NO:81 TGCCAATCCCGATGAAATTGGAAATTT 27 CEGP1 NM_020974 S1494/CEGP1.f2 SEQ ID NO:82 TGACAATCAGCACACCTGCAT 21 CEGP1 NM_020974 S1495/CEGP1.r2 SEQ ID NO:83 TGTGACTACAGCCGTGATCCTTA 23 CEGP1 NM_020974 S4735/CEGP1.p2 SEQ ID NO:84 CAGGCCCTCTTCCGAGCGGT 20 CIAP1 NM_001166 S0764/CIAP1.f2 SEQ ID NO:85 TGCCTGTGGTGGGAAGCT 18 CIAP1 NM_001166 S0765/CIAP1.r2 SEQ ID NO:86 GGAAAATGCCTCCGGTGTT 19 CIAP1 NM_001166 S4802/CIAP1.p2 SEQ ID NO:87 TGACATAGCATCATCCTTTGGTTCCCAGTT 30 cMYC NM 002467 S0085/cMYC.f3 SEQ ID NO:88 TCCCTCCACTCGGAAGGACTA 21 cMYC NM_002467 S0087/cMYC.r3 SEQ ID NO:89 CGGTTGTTGCTGATCTGTCTCA 22 cMYC NM_002467 S4994/cMYC.p3 SEQ ID NO:90 TCTGACACTGTCCAACTTGACCCTCTT 27 CTSL2 NM 001333 S4354/CTSL2.fl SEQ ID NO:91 TGTCTCACTGAGCGAGCAGAA 21 CTSL2 NM_001333 S4355/CTSL2.rl SEQ ID NO:92 ACCATTGCAGCCCTGATTG 19 CTSL2 NM_001333 S4356/CTSL2.pl SEQ ID NO:93 CTTGAGGACGCGAACAGTCCACCA 24 DKFZp586M0723 AL050227 S4396/DKFZp5.f1 SEQ ID NO:94 TCCATTTTCTACCTGTTAACCTTCATC 27 DKFZp586M0723 AL050227 S4397/DKFZp5.rl SEQ ID NO:95 ATGCAGTCGGTCCCTTCCT 19 DKFZp586M0723 AL050227 S4398/DKFZpS.pl SEQ ID NO:96 TTGCTTCCAGGGCCTGCACAAAA 23 DR5 NM_003842 S2551/DR5.f2 SEQ ID NO:97 CTCTGAGACAGTGCTTCGATGACT 24 DR5 NM_003842 S2552/DR5.r2 SEQ ID NO:98 CCATGAGGCCCAACTTCCT 19 DR5 NM_003842 S4979/DR5.p2 SEQ ID NO:99 CAGACTTGGTGCCCTTTGACTCC 23 EpCAM NM_002354 S1807/EpCAM.f1 SEQ ID NO:100 GGGCCCTCCAGAACAATGAT 20 EpCAM NM_002354 S1808/EpCAM.rl SEQ ID NO:101 TGCACTGCTTGGCCTTAAAGA 21 32 4058201_1 (GHMatters) P59406.AU.2 Gene Accession Name SEQ ID NO Sequence EpCAM NM_002354 S4984/EpCAM.p1 SEQ ID NO:102 CCGCTCTCATCGCAGTCAGGATCAT 25 EstR1 NM 000125 S0115/EstR1.f1 SEQ ID NO:103 CGTGGTGCCCCTCTATGAC 19 EstR1 NM_000125 S0117/EstR1.r1 SEQ ID NO:104 GGCTAGTGGGCGCATGTAG 19 EstR1 NM_000125 S4737/EstR1.p1 SEQ ID NO:105 CTGGAGATGCTGGACGCCC 19 FGFR1 NM_023109 S0818/FGFR1.f3 SEQ ID NO:106 CACGGGACATTCACCACATC 20 FGFR1 NM_023109 S0819/FGFR1.r3 SEQ ID NO:107 GGGTGCCATCCACTTCACA 19 FGFR1 NM_023109 S4816/FGFR1.p3 SEQ ID NO:108 ATAAAAAGACAACCAACGGCCGACTGC 27 FOXM1 NM_021953 S2006/FOXM1.fl SEQ ID NO:109 CCACCCCGAGCAAATCTGT 19 FOXM1 NM_021953 S2007/FOXM1.r1 SEQ ID NO:110 AAATCCAGTCCCCCTACTTTGG 22 FOXM1 NM_021953 S4757/FOXM1.pl SEQ ID NO:111 CCTGAATCCTGGAGGCTCACGCC 23 GRB7 NM_005310 S0130/GRB7.f2 SEQ ID NO:112 ccatctgcatccatcftgft 20 GRB7 NM_005310 S0132/GRB7.r2 SEQ ID NO:113 ggccaccagggtattatctg 20 GRB7 NM_005310 S4726/GRB7.p2 SEQ ID NO:114 ctccccacccttgagaagtgcct 23 GSTM1 NM 000561 S2026/GSTM1.rl SEQ ID NO:115 GGCCCAGCTTGAATTTTTCA 20 GSTM1 NM_000561 S2027/GSTM1.fl SEQ ID NO:1 16 AAGCTATGAGGAAAAGAAGTACACGAT 27 GSTM1 NM_000561 S4739/GSTM1.pl SEQ ID NO:1 17 TCAGCCACTGGCTTCTGTCATAATCAGGAG 30 GSTM3 NM_000849 S2038/GSTM3.f2 SEQ ID NO:1 18 CAATGCCATCTTGCGCTACAT 21 GSTM3 NM_000849 S2039/GSTM3.r2 SEQ ID NO:1 19 GTCCACTCGAATCTTTTCTTCTTCA 25 GSTM3 NM_000849 S5064/GSTM3.p2 SEQ ID NO:120 CTCGCAAGCACAACATGTGTGGTGAGA 27 HER2 NM_004448 S0142/HER2.f3 SEQ ID NO:121 CGGTGTGAGAAGTGCAGCAA 20 HER2 NM_004448 S0144/HER2.r3 SEQ ID NO:122 CCTCTCGCAAGTGCTCCAT 19 HER2 NM_004448 S4729/HER2.p3 SEQ ID NO:123 CCAGACCATAGCACACTCGGGCAC 24 HNRPAB NM 004499 S4510/HNRPAB.f3 SEQ ID NO:124 CAAGGGAGCGACCAACTGA 19 HNRPAB NM_004499 S451 1/HNRPAB.r3 SEQ ID NO:125 GTTTGCCAAGTTAAATTTGGTACATAAT 28 HNRPAB NM_004499 S4512/HNRPAB.p3 SEQ ID NO:126 CTCCATATCCAAACAAAGCATGTGTGCG 28 ID1 NM 002165 S0820/ID1.f1 SEQ ID NO:127 AGAACCGCAAGGTGAGCAA 19 ID1 NM_002165 S0821/ID1.r1 SEQ ID NO:128 TCCAACTGAAGGTCCCTGATG 21 ID1 NM_002165 S4832/ID1.p1 SEQ ID NO:129 TGGAGATTCTCCAGCACGTCATCGAC 26 IGF1R NM_000875 S1249/IGF1R.f3 SEQ ID NO:130 GCATGGTAGCCGAAGATTTCA 21 IGF1R NM_000875 S1250/IGF1R.r3 SEQ ID NO:131 TTTCCGGTAATAGTCTGTCTCATAGATATC 30 IGF1R NM_000875 S4895/IGF1R.p3 SEQ ID NO:132 CGCGTCATACCAAAATCTCCGATTTTGA 28 ITGA7 NM_002206 S0859/ITGA7.f1 SEQ ID NO:133 GATATGATTGGTCGCTGCTTTG 22 ITGA7 NM_002206 S0920/ITGA7.rl SEQ ID NO:134 AGAACTTCCATTCCCCACCAT 21 ITGA7 NM_002206 S4795/ITGA7.pl SEQ ID NO:135 CAGCCAGGACCTGGCCATCCG 21 KI-67 NM 002417 S0436/Ki-67.f2 SEQ ID NO:136 CGGACTTTGGGTGCGACTT 19 Ki-67 NM_002417 S0437/Ki-67.r2 SEQ ID NO:137 TTACAACTCTTCCACTGGGACGAT 24 Ki-67 NM_002417 S4741/Ki-67.p2 SEQ ID NO:138 CCACTTGTCGAACCACCGCTCGT 23 KLK10 NM 002776 S2624/KLK1 0.f3 SEQ ID NO:139 GCCCAGAGGCTCCATCGT 18 KLK10 NM_002776 S2625/KLK1O.r3 SEQ ID NO:140 CAGAGGTTTGAACAGTGCAGACA 23 KLK10 NM_002776 S4978/KLK1O.p3 SEQ ID NO:141 CCTCTTCCTCCCCAGTCGGCTGA 23 KNSL2 BC000712 S4432/KNSL2.f2 SEQ ID NO:142 CCACCTCGCCATGATTTTTC 20 KNSL2 BC000712 S4433/KNSL2.r2 SEQ ID NO:143 GCAATCTCTTCAAACACTTCATCCT 25 KNSL2 BC000712 S4434/KNSL2.p2 SEQ ID NO:144 TTTGACCGGGTATTCCCACCAGGAA 25 KRT5 NM_000424 S0175/KRT5.f3 SEQ ID NO:145 tcagtggagaaggagttgga 20 KRT5 NM_000424 S0177/KRT5.r3 SEQ ID NO:146 tgccatatccagaggaaaca 20 KRT5 NM_000424 S5015/KRT5.p3 SEQ ID NO:147 ccagtcaacatctctgttgtcacaagca 28 LMNB1 NM 005573 S4477/LMNB1.fl SEQ ID NO:148 TGCAAACGCTGGTGTCACA 19 LMNB1 NM_005573 S4478/LMNB1.r1 SEQ ID NO:149 CCCCACGAGTTCTGGTTCTTC 21 33 4058201_1 (GHMatters) P59406.AU.2 Gene Accession Name SEQ ID NO Sequence LMNB1 NM_005573 S4479/LMNB1.p1 SEQ ID NO:150 CAGCCCCCCAACTGACCTCATC 22 MCM2 NM 004526 S1602/MCM2.f2 SEQ ID NO:151 GACTTTTGCCCGCTACCTTTC 21 MCM2 NM_004526 S1603/MCM2.r2 SEQ ID NO:152 GCCACTAACTGCTTCAGTATGAAGAG 26 MCM2 NM_004526 S4900/MCM2.p2 SEQ ID NO:153 ACAGCTCATTGTTGTCACGCCGGA 24 MCM6 NM_005915 S1704/MCM6.f3 SEQ ID NO:154 TGATGGTCCTATGTGTCACATTCA 24 MCM6 NM_005915 S1705/MCM6.r3 SEQ ID NO:155 TGGGACAGGAAACACACCAA 20 MCM6 NM_005915 S4919/MCM6.p3 SEQ ID NO:156 CAGGTTTCATACCAACACAGGCTTCAGCAC 30 MELK NM_014791 S4318/MELK.f1 SEQ ID NO:157 AACCCGGCGATCGAAAAG 18 MELK NM_014791 S4319/MELK.rl SEQ ID NO:158 GGGCCTGCTGTCCTGAGA 18 MELK NM_014791 S4320/MELK.p1 SEQ ID NO:159 TCTTAGGAACGCCGTACCAGCCGC 24 MMP12 NM 002426 S4381/MMP12.f2 SEQ ID NO:160 CCAACGCTTGCCAAATCCT 19 MMP12 NM_002426 S4382/MMP12.r2 SEQ ID NO:161 ACGGTAGTGACAGCATCAAAACTC 24 MMP12 NM_002426 S4383/MMP12.p2 SEQ ID NO:162 AACCAGCTCTCTGTGACCCCAATT 24 MMP9 NM 004994 S0656/MMP9.fl SEQ ID NO:163 GAGAACCAATCTCACCGACA 20 MMP9 NM_004994 S0657/MMP9.rl SEQ ID NO:164 CACCCGAGTGTAACCATAGC 20 MMP9 NM_004994 S4760/MMP9.pl SEQ ID NO:165 ACAGGTATTCCTCTGCCAGCTGCC 24 MYBL2 NM_002466 S3270/MYBL2.f 1 SEQ ID NO:166 GCCGAGATCGCCAAGATG 18 MYBL2 NM_002466 S3271/MYBL2.rl SEQ ID NO:167 CTTTTGATGGTAGAGTTCCAGTGATTC 27 MYBL2 NM_002466 S4742/MYBL2.pl SEQ ID NO:168 CAGCATTGTCTGTCCTCCCTGGCA 24 NEK2 NM_002497 S4327/NEK2.fl SEQ ID NO:169 GTGAGGCAGCGCGACTCT 18 NEK2 NM_002497 S4328/NEK2.rl SEQ ID NO:170 TGCCAATGGTGTACAACACTTCA 23 NEK2 NM_002497 S4329/NEK2.pl SEQ ID NO:171 TGCCTTCCCGGGCTGAGGACT 21 NME1 NM 000269 S2526/NME1.f3 SEQ ID NO:172 CCAACCCTGCAGACTCCAA 19 NME1 NM_000269 S2527/NME1.r3 SEQ ID NO:173 ATGTATAATGTTCCTGCCAACTTGTATG 28 NME1 NM_000269 S4949/NME1.p3 SEQ ID NO:174 CCTGGGACCATCCGTGGAGACTTCT 25 NPDO09 NM 020686 S4474/NPDO09.f3 SEQ ID NO:175 GGCTGTGGCTGAGGCTGTAG 20 NPDO09 NM_020686 S4475/NPDO09.r3 SEQ ID NO:176 GGAGCATTCGAGGTCAAATCA 21 NPDO09 NM_020686 S4476/NPDO09.p3 SEQ ID NO:177 TTCCCAGAGTGTCTCACCTCCAGCAGAG 28 PCNA NM_002592 S0447/PCNA.f2 SEQ ID NO:178 GAAGGTGTTGGAGGCACTCAAG 22 PCNA NM_002592 S0448/PCNA.r2 SEQ ID NO:179 GGTTTACACCGCTGGAGCTAA 21 PCNA NM_002592 S4784/PCNA.p2 SEQ ID NO:180 ATCCCAGCAGGCCTCGTTGATGAG 24 PR NM_000926 S1336/PR.f6 SEQ ID NO:181 GCATCAGGCTGTCATTATGG 20 PR NM_000926 S1337/PR.r6 SEQ ID NO:182 AGTAGTTGTGCTGCCCTTCC 20 PR NM_000926 S4743/PR.p6 SEQ ID NO:183 TGTCCTTACCTGTGGGAGCTGTAAGGTC 28 PREP NM 002726 S1771/PREP.fl SEQ ID NO:184 GGGACGGTGTTCACATTCAAG 21 PREP NM_002726 S1772/PREP.r1 SEQ ID NO:185 CAGGATCCCAGAAGTCAATGTTG 23 PREP NM_002726 S4929/PREP.p1 SEQ ID NO:186 TCGCCAGTCTCCCAACTATCGCGT 24 PTTG1 NM 004219 S4525/PTTG1.f2 SEQ ID NO:187 GGCTACTCTGATCTATGTTGATAAGGAA 28 PTTG1 NM_004219 S4526/PTTG1.r2 SEQ ID NO:188 GCTTCAGCCCATCCTTAGCA 20 PTTG1 NM_004219 S4527/PTTG1.p2 SEQ ID NO:189 CACACGGGTGCCTGGTTCTCCA 22 RPLPO NM_001002 S0256/RPLPO.f2 SEQ ID NO:190 CCATTCTATCATCAACGGGTACAA 24 RPLPO NM_001002 S0258/RPLPO.r2 SEQ ID NO:191 TCAGCAAGTGGGAAGGTGTAATC 23 RPLPO NM_001002 S4744/RPLPO.p2 SEQ ID NO:192 TCTCCACAGACAAGGCCAGGACTCG 25 SNRPF NM_003095 S4489/SNRPF.f2 SEQ ID NO:193 GGCTGGTCGGCAGAGAGTAG 20 SNRPF NM_003095 S4490/SNRPF.r2 SEQ ID NO:194 TGAGGAAAGGTTTGGGATTGA 21 SNRPF NM_003095 S4491/SNRPF.p2 SEQ ID NO:195 AAACTCATGTAAACCACGGCCGAATGTTG 29 Src NM 004383 S1820/Src.f2 SEQ ID NO:196 CCTGAACATGAAGGAGCTGA 20 Src NM_004383 S1821/Src.r2 SEQ ID NO:197 CATCACGTCTCCGAACTCC 19 34 4058201_1 (GHMatters) P59406.AU.2 Gene Accession Name SEQ ID NO Sequence Src NM_004383 S5034/Src.p2 SEQ ID NO:198 TCCCGATGGTCTGCAGCAGCT 21 STK15 NM 003600 S0794/STK1 5.f2 SEQ ID NO:199 CATCTTCCAGGAGGACCACT 20 STK15 NM_003600 S0795/STK15.r2 SEQ ID NO:200 TCCGACCTTCAATCATTTCA 20 STK15 NM_003600 S4745/STK1 5.p2 SEQ ID NO:201 CTCTGTGGCACCCTGGACTACCTG 24 STMY3 NM_005940 S2067/STMY3.f3 SEQ ID NO:202 CCTGGAGGCTGCAACATACC 20 STMY3 NM_005940 S2068/STMY3.r3 SEQ ID NO:203 TACAATGGCTTTGGAGGATAGCA 23 STMY3 NM_005940 S4746/STMY3.p3 SEQ ID NO:204 ATCCTCCTGAAGCCCTTTTCGCAGC 25 SURV NM_001168 S02591 SURV.f2 SEQ ID NO:205 TGTTTTGATTCCCGGGCTTA 20 SURV NM_001168 S0261/SURV.r2 SEQ ID NO:206 CAAAGCTGTCAGCTCTAGCAAAAG 24 SURV NM_001168 S4747/SURV.p2 SEQ ID NO:207 TGCCTTCTTCCTCCCTCACTTCTCACCT 28 TFRC NM 003234 S1352/TFRC.f3 SEQ ID NO:208 GCCAACTGCTTTCATTTGTG 20 TFRC NM_003234 S1353/TFRC.r3 SEQ ID NO:209 ACTCAGGCCCATTTCCTTTA 20 TFRC NM_003234 S4748/TFRC.p3 SEQ ID NO:210 AGGGATCTGAACCAATACAGAGCAGACA 28 TOP2A NM 001067 S0271/TOP2A.f4 SEQ ID NO:211 AATCCAAGGGGGAGAGTGAT 20 TOP2A NM_001067 S0273/TOP2A.r4 SEQ ID NO:212 GTACAGATTTTGCCCGAGGA 20 TOP2A NM_001067 S4777/TOP2A.p4 SEQ ID NO:213 CATATGGACTTTGACTCAGCTGTGGC 26 TS NM_001071 S0280/TS.f1 SEQ ID NO:214 GCCTCGGTGTGCCTTTCA 18 TS NM_001071 S0282/TS.rl SEQ ID NO:215 CGTGATGTGCGCAATCATG 19 TS NM_001071 S4780/TS.pl SEQ ID NO:216 CATCGCCAGCTACGCCCTGCTC 22 35 4058201_1 (GHMatters) P59406.AU.2
权利要求:
Claims (50)
[1] 1. A method of predicting the likelihood of long-term survival of a cancer patient without the recurrence of cancer, comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a cancer cell obtained from said patient, normalized against the expression level of all RNA transcripts or their products in 5 said cancer cell, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is the transcript of one or more genes selected from the group consisting of B_Catenin; BAGI; BINI; BUBI; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAPI; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRI; FOXM1; GRB7; GSTM1; GSTM3; HER2; HNRPAB; IDI; IGF1R; ITGA7; Ki_67; 10 KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS; wherein expression of one or more of BUBI; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CTSL2; EpCAM; FOXM1; GRB7; HER2; HNRPAB; Ki_67; KNSL2; LMNB1; 15 MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; PCNA; PREP; PTTG1; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS indicates a decreased likelihood of long term survival without cancer recurrence; and the expression of one or more of BAG1; BCatenin; BIN1; CEGP1; CIAP1; cMYC; DKFZp586MO7; DR5; EstRI; GSTM1; GSTM3; IDI; IGF1R; ITGA7; NPDO09; PR; and RPLPO indicates an increased likelihood of long-term survival without cancer recurrence.
[2] 2. The method of claim 1 comprising determining the expression level of at least two of said prognostic RNA transcripts or their expression products.
[3] 3. The method of claim 1 comprising determining the expression level of at least 5 of said prognostic RNA transcripts or their expression products.
[4] 4. The method of claim 1 comprising determining the expression level of at least 10 of said prognostic RNA transcripts or their expression products.
[5] 5. The method of claim 1 comprising determining the expression level of at least 15 of said prognostic transcripts of their expression products.
[6] 6. The method of claim 1 wherein said cancer is breast cancer.
[7] 7. The method of claim 6 wherein said cancer is node negative, ER positive breast cancer. 36 4058201_1 (GHMatters) P59406.AU.2
[8] 8. The method of claim 1 wherein said cancer is ovarian cancer.
[9] 9. The method of claim 1 wherein the expression level of one or more prognostic RNA transcripts is determined.
[10] 10. The method of claim 1 wherein said RNA comprises intronic RNA.
[11] 11. The method of claim 1 comprising determining the expression level of one or more prognostic RNA transcripts or their expression products of one or more genes selected from the group consisting of MMP9, GSTM1, MELK, PR, DKFZp586MO7, GSTM3, CDC20, CCNB1, STMY3, GRB7, MYBL2, CEGP1, SURV, LMNB1, CTSL2, PTTG1, 5 BAGI, KNSL2, CIAP 1, PREP, NEK2, EpCAM, PCNA, C20_orfl, ITGA7, IDI BCatenin, EstRI, CDH1, TS HER2, and cMYC, wherein expression of one or more of C20_orfl; CCNB1; CDC20; CDH1; CTSL2; EpCAM; GRB7; HER2; KNSL2; LMNB1; MCM2; MMP9; MYBL2; NEK2; PCNA; PREP; PTTG1; STMY3; SURV; TS; and MELK indicates a decreased likelihood of long-term 10 survival without cancer recurrence; and expression of one or more of BAGI; BCatenin; CEGP1; CIAPI; cMYC; DKFZp586MO7; EstRI; GSTM1; GSTM3; IDI; ITGA7; and PR indicates an increased likelihood of long-term survival without cancer recurrence.
[12] 12. The method of claim 1 comprising determining the expression level of one or more prognostic RNA transcripts or their expression products of one or more genes selected from the group consisting of GRB7, SURV, PR, LMNB1, MYBL2, HER2, GSTM1, MELK, S20_orfl, PTTG1, BUBI, CDC20, CCNB1, STMY3, KNSL2, CTSL2, MCM2, NEK2, DR5, 15 Ki_67, CCNE2, TOP2A, PCNA, PREP, FOXM1, NME1, CEGP1, BAGI, STK15, HNRPAB, EstRI, MMP9, DKFZp586M07, TS, Src, BINI, NP009, RPLPO, GSTM3, MMP12, TFRC, and IGF1R, wherein expression of one or more of GRB7; SURV; LMNB 1; MYBL2; HER2; MELK; C20_orfl; PTTG1; BUBI; CDC20; CCNB1; STMY3; KNSL2; CTSL2; MCM2; 20 NEK2; Ki_67; CCNE2; TOP2A_4; PCNA; PREP; FOXM1; NME1; STK15; HNRPAB; MMP9; TS; Src; MMP12; and TFRC indicates a decreased likelihood of long-term survival without cancer recurrence; and the expression of one or more of PR; GSTM1; DR5; CEGP1; BAGI; EstRI; DKFZp586M07; BINI; NPD009; RPLPO; GSTM3; IGF1R indicates an increased likelihood of long-term survival without cancer recurrence. 37 4058201_1 (GHMatters) P59406.AU.2
[13] 13. A method of predicting the likelihood of long-term survival of a cancer patient without the recurrence of cancer, comprising determining the expression level of one or more prognostic RNA transcripts or their expression products in a cancer cell obtained from said patient, normalized against the expression level of all RNA transcripts or their products in 5 said cancer cell, or of a reference set of RNA transcripts or their expression products, wherein the prognostic RNA transcript is the transcript of one or more genes selected from the group consisting of GRB7; LMNB1; ER; STMY3; KLK1O; PR; KRT5; FGFR1; MCM6; SNRPF, wherein expression of one or more of GRB7, LMNB1, STMY3, KLK1O, FGFR1, and SNRPF indicates a decreased likelihood or long term survival without cancer recurrence; and the expression of one or more of ER, PR, KRT5 and MCM6 indicates an increased likelihood of long-term survival without cancer recurrence.
[14] 14. The method of claim 6 wherein said RNA is isolated from a fixed, wax embedded breast cancer tissue specimen of said patient.
[15] 15. The method of claim 6 wherein said RNA is isolated from core biopsy tissue or fine needle aspirate cells.
[16] 16. An array comprising polynucleotides hybridizing to two or more of the following genes: B_Catenin; BAGI; BINI; BUBI; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAPI; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRI; FOXM1; GRB7; GSTM1; GSTM3; HER2; HNRPAB; IDI; IGF1R; ITGA7; Ki_67; KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS, immobilized on a solid surface.
[17] 17. The array of claim 16 comprising polynucleotides hybridizing to two or more of the following genes: MMP9, GSTM1, MELK, PR, DKFZp586MO7, GSTM3, CDC20, CCNB1, STMY3, GRB7, MYBL2, CEGP1, SURV, LMNB1, CTSL2, PTTG1, BAGI, KNSL2, CIAP1, PREP, NEK2, EpCAM, PCNA, C20_orfl, ITGA7, IDI BCatenin, EstRI, CDH1, TS HER2, and cMYC.
[18] 18. The array of claim 16 comprising polynucleotides hybridizing to two or more of the following genes: GRB7, SURV, PR, LMNB1, MYBL2, HER2, GSTM1, MELK, S20_orfl, PTTG1, BUBI, CDC20, CCNB1, STMY3, KNSL2, CTSL2, MCM2, NEK2, DR5, Ki_67, CCNE2, TOP2A, PCNA, PREP, FOXM1, NME1, CEGP1, BAGI, STK15, 38 4058201_1 (GHMatters) P59406.AU.2 HNRPAB, EstRI, MMP9, DKFZp586MO7, TS, Src, BINI, NP009, RPLPO, GSTM3, MMP12, TFRC, and IGF1R.
[19] 19. The array of claim 16 comprising polynucleotides hybridizing to at least 3 of said genes.
[20] 20. The array of claim 16 comprising polynucleotides hybridizing to at least 5 of said genes.
[21] 21. The array of claim 16 comprising polynucleotides hybridizing to at least 10 of said genes.
[22] 22. The array of claim 16 comprising polynucleotides hybridizing to all of said genes.
[23] 23. The array of claim 16 comprising more than one polynucleotide hybridizing to the same gene.
[24] 24. The array of claim 16 wherein said polynucleotides are cDNAs.
[25] 25. The array of claim 24 wherein said cDNAs are about 500 to 5000 bases long.
[26] 26. The array of claim 16 wherein said polynucleotides are oligonucleotides.
[27] 27. The array of claim 26 wherein said oligonucleotides are about 20 to 80 bases long.
[28] 28. The array of claim 16 wherein the solid surface is glass.
[29] 29. The array of claim 16 which comprises about 330,000 oligonucleotides.
[30] 30. The method of claim 16 wherein said array comprises intron-based polynucleotide sequences.
[31] 31. A method of predicting the likelihood of long-term survival of a patient diagnosed with invasive breast cancer, without the recurrence of breast cancer, comprising the steps of (a) determining the expression levels of the RNA transcripts or the expression 5 products of genes of a gene set selected from the group consisting of BCatenin; BAG1; BINI; BUB1; C20_orfl; CCNB1; CCNE2; CDC20; CDH1; CEGP1; CIAPI; cMYC; CTSL2; DKFZp586MO7; DR5; EpCAM; EstRI; FOXM1; GRB7; GSTM1; GSTM3; HER2; HNRPAB; IDI; IGF1R; ITGA7; Ki_67; KNSL2; LMNB1; MCM2; MELK; MMP12; MMP9; MYBL2; NEK2; NME1; NPDO09; PCNA; PR; PREP; PTTG1; 10 RPLPO; Src; STK15; STMY3; SURV; TFRC; TOP2A; and TS in a breast cancer cell obtained from said patient, normalized against the expression levels of all RNA transcripts or 39 4058201_1 (GHMatters) P59406.AU.2 their expression products in said breast cancer cell, or of a reference set of RNA transcripts or their products; (b) subjecting the data obtained in step (a) to statistical analysis; and; (c) determining whether the likelihood of said long-term survival has increased or decreased.
[32] 32. A method of preparing a personalized genomics profile for a patient, 5 comprising the steps of (a) subjecting RNA extracted from a breast tissue obtained from the patient to gene expression analysis; (b) determining the expression level in the tissue of one or more genes selected from the breast cancer gene set listed in any one of Tables 1 and 2, wherein the expression 10 level is normalized against a control gene or genes and optionally is compared to the amount found in a breast cancer reference tissue set; and (c) creating a report summarizing the data obtained by said gene expression analysis.
[33] 33. The method of claim 32 wherein said breast tissue comprises breast cancer cells.
[34] 34. The method of claim 33 wherein said breast tissue is obtained from a fixed, paraffin-embedded biopsy sample.
[35] 35. The method of claim 34 wherein said RNA is fragmented.
[36] 36. The method of claim 32 wherein said report includes prediction of the likelihood of long term survival of the patient.
[37] 37. The method of claim 32 wherein said report includes recommendation for a treatment modality of said patient.
[38] 38. A method for amplification of a gene listed in Tables 1 and 2 by polymerase chain reaction (PCR), comprising performing said PCR by using an amplicon listed in Table 3 and a primer-probe set listed in Tables 4A - 4D.
[39] 39. A PCR primer-probe set listed in Tables 4A - 4D.
[40] 40. A PCR amplicon listed in Table 3.
[41] 41. A method of predicting a likelihood of long-term survival without the recurrence of cancer in a human patient with breast cancer, comprising: 40 4058201_1 (GHMatters) P59406.AU.2 a) assaying an expression level of an RNA transcript of CDC20, or a product thereof, in a cancer tissue sample obtained from said patient; b) normalizing said expression level against an expression level of at least one reference RNA transcript, or its product, in said cancer tissue sample to provide a 5 normalized CDC20 expression level; and c) providing an estimate of the likelihood of long-term survival without the recurrence of cancer in said patient, wherein said estimate is based on said normalized CDC20 expression level and a negative correlation between CDC20 expression and an increased likelihood of long-term survival without cancer recurrence. 10
[42] 42. The method of claim 41, wherein said breast cancer is invasive breast cancer.
[43] 43. The method of claim 41 or claim 42, wherein the cancer tissue sample is a fixed, wax-embedded tissue sample obtained from the patient.
[44] 44. The method of any one of claims 41 to 43, wherein the cancer tissue sample is isolated from core biopsy tissue or fine needle aspirate. 15
[45] 45. The method of any one of claims 41 to 44, further comprising providing a report comprising said estimate.
[46] 46. The method of any one of claims 41 to 45, wherein said assaying is done by assaying an expression level of an RNA transcript of CDC20.
[47] 47. The method of any one of claims 41 to 46, wherein said assaying is done by 20 RT-PCR.
[48] 48. The method of any one of claims 41 to 45, wherein said assaying is done by assaying an expression level of CDC20 protein.
[49] 49. The method of any one of claims 41 to 48, further comprising: assaying the expression level of one or more of the following genes in said cancer 25 tissue sample: GSTM1, GRB7, PR, CCNB1, MYBL2, CEGP1, SURV, BAGI, EstRI, and HER2, wherein increased expression of CCNB 1, GRB7, HER2, MYBL2, and SURV negatively correlates with increased likelihood of long-term survival without cancer recurrence and increased expression of BAGI, CEGP1, EstRI, GSTM1, and PR positively correlates with increased likelihood of long-term survival without cancer recurrence. 30
[50] 50. A method according to claim 41, substantially as hereinbefore described with reference to any one of the examples. 41 4058201_1 (GHMatters) P59406.AU.2 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013 2013200793 14 Feb 2013
类似技术:
公开号 | 公开日 | 专利标题
US10619215B2|2020-04-14|Prediction of likelihood of cancer recurrence
CA2563074C|2014-05-20|Gene expression markers for predicting response to chemotherapy
US7569345B2|2009-08-04|Gene expression markers for breast cancer prognosis
US20050064455A1|2005-03-24|Gene expression markers for predicting response to chemotherapy
AU2017228579B2|2019-12-12|Prediction of likelihood of cancer recurrence
AU2013200793B2|2015-07-02|Prediction of likelihood of cancer recurrence
AU2015202326A1|2015-05-21|Gene expression markers for breast cancer prognosis
同族专利:
公开号 | 公开日
AU2013200793B2|2015-07-02|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题
法律状态:
2015-10-29| FGA| Letters patent sealed or granted (standard patent)|
优先权:
申请号 | 申请日 | 专利标题
US60/482,339||2003-06-24||
AU2010202424A|AU2010202424B2|2003-06-24|2010-06-10|Prediction of likelihood of cancer recurrence|
AU2013200793A|AU2013200793B2|2003-06-24|2013-02-14|Prediction of likelihood of cancer recurrence|AU2013200793A| AU2013200793B2|2003-06-24|2013-02-14|Prediction of likelihood of cancer recurrence|
AU2015230746A| AU2015230746B2|2003-06-24|2015-09-23|Prediction of likelihood of cancer recurrence|
AU2017228579A| AU2017228579B2|2003-06-24|2017-09-13|Prediction of likelihood of cancer recurrence|
AU2019261715A| AU2019261715A1|2003-06-24|2019-11-06|Prediction of likelihood of cancer recurrence|
[返回顶部]